IncP-9 replication initiator protein binds to multiple DNA sequences in oriV and recruits host DnaA protein

Plasmid 56 (2006) 187–201 www.elsevier.com/locate/yplas

IncP-9 replication initiator protein binds to multiple DNA sequences in oriV and recruits host DnaA protein Renata Krasowiak a,1, Yanina Sevastsyanovich a, Igor Konieczny b, Lewis E.H. Bingle a, Christopher M. Thomas a,¤ a

b

School of Biosciences, University of Birmingham, Edgbaston, Birmingham B15 2TT, UK Department of Molecular and Cellular Biology, Faculty of Biotechnology, University of Gdansk, Kladki 24, 80-822 Gdansk, Poland Received 20 January 2006, revised 12 May 2006 Available online 7 July 2006 Communicated by Manuel Espinosa

Abstract The minimal replicon from IncP-9 plasmid pM3, consisting of oriV and rep, is able to replicate in Pseudomonas putida but not in Escherichia coli, unless production of Rep protein is increased. The Rep protein, at 20 kDa, is the smallest replication protein so far identiWed for a theta replicating plasmid. Rep was puriWed and shown to bind in three blocks across the oriV region that do not correlate with a single unique binding sequence. The block closest to rep is not necessary for oriV function. Rep forms at least two types of complex—one rendering the DNA entirely resistant to cleavage, the other occupying one side of the helix. No short segment of oriV showed the same aYnity for Rep as the whole of oriV. The oriV region did not bind puriWed DnaA from E. coli, P. putida or P. aeruginosa but when Rep was present also, super-shifts were found with DnaA in a sequence-speciWc manner. Scrambling of the primary candidate DnaA box did not inactivate oriV but did increase the level of Rep required to activate oriV. The general pattern of Rep-DNA recognition sequences in oriV indicates that the IncP-9 system falls outside of the paradigms of model plasmids that have been well-studied to date. © 2006 Elsevier Inc. All rights reserved. Keywords: Antibiotic resistance; Biodegradation; DNA replication; Plasmid evolution; Pseudomonas plasmids

1. Introduction The fundamental property of a bacterial plasmid is its ability to replicate autonomously and it is this property that allows plasmids to facilitate the spread of genes from one bacterium to another without the *

Corresponding author. Fax: +44 121 414 5925. E-mail address: [email protected] (C.M. Thomas). 1 Present address: Department of Biology, Infection and Immunity Unit, University of York, Heslington, York YO10 5DD, UK. 0147-619X/$ - see front matter © 2006 Elsevier Inc. All rights reserved. doi:10.1016/j.plasmid.2006.05.006

need for recombination in the recipient. All that the plasmid normally provides is a means of initiating replication at a speciWc origin or origins on the plasmid and controlling the frequency with which this occurs (Espinosa et al., 2000). The interaction with host enzymes that can carry out the majority of the replication cycle is thus critical to the success of the plasmid and since these host enzymes vary from one bacterial species to another, some plasmids are more adapted to one species than others (del Solar et al., 1996). Thus a plasmid will have a deWned set of

188

R. Krasowiak et al. / Plasmid 56 (2006) 187–201

Ramos-Gonzalez et al., 1991; Titok et al., 1991). Complete DNA sequences are available for pWW0 (Greated et al., 2002) and pDTG1 (Dennis and Zylstra, 2004) and for a mini-replicon from pM3 (Greated et al., 2000). These sequences reveal a clustered set of replication and maintenance modules (par, mrs, and rep) typical of low copy number plasmids (Thomas, 2000). We recently showed that the minimal replicon, consisting of the replication origin (oriV) and gene (rep) for the replication activator protein from IncP-9 plasmid pM3 (Fig. 1) is capable of replication in Pseudomonas putida, its natural host, but not in E. coli (Sevastsyanovich et al., 2005). Mutations in the rep promoter that increase rep expression overcome this defect, showing that Rep could activate oriV and recruit host replication functions so long as the Rep protein levels are high enough. The ability to extend host range if Rep expression is increased has also been reported recently for E. coli IncX plasmid R6K (Wild et al., 2004). In most plasmid replicons, including those replicating by a theta-type mechanism, the initiator role is played by a plasmid-encoded Rep protein, of size varying from 24 to 40 kDa (del Solar et al., 1998). The IncP-9 Rep protein is the smallest Rep protein (184 aa, 20 kDa) described to date and shows similarity to the Rep of pBBR1 from Bordetella bronchiseptica (Antoine and Locht, 1992), pAM10.6 from

hosts in which it is able to replicate eYciently and inherited most stably and this set of hosts is known as its host range. Strategies to achieve a broad host range vary (del Solar et al., 1996). One strategy is to have a simple system that interacts Xexibly with the host replication machinery, as in the case of Pseudomonas IncP-1 (IncP in Escherichia coli) plasmids (Jiang et al., 2003; Zhong et al., 2003) or rolling circle replication plasmids (Espinosa et al., 1995). An alternative strategy is to have a more complex system such as IncP-4 (IncQ in E. coli) plasmids which make the plasmid less dependent on their host (Rawlings and Tietze, 2001). On this basis one might expect that what limits the host range of a plasmid would be the interaction with the host replication machinery, as has been shown to be the case for the Pseudomonas syringae plasmid pPS10 (Maestro et al., 2003) and E. coli plasmid F (Zhong et al., 2005). However, few examples of how narrow host range plasmids interact with heterologous hosts have been studied in detail and so it is not clear how far one can generalise from what is currently known. The IncP-9 plasmids are interesting because they include the best-studied plasmid used in bioremediation, pWW0 or TOL (Assinder and Williams, 1990; Williams and Murray, 1974). Where host range has been studied these plasmids are unstable and temperature-sensitive outside of Pseudomonas species (Benson and Shapiro, 1978; Korfhagen et al., 1978; A

mpf C

B

A

parA

parB korA tolA

res

oriV rep

orf1

tsp

B

res

1.6

3.3 1.4 1.3 1.5 2.2 R1.6 R1.5

PstI

C

DnaA2

3.2 2.1

3.1

rep

1.2 1.1

R1.3 R2.2

R1.2

A+T

NdeI DnaA1

ori1 ori2 ori3 ori4 ori5 ori6 ori7 ori8 ori9 ori10 3692

3497 3467

3405

3373 3349 3346

3265 3253

3219 3168

pMT2 co-ordinate (bp)

Fig. 1. (A) Map of the key orfs of the mini-replicon pMT2 (Greated et al., 2000) derived from IncP-9 plasmid pM3, showing the location of the origin of vegetative replication, oriV, whose features are summarised in the expanded diagram. (B) The oriV region, showing the approximate position of the three families of repeats. (C) Summary of the set of fragments used to analyse protein binding in this study. Three families of repeats (arrows), putative DnaA boxes (vertical rectangles), methylation sites (ellipses), and transcription start point (tsp) are indicated.

R. Krasowiak et al. / Plasmid 56 (2006) 187–201

Pseudomonas Xuorescens (Peters et al., 2001), pJK21 from Gluconacetobacter europaeus (Accession No. CAA11421), and pBMYdx—from Bacillus mycoides (Di Franco et al., 2000). The IncP-9 oriV region contains sequence features common for plasmids that replicate by a theta-type mechanism, independently of DNA Pol I (del Solar et al., 1998). These include repeated sequences (iterons) which may bind Rep, potential binding sites for the DnaA initiator protein (DnaA boxes), and an AT-rich segment adjacent to iterons which might be melted by the action of Rep and DnaA (Fig. 1). However, in IncP-9 oriV none of these sequence features can be assigned an unambiguous role, since there is more than one sequence repeat family that may bind Rep and the match of the putative DnaA boxes is poor. Intriguingly the pattern of repeats and possible DnaA boxes suggest that the oriV region may have at least partly have arisen as a result of a sequence duplication. To initiate dissection of the oriV region we have therefore puriWed Rep and analysed binding of Rep and DnaA proteins to oriV. We have also carried out limited genetic analysis to deWne sequences needed for oriV function. The results suggest distinct properties for Rep that justify further detailed analysis. 2. Results 2.1. PuriWcation of the Rep protein The rep orf was ampliWed by PCR, cloned into expression vector pET28a (Novagen) and overexpressed in E. coli BL21 with (0.1 mM) IPTG as inducer. The His-tagged Rep protein was puriWed by Ni2+-agarose aYnity chromatography with elution by an imidazole concentration gradient. Rep eluted at 250–300 mM imidazole. A clear band was observed corresponding to a polypeptide of relative molecular mass about 22 kDa as expected for the 19.8 kDa Rep enlarged by the histidine aYnity tag and 25-amino acid linker. The protein solution at 2.0 mg/ml was dialysed and checked by mass spectrometry, giving the 22.4 kDa value expected. The ability of Rep protein to form multimers was examined by chemical cross-linking using glutaraldehyde. Incubation with 0.005% and higher concentrations of the cross-linking agent resulted in the appearance of an additional band of approximately 45 kDa corresponding to the size of putative Rep dimers. Appearance of these forms was not aVected by varying the Rep protein concentration, indicating that

189

the cross-linking is not the result of non-speciWc association at high protein concentration. To provide independent evidence of Rep dimerization, sedimentation equilibrium in an analytical ultracentrifuge was used (Laue and StaVord, 1999). The data did not Wt a single, ideal species model but showed classic signs of polydispersity in the residuals to the Wt. Models of associating systems were then tried where the base molecular weight is Wxed and the association constant for a deWned interaction is allowed to vary. This approach was successful when the model used was reversible association between a dimer and tetramer of the Rep molecule, with no monomer present. The dissociation constant between dimer and tetramer was of the order of 1 M. Therefore under the experimental concentration ranges where binding has been studied around the Km value, Rep is likely to exist mainly as a dimer, although it may be a tetramer at the highest concentrations used. 2.2. Binding of Rep to oriV fragments Many repeated sequence motifs are present throughout the putative oriV region (Fig. 1). The most striking is a series of what initially appear to be direct repeats (iterons) that occur six times (1.1–1.6) but in fact are part of an incomplete set of inverted repeats with the sequence TGAGNTA being the core of the unit. The inverted repeat sequences have been designated by the preWx R (for Reverse) and the number used corresponds to the closest Forward repeat. Thus we have R1.6 and R1.5, which with 1.6 and 1.5 constitute the longest and most perfect repeats, as well R1.3 and R1.2. There is no obvious R1.4. These reverse repeats could have been numbered from the other end with R1.2 actually being R1.1, but then that would have created a problem for what we now call R1.3, since that would have been designated R1.2 even though it is much more linked to 1.3 than to 1.2. Nevertheless, the spacing between the repeats is such that it is not clear which inverted repeats might form real pairs (for example, 1.6/R1.6, 5⬘ ATGAGCTAn4TAGCTCAT 3⬘ or R1.6/1.5, 5⬘ TAGCTCATn5ATGAGCTA 3⬘). There is also TGAGAGATA repeated twice within 30 bp (repeats 2.1 and 2.2) and their related sequence R2.2 and GATATC repeated three times within 120 bp (repeats 3.1, 3.2, and 3.3). Because of the variety and number of repeats scattered over a relatively long stretch of the oriV region a number of overlapping fragments (Fig. 1) were ampliWed, radioactively

R. Krasowiak et al. / Plasmid 56 (2006) 187–201

ori1

ori3

ori2

3168-3405 (237 bp)

ori4 3168-3497 (329 bp)

0.00 15.0 5.0 1.5 0.15 0.05 0.015 0.00 15.0 5.0 1.5 0.15 0.05 0.015

[Rep] μM

0.00 15.0 5.0 1.5 0.15 0.05 0.015 0.00 15.0 5.0 1.5 0.15 0.05 0.015

3506-3692 (186 bp) 3253-3405 3405-3506 (101 bp) (152 bp)

ori5 3253-3497 (244 bp) 0.015 0.05 0.15 1.5 5.0 15.0 0.00

190

Fig. 2. Retardation of segments of oriV by increasing concentrations of Rep. The fragments with indicated coordinates are shown in Fig. 1 (ori1–ori5). Double-stranded DNA fragments were 32P 5⬘-end labelled and then incubated with the diVerent concentrations of Rep shown before being analysed by EMSA as described in Section 4. Black triangles indicate increasing amounts of Rep protein.

labelled and tested for their ability to bind Rep as indicated by electrophoretic mobility shift assay (EMSA; Fig. 2). Test experiments were done to determine the eVect of removing the His-tag from the Rep protein. Similar results were obtained for Rep and His6-Rep (data not shown) and so the majority of the data was generated without removing the His6-tag. Fragment 1 (coordinates 3692–3405; Fig. 1) was digested with PstI that cuts at 3506 to conWrm that no Rep-DNA interaction occurs within a region that lacks any of these repeats. As expected, Rep shifted only the shorter, iteron-containing part, except at the highest Rep concentration used when non-speciWc binding was observed (Fig. 2, ori1). Surprisingly, even the lowest concentration of Rep shifted the labelled fragment to a very slowly moving complex. This segment contains 1.6, part of 1.5 and the inverted copy between them (R1.6). By contrast all remaining fragments were initially retarded to distinct species that only at higher concentrations where shifted to a more slowly moving and apparently heterogeneous complex (Fig. 2, ori2–5). Overall, the concentration required to shift 50% of the unbound fragment was approximately 15 nM. For all fragments approximately 150 nM Rep was suYcient to shift all DNA to very slowly moving species. The number of retarded species obtained with Rep at lower concentrations, suggests the presence of multiple distinct, at least partly non-cooperating binding sites. The increased strength of some of the intermediate bands, particularly the one that should have two Rep molecules bound, suggests that there may be interactions that favour this intermediate complex over lower or higher complexes. The particular

strength of this band appears to coincide with the presence of the region containing binding sites 3.1 and 3.2. The patterns of protein–DNA complexes are similar for those tested fragments that contain the sequences between co-ordinates 3168 and 3405. The bands seem to be more distinct for the fragments containing the sequence downstream of co-ordinate 3253 (fragments 3 and 4) where two additional direct repeats are located. The same fragments are also shifted to more than two positions, appearing as Wve species with Rep in the 15–150 nM range. To further explore Rep binding some of the possible targets for Rep were incorporated into oligonucleotides (Supplementary Data, Table 1), inserted into pGEM-T, and then ampliWed as the centre of a larger fragment. For repeats of type 1 and 2 which are associated with an inverted partial copy both the direct and the inverted sequence were incorporated. Fig. 3 shows that the same concentration of Rep protein caused a similar shift of the repeats of type 1 (1.2 and 1.3) and 2 (2.2); 3.1 gave the highest aYnity, while binding to repeat 3.2 was slightly less eYcient. When repeat 3.1 was extended to include both 3.1 and 3.2 (to give segment 3.1.2), the mobility of the retarded species did not change, but the stability appeared to increase—that is, the retarded band appeared to be sharper, suggesting less tendency for Rep to dissociate. Surprisingly, none of these candidate-binding sites showed as high aYnity for Rep as the fragments with longer segments from oriV, even ori1 after cutting with PstI that contains only 1.6, 1.5, and R1.6 between them. Alternating inverted copies of a sequence can be paired in two ways, so the important ori1 repeats might either be 1.6 and its

R. Krasowiak et al. / Plasmid 56 (2006) 187–201

300 500

150

0

2.2 500

300

150

0

1.3 500

300

150

0

1.2 500

300

150

0

500

3.1 300

150

50

0

3.2 500

300

150

50

0

3.1.2

191

nM [Rep]

Fig. 3. Retardation of DNA fragments carrying the selected candidate binding sites for Rep. The 32P 5⬘-end labelled double-stranded DNA fragments were incubated with increasing Rep concentrations (black triangles) and analysed by EMSA as described in Section 4. Uninformative tracks were deleted and the orientation of some gels were reversed to make the data easier to follow and occupy less space.

downstream inverted sequence (R1.6) or 1.5 and its upstream inverted sequence. To distinguish between these two possible inverted repeat versions of the iterons we constructed a fragment with 1.5 and its upstream sequence and compared it in retardation experiments with 1.3/R1.3 (data not shown). The R1.6/1.5 fragment showed higher aYnity. This suggests that the preferred target conWguration may be 5⬘ CCTAGCTCATTATCCATGAGCTAGG 3⬘ rather than 5⬘ ATGAGTTACCCCCTAGCTCAT 3⬘ where the conserved pentanucleotide is in bold and underlined. 2.3. Rep facilitates binding of DnaA to oriV Two putative DnaA boxes were identiWed upstream of rep (Fig. 1): Box 1—TATCTCACA (position 3329–3337) and Box 2—TTATCCA (position 3417–3423). DnaA proteins from E. coli, P. putida, and P. aeruginosa were puriWed as described elsewhere (Caspi et al., 2000). They were tested for binding to radioactively labelled fragments containing one or both of these sequences—fragment ori8 that included both sites and ori9 with the second box (data for these two fragments are not shown) as well as ori10 with the Wrst one (Fig. 4C). None of the DnaA proteins tested caused a gel mobility shift of the analysed fragments (illustrated with data for the Pseudomonas DnaA proteins; Fig. 4A). DNA binding activity of the DnaA proteins was conWrmed with radioactively labelled oriV of RK2 (Fig. 4B) that has functional boxes for all three DnaA proteins (Caspi et al., 2000). The oriVpM3 fragments labelled for these experiments were also subject to EMSAs with a range of Rep concentrations which

conWrmed that there was nothing abnormal about them (data not shown). Therefore, the interaction between putative pMT2 DnaA boxes and DnaA proteins was studied again but in presence of Rep at 15 nM where partial retardation was seen. Fig. 4C shows that the combined action of Rep and DnaA resulted in super-shifts in comparison to that caused by Rep alone. This eVect was observed only with the segment carrying DnaA Box1—fragments ori8 or ori10—but not with fragment ori9 carrying Box2. DnaA proteins from P. putida and P. aeruginosa generally exhibited higher aYnity for the Rep-oriV complexes than E.coli DnaA. At higher concentrations the Pseudomonas proteins produced stronger band-shifts in comparison to the same amount of E. coli DnaA. In contrast, lower concentration of E.coli DnaA was more eYcient in causing super-shifts than the same concentration of DnaA from Pseudomonas. Despite these diVerences the retardation pattern of the same analyzed fragment appeared to be similar for all DnaA proteins. 2.4. Dnase I footprinting of Rep on oriV To deWne more precisely the location of Rep binding sites, DNase I footprinting on pMT2 oriV was carried out. The putative oriV region on fragment ori4 (Fig. 1) carrying all the putative iterons that were suspected to bind Rep was 32P-labelled by PCR ampliWcation with 32P rep1 reversed primer (Supplementary Data, Table 1). Radioactive fragment was incubated with increasing concentrations of Rep prior to digestion with DNase I and run on a sequencing gel (Fig. 5). No clear footprint was seen even at 500 nM Rep, even though complexes are

R. Krasowiak et al. / Plasmid 56 (2006) 187–201

0

0.06

0.6

1.2

0.06

[DnaA] μM

0.06

2.4

1.2

0.6

0.06

2.4

1.2

0.6

0.06

0

E. coli

0.6

P. aerug.

P. aeruginosa

0.6

0

2.4

P. putida

1.2

P. putida

0.06

0.6

1.2

2.4

0.06

P. aeruginosa

oriVRK2

2.4

C

0.6

1.2

[DnaA] μM

2.4

P. putida

B

2.4

oriVpM3

A

1.2

192

[Rep] 15 nM

+

+

+

+

+

+

+

+

+

+

+

+

+

-

DnaA-Rep-ori Rep-ori

ori10 Fig. 4. DnaA binds to pM3 only when Rep is present. (A) DnaA from the Pseudomonas species indicated did not bind to pM3 ori10 DNA fragment. (B) The same DnaA proteins did retard oriV DNA fragment from broad host range plasmid RK2. (C) Retardation of pM3 ori10 DNA fragment by increasing concentration of DnaA from the three species indicated in the presence of 15 nM Rep. Essentially identical results were obtained for ori8, but no supershift was seen for ori9. Black triangles indicate changing of amount of the proteins.

clearly visible in gel mobility shift experiments (Fig. 2). This may be due to Rep binding to many diVerent sites so that for no site is the majority of the DNA protected. Alternatively DNase I may displace separated Rep molecules or the lifetime of the separated Rep-DNA complexes may be short so that DNase I can attack the DNA when the Rep dissociates. At 500 nM the Wrst signs of Rep binding are the appearance of an enhancement in the middle of region II and a nearby protection (Fig. 5A). At 1.5 M extensive regions of protection appeared, separated by distinct regions of no protection. The regions of protection were designated I, II, and III. Regions I and II showed protection interspersed with one or a few bands with no protection or

enhancements, characteristic of proteins that bind to one side of the DNA and bend the DNA around themselves (Fig. 5B and C). Interestingly, it can be seen in Fig. 5B that the nature of the protection and enhancements changes quite dramatically even once a footprint is clearly visible, indicating changes in the conformation of the complex. Region III is striking in not having any regions of sensitivity (Fig. 5A), suggesting that Rep makes it completely insensitive to DNase I from any side. Careful assignment of protected and sensitive sites (Fig. 6) in regions 1 and 2, suggested that Rep was binding to the sequence 5⬘ TAGCTCAT nnnnnATGAGCTA 3⬘ and its relatives, because the region between the two half sites in this orientation

R. Krasowiak et al. / Plasmid 56 (2006) 187–201

T

A G

G A T C

C [Rep] μM

ori5: 3497*-3253 C T A G

0.00 1.5 5.0

C

ori7: 3253*-3692 0.00 15 5.0 1.5 0.5

[Rep] μM

B

ori4: 3168*-3497 15 5.0 1.5 0.5 0.15 0.00

A

193

[Rep] μM

3420

3280 3340

3400

I 3320 II

3380

3300 3320

3300

II

3340

3360

3280 3360 3340

3260 3380 3320

II

3240

I 3400

III

3220

3300

3420 pMT2

pMT2

co-ordinates

co-ordinates

Fig. 5. DNase I footprinting of Rep bound to radioactively labelled fragments of oriV. The fragments used are shown in Fig. 1 and their deWning coordinates are indicated. The * indicates the end at which they are radioactively labelled. Details of the DNase I partial digestion, sequencing and gel electrophoresis are given in Section 4. The DNA coordinates beside each gel are estimated from the sequencing ladders run on each gel. The windows of protection are indicated by brackets and internal enhancements are highlighted with arrow heads.

was poorly accessible, whereas the region between half sites in the alternative orientation, 5⬘ ATGAGCTAnnnTAGCTCAT 3⬘ was highly accessible. This is consistent with the deductions from the band-shift experiments reported above. In addition, it appears that repeat 1.6 is not fully protected, which would Wt with binding to repeat 1.5 and its adjacent inverted copy R1.6 being the key interaction. 2.5. Mutagenesis of oriV To better deWne what is required for oriV function deletion derivatives were created removing DNA up to the PstI site at coordinate 3506. This inactivated oriV function indicating that regions outside the area covered by the Rep footprints are required for function. Not surprisingly an internal deletion from PstI at 3506 to NdeI at 3346 also inactivated oriV. At the rep end of oriV we found that both a 20 bp and a 44 bp deletion from the MfeI site at 3214, removing either just repeat 3.1 or both repeat 3.1 and 3.2 retained oriV function although

the 20 bp deletion resulted in a requirement for a higher level of Rep protein than the full size or shorter oriV (Table 1). Finally mutagenesis of the putative DnaA box I did not abolish oriV function but did result in an increased Rep requirement (Table 1). 3. Discussion The Wrst aim of this study was to determine the sites at which Rep binds in oriV and thus if possible to identify which of the repeat sequences it recognises speciWcally. However, the combination of EMSA and DNase I footprinting showed that Rep binds three segments, designated I (60 bp), II (90 bp), and III (40 bp), separated by only a few bp across the whole region, from 3220 to 3423, and is not conWned to a region or regions deWned by the presence of a single type of sequence repeat (Figs. 1 and 6). This is not due to a complete lack of sequence speciWcity because Rep clearly did not bind to DNA from a control region lacking any of the three repeat families (Fig. 2). This implies that Rep has sequence

194

R. Krasowiak et al. / Plasmid 56 (2006) 187–201

Fig. 6. Summary of footprinting data on the oriV sequence. The grey lines above and below each line of sequence indicate the regions protected on upper and lower strands. Transcription start point and deduced promoter location are as from Sevastsyanovich et al. (2005). Table 1 Transformation of plasmid with pM3 oriV-rep or just oriV and derivatives into P. putida KT2440 in the absence and presence of Rep provided in trans at low and high levels Plasmid

Characteristic

Transformation frequency of P. putida KT2440, transformants per 1 g DNA a Rep (pYRS32b)

No Rep

IPTG pACT1 pYRS1.1 pYRS7.1 pYRS8.1 pYRS7.2 pYRS8.2 pYRS7.3 pYRS8.3 pYRS7.4 pYRS8.4 pYRS7.5 pYRS8.5

oriV-rep oriV 3.1oriV-rep 3.1oriV 3.1.2 oriV-rep 3.1.2 oriV DnaA box mut oriV-rep DnaA box mut oriV Hind–Pst oriV-rep Hind–Pst oriV Pst–Nde oriV-rep Pst–Nde oriV

4

1.1 £ 10 0 1.1 £ 104 0 9.5 £ 103 0 3.8 £ 104 0 0 0 0 0

+0.1 mM IPTG 3

6.2 £ 10 6.1 £ 103 2.5 £ 104 0 1.2 £ 104 1.0 £ 104 2.6 £ 104 0 0 0 0 0

1.3 £ 104 1.2 £ 104 3.3 £ 104 4.6 £ 103 1.9 £ 104 1.7 £ 104 3.5 £ 104 4.6 £ 103 0 0 0 0

a

All transformation eYciencies are means from at least two independent experiments. pYRS4 is an IncQ vector with rep under the control of the tac promoter and carrying the lacIQ gene so that expression can be regulated by IPTG. b

speciWcity but may be able to recognise more than one sequence. This would be consistent with a number of our observations. First, the DNase I footprints of the complexes formed with diVerent

binding regions are not identical (Fig. 5). Thus region III is completely protected by Rep in contrast to the periodic sensitivity and enhancement seen in regions I and II. Rep may be binding to one side of

R. Krasowiak et al. / Plasmid 56 (2006) 187–201

the DNA and bending the DNA around itself in regions I and II, but perhaps clamping the DNA between DNA recognition domains in region III as recently suggested for two ParB proteins (Khare et al., 2004; Leonard et al., 2004). Second, regions II and III form a series of discrete retarded species at lower Rep concentrations (Fig. 2), implying the presence of one or more Rep protein molecules bound weakly and distributed evenly so that no single site is highly occupied. By contrast region I, when present alone, caused a shift straight from unbound to very slowly moving complex implying that the binding of the Wrst Rep molecule stabilises the binding of other Rep molecules in a cooperative cascade. Although regions I and II may be merged into a single region, they do contain distinct sequence motifs. Region I has repeats 1.3 to 1.6 alternating with inverted copies while region II has only 1.1, 1.2, and R1.2 along with repeats 2.1, 2.2, R2.2, and 3.3. Region III has only repeats 3.1 and 3.2 and since these can be deleted without loss of oriV activity this suggests that region I/II must be the complexes critical for origin activation. Interestingly, despite Rep being bound at low concentrations (as indicated by EMSA) no footprints were obvious (Fig. 5A). This implies either that the complexes observed in EMSA are not stable enough in solution to prevent DNase I attack, or that the complexes are broadly distributed across many binding sites so that no single site is suYciently occupied to give a noticeable degree of protection. Thus, despite the implication from studies on single candidate sites cloned separately that repeat 3.1 in its normal context has the highest aYnity (Fig. 3), it seems that there is no strict hierarchy for the order in which the sites are occupied as Rep concentration increases. The ability of such a small Rep protein to recognise diVerent sequences is worthy of further investigation. If indeed Rep does form diVerent types of complex at diVerent sites then it may do so either by using diVerent conformations of the same oligomeric form or may employ diVerent oligomeric forms. Our data indicate that the Rep preparation used here is a dimer in solution, in equilibrium with tetramers at higher concentration. It is well established that for many Rep proteins diVerent forms (normally monomer versus dimer) are needed for ori activation and autoregulation (del Solar et al., 1998; Kruger et al., 2004). The same or similar binding motifs present in the iterons and in the rep promoter are often involved in initiation of replication and

195

negative control of the process via autoregulation. For example, replication initiator proteins of FIA, R6K, pSC101, and pPS10 are in monomer-to-dimer equilibrium: RepA dimers bind at or near the repA promoter and repress repA transcription whereas monomers bind to iterons located in the origin and constitute nucleoprotein complexes that initiate replication (Ishiai et al., 1994; Filutowicz et al., 1986, 1994; Kunnimalaiyaan et al., 2004; Ingmer et al., 1995; de Viedma et al., 1995). If this were the case for IncP-9, Rep activation might involve conversion between those two structural states and in other systems chaperone proteins are required to facilitate monomer formation (Diaz-Lopez et al., 2003; Giraldo and Fernandez-Tresguerres, 2004; Sharma et al., 2004). Nevertheless oligomeric forms of plasmid replication initiation protein have also been documented. RepA of pKL1 behaves as a dynamic equilibrium of monomers and oligomers with a predominance of hexamers, which exhibit diVerent aYnities for two separated RepA-DNA binding sites (Burian et al., 2003; Burian et al., 1999). On the other hand in the case of plasmids such as P1, Rts1, and HI1B, the rep operator(s)/promoter(s) sites are buried in the sequence of direct repeats (Abeles et al., 1984; Chahdi et al., 1997; Gammie and Crosa, 1991). Apart from competing with monomers for binding to ori, Rep dimers are thought to block replication by linking plasmid daughter molecules together in so-called handcuYng complex (Chattoraj, 2000; Kittell and Helinski, 1991; McEachern et al., 1989; Pal and Chattoraj, 1988). Further work is necessary to establish the equivalent properties of IncP-9 Rep. Nevertheless, it is clear from these data that IncP-9 Rep does bind to the previously mapped rep promoter region (Sevastsyanovich et al., 2005) consistent with its ability to autoregulate rep gene expression as previously established (Greated et al., 2000; Sevastsyanovich et al., 2005). In searching oriV for typical features two sequences with weak similarity to DnaA consensus binding sequences were observed. However, none of the three DnaA proteins used were able to interact with pM3 dnaA site on their own, presumably due to its weak resemblance to the sequence TTATA/ CCAA/CA established by Fuller et al. (1984) or TT(A/T)TNCACA proposed by Schaper and Messer (1995). However, we did observe co-operative binding of Rep and DnaA proteins from E. coli, P. putida, and P. aeruginosa to pM3 origin of replication within the region containing the better of the two putative dnaA boxes. The fact that a supershift

196

R. Krasowiak et al. / Plasmid 56 (2006) 187–201

was seen only with Rep and the oriV DNA that contains the putative DnaA box I suggests that DnaA may contact oriV DNA directly rather than simply being recruited by Rep, unless the recruitment relies on the architecture of the oriV-Rep complex. Thus Rep may lead DnaA into an initiation complex to activate oriV. DnaA boxes are typical for iteron-regulated plasmids (del Solar et al., 1998; Helinski et al., 1996; Kruger et al., 2004; Kues and Stahl, 1989), which display a varying degree of dependence on the activity of this host-encoded protein. The likely role of DnaA in their replication is to contribute to the separation of the plasmid DNA strands (Betteridge et al., 2004; Konieczny et al., 1997). In addition, it may direct the recruitment of other host proteins such as DnaBC to the pre-priming complex (Datta et al., 1999; Marszalek and Kaguni, 1994). According to a model for the initiation of RK2 replication, DnaA protein binds to the DnaA boxes upstream of the iterons and Wrst enhances the formation of the open complex by replication protein TrfA. In the second step DnaA leads the DnaB–DnaC complex to the plasmid replication origin (Konieczny and Helinski, 1997). Although not universal, a notable exception being plasmid R1 (Masai and Arai, 1987), generally in most systems studied DnaA has been shown to bind alone, although subsequent interaction with the plasmid-encoded Rep proteins may be needed to activate the origin (Lu et al., 1998; Sharma et al., 2001). In the P. syringae plasmid pPS10, there is indirect evidence that Rep-DnaA interactions may be needed to activate the origin and that these are the basis for host range constraints (Maestro et al., 2003; Maestro et al., 2002), but no direct evidence for such an obligatory role in allowing the DnaA protein to bind has been shown. Thus in pM3 Rep may recruit DnaA by speciWc protein–protein interactions that presumably could form the basis for a factor that limits the hosts in which the plasmid can replicate. Ability to recruit DnaA proteins from diverse species to the replication machinery may deWne a range of potential bacterial hosts for pMT2 and hence, can have important environmental implications. However, it does not appear that oriV functions as if it is a duplication since DnaA box 2 is not associated with DnaA binding. Overall it appears that the IncP-9 replicon does not Wt directly with any of the well-studied plasmid paradigms. Few Rep proteins of theta replication plasmids have been analysed structurally (Giraldo et al., 2003; Komori et al., 1999). IncP-9 Rep not

only appears to represent a new class of initiator proteins, but is one of the smallest theta Rep proteins known (del Solar et al., 1998). Therefore further studies may fruitfully help to reveal the mechanism of origin activation. It would also be worth exploring the role of Rep-RNAP-DnaA proteins network in replication of pM3 and in relation to ecological distribution of this and related plasmids. Most critically though, the biochemical studies described here provide the basis for experiments to determine how the IncP-9 ParB protein, through its binding to cis-acting sites, allows activation of the replicon in E. coli (Sevastsyanovich et al., 2005). It is possible that it activates the rep promoter, but it could also either help Rep to bind or inXuence oriV conformation so that less Rep is needed. PuriWcation of ParB and creation of suitable model replicons with the ParB binding site close enough to allow easy in vitro analysis of the biochemical events occurring will allow these models to be tested. 4. Materials and methods 4.1. Bacterial strains and growth conditions Escherichia coli K12 strains used were: BL21 (F¡ompT hsdSB (rB¡ mB¡) dcm gal (DE3) (from Promega); DH5 (F80 dlacZM15 recA1 endA1 gyrA96 thi-1 hsdR17 (rK¡ mK+) supE44 relA1 deoR (lacZYA-argF) U169 (Gibco BRL); NEM 259 (supE supF hsdR met trpR) (W. Brammar, University of Leicester); TG1 ((lac-pro) supE hsd5 [F⬘: ‘traD36 thi proAB lacIq lacZM15] (from Amersham Ltd.). The E. coli C strain used was: C2110 polA1 his rha P2S (from D.R. Helinski, University of California, San Diego). The P. putida strain used was: KT2440 (hsdR1 hsdM+) (Franklin et al., 1981); KT2442 (KT2440 RifR). Bacteria were grown at 37 °C or 30 °C (when harbouring pMT2) in Luria–Bertani broth (LB), on Lagar (Kahn et al., 1979) or in minimal M9 medium (Gerhardt et al., 1994). Selective media contained the following antibiotics and components: chloramphenicol (for CmR; 25 l/ ml); kanamycin sulphate (for KmR; 50 g/ml); Penicillin G, sodium salt (for PnR; 300 g/ml in agar,120 g/ml in liquid medium); streptomycin sulphate (for SmR; 30 g/ml); tetracycline hydrochloride (for TcR; 25 g/ml); Xgal (5bromo-4-chloro-3-indolyl--D-galactoside) (0.02 % w/v); IPTG (isopropyl--D-thiogalactopyranoside) (1 mM; and 0.1 mM in the replication test). 4.2. Plasmids Plasmids used and constructed in this work are listed in Table 2. pMT2 was used as a template for ampliWcation of rep and oriV regions. The primers used in PCR

R. Krasowiak et al. / Plasmid 56 (2006) 187–201

197

Table 2 Plasmids used or constructed in this study Plasmid pACT1 pET-28a pGEM-T Easy pGE1.2 pGE1.3 pGE1.5 pGE2.1 pGE2.2 pGE3.1 pGE3.2 pGE3.12 pMT2 pYRS1.1 pYRS7.1 pYRS7.2 pYRS7.3 pYRS7.4 pYRS7.5 pYRS8.1 pYRS8.2 pYRS8.3 pYRS8.4 pYRS8.5 pYRS32

Description R

Source

R

Cm , Km , pACYC184 with pMT2 oriV-rep cloned as a HindIII–SalI segment KmR, lacI, His-Tag, T7-Tag, multiple cloning sites ApR, lacZ, MCS, cloning vector ApR, pGEM-T with synthetic oligonucleotide carrying repeat 1.2 cloned between EcoRI and PstI ApR, pGEM-T with synthetic oligonucleotide carrying repeat 1.3 cloned between EcoRI and PstI ApR, pGEM-T with synthetic oligonucleotide carrying repeat 1.5 cloned between EcoRI and PstI ApR, pGEM-T with synthetic oligonucleotide carrying repeat 2.1 cloned between EcoRI and PstI ApR, pGEM-T with synthetic oligonucleotide carrying repeat 2.2 cloned between EcoRI and PstI ApR, pGEM-T with synthetic oligonucleotide carrying repeat 3.1 cloned between EcoRI and PstI ApR, pGEM-T with synthetic oligonucleotide carrying repeat 3.2 cloned between EcoRI and PstI ApR, pGEM-T with synthetic oligonucleotide carrying repeats 3.1 to 3.2 cloned between EcoRI and PstI KmR, Mob+ CmR, KmR, pACT1 with BamHI deletion in pMT2 rep CmR, KmR, pACT1 with deletion of repeat 3.1 CmR, KmR, pACT1 with deletion of repeats 3.1 and 3.2 CmR, KmR, pACT1 with scrambled DnaA box CmR, KmR, pACT1 with deletion of HindIII–PstI segment in oriV CmR, KmR, pACT1 with deletion of PstI–NdeI segment in oriV CmR, KmR, pYRS7.1 with BamHI deletion in rep gene CmR, KmR, pYRS7.2 with BamHI deletion in rep gene CmR, KmR, pYRS7.3 with BamHI deletion in rep gene CmR, KmR, pYRS7.4 with BamHI deletion in rep gene CmR, KmR, pYRS7.5 with BamHI deletion in rep gene TcR, ptac-pMT2 rep in pJH10

Sevastsyanovich et al. (2005) Novagen Promega This study This study This study This study This study This study This study This study Greated et al. (2000) Sevastsyanovich et al. (2005) This study This study This study This study This study This study This study This study This study This study Sevastsyanovich et al. (2005)

to construct the various plasmids are listed in Supplementary data Table 1. All constructed plasmids were checked by DNA sequencing. Plasmids pYRS1.31 and pYRS1.312 were constructed from pACT1 by replacement of 132 bp NdeI–MfeI fragment in oriV with 112 and 88 bp fragments, respectively, generated by PCR using primer pairs 1F-MfeI and R-NdeI or 2FMfeI and R-NdeI (Supplementary Data, Table 1). Deletion between unrelated restriction sites were achieved by ligating the ends with speciWcally designed oligonucleotides (Table 2, and Supplementary Data Table 1).

ethanol precipitation as well as the Geneclean kit (Bio 101) for DNA from gel slices or the High Pure PCR Product PuriWcation kit (Boehringen Mannheim) for DNA fragments in solution after PCR. The ‘pGEM-T Easy Vector system I’ from Promega was utilised for cloning PCR products under conditions recommended by the manufacturer.

4.3. Plasmid DNA isolation and manipulations

4.5. Polymerase chain reaction

Plasmid DNA was isolated and manipulated by standard procedures (Sambrook et al., 1989). For DNA sequencing the Wizard® plus SV mini-prep puriWcation system (Promega) was used as described in the protocol provided by the manufacturer. Enzymes were from MBI Fermentas, Boehringer Mannheim, and New England Biolabs. DNA fragments were puriWed using standard

PCR Primers used in this study are listed in Table 1 of the supplementary data. They were synthesised by Alta Bioscience, University of Birmingham. PCR reactions (Mullis et al., 1986) were performed on puriWed pMT2 or pGEM-T DNA using Expand™ High Fidelity PCR System (Rosche Diagnostics GmbH) using standard conditions (Sambrook et al., 1989).

4.4. Transformation of P. putida KT2440 This was done as previously described (Sevastsyanovich et al., 2005).

198

R. Krasowiak et al. / Plasmid 56 (2006) 187–201

4.6. DNA sequencing Automated DNA Sequencing was carried out on fragments in pGEM-T (Promega). Sequencing reactions were carried out with universal and custom primers using the ABI PRISM BigDye™ Terminator Cycle Sequencing Ready Reaction Kit (Perkin-Elmer Applied Biosystems). Sequence generated was analysed computationally using programs of the University of Wisconsin Genetics Computer Group (UWGCG), Madison, USA (Devereux et al., 1984). To provide control sequencing reactions for primer footprinting gels, DNA templates were sequenced by the chain termination reaction method (Sanger et al., 1977) using T7 Sequenase version 2.0 sequencing kit (Amersham) with modiWcations as described (Hsiao, 1991). 4.7. Radioactive labelling of oligonucleotides and PCR products The 5⬘ends were labelled using T4 polynucleotide kinase (New England Biolabs) and [-32P] ATP (ICN Biomedicals) as recommended by the manufacturers and incubated at 37 °C for 1 h and then at 70 °C for 10 min. The kinase was then inactivated by 10 min incubation at 80 °C. Unincorporated nucleotides were removed using the High Pure puriWcation kit (Boehringen Mannheim). 4.8. PuriWcation of Rep The PCR generated rep open reading frame was cloned between EcoRI and SalI sites of the expression vector pET28a. N-terminal His6-tagged Rep was over-produced in E. coli BL21 grown with shaking at 37 °C in 1 L of LB to OD600 D 0.4 prior to induction with 0.1 mM isopropyl-thiogalactoside (IPTG). After 3 h, bacteria were harvested at 4 °C and resuspended in 8 ml of sonication buVer (50 mM sodium phosphate, pH 8.0, 300 mM NaCl) with lysozyme (Wnal concentration 1 mg/ml). After 30 min on ice the suspension was sonicated at 4 °C in 10 s bursts for 2 min. Cell debris were separated by centrifugation for 30 min at 4 °C at 15,000 rpm and supernatant was puriWed as recommended for soluble native proteins by QIAGEN (protocol 5) on Ni2+-agarose columns using an imidazole gradient (50 mM steps) in phosphate buVer pH 6.0. Protein puriWcation was monitored by standard SDS–PAGE (Sambrook et al., 1989). The His-tag was cleaved using Thrombin Cleavage Capture kit (Novagen) according to the supplied protocol, then dialysed against phosphate buVer (50 mM sodium phosphate, 300 mM NaCl, and 10% glycerol, pH 8.0) and concentrated by centrifugation through a Centricon YM-10 Wlter (MWCO 10 000) (Millipore). 4.9. Cross-linking of polypeptide chains with glutaraldehyde Rep was incubated with diVerent concentrations of glutaraldehyde as previously described (Jagura-Burdzy

and Thomas, 1995). Samples were analysed with 12.5% homogenous SDS–PAGE gels. 4.10. Sedimentation equilibrium experiments The oligomeric state of Rep molecules in solution (50 mM sodium phosphate, pH 6.0, 300 mM NaCl, and 10% glycerol) was examined by sedimentation equilibrium on Beckmann Optima XL-A analytical ultracentrifuge in the NCMH Business Centre (http://www.nottingham.ac.uk/ncmh/business). Standard double-sector cells with 12 mm optical path-length, carbon-Wlled epon centrepieces were used for the experiments and these were loaded into an An60-Ti analytical rotor. The protein sample was analyzed as undiluted and at two dilutions, 1:2 and 1:8. The density of the solvent and the partial speciWc volume of the protein were each calculated from composition using the program Sednterp (Laue et al., 1992). 70 l of sample and 75 l of solvent were loaded. The rotor was accelerated to 3000 rpm and initial concentrations measured at 280 nm. The undiluted sample had too high absorbance at 280 nm so this solution was subsequently scanned at 295 nm at which the Beer–Lambert law was obeyed. The speed was then raised to 13,000 rpm and scans of concentration distribution taken at intervals of 2– 4 h until sedimentation equilibrium had been achieved. Finally, the rotor was accelerated to 45,000 rpm to clear the meniscus region of the solutions of solute and enable recording of a baseline absorbance value. Data were analyzed using the non-linear least squares Wtting routine WinNonlin (v1.060, for Windows 95). Global Wts were made of data from all cells. A correction factor was calculated to account for the diVerence in wavelength used for undiluted sample. 4.11. Electrophoretic mobility shift assays (EMSAs) DNA fragments for EMSA were ampliWed from pMT2 or from respective pGEM-T derivatives and labelled as described above. To create the latter plasmids, pairs of complementary oligonucleotides (1000 pM/l) corresponding to potential Rep binding sites (Table 1 of supplementary data) were annealed, cloned between EcoRI and PstI restriction sites on pGEM-T and subsequently ampliWed with PGMOLI-F and PGMOLI-R primers. All fragments were thus of similar length (approximately 240 bp), facilitating comparison of their electrophoretic mobility in presence of Rep. Radioactively labelled fragments (approximately 5 fmol) were incubated with diVerent concentrations separately and in pairs. Binding reactions with speciWc proteins were performed in 20 l Wnal volume of 50 mM Tris–HCl, pH 8.0, 10 mM MgCl2, 50 mM NaCl, 0.2 mg bovine serum albumin (BSA), and 100 g/ml or 1 mg/ml of salmon sperm DNA at 37 °C for 20 min. Samples were analyzed in 5% native polyacrylamide gels in TBE buVer (Sambrook et al., 1989) at 4 °C.

R. Krasowiak et al. / Plasmid 56 (2006) 187–201

The gels were Wxed and imaged with a Bio-Rad Molecular Imager FX. Bands were quantiWed by Quantity One software (Bio-Rad Laboratories Ltd.). 4.12. DNase I footprinting Footprinting analysis was performed on fragments of putative oriV that were radioactively labelled by PCR ampliWcation with 5⬘-end-labelled primers (see above). DNA binding reactions were set up as described for EMSAs above. After 25 min at 37 °C DNase I partial digests were performed as previously described (JaguraBurdzy and Thomas, 1992).

Acknowledgments R.K. and Y.S. were supported by Scholarships from the Darwin Trust of Edinburgh. This work was partly carried out in the context of EU Concerted action MECBAD. The work was also funded in part by INTAS projects 99-01487 and 2001-2383, and by project Grants 056000 and 07526 from The Wellcome Trust. Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at doi:10.1016/ j.plasmid.2006.05.006. References Abeles, A.L., Snyder, K.M., Chattoraj, D.K., 1984. P1 plasmid replication—replicon structure. J. Mol. Biol. 173, 307–324. Antoine, R., Locht, C., 1992. Isolation and molecular characterisation of a novel broad-host-range plasmid from Bordetella bronchisceptica with sequence similarity to plasmids from Gram-positive organisms. Mol. Microbiol. 6, 1785–1799. Assinder, S.J., Williams, P.A., 1990. The Tol plasmids—determinants of the catabolism of toluene and the xylenes. Adv. Microb. Physiol. 31, 1–69. Benson, S., Shapiro, J., 1978. TOL is a broad-host-range plasmid. J. Bacteriol. 135, 278–280. Betteridge, T., Yang, J., Pittard, A.J., Praszkier, J., 2004. Role of RepA and DnaA proteins in the opening of the origin of DNA replication of an IncB plasmid. J. Bacteriol. 186, 3785– 3793. Burian, J., Ausio, J., Phipps, B., Moore, S., Dougan, D., Kay, W., 2003. Hexamerization of RepA from the Escherichia coli plasmid pKL1. Biochemistry 42, 10282–10287. Burian, J., Stuchlik, S., Kay, W.W., 1999. Replication control of a small cryptic plasmid of Escherichia coli. J. Mol. Biol. 294, 49–65. Caspi, R., Helinski, D.R., Pacek, M., Konieczny, I., 2000. Interactions of DnaA proteins from distantly related bacteria with the replication origin of the broad host range plasmid RK2. J. Biol. Chem. 275, 18454–18461.

199

Chahdi, A.O., Gabant, P., Couturier, M., 1997. Molecular analysis of RepHI1B, a replicon speciWc to IncHI1 plasmids. Mol. Gen. Genet. 255, 477–486. Chattoraj, D.K., 2000. Control of plasmid DNA replication by iterons: no longer paradoxical. Mol. Microbiol. 37, 467–476. Datta, H.J., Khatri, G.S., Bastia, D., 1999. Mechanism of recruitment of DnaB helicase to the replication origin of the plasmid pSC101. Proc. Natl. Acad. Sci. USA 96, 73–78. de Viedma, D.G., Serrano-Lopez, A., Diaz-Orejas, R., 1995. SpeciWc binding of the replication protein of plasmid pPS10 to direct and inverted repeats is mediated by an HTH motif. Nucl. Acids Res. 23, 5048–5054. del Solar, G., Alonso, J.C., Espinosa, M., Diaz-Orejas, R., 1996. Broad-host-range plasmid replication: an open question. Mol. Microbiol. 21, 661–666. del Solar, G., Giraldo, R., Ruiz-Echevarria, M.J., Espinosa, M., Diaz-Orejas, R., 1998. Replication and control of circular bacterial plasmids. Microbiol. Mol. Biol. Rev. 62, 434–464. Dennis, J.J., Zylstra, G.J., 2004. Complete sequence and genetic organization of pDTG1, the 83 kilobase naphthalene degradation plasmid from Pseudomonas putida strain NCIB 9816-4. J. Mol. Biol. 341, 753–768. Devereux, J., Haeberli, P., Smithies, O., 1984. A comprehensive set of sequence-analysis programs for the VAX. Nucleic Acids Res. 12, 387–395. DiFranco, C., Pisaneschi, G., Beccari, E., 2000. Molecular analysis of two rolling-circle replicating cryptic plasmids, pBMYdx and pBMY1, from the soil Gram-positive Bacillus mycoides. Plasmid 44, 280–284. Diaz-Lopez, T., Lages-Gonzalo, M., Serrano-Lopez, A., Alfonso, C., Rivas, G., Diaz-Orejas, R., Giraldo, R., 2003. Structural changes in RepA, a plasmid replication initiator, upon binding to origin DNA. J. Biol. Chem. 278, 18606–18616. Espinosa, M., Cohen, S., Couturier, M., del Solar, G., Diaz-Orejas, R., Giraldo, R., Janniere, L., Miller, C., Osborn, M., Thomas, C.M., 2000. Plasmid replication and copy number control. In: Thomas, C.M. (Ed.), The Horizontal Gene Pool: Bacterial Plasmids and Gene Spread. Harwood Academic Press, Amsterdam, pp. 1–47. Espinosa, M., del Solar, G., Rojo, F., Alonso, J.C., 1995. Plasmid rolling circle replication and its control. FEMS Microbiol. Lett. 130, 111–120. Filutowicz, M., Uhlenhopp, E., Helinski, D.R., 1986. Binding of puriWed wild-type and mutant-Pi initiation proteins to a replication origin region of plasmid R6K. J. Mol. Biol. 187, 225–239. Filutowicz, M., York, D., Levchenko, I., 1994. Cooperative binding of initiator protein to replication origin conferred by single amino-acid substitution. Nucl. Acids Res. 22, 4211–4215. Franklin, F.C.H., Bagdasarian, M., Bagdasarian, M.M., Timmis, K., 1981. Molecular and functional analysis of the TOL plasmid pWW0 from Pseudomonas putida and cloning of genes for the entire regulated aromatic ring meta cleavage. Proc. Natl. Acad. Sci. USA 78, 7458–7462. Fuller, R.S., Funnell, B.E., Kornberg, A., 1984. The DnaA protein complex with the Escherichia coli chromosomal replication origin (oriC) and other DNA sites. Cell 38, 889–900. Gammie, A.E., Crosa, J.H., 1991. Cooperative autoregulation of a replication protein gene. Mol. Microbiol. 5, 3015–3023. Gerhardt, P., Murray, R.G.E., Wood, W.A., Krieg, N.R., 1994. Methods for general and molecular bacteriology. American Society for Microbiology, Washington DC.

200

R. Krasowiak et al. / Plasmid 56 (2006) 187–201

Giraldo, R., Fernandez-Tornero, C., Evans, P.R., Diaz-Orejas, R., Romero, A., 2003. A conformational switch between transcriptional repression and replication initiation in the RepA dimerization domain. Nat. Struct. Biol. 10, 565–571. Giraldo, R., Fernandez-Tresguerres, M.E., 2004. Twenty years of the pPS10 replicon: insights on the molecular mechanism for the activation of DNA replication in iteron-containing bacterial plasmids. Plasmid 52, 69–83. Greated, A., Lambertsen, L., Williams, P.A., Thomas, C.M., 2002. The complete nucleotide sequence of TOL plasmid pWW0. Environ. Microbiol. 4, 856–871. Greated, A., Titok, M., Krasowiak, R., Fairclough, R.J., Thomas, C.M., 2000. The replication and stable-inheritance functions of IncP-9 plasmid pM3. Microbiology-(UK) 146, 2249–2258. Helinski, D.R., Toukdarian, A.E., Novick, R.P., 1996. Replication control and other stable mechanisms of plasmids. In: Neihardt, F.C. (Ed.), Escherichia coli and Salmonella. 2. American Society for Microbiology, Washington DC, pp. 2295–2324. Hsiao, K.C., 1991. A fast and simple procedure for sequencing double-stranded DNA with Sequenase. Nucleic Acids Res. 19, 2787. Ingmer, H., Fong, E.L., Cohen, S.N., 1995. Monomer-dimer equilibrium of the pSC101 RepA Protein. J. Mol. Biol. 250, 309–314. Ishiai, M., Wada, C., Kawasaki, Y., Yura, T., 1994. Replication initiator protein RepE of mini-F plasmid-functional-diVerentiation between monomers (initiator) and dimers (autogenous repressor). Proc. Natl. Acad. Sci. USA 91, 3839–3843. Jagura-Burdzy, G., Thomas, C.M., 1992. kfrA gene of broad host range plasmid RK2 encodes a novel DNA-binding protein. J. Mol. Biol. 225, 651–660. Jagura-Burdzy, G., Thomas, C.M., 1995. PuriWcation of KorA protein from broad-host-range plasmid RK2 - deWnition of a hierarchy of KorA operators. J. Mol. Biol. 253, 39–50. Jiang, Y., Pacek, M., Helinski, D.R., Konieczny, I., Toukdarian, A., 2003. A multifunctional plasmid-encoded replication initiation protein both recruits and positions an active helicase at the replication origin. Proc. Natl. Acad. Sci. USA 100, 8692–8697. Kahn, M., Kolter, R., Thomas, C., Figurski, D., Meyer, R., Remaut, E., Helinski, D.R., 1979. Plasmid cloning vehicles derived from ColE1, R6K and RK2. Methods Enzymol. 68, 268–280. Khare, D., Ziegelin, G., Lanka, E., Heinemann, U., 2004. Sequence-speciWc DNA binding determined by contacts outside the helix-turn-helix motif of the ParB homolog KorB. Nat. Struct. Mol. Biol. 11, 656–663. Kittell, B.L., Helinski, D.R., 1991. Iteron inhibition of Plasmid RK2 replication in vitro—evidence for intermolecular coupling of replication origins as a mechanism for RK2 replication control. Proc. Natl. Acad. Sci. USA 88, 1389–1393. Komori, H., Matsunaga, F., Higuchi, Y., Ishiai, M., Wada, C., Miki, K., 1999. Crystal structure of a prokaryotic replication initiator protein bound to DNA at 2.6 angstrom resolution. EMBO J. 18, 4597–4607. Konieczny, I., Doran, K.S., Helinski, D.R., Blasina, A., 1997. Role of TrfA and DnaA proteins in origin opening during initiation of DNA replication of the broad host range plasmid RK2. J. Biol. Chem. 272, 20173–20178. Konieczny, I., Helinski, D.R., 1997. Helicase delivery and activation by DnaA and TrfA proteins during the initiation of replication of the broad host-range plasmid RK2. J. Biol. Chem. 272, 33312–33318.

Korfhagen, T.R., Sutton, L., Jacoby, G.A., 1978. ClassiWcation and physical properties of Pseudomonas plasmids. In: Schlessinger, D. (Ed.), Microbiology-1978. American Society for Microbiology, Washington, DC, pp. 21–224. Kruger, R., Rakowska, S.A., Filutowicz, M., 2004. Participating elements in the replication of iteron-containing plasmids. In: Funnell, B.E., Phillips, G.J. (Eds.), Plasmid Biology. American Society for Microbiology, Washington DC, pp. 5–45. Kues, U., Stahl, U., 1989. Replication of Plasmids in Gram-Negative Bacteria. Microbiol. Rev. 53, 491–516. Laue, T.M., Shah, B.D., Ridgeway, T.M, Pelletier, S.L., 1992. In: Harding, S.E., Rowe, A.J., Horton, J.C. (Eds.), Analytical Ultracentrifugation in Biochemistry and Polymer Science. Royal Society of Chemistry, London, pp. 90–125. Laue, T.M., StaVord, W.F., 1999. Modern applications of analytical ultracentrifugation. Ann. Rev. Biophys. Biomol. Struct. 28, 75–100. Leonard, T.A., Butler, P.J.G., Lowe, J., 2004. Structural analysis of the chromosome segregation protein Spo0J from Thermus thermophilus. Mol. Microbiol. 53, 419–432. Lu, Y.B., Datta, H.J., Bastia, D., 1998. Mechanistic studies of initiator-initiator interaction and replication initiation. EMBO J. 17, 5192–5200. Maestro, B., Sanz, J.M., Diaz-Orejas, R., Fernandez-Tresguerres, E., 2003. Modulation of pPS10 host range by plasmidencoded RepA initiator protein. J. Bacteriol. 185, 1367–1375. Maestro, B., Sanz, J.M., Faelen, M., Couturier, M., Diaz-Orejas, R., Fernandez-Tresguerres, E., 2002. Modulation of pPS10 host range by DnaA. Mol. Microbiol. 46, 223–234. Marszalek, J., Kaguni, J.M., 1994. DnaA protein directs the binding of DnaB protein in initiation of DNA replication in Escherichia coli. J. Biol. Chem. 269, 4883–4890. Masai, H., Arai, K.I., 1987. RepA and DnaA proteins are required for initiation of R1 plasmid replication in vitro and interact with the oriR sequence. Proc. Natl. Acad. Sci. USA 84, 4781–4785. McEachern, M.J., Bott, M.A., Tooker, P.A., Helinski, D.R., 1989. Negative control of plasmid R6K replication—possible role of intermolecular coupling of replication origins. Proc. Natl. Acad. Sci. USA 86, 7942–7946. Mullis, K., Faloona, F., Scharf, S., Saiki, R., Horn, G., Erhlich, H., 1986. SpeciWc enzymatic ampliWcation of DNA in vitro: the polymerase chain reaction. Cold Spring Harb. Symp. Quant. Biol. 51, 263–273. Pal, S.K., Chattoraj, D.K., 1988. P1 plasmid replication—initiator sequestration is inadequate to explain control by initiatorbinding sites. J. Bacteriol. 170, 3554–3560. Peters, M., Jogi, E., Suitso, I., Punnisk, T., Nurk, A., 2001. Features of the replicon of plasmid pAM10.6 of Pseudomonas Xuorescens. Plasmid 46, 25–36. Ramos-Gonzalez, M.I., Duque, E., Ramos, J.L., 1991. Conjugational transfer of recombinant DNA in cultures and in soils: host range of Pseudomonas putida TOL plasmids. Appl. Environ. Microbiol. 57, 3020–3027. Rawlings, D.E., Tietze, E., 2001. Comparative biology of IncQ and IncQ-like plasmids. Microbiol. Mol. Biol. Rev. 65, 481–496. Sambrook, J., Fritsch, E.F., Maniatis, T., 1989. Molecular Cloning: A Laboratory Manual. Cold Spring Harbour Laboratory, New York. Sanger, F., Nicklen, S., Coulson, A.R., 1977. DNA-sequencing with chain terminating inhibitors. Proc. Natl. Acad. Sci. USA 74, 4563–4567.

R. Krasowiak et al. / Plasmid 56 (2006) 187–201 Schaper, S., Messer, W., 1995. Interaction of the initiator protein DnaA of Escherichia coli with Its DNA target. J. Biol. Chem. 270, 17622–17626. Sevastsyanovich, Y.R., Titok, M.A., Krasowiak, R., Bingle, L.E.H., Thomas, C.M., 2005. Ability of IncP-9 plasmid pM3 to replicate in E. coli is dependent on both rep and par functions. Mol. Microbiol. 57, 819–833. Sharma, R., Kachroo, A., Bastia, D., 2001. Mechanistic aspects of DnaA-RepA interaction as revealed by yeast forward and reverse two-hybrid analysis. EMBO J. 20, 4577–4587. Sharma, S., Sathyanarayana, B.K., Bird, J.G., Hoskins, J.R., Lee, B., Wickner, S., 2004. Plasmid P1 RepA is homologous to the F plasmid RepE class of initiators. J. Biol. Chem. 279, 6027–6034. Thomas, C.M., 2000. Paradigms of plasmid organization. Mol. Microbiol. 37, 485–491.

201

Titok, M., Maksimava, N.P., Fomichev, Y.K., 1991. Characteristics of the broad host range IncP-9 R plasmid pM3. Mol. Genet., Microbiol. and Virol. 8, 18–23. Wild, J., Czyz, A., Rakowski, S.A., Filutowicz, M., 2004. Gamma origin plasmids of RISK lineage replicate in diverse genera of Gram-negative bacteria. Ann. Microbiol. 54, 471–480. Williams, P.A., Murray, K., 1974. Metabolism of benzoate and the methylbenzoates by Pseudomonas arvilla mt-2: evidence for the existence of a TOL plasmid. J. Bacteriol. 120, 416–423. Zhong, Z.P., Helinski, D., Toukdarian, A., 2003. A speciWc region in the N terminus of a replication initiation protein of plasmid RK2 is required for recruitment of Pseudomonas aeruginosa DnaB helicase to the plasmid origin. J. Biol. Chem. 278, 45305–45310. Zhong, Z.P., Helinski, D., Toukdarian, A., 2005. Plasmid host-range: restrictions to F replication in Pseudomonas. Plasmid 54, 48–56.