In silico analysis and expression profiling of miRNAs targeting genes of steviol glycosides biosynthetic pathway and their relationship with steviol glycosides content in different tissues of Stevia rebaudiana

Plant Physiology and Biochemistry 94 (2015) 57e64

Contents lists available at ScienceDirect

Plant Physiology and Biochemistry journal homepage: www.elsevier.com/locate/plaphy

Research article

In silico analysis and expression profiling of miRNAs targeting genes of steviol glycosides biosynthetic pathway and their relationship with steviol glycosides content in different tissues of Stevia rebaudiana Monica Saifi a, Nazima Nasrullah a, Malik Mobeen Ahmad b, Athar Ali a, Jawaid A. Khan c, M.Z. Abdin a, * a b c

Centre for Transgenic Plant Development, Department of Biotechnology, Faculty of Science, Jamia Hamdard, Hamdard Nagar, New Delhi, 110062, India Integral Institute of Agricultural Science and Technology (IIAST), Integral University, Lucknow, 226026, India Plant Virus Laboratory, Department of Biosciences, Jamia Millia Islamia, New Delhi, 110025, India

a r t i c l e i n f o

a b s t r a c t

Article history: Received 4 March 2015 Received in revised form 13 May 2015 Accepted 16 May 2015 Available online

miRNAs are emerging as potential regulators of the gene expression. Their proven promising role in regulating biosynthetic pathways related gene networks may hold the key to understand the genetic regulation of these pathways which may assist in selection and manipulation to get high performing plant genotypes with better secondary metabolites yields and increased biomass. miRNAs associated with genes of steviol glycosides biosynthetic pathway, however, have not been identified so far. In this study miRNAs targeting genes of steviol glycosides biosynthetic pathway were identified for the first time whose precursors were potentially generated from ESTs and nucleotide sequences of Stevia rebaudiana. Thereafter, stem-loop coupled real time PCR based expressions of these miRNAs in different tissues of Stevia rebaudiana were investigated and their relationship pattern was analysed with the expression levels of their target mRNAs as well as steviol glycoside contents. All the miRNAs investigated showed differential expressions in all the three tissues studied, viz. leaves, flowers and stems. Out of the eleven miRNAs validated, the expression levels of nine miRNAs (miR319a, miR319b, miR319c, miR319d, miR319e, miR319f, miR319h, miRstv_7, miRstv_9) were found to be inversely related, while expression levels of the two, i.e. miR319g and miRstv_11 on the contrary, showed direct relation with the expression levels of their target mRNAs and steviol glycoside contents in the leaves, flowers and stems. This study provides a platform for better understanding of the steviol glycosides biosynthetic pathway and these miRNAs can further be employed to manipulate the biosynthesis of these metabolites to enhance their contents and yield in S. rebaudiana. © 2015 Elsevier Masson SAS. All rights reserved.

Keywords: miRNA Stevia rebaudiana Real-time PCR HPTLC Stevioside Rebaudioside-A

1. Introduction Stevia rebaudiana Bertoni (family Asteraceae) is one of 154 members of genus Stevia and one of the only two species which produce sweet steviol glycosides. Its leaves contain diterpene glycosides including well characterized stevioside (5e10%) and rebaudioside-A (2e4%) (Brandle and Rosa, 1992). Sweetness indices of these compounds ranges between 30 to 300 times higher than that of sucrose and are used as non-calorific sweeteners in many countries of the world. Steviol glycosides being important * Corresponding author. E-mail addresses: monica.saifi@gmail.com (M. Saifi), [email protected] (N. Nasrullah), [email protected] (M.M. Ahmad), [email protected] (A. Ali), [email protected] (J.A. Khan), [email protected] (M.Z. Abdin). http://dx.doi.org/10.1016/j.plaphy.2015.05.009 0981-9428/© 2015 Elsevier Masson SAS. All rights reserved.

compounds of Stevia rebaudiana, impart various medicinal properties to the plants viz. anti-hyperglycemic (Jeppesen et al., 2002), antihypertensive (Melis and Sainati, 1991; Melis, 1995), antioxidant (Tadhani et al., 2007) and anticancerous (Jayaraman et al., 2008; Kumar et al., 2012) activities. Due to these immense medicinal properties of S. rebaudiana, the demand for this plant is increasing regularly. One of the problem with this plant, however, is that its leaves have liquorice like aftertaste. It has also been reported that the rebaudioside-A present in its leaves is the sweetest and the purest compound, while the stevioside is responsible for aftertaste bitterness (Morita et al., 2011). The ratio of rebaudioside-A to stevioside is the accepted measure of sweetness quality; the more rebaudioside-A, the better is the organoleptic quality (Lee et al., 1982). Therefore, in order to utilize this source of natural

58

M. Saifi et al. / Plant Physiology and Biochemistry 94 (2015) 57e64

sweetener, there is a need to develop a novel variety of S. rebaudiana with higher steviol glycoside contents and higher ratio of rebaudioside-A to stevioside. Till date several agrotechniques, bioproduct extraction, phytochemical, biological and toxicological studies have been carried out on S. rebaudiana (Mandhan et al., 2012). Also, the biosynthetic pathway of steviol glycosides is elucidated and known to consist of multiple steps which are catalysed by different enzymes. Further, modern genomics approaches have documented the importance of miRNAs in such metabolic pathway regulation (Guleria and Yadav, 2011; Schommer et al., 2008). For example, in Arabidopsis, TEOSINTE BRANCHED/CYCLOIDEA/PC (TCP) transcription factors, which control the biosynthesis of jasmonic acid, are regulated by miR319 (Schommer et al., 2008). The yield of these metabolites and expression levels of the genes encoding their biosynthetic enzymes are known to be developmentally regulated (Bondarev et al., 2003; Yadav and Guleria, 2012). Therefore, better understanding of the genetic regulation of this pathway involving miRNA, could be very useful for manipulating the yield of steviol glycosides in S. rebaudiana. A microRNA (miRNA) is a 21e24 nucleotide (nt) small RNA, an end product of a non-coding RNA gene. miRNA genes resemble protein coding genes in that they may contain introns and that they are transcribed by RNA polymerase II. Like other pol II transcripts, the transcripts from miRNA genes are capped, spliced and polyadenylated. The mature miRNA is located in a hairpin structure within the primary transcript (pri-miRNA), which is processed to form the precursor-miRNA (pre-miRNA). This pre-miRNA is further processed through at least two RNAse III-mediated steps to form the mature miRNA. Thereafter, the mature miRNA is loaded into a ribonucleoprotein complex named RISC, where it guides the cleavage or translational repression of its target mRNA by basepairing (Bartel, 2004). In certain cases, however, miRNAs have also been reported to enhance the expression of their target genes, possibly, as a transcription factors targeting complementary motifs in gene promoters (Place et al., 2008). So far, smRNA profiling has already been carried out in S. rebaudiana and 34 highly conserved miRNA families as well as 12 novel potential miRNAs were identified using high throughput solexa sequencing of sRNAs. These results indicate that species specific to miRNAs exist in S. rebaudiana and may have role in the growth, development and response to stress as well as in regulation of steviol glycosides biosynthetic pathway in this plant species (Guleria and Yadav, 2011; Mandhan et al., 2012). The miRNAs involved in the regulation of biosynthesis of steviol glycosides, however, have not been characterized from this plant. Keeping in view these facts, we performed experiments and for the first time reporting miRNAs targeting genes of steviol glycosides biosynthetic pathway which were experimentally validated and the relationship pattern of their differential expression was analysed with the expression levels of their target mRNAs and steviol glycosides content. 2. Materials and methods 2.1. In silico identification of miRNAs targeting genes of steviol glycosides biosynthetic pathway A total of 100 miRNAs belonging to 34 highly conserved families and 12 novel miRNAs, whose precursors were potentially generated from stevia ESTs and nucleotide sequences (Mandhan et al., 2012), were targeted against genes involved in steviol glycosides biosynthetic pathway using miRanda (Enright et al., 2004) database tool with detailed statistical study of minimum free energies (MFEs). The prediction was made using miRanda with default parameters

(Gap Open Penalty: e0.9; Gap Extend: e0.4; Score Threshold: 50.0; Energy Threshold:
0.20 kcal/mol). List of conserved and novel miRNA sequences and genes involved in steviol glycosides biosynthetic pathway are given in Table S1 (a & b) and Table S2, respectively. 2.2. In planta validation of miRNAs targeting genes of steviol glycosides biosynthetic pathway 2.2.1. Primer designing For the selected miRNAs, miRNA-specific stem-loop primers for reverse transcription were designed approximately 50 nt in length (44e45 nucleotides common to stem and 5e6 nucleotide for loop structure were miRNA specific) and subsequently amplified using miRNA specific forward primer and universal reverse primer following procedure of Chen et al. (2005). Primers for target mRNAs were designed using published sequences retrieved from NCBI Genbank from S. rebaudiana plant using primer designing tool, NCBI. The primers were synthesized by Sigma-Aldrich Chemicals Pvt. Ltd. Sequences of the Real-Time PCR primers of miRNAs, their target mRNAs along with that of internal control are summarized in Table S3. 2.2.2. Plant material The leaf, flower and stem tissues were collected at the flowering stage from S. rebaudiana, grown in the Herbal Garden of Jamia Hamdard, New Delhi, India. Total RNA from 100 mg of each tissue was isolated using RNeasy plant mini kit (Qiagen) according to the manufacturer's instructions. Quantity and quality of the isolated RNA samples were estimated through spectrophotometer and denaturing agarose gel electrophoresis. These RNA samples were thereafter, used as RNA templates in stem-loop RT-PCR assays. The remaining samples of leaf, flower and stem tissues were dried in shade at 25e30  C and stored at 25 ± 3  C in air tight containers till further used for HPTLC analysis. 2.2.3. Stem-loop RT-PCR of miRNAs and RT-PCR of their target mRNAs Mature miRNAs were validated by stem-loop RT-PCR (Gasic et al., 2007). Stem-loop RT primers were allowed to bind to the miRNA and reverse transcribed in a pulsed RT reaction using RevertAid™ H Minus cDNA synthesis kit (Fermentas, USA). For cDNA synthesis, 1 ml of stem-loop RT primer, 50 ng of RNA sample, 4 ml of 5 long range RT buffer, 2 ml dNTP mix, 0.2 ml RNase inhibitor and 1 ml long range reverse transcriptase enzyme were added in the reaction mixture and then water was mixed to make up the final volume to 20 ml. First strand was synthesized under cycling condition of 30  C for 16 min and 60 cycles of 30  C for 30 s, 42  C for 30 s, 50  C for 1 s and reaction terminated at 85  C. The RT product (cDNA) synthesized from each RNA sample was used as template to amplify the miRNA sequences through semi-quantitative RT-PCR by using miRNA specific forward primer and universal reverse primer as described below: 1 ml from 1/10th dilution of prepared cDNA was used as template for semi-quantitative RT-PCR along with 1.5 ml of buffer, 2 ml dNTP mix, 1 ml each of miRNA specific forward primer as well as universal reverse primer and 1 ml Taq DNA polymerase. Autoclaved milliQ water was added to make the final volume of reaction mixture to 25 ml. For amplification of target mRNAs, RT-PCR was carried out using two step RT-PCR kit (Qiagen) with mRNA specific forward and reverse primers. The PCR conditions employed were: 94  C for 3 min, 94  C for 30 s, 55  C for 30 s, 72  C for 30 s and 72  C for 10 min. The amplified products obtained were analysed by electrophoresis on 4% and 1.2% agarose gel for miRNAs and their target RNAs in

M. Saifi et al. / Plant Physiology and Biochemistry 94 (2015) 57e64

1 TAE buffer (pH 8.0), respectively. 2.2.4. miRNA SYBR green assay (real-time PCR) Real-Time PCR of miRNAs in different tissues was carried out through SYBR green chemistry (Czechowski et al., 2004) on a RealTime thermal cycler (Light Cycler 480, Roche, USA). b-actin was used as an internal control. 1 ml of each cDNA sample was used with cocktail containing 10 ml of SYBR green, 7 ml of water, 1 ml of each miRNA specific forward primer and stem loop complimentary universal reverse primer in cycling condition of hot start at 95  C for 2 min, 45 cycles of denaturation at 95  C for 15 s, annealing at 55  C for 30 s and extension at 72  C for 30 s. All reactions were run in duplicates. The DDCT method was used to determine the expression level differences among samples of the leaves, flowers and stems. For a given leaf sample, the fold change in terms of flower or stem was calculated as 2
DDCT, where DDCT ¼ (CT miRNA of leaf-CT miRNA of b-actin)-(CT miRNA of flower/stem-CT miRNA of b-actin) was based on equation 9 of DDCT method (Livak and Schmittgen, 2001). Standard errors and standard deviations were calculated from replicates of three biological tissues. 2.3. HPTLC analysis of steviol glycosides in different tissues 2.3.1. Chemicals and reference compounds All the chemicals including solvents were of analytical grade and procured from E. Merck (Darmstadt, Germany). The HPTLC plates coated with silica gel 60F254 were purchased from E. Merck (Darmstadt, Germany). The standards, stevioside and rebaudiosideA were purchased from Sigma-Aldrich, Poole, Dorset, UK.

59

Reference marker compounds were also applied on the TLC plate along with samples to confirm the presence of stevioside and rebaudioside-A, respectively, in test samples. The development distance was 90 mm. Subsequent to the development, the TLC plate was air dried for 5e10 min. The dried plate was then sprayed with a spraying reagent consisting of acetic anhydride: sulphuric acid: ethanol (1:1:4), followed by heating at 110  C for 3e5 min. The densitometric analysis was performed at 400 nm using Camag TLC Scanner 3 in absorption-reflection mode, win CATS software (v. 1.4.3.6335). Slit dimension was 6.00  0.45 mm with scanning speed of 20 mm/s. 2.3.5. Calibration curve of steviol glycosides Different volumes of standard mix solution (1, 2, 3, 4, 5, 6 ml) containing stevioside (200, 400, 600, 800, 1000, 1200 ng/spot) and rebaudioside-A (100, 200, 300, 400, 500, 600 ng/spot) were then applied to TLC plates to prepare six point linear calibration curve for each marker compound. The calibration curves of stevioside and rebaudioside-A were obtained by plotting peak area versus concentration of stevioside and rebaudioside-A applied. 2.3.6. Quantification of stevioside and rebaudioside-A in test samples 2 ml each of sample extracts were applied in triplicate on a TLC plate with a Linomat 5 applicator. The plate was developed and scanned as mentioned above and peak areas were recorded. The amounts of two steviol glycosides in all sample extracts were calculated using the calibration curves of stevioside and rebaudioside-A, respectively. 3. Results

2.3.2. Preparation of sample extract The dried samples (1 g) of S. rebaudiana were crushed in a mortar pestle separately and passed through a sieve to obtain a powder of particle size of approximately 1 mm. The powder obtained from leaf, flower and stem tissues was then transferred into a volumetric flask of 50 ml and mixed with 20 ml of 95% ethanol, respectively. The mixture was heated with reflux in a boiling water bath for 15min, and filtered through Whatman filter paper number 0.45. All the samples were subjected to this process and the ethanol extracts obtained were used for estimation of stevioside and rebaudioside-A as described by Saifi et al. (2014). 2.3.3. Preparation of standard solution The standard stock solution (1 mg/ml) of stevioside was prepared by accurately weighing 1 mg of stevioside, and dissolving in 1.0 ml of methanol. Further dilutions were prepared by diluting this stock solution with methanol. Standard stock solution (1 mg/ 2.5 ml) of rebaudioside-A was prepared by weighing 1 mg of rebaudioside-A, and dissolving in 2.5 ml methanol. Further dilutions were prepared by diluting this stock solution with methanol. The two standard solutions were then mixed in 1:1 ratio for further use. 2.3.4. Chromatography The HPTLC was performed on 20  10 cm aluminium foil plate coated with a 200 mm layer of silica gel 60F254 (E. Merck, Germany). The plate was activated for 30 min at 110  C in hot air oven. 2 ml aliquot of each sample solution was applied as 6 mm band by means of a Camag (Switzerland) Linomat 5 applicator fitted with a 100 ml syringe. A constant application rate of 150 nl/s was used. Linear ascending development using the mobile phase, chloroform: methanol: water (60:32:4 v/v/v) was performed in a glass twin trough chamber (Camag) previously saturated with mobile phase for 20 min (optimized saturation time) at room temperature.

3.1. In silico characterization of miRNAs targeting genes of steviol glycosides biosynthesis In silico analysis provided a repertoire of miRNAs targeting respective steviol glycosides biosynthetic pathway genes in S. rebaudiana. Only top scoring miRNA-target pairs with maximum complementarity and optimal MFE were selected as summarised in Tables 1 and 2. A total number of eleven miRNA targeting genes of steviol glycosides biosynthetic pathway were identified above the threshold values. A total of 8, 6, 4, 3 and 1 miRNAs were found to target UGT85C2, KO, KAH, KS and UGT76G1 genes of steviol glycosides biosynthetic pathway, respectively. UGT85C2 gene was targeted by maximum number of miRNAs, viz. miR319a, miR319b, miR319c, miR319d, miR319e, miR319f, miR319g and miR319h. Among them, miR319a, miR319b, miR319c, miR319d, miR319e, miR319f and miR319g showed multiple loci interactions. KO and KAH were targeted by six and four miRNAs, viz. miR319a, miR319c, miR319f, miR319g, miR319h, miRstv_9, and miR319a, miRstv_7, miRstv_9, miRstv_11, respectively. KS and UGT76G1 genes were targeted by three and one miRNAs, viz. miR319b, miR319d, miR319g, and miRstv_7, respectively. 3.2. Validation and expression profiling of miRNAs and their target mRNAs in leaves, flowers and stems of S. rebaudiana Stem-loop RT-PCR and RT-PCR assays were performed to validate these miRNAs and their target mRNAs in different tissues of S. rebaudiana, respectively. The amplified products were resolved on 4% agarose gel and amplicons of respective miRNAs and their target mRNAs were detected. Real-Time PCR was performed for expression analysis of the mature miRNAs and their target mRNAs. The expression patterns of miRNAs and their target mRNAs were measured on the basis of change in normalized cyclic threshold 3

60

M. Saifi et al. / Plant Physiology and Biochemistry 94 (2015) 57e64

Table 1 Potential miRNA-Target Pairs derived from miRanda database tool above the threshold value. Target gene

miRNA

Target binding position

Score

MFE (Kcal/mol)

% Complementarity

Inhibition

UGT85C2

miR319a

1368e1390 1094e1116 1102e1124 223e244 1369e1390 1095e1116 357e376 224e244 1370e1390 1096e1116 226e244 1098e1116 225e244 1371e1390 1097e1116 224e244 1370e1390 1096e1116 222e244 850e872 1368e1390 1094e1116 224e243 1173e1195 264e286 266e286 266e286 312e334 263e286 1310e1332 78e97 177e197 701e722 704e722 700e722 467e489 647e666 1140e1160 303e330 450e472 46e65

133 107 100 148 133 112 98 143 133 107 80 141 138 133 105 143 133 107 143 139 133 109 125 124 113 107 107 133 116 65 116 60 80 80 80 84 93 107 93 84 102


23.24
22.87
22.32
23.33
22.76
22.54
21.44
22.54
21.65
20.12
20.44
21.23
21.09
22.78
21.32
21.43
20.76
20.22
23.98
22.54
22.43
21.87
23.22
22.09
21.33
20.67
20.87
20.07
23.50
22.73
21.23
23.80
21.22
20.12
20.23
22.03
22.28
21.79
22.40
21.81
22.19

87.50 87.50 68 84.21 87.50 88.24 93.75 83.33 87.50 87.50 100 87.50 82.35 87.50 92.86 83.33 87.50 87.50 83.33 100 87.50 83.33 81.25 100 80 77.78 77.78 81.25 80.95 75 100 100 100 100 100 100 81.25 90 75 1000 81.25

Translational Cleavage Translational Translational Translational Cleavage Translational Translational Translational Cleavage Translational Cleavage Translational Translational Cleavage Translational Translational Cleavage Translational Translational Translational Cleavage Translational Translational Translational Translational Translational Translational Translational Cleavage Translational Translational Translational Translational Translational Translational Cleavage Translational Translational Translational Translational

miR319b

miR319c

miR319d miR319e

miR319f

miR319g

miR319h miR319a

KO

miR319c miR319f miR319g

miRstv_7 miRstv_9 miR319b miR319d miR319g miR319a miRstv_7 miRstv_9 miRstv_11

KS

KAH

UGT76G1

miRstv_7

Table 2 List of selected miRNAs for in planta validation. S.no.

miRNA name

Sequence

Target genes

1 2 3 4 5 6 7 8 9 10 11

miR319a miR319b miR319c miR319d miR319e miR319f miR319g miR319h miRstv_7 miRstv_9 miRstv_11

UUGGACUGAAGGGAGCUCCCUUC UUGGACUGAAGGGAGCUCCAUC UUGGACUGAAGGGAGCUCCCU UUGGACUGAAGGGAGCAUC UUGGACUGAAGGGAGCUCCC UUGGACUGAAGGGAGCUCCCC UUGGACUGAAGGGAGCUCCCACC UGGACUGAAGGGAGCUCAUC UCGUGCUGUUGGGAAGUGGA GGUAAAGCACUGUUUCGGUGC GGCGGGCUCAAAUGACGAAUCAU

KAH,KO,UGT85C2 UGT85C2, KS UGT85C2, KO KS, UGT85C2 UGT85C2 KO, UGT85C2 KO, UGT85C2, KS UGT85C2 UGT76G1, KAH, KO KAH, KO KAH

(DDCT±3) in the leaves, when compared to stems and flowers of S. rebaudiana. Comparative expression levels or relative quantification plot of miRNAs and their target mRNAs in leaves, stems and flowers of S. rebaudiana are shown in Figs. 1 and 2, respectively. The expression levels of miRNAs and their target mRNAs were normalized to the level of b-actin and given on a logarithmic scale expressed as 45-DCT, where DCT is the difference in Real-Time PCR threshold cycle number of the respective miRNA and the reference b-actin gene, where 45 equals the expression level of b-actin gene (the number 45 was chosen because the PCR run stops after 45 cycles) (Nischal et al., 2012). The results are averages ±SE of

duplicates of three tissues. All the eleven miRNAs and their target mRNAs showed differential expressions in the leaves, flowers and stems of S. rebaudiana. Out of eleven miRNAs analysed, nine miRNAs (miR319a, miR319b, miR319c, miR319d, miR319e, miR319f, miR319h, miRstv_7, miRstv_9) were found to have low expression, while on the contrary, two miRNAs (miR319h and miRstv_11) had higher expression levels in leaf tissue in comparison to flower as well as stem tissues. On the contrary, all the target mRNAs found to have higher expression in leaf tissue when compared with flower and stem tissue. Fold-change expressions of miRNAs and their target mRNAs in leaf tissue in comparison to flower and stem tissues are given in Tables 3 and 4.

3.3. HPTLC analysis of steviol glycosides in different tissues Detailed TLC studies revealed that the mobile phase comprising of chloroform: methanol: water in the ratio of 60:32:4 (v/v/v) has shown the highest selectivity for resolution of steviol glycosides. The bands of these compounds were well separated on HPTLC plate at Rf 0.33 ± 0.03 and 0.24 ± 0.04 for stevioside and rebaudioside-A, respectively. The calibration curve for stevioside and rebaudiosideA are shown in Fig. S1 (A and B). Initial HPTLC fingerprinting was performed on the pure marker compounds, stevioside and rebaudioside-A. The bands of marker compounds were scanned and their spectra were recorded at

M. Saifi et al. / Plant Physiology and Biochemistry 94 (2015) 57e64

61

Fig. 1. Relative Quantification plot of miRNA levels in leaf, flower and stem tissues of S. rebaudiana. The expression levels of miRNAs were normalized to the level of b-actin and given on a logarithmic scale expressed as 45-DCT, where DCT is the difference in Real-Time PCR threshold cycle number of the respective miRNA and the reference b-actin gene, where 45 equals the expression level of b-actin gene (the number 45 was choosen because the PCR run stops after 45 cycles). The results are averages ±SE of duplicates of three tissues.

Fig. 2. Relative Quantification plot of target mRNA levels in leaf, flower and stem tissues of S. rebaudiana. The expression levels of mRNAs were normalized to the level of b-actin and given on a logarithmic scale expressed as 45-DCT, where DCT is the difference in Real-Time PCR threshold cycle number of the respective mRNA and the reference b-actin gene, where 45 equals the expression level of b-actin gene (the number 45 was choosen because the PCR run stops after 45 cycles). The results are averages ±SE of duplicates of three tissues.

400 nm. Fig. 3A, B, C shows the chromatograms obtained at 400 nm for the standard marker compounds separately and as well as standard mix.

Fingerprint patterns obtained from the test samples under identical conditions showed that the amount of two dominant steviol glycosides varied among different tissues (leaf, flower and

62

M. Saifi et al. / Plant Physiology and Biochemistry 94 (2015) 57e64

Table 3 List of differentially expressed miRNAs and expression levels in different tissues of S. rebaudiana. miR-ID

Fold increase(þ)/decrease (
) in leaf in comparision to Flowers

Stems

miR319a miR319b miR319c miR319d miR319e miR319f miR319g miR319h miRstv_7 miRstv_9 miRstv_11

(
)0.7526 (
)0.3321 (
)0.9012 (
)0.4600 (
)0.5547 (
)0.4383 (þ)1.1250 (
)0.4895 (
)1.1566 (
)0.2284 (þ)1.4240

(
)0.539614 (
)0.343885 (
)0.348686 (
)0.353553 (
)0.48971 (
)0.140632 (þ)4.531536 (
)0.154963 (
)0.417544 (
)0.11744 (þ)1.905276

Sequence of miRNA in S. rebaudiana

UUGGACUGAAGGGAGCUCCCUUC UUGGACUGAAGGGAGCUCCAUC UUGGACUGAAGGGAGCUCCCU UUGGACUGAAGGGAGCAUC UUGGACUGAAGGGAGCUCCC UUGGACUGAAGGGAGCUCCCC UUGGACUGAAGGGAGCUCCCACC UGGACUGAAGGGAGCUCAUC UCGUGCUGUUGGGAAGUGGA GGUAAAGCACUGUUUCGGUGC GGCGGGCUCAAAUGACGAAUCAU

Table 4 List of differentially expressed mRNAs and expression levels in different tissues of S. rebaudiana. mRNA-ID

Fold increase(þ)/decrease (
) in leaf in comparision to Flowers

Stems

KO KS KAH UGT85C2 UGT76G1

(þ)1.777685 (þ)1.109569 (þ)2.620787 (þ)1.464086 (þ)2.250117

(þ)3.160165 (þ)4.112455 (þ)4.377175 (þ)3.5801 (þ)7.361501

Accession no. of gene

DQ200952.1 AF097310.1 DQ398871.3 AY345978.1 AY345974.1

stem) of S. rebaudiana. In all the tissues, the concentration of stevioside was found higher than rebaudioside-A. The highest stevioside and rebaudioside-A contents (7.5% and 2.17%) were detected in leaves, whereas their contents in flowers and stems were 7e8 and 12e13 fold lower than leaves, respectively (Fig. 4). HPTLC chromatograms obtained from all the samples showed the peaks corresponding to standard stevioside and rebaudioside-A marker compounds in leaf, flower and stem tissues (Fig. 5A, B and C) respectively. 4. Discussion S. rebaudiana is a new world species. Diterpenoids like steviol glycosides present in the leaves of S. rebaudiana are important due to their application in industrial products such as commercial sweeteners, flavouring agents, pharmaceuticals and antimicrobial agents. They play an important role in planteenvironment interaction, planteplant communication and plant-insect and

Fig. 4. Steviol glycosides contents in stem, leaf and flower tissues of S. rebaudiana.

planteanimal interactions (Pichersky and Gershenzon, 2002). It was reported that the leaves of S. rebaudiana have functional and sensory sweeteners and are likely to become major source of high potency sweetener for upcoming natural food market (Goyal and Goyal, 2010). Metabolic engineering may further pave a way to improvise the yield of steviol glycosides by increasing leaf biomass and the contents of these metabolites in this plant. One of the way to tinker with biosynthetic pathway is through modulating miRNA levels. At present more than thousand miRNA genes among diverse species have been identified, annotated and some of them have been well characterized (Griffith's et al., 2008). But still a large number of plant species are unexplored and S. rebaudiana is one of them. A large flux of research activities have diverted to understand the biosynthesis and possible manipulation of diterpenoids in S. rebaudiana, particularly steviol glycosides which are mainly responsible for its ecological and commercial importance. But till date no research activity is reported for exploring the miRNAs that may regulate genes involved in steviol glycosides biosynthetic pathway. With the advent of novel next generation technology, computational approaches were introduced and currently software tools can identify miRNAs from EST/GSS sources and predict their secondary structures, targets and homologues (Zhang et al., 2006). However, computational predicted data need to be validated experimentally. Thus, combined computational and experimental approaches would provide more reliable data. In the present study, we attempted to identify miRNAs from

Fig. 3. HPTLC chromatograms of Stevioside(A), Rebaudioside-A(B), and stevioside and rebaudioside-A mix(C).

M. Saifi et al. / Plant Physiology and Biochemistry 94 (2015) 57e64

63

Fig. 5. HPTLC chromatogram of stevioside and rebaudioside-A in leaf (A), flower (B), and stem (C) tissues.

S. rebaudiana targeting genes of steviol glycosides biosynthetic pathway using computational and experimental methods and their relationship pattern was analysed with the expression levels of their target mRNAs as well as steviol glycosides content in different tissues of this plant. A total of 100 miRNAs belonging to 34 highly conserved families and 12 novel miRNAs, whose precursors were potentially generated from stevia EST and nucleotide sequences (Mandhan et al., 2012), were targeted against genes involved in steviol glycosides biosynthetic pathway using miRanda database tool. On the basis of query coverage and alignment score miRanda database tool results predicted eleven miRNAs targeting genes of steviol glycosides biosynthetic pathway. Out of which, eight (miR319a, miR319b, miR319c, miR319d, miR319e, miR319f, miR319g, miR319h) belong to conserved miRNA family (miR319) and three (miRstv_7, miRstv_9, miRstv_11) are novel miRNAs specific to S. rebaudiana. Stem loop RT-PCR was performed to validate these miRNAs and then Real-Time PCR was performed to evaluate the expression levels of these miRNAs and their target mRNAs.The expression patterns of miRNAs were measured on the basis of changes in normalized cyclic threshold 3 (DDCt±3) in the leaves, stems and flowers of S. rebaudiana. All the eleven miRNAs incuding the isoforms of miR319 family showed differential expressions in these tissues. Similar results in terms of variations in expression levels of isoforms of miRNAs were also reported in earlier studies (Jiang et al., 2005). Though the exact mechanism for this variation is not known, but it can be explained as the 30 ends are the key determinants of target specificity within miRNA families (Brennecke et al., 2005) and variation of one to four nucleotides is found within isoforms of miR319 family. Thus, they may have different unknown targets within the Stevia genome. Out of eleven miRNA analysed, nine miRNAs (miRNA319a, miRNA319b, miRNA319c, miRNA319d, miRNA319e, miRNA319f, miRNAh, miRstv_7, miRstv_9) were found to have lowest expression levels in leaves, when compared with flowers and stems. Their expression levels were in the following order: stems > flowers > leaves. On the contrary, the expression levels of their target mRNAs and steviol glycosides content were exactly in opposite order i.e. leaves > flowers > stems. These observations, thus, suggest that these miRNAs may be associated with down-regulation of their target genes leading to the lower contents of steviol glycosides in stems and flowers. The expression levels of miR319g as well as miRstv_11 and steviol glycosides contents on the other hand were highest in the leaves, when compared with stems and flowers. These miRNAs may therefore, be up-regulating their target genes resulting in higher steviol glycosides content in the leaves as compared to the flowers and stems of S. rebaudiana. Similar kinds of regulatory roles of miRNAs have also been reported by other investigators, where certain miRNAs down-regulated the expression

of their target genes resulting in lower synthesis of metabolites, while some were found to activate the expression of their target genes leading to higher metabolites synthesis (Place et al., 2008; Barozai, 2012 a,b; Ji et al., 2009; Kenell et al., 2012; Nunez et al., 2013; Enright et al., 2004). 5. Conclusion In conclusion, the present study for the first time documents the stem-loop coupled RT-PCR and Real -Time PCR assays based validation and expressions of miRNAs targeting genes of steviol glycosides biosynthetic pathway in different tissues (leaves, flowers and stems) of S. rebaudiana and their relationship pattern was analysed with the expression levels of their target mRNAs and steviol glycosides content. Based on the relationship pattern among expression levels of miRNAs, their target mRNAs and the contents of steviol glycosides in these tissues, the two miRNAs (miR319g and miRstv_11) may up-regulate, while nine miRNAs (miR319a, miR319b, miR319c, miR319d, miR319e, miR319f, miR319h, miRstv_7 and miRstv_11) may down-regulate their target genes involved in steviol glycosides biosynthetic pathway and steviol glycosides content in the leaves, flowers and stems of S. rebaudiana. These miRNAs hence, can be further used to manipulate steviol glycosides biosynthetic pathway genes so as to enhance the yield of steviol glycosides in S. rebaudiana. Further, based on the results of present study, S. rebaudiana can also be added to the list of plant species containing miRNAs and supporting the concept of their evolutionary conservation. Author contributions MS carried out laboratory work, bioinformatics analysis and drafted the manuscript. NN and AA helped in experiments. MMA helped in Real-Time PCR experiments. JAK helped in bioinformatics analysis and in silico data interpretation. MZA conceived the idea and designed the experiment. He also interpreted the results and coordinated the entire study. All the authors have read and approved the manuscript. Conflicts of interest Author declares no conflicts of interest. Acknowledgement The research facilities developed from UGC-SAP (DRS-1) grant sanctioned to the Department of Biotechnology and Maulana Azad National research fellowship awarded to M. S. and BSR fellowships to N.N., M.M.A., and A.A. by University Grants Commission,

64

M. Saifi et al. / Plant Physiology and Biochemistry 94 (2015) 57e64

Government of India, are gratefully acknowledged. Appendix A. Supplementary data Supplementary data related to this article can be found at http:// dx.doi.org/10.1016/j.plaphy.2015.05.009. References Barozai, M.Y.K., 2012a. Identification and characterization of the microRNAs and their targets in Salmo salar. Gene 499, 163e168. Barozai, M.Y.K., 2012b. The MicroRNAs and their targets in the channel catfish (Ictalurus punctatus). Mol. Biol. Reports 39, 8867e8872. Bartel, D.P., 2004. MicroRNAs: genomics, biogenesis, mechanism, and function. Cell 116, 281e297. Bondarev, N.I., Sukhanova, M.A., Reshetnyak, O.V., Nosov, A.M., 2003. Steviol glycoside content in different organs of Stevia rebaudiana and its dynamics during ontogeny. Biol. Plant. 47, 261e264. Brandle, J.E., Rosa, N., 1992. Heritability for yield, leaf: stem ratio and stevioside content estimated from a landrace cultivar of Stevia rebaudiana. Can. J. Plant Sci. 72, 1263e1266. Brennecke, J., Stark, A., Russell, R.B., Cohen, S.M., 2005. Principles of microRNAetarget recognition. PLoS Biol. 3, e85. Chen, C., Ridzon, D.A., Broomer, A.J., Zhou, Z., Lee, D.H., Nguyen, J.T., Barbisin, M., 2005. Real-time quantification of microRNAs by stemeloop RTePCR. Nucleic Acids Res. 33 e179ee179. Czechowski, T., Bari, R.P., Stitt, M., Scheible, W.R., Udvardi, M.K., 2004. Real-time RTPCR profiling of over 1400 Arabidopsis transcription factors: unprecedented sensitivity reveals novel root-and shoot-specific genes. Plant J. 38, 366e379. Enright, A.J., Bino, J., Gaul, U., Tuschl, T., Sander, C., Marks, D.S., 2004. MicroRNA targets in Drosophila. Genome Biol. 5. R1eR1. Gasic, E.V., Rongmei, W., Wood, M., Walton, E.F., Hellens, R.P., 2007. Protocol: a highly sensitive RT-PCR method for detection and quantification of microRNAs. Plant Methods 3, 12. Goyal, S.S., Goyal, R.K., 2010. Stevia (Stevia rebaudiana) a bio-sweetener: a review. Int. J. Food Sci. Nutr. 61, 1e10. Griffiths, J.S., Saini, H.K., Van, D.S., Enright, A.J., 2008. miRBase: tools for microRNA genomics. Nucleic Acids Res. 36, D154eD158. Guleria, P., Yadav, S.K., 2011. Identification of miR414 and Expression Analysis of Conserved miRNAs from Stevia rebaudiana. Genomics, Proteom. Bioinforma. 9, 211e217. Jayaraman, Sathishkumar, Manoharan, M.S., Illanchezian, S., 2008. In-vitro antimicrobial and antitumor activities of Stevia rebaudiana (Asteraceae) leaf extracts. Trop. J. Pharm. Res. 7, 1143e1149. Jeppesen, P.B., Gregersen, S., Alstrup, K.K., Hermansen, K., 2002. Stevioside induces antihyperglycaemic, insulinotropic and glucagonostatic effects in vivo: studies in the diabetic Goto-Kakizaki (GK) rats. Phytomedicine 9, 9e14. Ji, J., Shi, J., Budhu, A., Yu, Z., Forgues, M., Roessler, S., Ambs, S., 2009. MicroRNA expression, survival, and response to interferon in liver cancer. N. Engl. J. Med.

15, 1437e1447. Jiang, J., Lee, E.J., Gusev, Y., Schmittgen, T.D., 2005. Real-time expression profiling of microRNA precursors in human cancer cell lines. Nucleic Acids Res. 33, 5394e5403. Kennell, J.A., Cadigan, K.M., Shakhmantsir, I., Waldron, E.J., 2012. The MicroRNA miR-8 is a positive regulator of pigmentation and eclosion in Drosophila. Dev. Dyn. 241, 161e168. Kumar, H., Kaul, K., Gupta, S.B., Kaul, V.K., Kumar, S., 2012. A comprehensive analysis of fifteen genes of steviol glycosides biosynthesis pathway in Stevia rebaudiana (Bertoni). Gene 492, 276. Lee, J.I., Kang, K.H., Park, H.W., 1982. The Research Reports of the Office of Rural Development (Korea R.). New High Rebaudioside-A Stevia Variety Suweon 11, 24, pp. 186e188. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using real-time quantitative PCR and the DDCT method. Methods 25, 402e408. Mandhan, V., Kaur, J., Singh, K., 2012. smRNAome profiling to identify conserved and novel microRNAs in Stevia rebaudiana Bertoni. BMC plant Biol. 12, 1471e2229. Melis, M.S., Sainati, A.R., 1991. Effect of calcium and verapamil on renal function of rats during treatment with stevioside. J. Ethnopharmacol. 33, 257e262. Melis, M.S., 1995. Chronic administration of aqueous extract of Stevia rebaudiana in rats: renal effects. J. Ethnopharmacol. 47, 129e134. Morita et al., 2011. High Rebaudioside-A plant. U.S. Patent. 7884265B2. Nischal, L., Mohsin, M., Khan, I., Kardam, H., Wadhwa, A., Abrol, Y.P., Iqbal, M., Ahmad, A., 2012. Identification and comparative analysis of microRNAs associated with low-N tolerance in rice genotypes. PloS One 7, e50261. Nunez, Y.O., Truitt, J.M., Gorini, G., Ponomareva, O.N., Blednov, Y.A., Harris, R.A., Mayfield, R.D., 2013. Positively correlated miRNA-mRNA regulatory networks in mouse frontal cortex during early stages of alcohol dependence. BMC genomics 14, 725. Pichersky, E., Gershenzon, J., 2002. The formation and function of plant volatiles: perfumes for pollinator attraction and defense. Curr. Opin. Plant Biol. 5, 237e243. Place, R.F., Li, L.C., Pookot, D., Noonan, E.J., Dahiya, R., 2008. MicroRNA-373 induces expression of genes with complementary promoter sequences. Proc. Natl. Acad. Sci. 105, 1608e1613. Saifi, M., Ali, A., Saini, M., Nasrullah, N., Khan, S., Abdin, M.Z., 2014. A rapid and efficient high performance thin layer chromatographic (hptlc) method for simultaneous analysis of stevioside and rebaudioside-a in stevia rebaudiana. Int. J. Pharm. Pharm. Sci. 6, 455e462. telat, A., Cubas, P., Farmer, E.E., Nath, U., Schommer, C., Palatnik, J.F., Aggarwal, P., Che Weigel, D., 2008. Control of jasmonate biosynthesis and senescence by miR319 targets. PLoS Biol. 6, e230. Tadhani, M.B., Patel, V.H., Subhash, R., 2007. In vitro antioxidant activities of Stevia rebaudiana leaves and callus. J. Food Compos. Anal. 20, 323e329. Yadav, S.K., Guleria, P., 2012. Steviol glycosides from Stevia: biosynthesis pathway review and their application in foods and medicine. Crit. Rev. Food Sci. Nutr. 52, 988e998. Zhang, et al., 2006. Computational identification of microRNAs and their targets. Comput. Biol. Chem. 30, 395e407.