- Email: [email protected]
In vivo clearing of idiotypic antibodies with antiidiotypic antibodies and their derivatives
Molecular Immunology 43 (2006) 599–606
In vivo clearing of idiotypic antibodies with antiidiotypic antibodies and their derivatives Ann Erlandsson a,b , David Eriksson a , Lennart Johansson c , Katrine Riklund c , Torgny Stigbrand a , Birgitta Elisabeth Sundstr¨om b,∗ b
a Department of Immunology, Ume˚ a University, S-901 85 Ume˚a, Sweden Division for Chemistry, Karlstad University, Department of Biomedicial Science, Universitetsg 2, S-651 88 Karlstad, Sweden c Department of Radiation Science, Diagnostic Radiology, Ume˚ a University, S-901 85 Ume˚a, Sweden
Received 1 March 2005 Available online 22 June 2005
Abstract At immunolocalization of experimental tumors, idiotypic monoclonal antibodies, such as TS1 against cytokeratin 8, can be used to carry and deposit in vivo terapeutics in the tumor. These carriers also remain in the circulation and may cause negative side-effects in other tissues. In this report, several derivatives of the antiidiotypic antibody ␣TS1 were produced and tested for their clearing capacity of the idiotypic carrier antibody TS1. Intact monoclonal ␣TS1, scFv of a ␣TS1 and ␣TS1 Fab and Fab2 fragments were produced by recombinant technology or by cleavage with Ficin. The scFv was tailored by use of the variable domain genes of the light and heavy chain from the hybridoma clone in combination with a (Gly4 Ser)3 -linker, followed by expression in E. coli. When tested for clearing capacity, the intact divalent antiidiotypic IgG was found to be the most efficient. The divalent Fab2 and the monovalent Fab fragment also demonstrated significant clearing, but lower than the intact antiidiotypic IgG. The ␣TS1 scFv antibody when injected separately was not found to clear the idiotype, but could do so when preincubated with the idiotype. Rapid excretion and in vivo instability of this low molecular weight antibody fragment may be the major reasons. Similar results were obtained when the system was reversed and the 131 I-labeled antiidiotype IgG was cleared with the idiotype Fab2 fragment. It is concluded that both intact antiidiotypic IgG, Fab2 and Fab fragments are able to clear the idiotypic antibodies. The experimental data support the conclusion that the Fc parts from both the idiotype and the antiidiotype may contribute to this elimination. © 2005 Elsevier Ltd. All rights reserved. Keywords: ScFv; Fab2 ; Fab; Idiotypic; Antiidiotypic
1. Introduction Immunotherapy is rapidly accelerating as an approach to selectively reach, identify and eliminate tumors (reviewed in Harris, 2004; reviewed in Milenic et al., 2004). The antibodies can be charged with different compounds (nuclides,
Abbreviations: mAb, monoclonal antibody; Id, idiotype; aId, antiidiotype; VL, variable light chain; VH, variable heavy chain; scFv, single chain fragment variable; CR1, complement receptor 1 ∗ Corresponding author. Tel.: +46 54 700 2472; fax: +46 54 700 1457. E-mail address: [email protected] (B.E. Sundstr¨om). 0161-5890/$ – see front matter © 2005 Elsevier Ltd. All rights reserved. doi:10.1016/j.molimm.2005.04.019
toxins, cytokines or cytotoxic drugs), intended to exert toxic effects on the tumors. Intact monoclonal antibodies (mAbs) of either human or mouse origin, or in the form of chimeric or humanized antibodies, may remain in the circulation and can generate unwanted side reactions. One of the possibilities to improve the efficiency of immunotargeting and immunotherapy is to generate the tools to eliminate these redundant circulating immunoconjugates. Intact antibodies are known, due to their size, to remain in the circulation causing putative damage systemically or in non-targeted organs. For intact IgG the residence time in the tumors is usually long, which favours their use in therapeutic approaches. Antibody fragments, on
600
A. Erlandsson et al. / Molecular Immunology 43 (2006) 599–606
the other hand, which are rapidly cleared, can generate high tumor/non-tumor ratios when used for tumor targeting, but do usually display comparatively short residence times, which make them less suitable for therapeutic targeting of tumors (Reff and Heard, 2001). Antibody fragments such as the scFv, Fab and Fab2 are, however, less immunogenic compared to intact IgG mainly due to their lack of constant-parts and partly to their shorter persistence in the circulation (Kuus-Reichel et al., 1994; Juweid et al., 1996). Antiidiotypic (␣Id) monoclonal antibodies can be used to identify and characterize monoclonal antibodies and even to regulate their concentrations both in vitro and in vivo. When using radiolabelled idiotypic antibodies (Id) in tumor therapy, different methods to clear the Id mAb from the circulation have been presented and one technology is to utilize ␣Id antibodies (Sharkey et al., 1992; Ull´en et al., 1996; Sandstrom et al., 1999). The mAbs used in this study are the Id mAb TS1 specific for cytokeratin 8, present in the epithelium of different tissues and exposed in necrotic regions in solid epithelial tumors and the ␣Id ␣TS1, which binds with high affinity to TS1. An effective clearing of the Id from the circulation by the ␣Id has been demonstrated in vivo, where approximately 60% of the radioactivity was reduced within approximately 50 h after injection of the ␣Id, using a 1:1 ratio of TS1:␣TS1 in non-tumor bearing mice (Ull´en et al., 1995; Johansson et al., 2002). So far no attempts to use fragmented ␣Id antibodies without the Fc part have been performed for clearing purposes. It is of importance to generate Fab and Fab2 fragment with retained immunoreactivity and the available cleavage methods by papain, pepsin and ficin have to be optimized for each antibody (Milenic et al., 1989). ScFv is one of the smallest antigen binding fragments and was originally developed to simplify expression of antigen binding fragments (Bird et al., 1988; Huston et al., 1988). Usually it is easy to produce scFv s with strong and specific binding to their actual targets by direct cloning from specific hybridomas or by selection from phage displayed libraries of scFvs (Winter et al., 1994; Krebber et al., 1997). The production of scFv in E. coli also enables cheap high throughput generation of scFv s. It is of significance to generate a scFv that is stable at in vivo conditions as well as during storage and in analytical applications. It has been shown that high thermal stability as well as resistance to serum proteases are essential properties for a therapeutic scFv. Incubation in high temperature and serum followed by studies of impaired immunochemical properties in ELISA or BIAcore can give important information on the stability (Willuda et al., 1999; Weidenhaupt et al., 2002). It is known that the lack of the Fc-parts, differences in size, charge and valency for scFv, Fab, Fab2 and IgG leads to variation in immunogenicity, excretion, tumor penetration and functional affinity. The aim of this investigation was to study how the clearing of radiolabelled intact Id IgG and ␣Id IgG is affected by use of the different antibody derivatives scFv, Fab, Fab2 and intact IgG of the ␣Id and Fab2 of the Id.
2. Materials and methods 2.1. Hybridoma, monoclonal antibodies Hybridoma cell lines producing the monoclonal antibody TS1 (Sundstrom et al., 1989), reactive with cytokeratin 8, and its antiidiotype (TS1 (Ull´en et al., 1995), were cultured in DMEM:F12 1:1 supplemented with 10% fetal calf serum and 100 IU/ml streptomycin and 100 g/ml penicillin (Gibco BRL). The antibodies were purified from cell culture media using a Protein G column (Amersham Biosciences) and eluted with 0.1 M glycine/HCl buffer pH 2.3. Fractions were neutralised and stored at −20 ◦ C until use. 2.2. Radiolabeling For the in vivo studies the mAbs TS1 and ␣TS1 were radiolabelled with 131 I (Amersham) using the chloramine T method to a specific activity of 30 MBq/mg. Free iodine was removed by passage over a column with Sephadex G 50 (Amersham Biosciences). 2.3. Production of Fab2 and Fab fragments The mAbs TS1 and ␣TS1 were dialysed against 0.1 M citrate buffer pH 6.0 and cleaved with Ficin to produce Fab2 and Fab fragments (according to the manufacturer) (PIERCE). Uncleaved IgG and Fc parts were removed by anion exchange chromatography at pH 8.0 (Hi Trap Q HP, Amersham Biosciences) leaving the Fab2 and Fab fragments in the flow through volume. Fab2 and Fab fragments were then separated by gelfiltration using a Sephacryl-S100 HR column (Amersham Biosciences). The antibody fragments were dialysed against 10mM phosphate buffer pH 7.4 with 0.15 M NaCl and filtered through a 0.22 m filter prior to injection. 2.4. Construction of αTS1 scFv The variable domain genes of the light (VL ) chain GenBank accession nos. AJ884575 and heavy (VH) chain GenBank accession nos. AJ884574 were cloned into the pGEM-T vector (Promega) and sequenced as described before (Erlandsson et al., 2003). The heavy and light chain were then combined with a (Gly4 Ser)3 -linker. Two separate PCR reactions were performed to generate a VH gene with an upstream Sfi cleavage site with primer 5 CTTGGTAGCAACGGCCCAGCCGGCCATGGCCCAGGTGCAACTGCAGCAGCCTGGGGCTGA-3 and a downstream linker sequence with primer 5 -CGATCCGCCACCGCCAGA GCCACCTCCGCCTGAACCGCCTCCACCGGAGACGGTGACCGT-3 . The VL gene was generated with an upstream linker sequence with primer 5 GGTGGAGGCGGTTCAGGCGG AGCTGGCTCTGGCGGTGGCGGATCGGATGTTGTCATGACC-3 and a down-
A. Erlandsson et al. / Molecular Immunology 43 (2006) 599–606
stream Not 1 cleavage site with primer 5 -AACAGAAGGAGCTGCGGCCGCCCGTTTCATTTCCAGC TTGGTCCCCCCTCCGAACGTGTA-3 . These PCR products were then combined by a seven cycle denaturing annealing reaction and amplified with the primer with the upstream Sfi cleavage site and the primer with the downstream Not 1 cleavage site. The final product was cleaved with Sfi and Not 1, ligated into the phagemid vector pCANTAB (Expression module, Amersham Bioscience) and transformed to the E. coli strain HB2151(Amersham Bioscience). The sequence of the construct was confirmed using the pCANTAB S1 and S6 primers (Amersham Bioscience) and the ␣TS1 scFv produced was tested for binding to TS1 with ELISA using an anti-E-tag antibody conjugated to HRP (Amersham Bioscience)(data not shown). The gene was then isolated from pCANTAB by digestion with Nco 1 and Not 1, ligated into the vector pET 26 with his tag and pel B leader (Novagene) and transformed to the E. coli strain Rosetta DE3 (Novagene) and sequenced using T7 promotor and terminator primers (Novagen). 2.5. Expression in Rosetta (DE3) Expression in Rosetta (DE3) was performed by culturing the bacteria in LB medium with kanamycin 30 g /ml and chloramphenicol 75 g/ml. Cultures were incubated for approximately 16 h at 30 ◦ C to an OD600 value between 3–3.5, thereafter glycine, Triton X-100 and IPTG were added to a final concentrations of 2%, 1% and 1mM, respectively and incubated at 20 ◦ C over night (Yang et al., 1998). 2.6. Purification of the αTS1 scFv The bacteria were centrifugated and the supernatant with soluble scFv was collected, concentrated and dialysed against 20 mM Na-phosphate buffer pH 6.5. The dialysed samples were filtered through a 0.45 m filter (acrodisc syringe filter, PALL Gelman Laboratory), affinity purified by Ni-NTA (QIAGEN) according to the manufacturer, desalted on a PD10 column (Amersham Bioscience) and then purified with cation exchange chromatography (Hi Trap Sp HP, Amersham Biosciences) with 20 mM Na-phosphate buffer pH 6.5 and eluted with a continuous NaCl gradient. The scFv used in the in vivo study was dialysed against 10 mM phosphate buffer pH 7.4 with 0.15 M NaCl and filtered through a 0.22 m filter prior to injection.
601
2.8. Temperature and serum stability test The temperature stability test was performed on purified ␣TS1 scFv diluted to 0.5 g/ml in 10 mM Hepes and 150 mM NaCl pH 7.4 and heated for 10 min at 40, 45, 50, 55, 60 and 65 ◦ C. The serum stability test was performed by diluting the purified ␣TS1 scFv to 0.5 g/ml in serum and incubation at 37 ◦ C for 10, 20, 30, 60, 120, 240 min and 16 h. The reactivity of ␣TS1 scFv with TS1 was analyzed by ELISA in several dilutions and the temperature causing a 50% reduction of the binding was determined, as well as the effect of incubation in 37 ◦ C in serum. Fab fragments of ␣TS1 were diluted to 0.7 g/ml in 10 mM Hepes and 150 mM NaCl pH 7.4 and heated for 10 min at 45 ◦ C. The Fab fragments of ␣TS1 were also diluted to 0.7 g/ml in serum and incubated at 37 ◦ C for 16 h. The immunoreactivity of the ␣TS1 Fab fragments was tested in an inhibition ELISA. 2.9. SDS-PAGE for analysis of the purity SDS-PAGE (9% T for the IgG and fragments and 12% T for the scFv) was used for analysis of the purity of the ␣TS1 IgG, ␣TS1 Fab2 , ␣TS1 Fab, ␣TS1 scFv, TS1 IgG and TS1 Fab2 . The SDS-PAGE gel was stained with Coomassie Brilliant Blue R250. 2.10. Spectrofotometric determination of the concentration The extinction coefficients were calculated to 1.82 for IgG and 1.75 for Fab2 , Fab and scFv from the amino acid sequences by the program Protean (DNAstar) using the Del´eage and Roux modification of Nishikawa and Ooi (1986) (Nishikawa and Ooi, 1986). The concentration of the purified ␣TS1 IgG, ␣TS1 Fab2 , ␣TS1 Fab, ␣TS1 scFv, TS1 IgG and TS1 Fab2 was determined by measuring the absorbance at 280 nm. 2.11. Calculation of the pI The pI’s of ␣TS1 Fab and the scFv were calculated by the Protean program (DNAstar) based on the amino acid sequence and pK tables. The amino acid sequence in the V gene of ␣TS1 and the (Gly4 Ser)3 -linker as well as the hexahistidine tag were used to calculate the scFv pI and for the Fab the V genes of ␣TS1 and the CL and CH genes of IgG1 GenBank accession nos. AAB50766 and AAB50767 (Christian et al., 1996) were used.
2.7. Size exclusion chromatography
2.12. Inhibition ELISA
Purified and concentrated ␣TS1 scFv was analyzed on a Superose 6 column in a FPLC system to determine the molecular weight. After calibration of the column, 100 l of scFv ␣TS1 (0.1 mg/ml) was applied to the column and eluted with phosphate buffered saline, pH 7.4 using a flow rate of 0.5 ml/min.
The monoclonal antibody ␣TS1 used for detection in the inhibition ELISA was conjugated to biotin using biotinNHS-carbodiimide (Pierce), as described by the manufacturer. Microtiter plates (Nunc) were coated over night at 4 ◦ C with 100 l/well of TS1 in 0.01 M phosphate buffer, pH 7.2, 0.15 M NaCl at a concentration of 2.5 g/ml. The plates were
602
A. Erlandsson et al. / Molecular Immunology 43 (2006) 599–606
washed three times with TBST (0.1 M Tris, 0.15 M NaCl and 0.05% Tween 20, pH 7.4) and antibody/fragments with the following concentrations; ␣TS1 IgG 10 g/ml (66 nM), ␣TS1 Fab2 10 g/ml (99 nM), ␣TS1 Fab 20 g/ml (198 nM), ␣TS1 scFv 40 g/ml (1320 nM) were combined undiluted and serially diluted 1:3 in six steps with a constant amount of approximately 0.7 g/ml (5 nM) of biotinylated ␣TS1 IgG. After sample incubation another washing step with TBST was performed and the avidin-AP conjugate (Biorad) was added to the wells and incubated at room temperature for 60 min. The plates were developed with 3 mM p-nitrophenyl phosphate in 50 mM 2-amino-2-methyl-1-propanol, 1 mM MgCl2 pH10.0 and the absorbance was read at 405 nm. 2.13. In vivo studies Twenty-six female mice (BALB/c Bomhooltgaard) were used in the study, were 16 mice were injected intraperitoneally with 50 g 131 I labelled TS1, six mice were injected with 50 g 131 I labelled ␣TS1 and four mice were injected with a mixture of 131 I labelled TS1 (50 g) pre-incubated with either ␣TS1 IgG (25 g) or ␣TS1 scFv (55 g). After 21 h, the mice that were given 131 I labelled TS1 were treated as follows; two mice received no antibody/antibody fragment, two mice received 25 g of ␣TS1 IgG (TS1 IgG:␣TS1 IgG, molar ratio 1:0.6), four mice received 48 g ␣TS1 Fab2 (TS1 IgG:␣TS1 Fab2 , molar ratio 1:1.9), four mice received 55 g ␣TS1 Fab (TS1 IgG:␣TS1 Fab, molar ratio 1:4.4) and four mice received 55 g ␣TS1 scFv (TS1 IgG:␣TS1 scFv, molar ratio 1:8). The mice given 131 I labelled ␣TS1 were treated as follows; two mice received no antibody/antibody fragments and four mice received 41 g TS1 Fab2 (␣TS1 IgG:TS1 Fab2 , molar ratio 1:1.6). Two mice received 50 g 131 I labelled TS1 that had been pre-incubated for 1 h with 55 g ␣TS1 scFv (TS1 IgG:␣TS1 scFv, molar ratio 1:6) and two mice received 50 g 131 I labelled TS1 that had been pre-incubated for 1 h with 25 g of ␣TS1 IgG (TS1 IgG:␣TS1 IgG, molar ratio 1:0.5). The total body activity of each mouse was measured using a gamma-camera (General Electric) without collimator coupled to a counter. To avoid anesthesia each mouse was kept in a small cup covered with a Plexiglas plate during measurements. The cup with the mouse was placed at a fixed distance of approximately 30 cm from the counter. The activity (cps) was recorded for 20 s. The mice were measured directly after injection of the radiolabelled antibody, after injection of the clearing antibody and after 11, 23, 33, 45 and 56 h. All calculations were corrected for the initial decay and non-specific elimination in the control.
The expression of the ␣TS1 scFv was performed in Rosetta (DE3), a strain which expresses tRNA with codons that are commonly used in mice but rarely used in E. coli. During culturing, the scFv was transported to the periplasmic space because of the pel B leader in the vector pET 26, and due to the Triton X-100 and glycine the scFv was released to the culture media. Approximately, 1 mg of scFv was obtained from 1 l of culture media. 3.2. Purity, size exclusion chromatography and concentration The scFv was purified by Ni-NTA and cation exchange chromatography and the result from the SDS-PAGE demonstrated a band at approximately 28 KDa with >95% purity. The size exclusion chromatography showed that the purified scFv consisted of only 28 KDa monomers. The solubility of the scFv was low. At concentrations above 0.2 mg/ml the immunoreactivity was completely lost. The IgGs and the cleaved fragments were >95% pure and had approximately the following sizes, TS1 IgG 150 KDa, ␣TS1 IgG 150 KDa, TS1 Fab2 100 KDa, ␣TS1 Fab2 2 bands around 100 KDa and ␣TS1 Fab 50 KDa. The antibody derivatives are presented in Fig. 1. The double band in the ␣TS1 Fab2 represents fragments cleaved at different positions by Ficin. Using -metcaptoethanol in the sample buffer the ␣TS1 Fab2 double bands were converted to a single band of approximately 25 KDa representing single light and partially cleaved heavy chain (data not shown). 3.3. Calculation of the pI, temperature and serum stability of αTS1 scFv and Fab The pI of ␣TS1 Fab was calculated to 7.7 and the pI of the ␣TS1 scFv was calculated to 8.9. The stability of ␣TS1 scFv
3. Results 3.1. Construction of the αTS1 scFv The sequence of the ␣TS1 scFv cloned in pET 26 was confirmed to be correct by sequencing in both directions.
Fig. 1. SDS PAGE gels from separate runs. Lane 1, TS1 Fab2 ; Lane 2, ␣TS1 Fab2 ; Lane 3, ␣TS1 Fab; Lane 4, ␣TS1 scFv.
A. Erlandsson et al. / Molecular Immunology 43 (2006) 599–606
Fig. 2. Inhibition ELISA showing the immunoreactivity of the ␣TS1 IgG and its derivatives used in vivo. The following starting concentrations of the ␣Id and its fragment were used; ␣TS1 IgG 10 g/ml (66 nM), ␣TS1 Fab2 10 g/ml (99 nM), ␣TS1 Fab 20 g/ml (198 nM), ␣TS1 scFv 40 g/ml (1320 nM) were combined undiluted and serially diluted 1:3 in six steps with a constant amount of approximately 0.7 g/ml (5 nM) of biotinylated ␣TS1 IgG.
and Fab was analysed after incubation in different temperatures and in serum at 37 ◦ C. After 10 min incubation at 45 ◦ C, the immunoreactivity of the ␣TS1 scFv was reduced to 50%, whereas the Fab fragment maintained its binding. After 16 h incubation at 37 ◦ C in serum both scFv and Fab retained their binding.
603
Fig. 3. Clearing of 131 I-TS1 IgG using ␣TS1 IgG post-injected or preincubated with TS1 IgG and clearing of 131 I-TS1 IgG using ␣TS1 scFv. The four different groups of mice were treated as follows: The group (four mice) indicated by diamonds, received 50 g 131 I-TS1 or 50 g 131 I-␣TS1. The group (two mice) indicated by squares, received 50 g 131 I-TS1 and 21 h later 25 g ␣TS1 IgG (molar ratio 1:0.6). The group (four mice) indicated by triangles, received 50 g 131 I-TS1 pre-incubated with 55 g ␣TS1 scFv (molar ratio 1:6). The group (one mouse) indicated by crosses, received 50 g 131 I-TS1 pre-incubated with 25 g ␣TS1 IgG (molar ratio 1:0.5). Bars represent S.E.M. values.
3.4. Inhibition ELISA The inhibition ELISA was performed to determine the immunoreactivity of the ␣TS1 IgG and its derivatives. Between 7 and 9 nM of IgG, Fab2 and Fab and 40–45 nM of scFv was needed to give a 50% inhibition of the biotinylated ␣TS1 IgG of approximately 5 nM. These results indicate that the IgG and the Fab2 used in vivo had equivalent immunoreactivity. The inhibition ELISA showed that the Fab maintained immunoreactivity and indicated that the monovalent ␣TS1 Fab at approximately twice the molar concentration was able to compete with the divalent biotinylated ␣TS1 IgG. The result does also show that approximately 6-fold higher molar concentration of the scFv compared to the Fab fragment was needed to give similar inhibition. By BIAcore analysis we have seen that the scFv has a KA which is similar to that of the ␣TS1 IgG (Erlandsson, unpublished result). Because of no affinity differences, the result in the inhibition ELISA indicate a reduced immunoreactivity of the ␣TS1 scFv but could also be due to sterical hindrance and accessibility differences. Fig. 2 demonstrates the results obtained by the inhibition ELISA. 3.5. In vivo studies In vivo the main clearing of radiolabeled antibody using intact monoclonal IgG take place within 24 h with the fastest clearing the first hours as shown by previous studies (Ull´en et al., 1995; Johansson et al., 2002). As illustrated in Fig. 3
the same clearing kinetics was observed in this study. The radioactivity was reduced 22% more than the control after 56 h using a molar ratio of 1:0.6 of 131 I-TS1:␣TS1. Within 11 h a 40% and 27% reduction were seen in the pre-incubated mixture of 131 I-TS1 IgG/␣TS1 IgG and 131 I-TS1 IgG/␣TS1 scFv, respectively. After 56 h the pre-incubated mixture with 131 I-TS1 and ␣TS1 did end up on the same level as for the post-injected ␣TS1 IgG and the final reduction of radioactivity using the pre-incubated scFv was, compared to the control, approximately 10% higher. Fig. 3 shows the clearing of 131 ITS1 IgG post-injected and pre-incubated with ␣TS1 IgG, respectively, and the clearing of 131 I-TS1 IgG pre-incubated with ␣TS1 scFv. In this study, we wanted to compare the ability of the different ␣TS1 fragment Fab2 , Fab and scFv to clear the circulation from 131 I-TS1 IgG and to see whether intact 131 I-␣TS1 in combination with TS1 Fab2 could clear in a similar way. The ␣Id scFv at molar ratio 1:8 of Id IgG:␣Id scFv showed only a 9% reduction within 11 h after administration and then no further reduction at all, ending at the same level of activity as the control group after 56 h. The ability of TS1 Fab2 and ␣TS1 Fab2 and ␣TS1 Fab to clear the circulation from radiolabeled IgG within 11 h were similar at the different molar ratio used, for ␣TS1 Fab2 20% was reduced, for TS1 Fab2 a 22% reduction and for ␣TS1 Fab the reduction was 15%. Fig. 4 shows the clearing of 131 I-TS1 IgG using ␣TS1 Fab2 , ␣TS1 Fab and ␣TS1 scFv and the clearing of 131 I-␣TS1 IgG using TS1 Fab2 .
604
A. Erlandsson et al. / Molecular Immunology 43 (2006) 599–606
Fig. 4. The clearing of radiolabelled TS1 IgG or ␣TS1 IgG. The five different groups of mice were treated as follows; The group (four mice) indicated by diamonds, received 50 g 131 I-TS1 or 50 g 131 I-␣TS1. The group (two mice) indicated by open triangles, received 50 g 131 I-TS1 and 21 h later 55 g ␣TS1 Fab (molar ratio 1:4.4). The group (four mice) indicated by triangles, received 50 g 131 I-TS1 and 21 h later 48 g ␣TS1 Fab2 (molar ratio 1:1.9). The group (four mice) indicated by crosses, received 50 g 131 I-␣TS1 and 21 h later 41 g TS1 Fab (molar ratio 1:1.6). Bars represent 2 S.E.M. values.
The ␣TS1 IgG, Fab2 and Fab used in this study displayed a clearing capability that was similar 18%, 20% and 15%, respectively within 11 h. The reduction of radioactivity compared to the control after 56 h was 22%, 18% and 12% for IgG, Fab2 and Fab, respectively. Considering the lower molar ratio of the ␣TS1 IgG and the lower immunoreactivity of the ␣TS1 IgG and ␣TS1 Fab2 compared to Fab, the intact IgG is the most efficient followed by the ␣TS1 Fab2 and finally the ␣TS1 Fab fragment. The ␣Id IgG was also able to give additional reduction of radioactivity between 12 and 56 h indicating that the fragment exerts their effect faster than the intact IgG.
4. Discussion In this investigation, the in vivo clearing capability of ␣Id scFv, ␣Id Fab, ␣Id Fab2 and Id Fab2 in combination with radiolabeled Id and ␣Id IgG from the circulation in non-tumor bearing BALB/c mice was investigated. IgG, Fab2 , Fab and scFv differ in size, presence of Fc part, charge and valency, but the present investigation clearly demonstrates that low molecular fragments such as Fab2 and Fab are able in vivo to clear the radiolabeled IgG from the circulation. The ␣Id IgG and the ␣Id Fab2 with the same immunoreactivity and a 3fold molar excess of Fab2 reached the same relative levels in vivo with similar kinetics and were able to cause significant excretion of radioactivity. Both the intact ␣Id and the Fab2 fragment are divalent, a molecular prerequisite for the ability to form large high molecular weight ring complexes. The intact antibodies used in this investigation have been shown
to participate in such complex formations in vitro (Johansson et al., 2002), and can appear in formations with 2, 4, 6 and 8 and more individual antibodies in a 1:1 relation between Id:␣Id. The Fab fragments were also able to cause significant elimination of the complexes, but despite a higher immunoreactivity demonstrated in vitro in the inhibition ELISA and a higher molar concentration, the Fab fragments were not more efficient than the IgG and Fab2 . The lower clearing capacity probably resides mainly in the monovalent status of Fab fragments. They can only saturate the antigen binding sites of the idiotypic antibody, but can never form any large molecular weight complexes, which might hamper the clearance mechanisms. Using an excess of either idiotype or antiidiotype as we used in this study does, however, favour the formation of smaller complexes in accordance to the classical precipitation curve (Gronski and Seiler, 1984). The scFv fragments did not demonstrate any significant clearing efficiency, when injected separately. When the scFv were injected as immune complexes following pre-incubation with the target antigen TS1 IgG, they were causing decreased radioactivity in the animals. ScFv in complex with IgG might not only be protected from fast excretion but also from denaturation and degradation in vivo. The excretion rate of scFv is usually rapid. Studies have demonstrated that as much as 50% of monomeric scFv’s are cleared from the blood within 10 min and that the scFv excretion rate is approximately three times faster than that seen for Fab fragments generated from the same IgG (Colcher et al., 1990, 1999; Milenic et al., 1991; Pavlinkova et al., 1999b). The differences in size, charge and stability between the Fab and scFv fragments might explain these in vivo differences. The Fab is almost twice the size compared to the scFv which probably affects the filtration rate through the kidney (Milenic et al., 1991; Colcher et al., 1998). The differences in pI might also influence the excretion through the kidney. It has been shown that the pI has major impact on the renal excretion, but also that a lowering of the pI causes no effect on renal excretion (Pavlinkova et al., 1999a; Kim et al., 2002). The stability in vivo is probably also different, since it has been shown to be difficult to produce stable scFvs from E. coli (Pluckthun and Pack, 1997), and as indicated in our study, the stability in vitro of the Fab was higher than for the scFv. The inhibition ELISA demonstrated that six times more scFv than Fab was needed to cause equal inhibition of the biotinylated IgG. BIAcore studies do, however, indicate that the affinity of the ␣TS1 scFv construct used is similar to that of the ␣TS1 IgG (Erlandsson et al. unpublished results). Sterical hindrance, accessibility and reduced immunoreactivity may have influenced the results in the inhibition ELISA. Considering ␣Id scFv as clearing agent, the fast excretion and instability of such scFv has to be considered. Increasing the size by generating multimeric scFv constructs, could lead to decreased excretion and higher functional affinity. Introducing negatively charged amino acids in the scFv construct might also improve this ␣Id scFv as this, according to some studies, can improve the solubility (Tan et al., 1998) and slow
A. Erlandsson et al. / Molecular Immunology 43 (2006) 599–606
down the fast excretion (Colcher et al., 1998). Stability problems of an ␣Id scFv might be possible to modulate by site directed mutagenesis of certain residues or by exchanging the frame (Jung and Pluckthun, 1997; Jung et al., 1999; Willuda et al., 1999; Worn and Pluckthun, 1999, 2001). For therapeutic purposes we can conclude that the ␣Id Fab2 and ␣Id Fab fragment can be used to clear the circulation in vivo from 131 I-TS1. However, the advantage of using fragments instead of intact IgG has to be investigated further. Previous studies using intact ␣TS1 for clearing in tumor bearing mice have demonstrated that the radioactivity is reduced also in the tumor. The reduction of radioactivity in the blood, spleen, lung, and kidney was, however, two times higher than in the tumor (Ull´en et al., 1995). Using Fab2 and Fab fragments of an ␣Id antibody in a therapeutic situation might be an advantage. The use of a higher molar concentration of the fragment to give an immediate clearing effect equal to that of the IgG but with a faster excretion might cause less reduction of the Id in the tumor. It is well known that antibody fragments are excreted faster than intact IgG (Milenic et al., 1991; Colcher et al., 1998; Pavlinkova et al., 1999b). Efficient clearing but faster excretion, especially for Fab but also for Fab2 , in comparison to intact IgG was also indicated by our study. However, the KA of the TS1-␣TS1 binding is very high (1010 M−1 ) which might lead to a competition between the TS1, ␣TS1 and CK8 at the tumor site using the antibody fragments Fab2 and Fab of ␣TS1. In this case, the ␣TS1 scFv which can be genetically manipulated to alter the affinity could be of interest. The size and type (linear or circular) of an immune complex probably influence the clearing of that complex and it has been shown by other studies that at low molar ratio between ␣Id/Id the relative uptake in the spleen is higher than at higher molar ratios (Sharkey et al., 1990). If ratios such as 1:2 or 2:1 of Id:␣Id results in different clearing of the complexes, it is indicated that the Id and ␣Id may have different sterical or functional roles in the clearing. In a study performed on three different ␣Id:s directed towards the same Id it was shown in vitro that the ␣Id forming mainly dimers (and some tetramer) (KA 107 ), had almost the same clearing efficiency as the ␣Id that formed large circular complexes (KA 108 ). The third ␣Id that formed linear complexes (KA 109 ) of different sizes cleared twice as efficient as the other two (Sandstrom et al., 1999). In vitro we have shown that large circular complexes between TS1 and ␣TS1 are formed and that the concentration of the ␣TS1 is crucial for an efficient clearing of TS1 (Johansson et al., 2002). In this study the pre-incubated mixture of TS1 and ␣TS1 enabling the formation of complexes in vitro prior to injection resulted in a faster but equal clearing compared to the non pre-incubated mixture, indicating that the formation of complex in vitro might be equal to the formation in vivo. The largest relative uptake of immune complexes takes place in the liver as shown by our previous study and others (Kosugi et al., 1992; Johansson et al., 2002). The reason for this could simply be the high blood flow through the liver
605
and the high level of Fc receptors in the liver that can bind directly to the antibody Fc part. In antibody–antigen interactions, the structure of an antigen changes very little, while the antibody may undergo structural changes (Jefferis et al., 1998; Sagawa et al., 2005) a change that might activate the elimination of the immune complex of antibody–antigen. Immune complexes can be taken up by Fc-receptor mediated endocytosis (Burton and Woof, 1992; Ravetch, 1997; Ravetch and Clynes, 1998) or be bound to CR1 on red blood cells via C3b opsonisation and subsequent delivery of the complexes to CR1 receptors in the liver and spleen (Schifferli et al., 1986; Nardin et al., 1999). When the Id and ␣Id antibodies bind to each other, it is to be expected that conformational changes in the Fc parts of one or both of the antibody molecules take place. When generating an ␣Id MAb, the Id is used as immunogen and one could, therefore, speculate that the Fc part of the ␣Id to be the most important signal for clearance. However, from our study, we can conclude that both the ␣Id Fab2 as well as the Id Fab2 lacking Fc parts, are able to clear the Id and ␣Id IgG, respectively from the circulation, indicating that both the ␣Id and Id are augmenting the Fc-receptor binding.
5. Conclusion Intact antiidiotypic IgG, Fab2 and Fab fragments are able to clear idiotypic antibodies from the circulation, the antiidiotypic scFv constructed for this study does, however, need some genetic manipulations before use in vivo. Experimental data support the conclusion that the Fc parts from both the idiotype and the antiidiotype may contribute to the in vivo elimination of these complexes in vivo.
References Bird, R.E., Hardman, K.D., Jacobson, J.W., Johnson, S., Kaufman, B.M., Lee, S.M., Lee, T., Pope, S.H., Riordan, G.S., Whitlow, M., 1988. Single-chain antigen-binding proteins. Science 242, 423–426. Burton, D.R., Woof, J.M., 1992. Human antibody effector function. Adv. Immunol. 51, 1–84. Christian, R.B., Couto, J.R., Peterson, J.A., Ceriani, R.L., 1996. Cloning and expression of cDNAs encoding the variable domains of the antibreast carcinoma antibody Mc5. Hybridoma 15, 155–158. Colcher, D., Bird, R., Roselli, M., Hardman, K.D., Johnson, S., Pope, S., Dodd, S.W., Pantoliano, M.W., Milenic, D.E., Schlom, J., 1990. In vivo tumor targeting of a recombinant single-chain antigen-binding protein. J. Natl. Cancer Inst. 82, 1191–1197. Colcher, D., Pavlinkova, G., Beresford, G., Booth, B.J., Choudhury, A., Batra, S.K., 1998. Pharmacokinetics and biodistribution of geneticallyengineered antibodies. Q. J. Nucl. Med. 42, 225–241. Colcher, D., Goel, A., Pavlinkova, G., Beresford, G., Booth, B., Batra, S.K., 1999. Effects of genetic engineering on the pharmacokinetics of antibodies. Q. J. Nucl. Med. 43, 132–139. Erlandsson, A., Holm, P., Ullen, A., Stigbrand, T., Sundstrom, B.E., 2003. Studies of the interactions between the anticytokeratin 8 monoclonal antibody TS1, its antigen and its anti-idiotypic antibody alphaTS1. J. Mol. Recognit. 16, 157–163.
606
A. Erlandsson et al. / Molecular Immunology 43 (2006) 599–606
Gronski, P., Seiler, F.R., 1984. Basic relationships in precipitating antigen–antibody systems: a comparison of a simple theory with experiment. Behring. Inst. Mitt., 15–28. Harris, M., 2004. Monoclonal antibodies as therapeutic agents for cancer. Lancet Oncol. 5, 292–302. Huston, J.S., Levinson, D., Mudgett-Hunter, M., Tai, M.S., Novotny, J., Margolies, M.N., Ridge, R.J., Bruccoleri, R.E., Haber, E., Crea, R., et al., 1988. Protein engineering of antibody binding sites: recovery of specific activity in an anti-digoxin single-chain Fv analogue produced in Escherichia coli. Proc. Natl. Acad. Sci. U.S.A. 85, 5879– 5883. Jefferis, R., Lund, J., Pound, J.D., 1998. IgG-Fc mediated effector functions: molecular definition of interaction sites for effector ligands and the role of glycosylaion. Immunol. Rev. 163, 59–76. Johansson, A., Erlandsson, A., Eriksson, D., Ullen, A., Holm, P., Sundstrom, B.E., Roux, K.H., Stigbrand, T., 2002. Idiotypic–antiidiotypic complexes and their in vivo metabolism. Cancer 94, 1306– 1313. Jung, S., Pluckthun, A., 1997. Improving in vivo folding and stability of a single-chain Fv antibody fragment by loop grafting. Protein Eng. 10, 959–966. Jung, S., Honegger, A., Pluckthun, A., 1999. Selection for improved protein stability by phage display. J. Mol. Biol. 294, 163–180. Juweid, M., Sharkey, R.M., Behr, T.M., Swayne, L.C., Dunn, R., Ying, Z., Siegel, J.A., Hansen, H.J., Goldenberg, D.M., 1996. Clinical evaluation of tumor targeting with the anticarcinoembryonic antigen murine monoclonal antibody fragment, MN-14 F(ab)2. Cancer 78, 157– 168. Kim, I., Kobayashi, H., Yoo, T.M., Kim, M.K., Le, N., Han, E.S., Wang, Q.C., Pastan, I., Carrasquillo, J.A., Paik, C.H., 2002. Lowering of pI by acylation improves the renal uptake of 99mTc-labeled antiTac dsFv: effect of different acylating reagents. Nucl. Med. Biol. 29, 795–801. Krebber, A., Bornhauser, S., Burmester, J., Honegger, A., Willuda, J., Bosshard, H.R., Pluckthun, A., 1997. Reliable cloning of functional antibody variable domains from hybridomas and spleen cell repertoires employing a reengineered phage display system. J. Immunol. Methods 201, 35–55. Kuus-Reichel, K., Grauer, L.S., Karavodin, L.M., Knott, C., Krusemeier, M., Kay, N.E., 1994. Will immunogenicity limit the use, efficacy, and future development of therapeutic monoclonal antibodies? Clin. Diagn. Lab. Immunol. 1, 365–372. Kosugi, I., Muro, H., Shirasawa, H., Ito, I., 1992. Endocytosis of soluble IgG immune complex its transport to lysosomes in hepatic sinusoidal endothelial cells. J. Hepatol. 16, 106–114. Milenic, D.E., Esteban, J.M., Colcher, D., 1989. Comparison of methods for the generation of immunoreactive fragments of a monoclonal antibody (B72.3) reactive with human carcinomas. J. Immunol. Methods 120, 71–83. Milenic, D.E., Yokota, T., Filpula, D.R., Finkelman, M.A., Dodd, S.W., Wood, J.F., Whitlow, M., Snoy, P., Schlom, J., 1991. Construction, binding properties, metabolism, and tumor targeting of a single-chain Fv derived from the pancarcinoma monoclonal antibody CC49. Cancer Res. 51, 6363–6371. Milenic, D.E., Brady, E.D., Brechbiel, M.W., 2004. Antibody-targeted radiation cancer therapy. Nat. Rev. Drug. Discov. 3, 488– 499. Nardin, A., Lindorfer, M.A., Taylor, R.P., 1999. How are immune complexes bound to the primate erythrocyte complement receptor transferred to acceptor phagocytic cells? Mol. Immunol. 36, 827–835. Nishikawa, K., Ooi, T., 1986. Radial locations of amino acid residues in a globular protein: correlation with the sequence. J. Biochem. (Tokyo) 100, 1043–1047. Pavlinkova, G., Beresford, G., Booth, B.J., Batra, S.K., Colcher, D., 1999a. Charge-modified single chain antibody constructs of monoclonal antibody CC49: generation, characterization, pharmacokinetics, and biodistribution analysis. Nucl. Med. Biol. 26, 27–34.
Pavlinkova, G., Beresford, G.W., Booth, B.J., Batra, S.K., Colcher, D., 1999b. Pharmacokinetics and biodistribution of engineered singlechain antibody constructs of MAb CC49 in colon carcinoma xenografts. J. Nucl. Med. 40, 1536–1546. Pluckthun, A., Pack, P., 1997. New protein engineering approaches to multivalent bispecific antibody fragments. Immunotechnology 3, 83–105. Ravetch, J.V., 1997. Fc receptors. Curr. Opin. Immunol. 9, 121–125. Ravetch, J.V., Clynes, R.A., 1998. Divergent roles for Fc receptors and complement in vivo. Annu. Rev. Immunol. 16, 421–432. Reff, M.E., Heard, C., 2001. A review of modifications to recombinant antibodies: attempt to increase efficacy in oncology applications. Crit. Rev. Oncol. Hematol. 40, 25–35. Sagawa, T., Oda, M., Morii, H., Takizawa, H., Kozono, H., Azuma, T., 2005. Conformational changes in the antibody constant domains upon hapten-binding. Mol. Immunol. 42, 9–18. Sandstrom, P., Johansson, A., Ullen, A., Rathsman, S., Riklund-Ahlstrom, K., Stigbrand, T., 1999. Idiotypic–anti-idiotypic antibody interactions in experimental radioimmunotargeting. Clin. Cancer Res. 5, 3073s–3078s. Schifferli, J.A., Ng, Y.C., Peters, D.K., 1986. The role of complement and its receptor in the elimination of immune complexes. N. Engl. J. Med. 315, 488–495. Sharkey, R.M., Blumenthal, R.D., Goldenberg, D.M., 1990. Anti-antibody enhancement of tumor imaging. Cancer Treat. Res. 51, 433–455. Sharkey, R.M., Boerman, O.C., Natale, A., Pawlyk, D., Monestier, M., Losman, M.J., Goldenberg, D.M., 1992. Enhanced clearance of radiolabeled murine monoclonal antibody by a syngeneic antiidiotype antibody in tumor-bearing nude mice. Int. J. Cancer 51, 266–273. Sundstrom, B.E., Nathrath, W.B., Stigbrand, T.I., 1989. Diversity in immunoreactivity of tumor-derived cytokeratin monoclonal antibodies. J. Histochem. Cytochem. 37, 1845–1854. Tan, P.H., Chu, V., Stray, J.E., Hamlin, D.K., Pettit, D., Wilbur, D.S., Vessella, R.L., Stayton, P.S., 1998. Engineering the isoelectric point of a renal cell carcinoma targeting antibody greatly enhances scFv solubility. Immunotechnology 4, 107–114. Ull´en, A., Sandstrom, P., Ahlstrom, K.R., Sundstrom, B., Nilsson, B., Arlestig, L., Stigbrand, T., 1995. Use of anticytokeratin monoclonal anti-idiotypic antibodies to improve tumor:nontumor ratio in experimental radioimmunolocalization. Cancer Res. 55, 5868s–5873s. Ull´en, A., Ahlstrom, K.R., Heitala, S., Nilsson, B., Arlestig, L., Stigbrand, T., 1996. Secondary antibodies as tools to improve tumor to non tumor ratio at radioimmunolocalisation and radioimmunotherapy. Acta Oncol. 35, 281–285. Weidenhaupt, M., Khalifa, M.B., Hugo, N., Choulier, L., Altschuh, D., Vernet, T., 2002. Functional mapping of conserved, surface-exposed charges of antibody variable domains. J. Mol. Recognit. 15, 94–103. Willuda, J., Honegger, A., Waibel, R., Schubiger, P.A., Stahel, R., Zangemeister-Wittke, U., Pluckthun, A., 1999. High thermal stability is essential for tumor targeting of antibody fragments: engineering of a humanized anti-epithelial glycoprotein-2 (epithelial cell adhesion molecule) single-chain Fv fragment. Cancer Res. 59, 5758– 5767. Winter, G., Griffiths, A.D., Hawkins, R.E., Hoogenboom, H.R., 1994. Making antibodies by phage display technology. Annu. Rev. Immunol. 12, 433–455. Worn, A., Pluckthun, A., 1999. Different equilibrium stability behavior of ScFv fragments: identification, classification, and improvement by protein engineering. Biochemistry 38, 8739–8750. Worn, A., Pluckthun, A., 2001. Stability engineering of antibody singlechain Fv fragments. J. Mol. Biol. 305, 989–1010. Yang, J., Moyana, T., MacKenzie, S., Xia, Q., Xiang, J., 1998. One hundred seventy-fold increase in excretion of an FV fragment-tumor necrosis factor alpha fusion protein (sFV/TNF-alpha) from Escherichia coli caused by the synergistic effects of glycine and Triton X-100. Appl. Environ. Microbiol. 64, 2869–2874.
In vivo clearing of idiotypic antibodies with antiidiotypic antibodies and their derivatives Ann Erlandsson a,b , David Eriksson a , Lennart Johansson c , Katrine Riklund c , Torgny Stigbrand a , Birgitta Elisabeth Sundstr¨om b,∗ b
a Department of Immunology, Ume˚ a University, S-901 85 Ume˚a, Sweden Division for Chemistry, Karlstad University, Department of Biomedicial Science, Universitetsg 2, S-651 88 Karlstad, Sweden c Department of Radiation Science, Diagnostic Radiology, Ume˚ a University, S-901 85 Ume˚a, Sweden
Received 1 March 2005 Available online 22 June 2005
Abstract At immunolocalization of experimental tumors, idiotypic monoclonal antibodies, such as TS1 against cytokeratin 8, can be used to carry and deposit in vivo terapeutics in the tumor. These carriers also remain in the circulation and may cause negative side-effects in other tissues. In this report, several derivatives of the antiidiotypic antibody ␣TS1 were produced and tested for their clearing capacity of the idiotypic carrier antibody TS1. Intact monoclonal ␣TS1, scFv of a ␣TS1 and ␣TS1 Fab and Fab2 fragments were produced by recombinant technology or by cleavage with Ficin. The scFv was tailored by use of the variable domain genes of the light and heavy chain from the hybridoma clone in combination with a (Gly4 Ser)3 -linker, followed by expression in E. coli. When tested for clearing capacity, the intact divalent antiidiotypic IgG was found to be the most efficient. The divalent Fab2 and the monovalent Fab fragment also demonstrated significant clearing, but lower than the intact antiidiotypic IgG. The ␣TS1 scFv antibody when injected separately was not found to clear the idiotype, but could do so when preincubated with the idiotype. Rapid excretion and in vivo instability of this low molecular weight antibody fragment may be the major reasons. Similar results were obtained when the system was reversed and the 131 I-labeled antiidiotype IgG was cleared with the idiotype Fab2 fragment. It is concluded that both intact antiidiotypic IgG, Fab2 and Fab fragments are able to clear the idiotypic antibodies. The experimental data support the conclusion that the Fc parts from both the idiotype and the antiidiotype may contribute to this elimination. © 2005 Elsevier Ltd. All rights reserved. Keywords: ScFv; Fab2 ; Fab; Idiotypic; Antiidiotypic
1. Introduction Immunotherapy is rapidly accelerating as an approach to selectively reach, identify and eliminate tumors (reviewed in Harris, 2004; reviewed in Milenic et al., 2004). The antibodies can be charged with different compounds (nuclides,
Abbreviations: mAb, monoclonal antibody; Id, idiotype; aId, antiidiotype; VL, variable light chain; VH, variable heavy chain; scFv, single chain fragment variable; CR1, complement receptor 1 ∗ Corresponding author. Tel.: +46 54 700 2472; fax: +46 54 700 1457. E-mail address: [email protected] (B.E. Sundstr¨om). 0161-5890/$ – see front matter © 2005 Elsevier Ltd. All rights reserved. doi:10.1016/j.molimm.2005.04.019
toxins, cytokines or cytotoxic drugs), intended to exert toxic effects on the tumors. Intact monoclonal antibodies (mAbs) of either human or mouse origin, or in the form of chimeric or humanized antibodies, may remain in the circulation and can generate unwanted side reactions. One of the possibilities to improve the efficiency of immunotargeting and immunotherapy is to generate the tools to eliminate these redundant circulating immunoconjugates. Intact antibodies are known, due to their size, to remain in the circulation causing putative damage systemically or in non-targeted organs. For intact IgG the residence time in the tumors is usually long, which favours their use in therapeutic approaches. Antibody fragments, on
600
A. Erlandsson et al. / Molecular Immunology 43 (2006) 599–606
the other hand, which are rapidly cleared, can generate high tumor/non-tumor ratios when used for tumor targeting, but do usually display comparatively short residence times, which make them less suitable for therapeutic targeting of tumors (Reff and Heard, 2001). Antibody fragments such as the scFv, Fab and Fab2 are, however, less immunogenic compared to intact IgG mainly due to their lack of constant-parts and partly to their shorter persistence in the circulation (Kuus-Reichel et al., 1994; Juweid et al., 1996). Antiidiotypic (␣Id) monoclonal antibodies can be used to identify and characterize monoclonal antibodies and even to regulate their concentrations both in vitro and in vivo. When using radiolabelled idiotypic antibodies (Id) in tumor therapy, different methods to clear the Id mAb from the circulation have been presented and one technology is to utilize ␣Id antibodies (Sharkey et al., 1992; Ull´en et al., 1996; Sandstrom et al., 1999). The mAbs used in this study are the Id mAb TS1 specific for cytokeratin 8, present in the epithelium of different tissues and exposed in necrotic regions in solid epithelial tumors and the ␣Id ␣TS1, which binds with high affinity to TS1. An effective clearing of the Id from the circulation by the ␣Id has been demonstrated in vivo, where approximately 60% of the radioactivity was reduced within approximately 50 h after injection of the ␣Id, using a 1:1 ratio of TS1:␣TS1 in non-tumor bearing mice (Ull´en et al., 1995; Johansson et al., 2002). So far no attempts to use fragmented ␣Id antibodies without the Fc part have been performed for clearing purposes. It is of importance to generate Fab and Fab2 fragment with retained immunoreactivity and the available cleavage methods by papain, pepsin and ficin have to be optimized for each antibody (Milenic et al., 1989). ScFv is one of the smallest antigen binding fragments and was originally developed to simplify expression of antigen binding fragments (Bird et al., 1988; Huston et al., 1988). Usually it is easy to produce scFv s with strong and specific binding to their actual targets by direct cloning from specific hybridomas or by selection from phage displayed libraries of scFvs (Winter et al., 1994; Krebber et al., 1997). The production of scFv in E. coli also enables cheap high throughput generation of scFv s. It is of significance to generate a scFv that is stable at in vivo conditions as well as during storage and in analytical applications. It has been shown that high thermal stability as well as resistance to serum proteases are essential properties for a therapeutic scFv. Incubation in high temperature and serum followed by studies of impaired immunochemical properties in ELISA or BIAcore can give important information on the stability (Willuda et al., 1999; Weidenhaupt et al., 2002). It is known that the lack of the Fc-parts, differences in size, charge and valency for scFv, Fab, Fab2 and IgG leads to variation in immunogenicity, excretion, tumor penetration and functional affinity. The aim of this investigation was to study how the clearing of radiolabelled intact Id IgG and ␣Id IgG is affected by use of the different antibody derivatives scFv, Fab, Fab2 and intact IgG of the ␣Id and Fab2 of the Id.
2. Materials and methods 2.1. Hybridoma, monoclonal antibodies Hybridoma cell lines producing the monoclonal antibody TS1 (Sundstrom et al., 1989), reactive with cytokeratin 8, and its antiidiotype (TS1 (Ull´en et al., 1995), were cultured in DMEM:F12 1:1 supplemented with 10% fetal calf serum and 100 IU/ml streptomycin and 100 g/ml penicillin (Gibco BRL). The antibodies were purified from cell culture media using a Protein G column (Amersham Biosciences) and eluted with 0.1 M glycine/HCl buffer pH 2.3. Fractions were neutralised and stored at −20 ◦ C until use. 2.2. Radiolabeling For the in vivo studies the mAbs TS1 and ␣TS1 were radiolabelled with 131 I (Amersham) using the chloramine T method to a specific activity of 30 MBq/mg. Free iodine was removed by passage over a column with Sephadex G 50 (Amersham Biosciences). 2.3. Production of Fab2 and Fab fragments The mAbs TS1 and ␣TS1 were dialysed against 0.1 M citrate buffer pH 6.0 and cleaved with Ficin to produce Fab2 and Fab fragments (according to the manufacturer) (PIERCE). Uncleaved IgG and Fc parts were removed by anion exchange chromatography at pH 8.0 (Hi Trap Q HP, Amersham Biosciences) leaving the Fab2 and Fab fragments in the flow through volume. Fab2 and Fab fragments were then separated by gelfiltration using a Sephacryl-S100 HR column (Amersham Biosciences). The antibody fragments were dialysed against 10mM phosphate buffer pH 7.4 with 0.15 M NaCl and filtered through a 0.22 m filter prior to injection. 2.4. Construction of αTS1 scFv The variable domain genes of the light (VL ) chain GenBank accession nos. AJ884575 and heavy (VH) chain GenBank accession nos. AJ884574 were cloned into the pGEM-T vector (Promega) and sequenced as described before (Erlandsson et al., 2003). The heavy and light chain were then combined with a (Gly4 Ser)3 -linker. Two separate PCR reactions were performed to generate a VH gene with an upstream Sfi cleavage site with primer 5 CTTGGTAGCAACGGCCCAGCCGGCCATGGCCCAGGTGCAACTGCAGCAGCCTGGGGCTGA-3 and a downstream linker sequence with primer 5 -CGATCCGCCACCGCCAGA GCCACCTCCGCCTGAACCGCCTCCACCGGAGACGGTGACCGT-3 . The VL gene was generated with an upstream linker sequence with primer 5 GGTGGAGGCGGTTCAGGCGG AGCTGGCTCTGGCGGTGGCGGATCGGATGTTGTCATGACC-3 and a down-
A. Erlandsson et al. / Molecular Immunology 43 (2006) 599–606
stream Not 1 cleavage site with primer 5 -AACAGAAGGAGCTGCGGCCGCCCGTTTCATTTCCAGC TTGGTCCCCCCTCCGAACGTGTA-3 . These PCR products were then combined by a seven cycle denaturing annealing reaction and amplified with the primer with the upstream Sfi cleavage site and the primer with the downstream Not 1 cleavage site. The final product was cleaved with Sfi and Not 1, ligated into the phagemid vector pCANTAB (Expression module, Amersham Bioscience) and transformed to the E. coli strain HB2151(Amersham Bioscience). The sequence of the construct was confirmed using the pCANTAB S1 and S6 primers (Amersham Bioscience) and the ␣TS1 scFv produced was tested for binding to TS1 with ELISA using an anti-E-tag antibody conjugated to HRP (Amersham Bioscience)(data not shown). The gene was then isolated from pCANTAB by digestion with Nco 1 and Not 1, ligated into the vector pET 26 with his tag and pel B leader (Novagene) and transformed to the E. coli strain Rosetta DE3 (Novagene) and sequenced using T7 promotor and terminator primers (Novagen). 2.5. Expression in Rosetta (DE3) Expression in Rosetta (DE3) was performed by culturing the bacteria in LB medium with kanamycin 30 g /ml and chloramphenicol 75 g/ml. Cultures were incubated for approximately 16 h at 30 ◦ C to an OD600 value between 3–3.5, thereafter glycine, Triton X-100 and IPTG were added to a final concentrations of 2%, 1% and 1mM, respectively and incubated at 20 ◦ C over night (Yang et al., 1998). 2.6. Purification of the αTS1 scFv The bacteria were centrifugated and the supernatant with soluble scFv was collected, concentrated and dialysed against 20 mM Na-phosphate buffer pH 6.5. The dialysed samples were filtered through a 0.45 m filter (acrodisc syringe filter, PALL Gelman Laboratory), affinity purified by Ni-NTA (QIAGEN) according to the manufacturer, desalted on a PD10 column (Amersham Bioscience) and then purified with cation exchange chromatography (Hi Trap Sp HP, Amersham Biosciences) with 20 mM Na-phosphate buffer pH 6.5 and eluted with a continuous NaCl gradient. The scFv used in the in vivo study was dialysed against 10 mM phosphate buffer pH 7.4 with 0.15 M NaCl and filtered through a 0.22 m filter prior to injection.
601
2.8. Temperature and serum stability test The temperature stability test was performed on purified ␣TS1 scFv diluted to 0.5 g/ml in 10 mM Hepes and 150 mM NaCl pH 7.4 and heated for 10 min at 40, 45, 50, 55, 60 and 65 ◦ C. The serum stability test was performed by diluting the purified ␣TS1 scFv to 0.5 g/ml in serum and incubation at 37 ◦ C for 10, 20, 30, 60, 120, 240 min and 16 h. The reactivity of ␣TS1 scFv with TS1 was analyzed by ELISA in several dilutions and the temperature causing a 50% reduction of the binding was determined, as well as the effect of incubation in 37 ◦ C in serum. Fab fragments of ␣TS1 were diluted to 0.7 g/ml in 10 mM Hepes and 150 mM NaCl pH 7.4 and heated for 10 min at 45 ◦ C. The Fab fragments of ␣TS1 were also diluted to 0.7 g/ml in serum and incubated at 37 ◦ C for 16 h. The immunoreactivity of the ␣TS1 Fab fragments was tested in an inhibition ELISA. 2.9. SDS-PAGE for analysis of the purity SDS-PAGE (9% T for the IgG and fragments and 12% T for the scFv) was used for analysis of the purity of the ␣TS1 IgG, ␣TS1 Fab2 , ␣TS1 Fab, ␣TS1 scFv, TS1 IgG and TS1 Fab2 . The SDS-PAGE gel was stained with Coomassie Brilliant Blue R250. 2.10. Spectrofotometric determination of the concentration The extinction coefficients were calculated to 1.82 for IgG and 1.75 for Fab2 , Fab and scFv from the amino acid sequences by the program Protean (DNAstar) using the Del´eage and Roux modification of Nishikawa and Ooi (1986) (Nishikawa and Ooi, 1986). The concentration of the purified ␣TS1 IgG, ␣TS1 Fab2 , ␣TS1 Fab, ␣TS1 scFv, TS1 IgG and TS1 Fab2 was determined by measuring the absorbance at 280 nm. 2.11. Calculation of the pI The pI’s of ␣TS1 Fab and the scFv were calculated by the Protean program (DNAstar) based on the amino acid sequence and pK tables. The amino acid sequence in the V gene of ␣TS1 and the (Gly4 Ser)3 -linker as well as the hexahistidine tag were used to calculate the scFv pI and for the Fab the V genes of ␣TS1 and the CL and CH genes of IgG1 GenBank accession nos. AAB50766 and AAB50767 (Christian et al., 1996) were used.
2.7. Size exclusion chromatography
2.12. Inhibition ELISA
Purified and concentrated ␣TS1 scFv was analyzed on a Superose 6 column in a FPLC system to determine the molecular weight. After calibration of the column, 100 l of scFv ␣TS1 (0.1 mg/ml) was applied to the column and eluted with phosphate buffered saline, pH 7.4 using a flow rate of 0.5 ml/min.
The monoclonal antibody ␣TS1 used for detection in the inhibition ELISA was conjugated to biotin using biotinNHS-carbodiimide (Pierce), as described by the manufacturer. Microtiter plates (Nunc) were coated over night at 4 ◦ C with 100 l/well of TS1 in 0.01 M phosphate buffer, pH 7.2, 0.15 M NaCl at a concentration of 2.5 g/ml. The plates were
602
A. Erlandsson et al. / Molecular Immunology 43 (2006) 599–606
washed three times with TBST (0.1 M Tris, 0.15 M NaCl and 0.05% Tween 20, pH 7.4) and antibody/fragments with the following concentrations; ␣TS1 IgG 10 g/ml (66 nM), ␣TS1 Fab2 10 g/ml (99 nM), ␣TS1 Fab 20 g/ml (198 nM), ␣TS1 scFv 40 g/ml (1320 nM) were combined undiluted and serially diluted 1:3 in six steps with a constant amount of approximately 0.7 g/ml (5 nM) of biotinylated ␣TS1 IgG. After sample incubation another washing step with TBST was performed and the avidin-AP conjugate (Biorad) was added to the wells and incubated at room temperature for 60 min. The plates were developed with 3 mM p-nitrophenyl phosphate in 50 mM 2-amino-2-methyl-1-propanol, 1 mM MgCl2 pH10.0 and the absorbance was read at 405 nm. 2.13. In vivo studies Twenty-six female mice (BALB/c Bomhooltgaard) were used in the study, were 16 mice were injected intraperitoneally with 50 g 131 I labelled TS1, six mice were injected with 50 g 131 I labelled ␣TS1 and four mice were injected with a mixture of 131 I labelled TS1 (50 g) pre-incubated with either ␣TS1 IgG (25 g) or ␣TS1 scFv (55 g). After 21 h, the mice that were given 131 I labelled TS1 were treated as follows; two mice received no antibody/antibody fragment, two mice received 25 g of ␣TS1 IgG (TS1 IgG:␣TS1 IgG, molar ratio 1:0.6), four mice received 48 g ␣TS1 Fab2 (TS1 IgG:␣TS1 Fab2 , molar ratio 1:1.9), four mice received 55 g ␣TS1 Fab (TS1 IgG:␣TS1 Fab, molar ratio 1:4.4) and four mice received 55 g ␣TS1 scFv (TS1 IgG:␣TS1 scFv, molar ratio 1:8). The mice given 131 I labelled ␣TS1 were treated as follows; two mice received no antibody/antibody fragments and four mice received 41 g TS1 Fab2 (␣TS1 IgG:TS1 Fab2 , molar ratio 1:1.6). Two mice received 50 g 131 I labelled TS1 that had been pre-incubated for 1 h with 55 g ␣TS1 scFv (TS1 IgG:␣TS1 scFv, molar ratio 1:6) and two mice received 50 g 131 I labelled TS1 that had been pre-incubated for 1 h with 25 g of ␣TS1 IgG (TS1 IgG:␣TS1 IgG, molar ratio 1:0.5). The total body activity of each mouse was measured using a gamma-camera (General Electric) without collimator coupled to a counter. To avoid anesthesia each mouse was kept in a small cup covered with a Plexiglas plate during measurements. The cup with the mouse was placed at a fixed distance of approximately 30 cm from the counter. The activity (cps) was recorded for 20 s. The mice were measured directly after injection of the radiolabelled antibody, after injection of the clearing antibody and after 11, 23, 33, 45 and 56 h. All calculations were corrected for the initial decay and non-specific elimination in the control.
The expression of the ␣TS1 scFv was performed in Rosetta (DE3), a strain which expresses tRNA with codons that are commonly used in mice but rarely used in E. coli. During culturing, the scFv was transported to the periplasmic space because of the pel B leader in the vector pET 26, and due to the Triton X-100 and glycine the scFv was released to the culture media. Approximately, 1 mg of scFv was obtained from 1 l of culture media. 3.2. Purity, size exclusion chromatography and concentration The scFv was purified by Ni-NTA and cation exchange chromatography and the result from the SDS-PAGE demonstrated a band at approximately 28 KDa with >95% purity. The size exclusion chromatography showed that the purified scFv consisted of only 28 KDa monomers. The solubility of the scFv was low. At concentrations above 0.2 mg/ml the immunoreactivity was completely lost. The IgGs and the cleaved fragments were >95% pure and had approximately the following sizes, TS1 IgG 150 KDa, ␣TS1 IgG 150 KDa, TS1 Fab2 100 KDa, ␣TS1 Fab2 2 bands around 100 KDa and ␣TS1 Fab 50 KDa. The antibody derivatives are presented in Fig. 1. The double band in the ␣TS1 Fab2 represents fragments cleaved at different positions by Ficin. Using -metcaptoethanol in the sample buffer the ␣TS1 Fab2 double bands were converted to a single band of approximately 25 KDa representing single light and partially cleaved heavy chain (data not shown). 3.3. Calculation of the pI, temperature and serum stability of αTS1 scFv and Fab The pI of ␣TS1 Fab was calculated to 7.7 and the pI of the ␣TS1 scFv was calculated to 8.9. The stability of ␣TS1 scFv
3. Results 3.1. Construction of the αTS1 scFv The sequence of the ␣TS1 scFv cloned in pET 26 was confirmed to be correct by sequencing in both directions.
Fig. 1. SDS PAGE gels from separate runs. Lane 1, TS1 Fab2 ; Lane 2, ␣TS1 Fab2 ; Lane 3, ␣TS1 Fab; Lane 4, ␣TS1 scFv.
A. Erlandsson et al. / Molecular Immunology 43 (2006) 599–606
Fig. 2. Inhibition ELISA showing the immunoreactivity of the ␣TS1 IgG and its derivatives used in vivo. The following starting concentrations of the ␣Id and its fragment were used; ␣TS1 IgG 10 g/ml (66 nM), ␣TS1 Fab2 10 g/ml (99 nM), ␣TS1 Fab 20 g/ml (198 nM), ␣TS1 scFv 40 g/ml (1320 nM) were combined undiluted and serially diluted 1:3 in six steps with a constant amount of approximately 0.7 g/ml (5 nM) of biotinylated ␣TS1 IgG.
and Fab was analysed after incubation in different temperatures and in serum at 37 ◦ C. After 10 min incubation at 45 ◦ C, the immunoreactivity of the ␣TS1 scFv was reduced to 50%, whereas the Fab fragment maintained its binding. After 16 h incubation at 37 ◦ C in serum both scFv and Fab retained their binding.
603
Fig. 3. Clearing of 131 I-TS1 IgG using ␣TS1 IgG post-injected or preincubated with TS1 IgG and clearing of 131 I-TS1 IgG using ␣TS1 scFv. The four different groups of mice were treated as follows: The group (four mice) indicated by diamonds, received 50 g 131 I-TS1 or 50 g 131 I-␣TS1. The group (two mice) indicated by squares, received 50 g 131 I-TS1 and 21 h later 25 g ␣TS1 IgG (molar ratio 1:0.6). The group (four mice) indicated by triangles, received 50 g 131 I-TS1 pre-incubated with 55 g ␣TS1 scFv (molar ratio 1:6). The group (one mouse) indicated by crosses, received 50 g 131 I-TS1 pre-incubated with 25 g ␣TS1 IgG (molar ratio 1:0.5). Bars represent S.E.M. values.
3.4. Inhibition ELISA The inhibition ELISA was performed to determine the immunoreactivity of the ␣TS1 IgG and its derivatives. Between 7 and 9 nM of IgG, Fab2 and Fab and 40–45 nM of scFv was needed to give a 50% inhibition of the biotinylated ␣TS1 IgG of approximately 5 nM. These results indicate that the IgG and the Fab2 used in vivo had equivalent immunoreactivity. The inhibition ELISA showed that the Fab maintained immunoreactivity and indicated that the monovalent ␣TS1 Fab at approximately twice the molar concentration was able to compete with the divalent biotinylated ␣TS1 IgG. The result does also show that approximately 6-fold higher molar concentration of the scFv compared to the Fab fragment was needed to give similar inhibition. By BIAcore analysis we have seen that the scFv has a KA which is similar to that of the ␣TS1 IgG (Erlandsson, unpublished result). Because of no affinity differences, the result in the inhibition ELISA indicate a reduced immunoreactivity of the ␣TS1 scFv but could also be due to sterical hindrance and accessibility differences. Fig. 2 demonstrates the results obtained by the inhibition ELISA. 3.5. In vivo studies In vivo the main clearing of radiolabeled antibody using intact monoclonal IgG take place within 24 h with the fastest clearing the first hours as shown by previous studies (Ull´en et al., 1995; Johansson et al., 2002). As illustrated in Fig. 3
the same clearing kinetics was observed in this study. The radioactivity was reduced 22% more than the control after 56 h using a molar ratio of 1:0.6 of 131 I-TS1:␣TS1. Within 11 h a 40% and 27% reduction were seen in the pre-incubated mixture of 131 I-TS1 IgG/␣TS1 IgG and 131 I-TS1 IgG/␣TS1 scFv, respectively. After 56 h the pre-incubated mixture with 131 I-TS1 and ␣TS1 did end up on the same level as for the post-injected ␣TS1 IgG and the final reduction of radioactivity using the pre-incubated scFv was, compared to the control, approximately 10% higher. Fig. 3 shows the clearing of 131 ITS1 IgG post-injected and pre-incubated with ␣TS1 IgG, respectively, and the clearing of 131 I-TS1 IgG pre-incubated with ␣TS1 scFv. In this study, we wanted to compare the ability of the different ␣TS1 fragment Fab2 , Fab and scFv to clear the circulation from 131 I-TS1 IgG and to see whether intact 131 I-␣TS1 in combination with TS1 Fab2 could clear in a similar way. The ␣Id scFv at molar ratio 1:8 of Id IgG:␣Id scFv showed only a 9% reduction within 11 h after administration and then no further reduction at all, ending at the same level of activity as the control group after 56 h. The ability of TS1 Fab2 and ␣TS1 Fab2 and ␣TS1 Fab to clear the circulation from radiolabeled IgG within 11 h were similar at the different molar ratio used, for ␣TS1 Fab2 20% was reduced, for TS1 Fab2 a 22% reduction and for ␣TS1 Fab the reduction was 15%. Fig. 4 shows the clearing of 131 I-TS1 IgG using ␣TS1 Fab2 , ␣TS1 Fab and ␣TS1 scFv and the clearing of 131 I-␣TS1 IgG using TS1 Fab2 .
604
A. Erlandsson et al. / Molecular Immunology 43 (2006) 599–606
Fig. 4. The clearing of radiolabelled TS1 IgG or ␣TS1 IgG. The five different groups of mice were treated as follows; The group (four mice) indicated by diamonds, received 50 g 131 I-TS1 or 50 g 131 I-␣TS1. The group (two mice) indicated by open triangles, received 50 g 131 I-TS1 and 21 h later 55 g ␣TS1 Fab (molar ratio 1:4.4). The group (four mice) indicated by triangles, received 50 g 131 I-TS1 and 21 h later 48 g ␣TS1 Fab2 (molar ratio 1:1.9). The group (four mice) indicated by crosses, received 50 g 131 I-␣TS1 and 21 h later 41 g TS1 Fab (molar ratio 1:1.6). Bars represent 2 S.E.M. values.
The ␣TS1 IgG, Fab2 and Fab used in this study displayed a clearing capability that was similar 18%, 20% and 15%, respectively within 11 h. The reduction of radioactivity compared to the control after 56 h was 22%, 18% and 12% for IgG, Fab2 and Fab, respectively. Considering the lower molar ratio of the ␣TS1 IgG and the lower immunoreactivity of the ␣TS1 IgG and ␣TS1 Fab2 compared to Fab, the intact IgG is the most efficient followed by the ␣TS1 Fab2 and finally the ␣TS1 Fab fragment. The ␣Id IgG was also able to give additional reduction of radioactivity between 12 and 56 h indicating that the fragment exerts their effect faster than the intact IgG.
4. Discussion In this investigation, the in vivo clearing capability of ␣Id scFv, ␣Id Fab, ␣Id Fab2 and Id Fab2 in combination with radiolabeled Id and ␣Id IgG from the circulation in non-tumor bearing BALB/c mice was investigated. IgG, Fab2 , Fab and scFv differ in size, presence of Fc part, charge and valency, but the present investigation clearly demonstrates that low molecular fragments such as Fab2 and Fab are able in vivo to clear the radiolabeled IgG from the circulation. The ␣Id IgG and the ␣Id Fab2 with the same immunoreactivity and a 3fold molar excess of Fab2 reached the same relative levels in vivo with similar kinetics and were able to cause significant excretion of radioactivity. Both the intact ␣Id and the Fab2 fragment are divalent, a molecular prerequisite for the ability to form large high molecular weight ring complexes. The intact antibodies used in this investigation have been shown
to participate in such complex formations in vitro (Johansson et al., 2002), and can appear in formations with 2, 4, 6 and 8 and more individual antibodies in a 1:1 relation between Id:␣Id. The Fab fragments were also able to cause significant elimination of the complexes, but despite a higher immunoreactivity demonstrated in vitro in the inhibition ELISA and a higher molar concentration, the Fab fragments were not more efficient than the IgG and Fab2 . The lower clearing capacity probably resides mainly in the monovalent status of Fab fragments. They can only saturate the antigen binding sites of the idiotypic antibody, but can never form any large molecular weight complexes, which might hamper the clearance mechanisms. Using an excess of either idiotype or antiidiotype as we used in this study does, however, favour the formation of smaller complexes in accordance to the classical precipitation curve (Gronski and Seiler, 1984). The scFv fragments did not demonstrate any significant clearing efficiency, when injected separately. When the scFv were injected as immune complexes following pre-incubation with the target antigen TS1 IgG, they were causing decreased radioactivity in the animals. ScFv in complex with IgG might not only be protected from fast excretion but also from denaturation and degradation in vivo. The excretion rate of scFv is usually rapid. Studies have demonstrated that as much as 50% of monomeric scFv’s are cleared from the blood within 10 min and that the scFv excretion rate is approximately three times faster than that seen for Fab fragments generated from the same IgG (Colcher et al., 1990, 1999; Milenic et al., 1991; Pavlinkova et al., 1999b). The differences in size, charge and stability between the Fab and scFv fragments might explain these in vivo differences. The Fab is almost twice the size compared to the scFv which probably affects the filtration rate through the kidney (Milenic et al., 1991; Colcher et al., 1998). The differences in pI might also influence the excretion through the kidney. It has been shown that the pI has major impact on the renal excretion, but also that a lowering of the pI causes no effect on renal excretion (Pavlinkova et al., 1999a; Kim et al., 2002). The stability in vivo is probably also different, since it has been shown to be difficult to produce stable scFvs from E. coli (Pluckthun and Pack, 1997), and as indicated in our study, the stability in vitro of the Fab was higher than for the scFv. The inhibition ELISA demonstrated that six times more scFv than Fab was needed to cause equal inhibition of the biotinylated IgG. BIAcore studies do, however, indicate that the affinity of the ␣TS1 scFv construct used is similar to that of the ␣TS1 IgG (Erlandsson et al. unpublished results). Sterical hindrance, accessibility and reduced immunoreactivity may have influenced the results in the inhibition ELISA. Considering ␣Id scFv as clearing agent, the fast excretion and instability of such scFv has to be considered. Increasing the size by generating multimeric scFv constructs, could lead to decreased excretion and higher functional affinity. Introducing negatively charged amino acids in the scFv construct might also improve this ␣Id scFv as this, according to some studies, can improve the solubility (Tan et al., 1998) and slow
A. Erlandsson et al. / Molecular Immunology 43 (2006) 599–606
down the fast excretion (Colcher et al., 1998). Stability problems of an ␣Id scFv might be possible to modulate by site directed mutagenesis of certain residues or by exchanging the frame (Jung and Pluckthun, 1997; Jung et al., 1999; Willuda et al., 1999; Worn and Pluckthun, 1999, 2001). For therapeutic purposes we can conclude that the ␣Id Fab2 and ␣Id Fab fragment can be used to clear the circulation in vivo from 131 I-TS1. However, the advantage of using fragments instead of intact IgG has to be investigated further. Previous studies using intact ␣TS1 for clearing in tumor bearing mice have demonstrated that the radioactivity is reduced also in the tumor. The reduction of radioactivity in the blood, spleen, lung, and kidney was, however, two times higher than in the tumor (Ull´en et al., 1995). Using Fab2 and Fab fragments of an ␣Id antibody in a therapeutic situation might be an advantage. The use of a higher molar concentration of the fragment to give an immediate clearing effect equal to that of the IgG but with a faster excretion might cause less reduction of the Id in the tumor. It is well known that antibody fragments are excreted faster than intact IgG (Milenic et al., 1991; Colcher et al., 1998; Pavlinkova et al., 1999b). Efficient clearing but faster excretion, especially for Fab but also for Fab2 , in comparison to intact IgG was also indicated by our study. However, the KA of the TS1-␣TS1 binding is very high (1010 M−1 ) which might lead to a competition between the TS1, ␣TS1 and CK8 at the tumor site using the antibody fragments Fab2 and Fab of ␣TS1. In this case, the ␣TS1 scFv which can be genetically manipulated to alter the affinity could be of interest. The size and type (linear or circular) of an immune complex probably influence the clearing of that complex and it has been shown by other studies that at low molar ratio between ␣Id/Id the relative uptake in the spleen is higher than at higher molar ratios (Sharkey et al., 1990). If ratios such as 1:2 or 2:1 of Id:␣Id results in different clearing of the complexes, it is indicated that the Id and ␣Id may have different sterical or functional roles in the clearing. In a study performed on three different ␣Id:s directed towards the same Id it was shown in vitro that the ␣Id forming mainly dimers (and some tetramer) (KA 107 ), had almost the same clearing efficiency as the ␣Id that formed large circular complexes (KA 108 ). The third ␣Id that formed linear complexes (KA 109 ) of different sizes cleared twice as efficient as the other two (Sandstrom et al., 1999). In vitro we have shown that large circular complexes between TS1 and ␣TS1 are formed and that the concentration of the ␣TS1 is crucial for an efficient clearing of TS1 (Johansson et al., 2002). In this study the pre-incubated mixture of TS1 and ␣TS1 enabling the formation of complexes in vitro prior to injection resulted in a faster but equal clearing compared to the non pre-incubated mixture, indicating that the formation of complex in vitro might be equal to the formation in vivo. The largest relative uptake of immune complexes takes place in the liver as shown by our previous study and others (Kosugi et al., 1992; Johansson et al., 2002). The reason for this could simply be the high blood flow through the liver
605
and the high level of Fc receptors in the liver that can bind directly to the antibody Fc part. In antibody–antigen interactions, the structure of an antigen changes very little, while the antibody may undergo structural changes (Jefferis et al., 1998; Sagawa et al., 2005) a change that might activate the elimination of the immune complex of antibody–antigen. Immune complexes can be taken up by Fc-receptor mediated endocytosis (Burton and Woof, 1992; Ravetch, 1997; Ravetch and Clynes, 1998) or be bound to CR1 on red blood cells via C3b opsonisation and subsequent delivery of the complexes to CR1 receptors in the liver and spleen (Schifferli et al., 1986; Nardin et al., 1999). When the Id and ␣Id antibodies bind to each other, it is to be expected that conformational changes in the Fc parts of one or both of the antibody molecules take place. When generating an ␣Id MAb, the Id is used as immunogen and one could, therefore, speculate that the Fc part of the ␣Id to be the most important signal for clearance. However, from our study, we can conclude that both the ␣Id Fab2 as well as the Id Fab2 lacking Fc parts, are able to clear the Id and ␣Id IgG, respectively from the circulation, indicating that both the ␣Id and Id are augmenting the Fc-receptor binding.
5. Conclusion Intact antiidiotypic IgG, Fab2 and Fab fragments are able to clear idiotypic antibodies from the circulation, the antiidiotypic scFv constructed for this study does, however, need some genetic manipulations before use in vivo. Experimental data support the conclusion that the Fc parts from both the idiotype and the antiidiotype may contribute to the in vivo elimination of these complexes in vivo.
References Bird, R.E., Hardman, K.D., Jacobson, J.W., Johnson, S., Kaufman, B.M., Lee, S.M., Lee, T., Pope, S.H., Riordan, G.S., Whitlow, M., 1988. Single-chain antigen-binding proteins. Science 242, 423–426. Burton, D.R., Woof, J.M., 1992. Human antibody effector function. Adv. Immunol. 51, 1–84. Christian, R.B., Couto, J.R., Peterson, J.A., Ceriani, R.L., 1996. Cloning and expression of cDNAs encoding the variable domains of the antibreast carcinoma antibody Mc5. Hybridoma 15, 155–158. Colcher, D., Bird, R., Roselli, M., Hardman, K.D., Johnson, S., Pope, S., Dodd, S.W., Pantoliano, M.W., Milenic, D.E., Schlom, J., 1990. In vivo tumor targeting of a recombinant single-chain antigen-binding protein. J. Natl. Cancer Inst. 82, 1191–1197. Colcher, D., Pavlinkova, G., Beresford, G., Booth, B.J., Choudhury, A., Batra, S.K., 1998. Pharmacokinetics and biodistribution of geneticallyengineered antibodies. Q. J. Nucl. Med. 42, 225–241. Colcher, D., Goel, A., Pavlinkova, G., Beresford, G., Booth, B., Batra, S.K., 1999. Effects of genetic engineering on the pharmacokinetics of antibodies. Q. J. Nucl. Med. 43, 132–139. Erlandsson, A., Holm, P., Ullen, A., Stigbrand, T., Sundstrom, B.E., 2003. Studies of the interactions between the anticytokeratin 8 monoclonal antibody TS1, its antigen and its anti-idiotypic antibody alphaTS1. J. Mol. Recognit. 16, 157–163.
606
A. Erlandsson et al. / Molecular Immunology 43 (2006) 599–606
Gronski, P., Seiler, F.R., 1984. Basic relationships in precipitating antigen–antibody systems: a comparison of a simple theory with experiment. Behring. Inst. Mitt., 15–28. Harris, M., 2004. Monoclonal antibodies as therapeutic agents for cancer. Lancet Oncol. 5, 292–302. Huston, J.S., Levinson, D., Mudgett-Hunter, M., Tai, M.S., Novotny, J., Margolies, M.N., Ridge, R.J., Bruccoleri, R.E., Haber, E., Crea, R., et al., 1988. Protein engineering of antibody binding sites: recovery of specific activity in an anti-digoxin single-chain Fv analogue produced in Escherichia coli. Proc. Natl. Acad. Sci. U.S.A. 85, 5879– 5883. Jefferis, R., Lund, J., Pound, J.D., 1998. IgG-Fc mediated effector functions: molecular definition of interaction sites for effector ligands and the role of glycosylaion. Immunol. Rev. 163, 59–76. Johansson, A., Erlandsson, A., Eriksson, D., Ullen, A., Holm, P., Sundstrom, B.E., Roux, K.H., Stigbrand, T., 2002. Idiotypic–antiidiotypic complexes and their in vivo metabolism. Cancer 94, 1306– 1313. Jung, S., Pluckthun, A., 1997. Improving in vivo folding and stability of a single-chain Fv antibody fragment by loop grafting. Protein Eng. 10, 959–966. Jung, S., Honegger, A., Pluckthun, A., 1999. Selection for improved protein stability by phage display. J. Mol. Biol. 294, 163–180. Juweid, M., Sharkey, R.M., Behr, T.M., Swayne, L.C., Dunn, R., Ying, Z., Siegel, J.A., Hansen, H.J., Goldenberg, D.M., 1996. Clinical evaluation of tumor targeting with the anticarcinoembryonic antigen murine monoclonal antibody fragment, MN-14 F(ab)2. Cancer 78, 157– 168. Kim, I., Kobayashi, H., Yoo, T.M., Kim, M.K., Le, N., Han, E.S., Wang, Q.C., Pastan, I., Carrasquillo, J.A., Paik, C.H., 2002. Lowering of pI by acylation improves the renal uptake of 99mTc-labeled antiTac dsFv: effect of different acylating reagents. Nucl. Med. Biol. 29, 795–801. Krebber, A., Bornhauser, S., Burmester, J., Honegger, A., Willuda, J., Bosshard, H.R., Pluckthun, A., 1997. Reliable cloning of functional antibody variable domains from hybridomas and spleen cell repertoires employing a reengineered phage display system. J. Immunol. Methods 201, 35–55. Kuus-Reichel, K., Grauer, L.S., Karavodin, L.M., Knott, C., Krusemeier, M., Kay, N.E., 1994. Will immunogenicity limit the use, efficacy, and future development of therapeutic monoclonal antibodies? Clin. Diagn. Lab. Immunol. 1, 365–372. Kosugi, I., Muro, H., Shirasawa, H., Ito, I., 1992. Endocytosis of soluble IgG immune complex its transport to lysosomes in hepatic sinusoidal endothelial cells. J. Hepatol. 16, 106–114. Milenic, D.E., Esteban, J.M., Colcher, D., 1989. Comparison of methods for the generation of immunoreactive fragments of a monoclonal antibody (B72.3) reactive with human carcinomas. J. Immunol. Methods 120, 71–83. Milenic, D.E., Yokota, T., Filpula, D.R., Finkelman, M.A., Dodd, S.W., Wood, J.F., Whitlow, M., Snoy, P., Schlom, J., 1991. Construction, binding properties, metabolism, and tumor targeting of a single-chain Fv derived from the pancarcinoma monoclonal antibody CC49. Cancer Res. 51, 6363–6371. Milenic, D.E., Brady, E.D., Brechbiel, M.W., 2004. Antibody-targeted radiation cancer therapy. Nat. Rev. Drug. Discov. 3, 488– 499. Nardin, A., Lindorfer, M.A., Taylor, R.P., 1999. How are immune complexes bound to the primate erythrocyte complement receptor transferred to acceptor phagocytic cells? Mol. Immunol. 36, 827–835. Nishikawa, K., Ooi, T., 1986. Radial locations of amino acid residues in a globular protein: correlation with the sequence. J. Biochem. (Tokyo) 100, 1043–1047. Pavlinkova, G., Beresford, G., Booth, B.J., Batra, S.K., Colcher, D., 1999a. Charge-modified single chain antibody constructs of monoclonal antibody CC49: generation, characterization, pharmacokinetics, and biodistribution analysis. Nucl. Med. Biol. 26, 27–34.
Pavlinkova, G., Beresford, G.W., Booth, B.J., Batra, S.K., Colcher, D., 1999b. Pharmacokinetics and biodistribution of engineered singlechain antibody constructs of MAb CC49 in colon carcinoma xenografts. J. Nucl. Med. 40, 1536–1546. Pluckthun, A., Pack, P., 1997. New protein engineering approaches to multivalent bispecific antibody fragments. Immunotechnology 3, 83–105. Ravetch, J.V., 1997. Fc receptors. Curr. Opin. Immunol. 9, 121–125. Ravetch, J.V., Clynes, R.A., 1998. Divergent roles for Fc receptors and complement in vivo. Annu. Rev. Immunol. 16, 421–432. Reff, M.E., Heard, C., 2001. A review of modifications to recombinant antibodies: attempt to increase efficacy in oncology applications. Crit. Rev. Oncol. Hematol. 40, 25–35. Sagawa, T., Oda, M., Morii, H., Takizawa, H., Kozono, H., Azuma, T., 2005. Conformational changes in the antibody constant domains upon hapten-binding. Mol. Immunol. 42, 9–18. Sandstrom, P., Johansson, A., Ullen, A., Rathsman, S., Riklund-Ahlstrom, K., Stigbrand, T., 1999. Idiotypic–anti-idiotypic antibody interactions in experimental radioimmunotargeting. Clin. Cancer Res. 5, 3073s–3078s. Schifferli, J.A., Ng, Y.C., Peters, D.K., 1986. The role of complement and its receptor in the elimination of immune complexes. N. Engl. J. Med. 315, 488–495. Sharkey, R.M., Blumenthal, R.D., Goldenberg, D.M., 1990. Anti-antibody enhancement of tumor imaging. Cancer Treat. Res. 51, 433–455. Sharkey, R.M., Boerman, O.C., Natale, A., Pawlyk, D., Monestier, M., Losman, M.J., Goldenberg, D.M., 1992. Enhanced clearance of radiolabeled murine monoclonal antibody by a syngeneic antiidiotype antibody in tumor-bearing nude mice. Int. J. Cancer 51, 266–273. Sundstrom, B.E., Nathrath, W.B., Stigbrand, T.I., 1989. Diversity in immunoreactivity of tumor-derived cytokeratin monoclonal antibodies. J. Histochem. Cytochem. 37, 1845–1854. Tan, P.H., Chu, V., Stray, J.E., Hamlin, D.K., Pettit, D., Wilbur, D.S., Vessella, R.L., Stayton, P.S., 1998. Engineering the isoelectric point of a renal cell carcinoma targeting antibody greatly enhances scFv solubility. Immunotechnology 4, 107–114. Ull´en, A., Sandstrom, P., Ahlstrom, K.R., Sundstrom, B., Nilsson, B., Arlestig, L., Stigbrand, T., 1995. Use of anticytokeratin monoclonal anti-idiotypic antibodies to improve tumor:nontumor ratio in experimental radioimmunolocalization. Cancer Res. 55, 5868s–5873s. Ull´en, A., Ahlstrom, K.R., Heitala, S., Nilsson, B., Arlestig, L., Stigbrand, T., 1996. Secondary antibodies as tools to improve tumor to non tumor ratio at radioimmunolocalisation and radioimmunotherapy. Acta Oncol. 35, 281–285. Weidenhaupt, M., Khalifa, M.B., Hugo, N., Choulier, L., Altschuh, D., Vernet, T., 2002. Functional mapping of conserved, surface-exposed charges of antibody variable domains. J. Mol. Recognit. 15, 94–103. Willuda, J., Honegger, A., Waibel, R., Schubiger, P.A., Stahel, R., Zangemeister-Wittke, U., Pluckthun, A., 1999. High thermal stability is essential for tumor targeting of antibody fragments: engineering of a humanized anti-epithelial glycoprotein-2 (epithelial cell adhesion molecule) single-chain Fv fragment. Cancer Res. 59, 5758– 5767. Winter, G., Griffiths, A.D., Hawkins, R.E., Hoogenboom, H.R., 1994. Making antibodies by phage display technology. Annu. Rev. Immunol. 12, 433–455. Worn, A., Pluckthun, A., 1999. Different equilibrium stability behavior of ScFv fragments: identification, classification, and improvement by protein engineering. Biochemistry 38, 8739–8750. Worn, A., Pluckthun, A., 2001. Stability engineering of antibody singlechain Fv fragments. J. Mol. Biol. 305, 989–1010. Yang, J., Moyana, T., MacKenzie, S., Xia, Q., Xiang, J., 1998. One hundred seventy-fold increase in excretion of an FV fragment-tumor necrosis factor alpha fusion protein (sFV/TNF-alpha) from Escherichia coli caused by the synergistic effects of glycine and Triton X-100. Appl. Environ. Microbiol. 64, 2869–2874.