- Email: [email protected]
Increased protease activated receptors in the colon of patients with Hirschsprung's disease
YJPSU-59498; No of Pages 7 Journal of Pediatric Surgery xxx (xxxx) xxx
Contents lists available at ScienceDirect
Journal of Pediatric Surgery journal homepage: www.elsevier.com/locate/jpedsurg
Increased protease activated receptors in the colon of patients with Hirschsprung's disease Christian Tomuschat a,⁎, Anne Marie O'Donnell a, David Coyle a, Prem Puri a,b a b
National Children's Research Centre, Our Lady's Children's Hospital, Crumlin, Dublin, Ireland School of Medicine and Medical Science and Conway Institute of Biomedical Research, University College Dublin, Ireland
a r t i c l e
i n f o
Article history: Received 28 May 2019 Received in revised form 12 November 2019 Accepted 21 November 2019 Available online xxxx Key words: Hirschsprung's disease HAEC Proteases Protease-activated receptor PAR1 PAR2
a b s t r a c t Purpose: The pathophysiology of Hirschsprung's associated enterocolitis (HAEC) is not understood. Abnormal intestinal motility and altered intestinal epithelial barrier function have been suggested to play a key role in the causation of HAEC. Protease-activated receptors (PARs) 1 and 2, have been implicated in inflammatory reactions, intestinal permeability and modulation of motility in the gut. Methods: We investigated PAR-1 and PAR-2 protein expression in aganglionic and ganglionic regions of patients with Hirschsprung's Disease (HSCR) (n = 10) versus normal control colon (n = 10). Protein distribution was assessed by using immunofluorescence and confocal microscopy. Gene and protein expression were quantified using quantitative real-time polymerase chain reaction (qPCR), western blot analysis, and densitometry. Results: qPCR and Western blot analysis revealed that PAR-1 and PAR-2 expression was significantly increased in ganglionic and aganglionic bowel in HSCR compared to controls (p b 0.003). Confocal microscopy revealed strong PAR-1 and PAR-2 expression in smooth muscles, interstitial cells of Cajal (ICCs), platelet-derived growth factoralpha receptor-positive (PDGFRα +) cells, enteric neurons and epithelium in the ganglionic and aganglionic bowel compared to controls. Conclusion: Increased PAR-1 and PAR-2 expression in the colon of patients with HSCR suggests that excessive local release of PAR activating proteases may trigger inflammatory responses leading to HAEC. © 2019 Elsevier Inc. All rights reserved.
Hirschsprung's-associated enterocolitis (HAEC) is a severe and potentially life-threatening complication of Hirschsprung's Disease (HSCR) if left untreated [1]. Classical the condition is defined by abdominal distension, bilious vomiting, diarrhea, followed by fever and sepsis if left untreated [2]. Histologically, the colonic epithelium is inflamed, showing similarities to changes as seen in inflammatory conditions of the gut such as ulcerative colitis [3]. The incidence of HAEC lies between 30 and 60% and is even after adequate surgical resection common [4–6]. Recent evidence from our group implicates that the proximal ganglionic bowel of patients with HSCR is immunologically changed [7, 8]. However, despite recent efforts, the pathogenesis of HAEC is not entirely known. New hypotheses have been published to analyze the pathomechanism of HAEC. Mainly, these include altered motility, dysfunction of the colonic epithelium, an inadequate innate immune response and aberrant gut microbiota [9–11]. The combined function of mucin release, immunoglobulin production and epithelial junctions composition (TJ) in interplay with the enteric nervous network has emerged as the central pathophysiology leading to HAEC [2, 3, 12]. Protease-activated receptors (PARS) are G-protein coupled. They are activated by proteolytic cleavage by serine proteases. ⁎ Corresponding author at: National Children's Research Centre, Our Lady's Children's Hospital, Crumlin, Dublin 12, Ireland. Tel.: +353 14096420; fax +353 1455 201. E-mail address: [email protected] (C. Tomuschat).
There are four different types of PARs (PAR 1–4) [13]. PARs are widely distributed in the gastrointestinal tract and are involved in the regulation of motility under physiological and pathological conditions [14]. Activation of PAR1 and PAR2 is reported to contribute to inflammatory response and increased intestinal motility and secretions [15]. Activation of both PAR1 and PAR2 stimulates the release of proinflammatory mediators such as interleukin-6 (IL-6), interleukin (IL-8) and prostaglandin E2 (PGE2) [16]. We hypothesized that in the colon of patients with HSCR PAR1 and PAR2 are increased in their expression. 1. Material and methods 1.1. Tissue samples This study was approved by the Ethics Medical Research Committee, Our Lady's Children's Hospital (Ref GEN.292/12) and tissue samples were obtained with informed parenteral consent. We followed the protocol, as described in previous studies from our group [7, 9, 10]. HSCR specimens from 10 patients (7 male, three female, 3–14 mo) who underwent pull-through surgery were studied (Table 1). Delphi criteria for HAEC diagnosis were applied. Those patients who developed HAEC received one course of antibiotics and twice daily rectal washouts. Surgery has been postponed until the episode of HAEC has been resolved under treatment.
https://doi.org/10.1016/j.jpedsurg.2019.11.009 0022-3468/© 2019 Elsevier Inc. All rights reserved.
Please cite this article as: C. Tomuschat, A.M. O'Donnell, D. Coyle, et al., Increased protease activated receptors in the colon of patients with Hirschsprung's disease, Journal of Pediatric Surgery, https://doi.org/10.1016/j.jpedsurg.2019.11.009
2
C. Tomuschat et al. / Journal of Pediatric Surgery xxx (xxxx) xxx
Table 1 Clinical data of patients with Hirschsprung's disease.
1 2 3 4 5 6 7 8 9 10
Age at surgery (month)
Gender
Associated anomalies
Extent Aganglionosis
Colostomy prior to pullthrough
Enterocolitis Preoperative
Post pullthrough
10 8 3 14 5 7 4 5 5 5
Female Female Male Female Male Male Male Male Male Male
Trisomy 21, ASD, PDA Trisomy 21, ASD ASD ASD PDA Ligation
Longsegment Rectosigmoid Rectosigmoid Rectosigmoid Rectosigmoid Sub-total colonic Rectosigmoid Rectosigmoid Rectosigmoid Rectosigmoid
yes Yes Yes -
yes Yes Yes -
yes -
These specimens were divided into aganglionic and ganglionic samples. Ganglionic samples were taken from the most proximal margin of the pull-through specimen while aganglionic samples were taken from the most distal margin of the pull through specimens. Normal control samples included 10 specimens from patients who underwent sigmoid colostomy closure following anorectoplasty for imperforate anus (6 male, four female, 8–19 mo). Tissue specimens were either snapfrozen in liquid nitrogen and stored at − 80 °C for protein extraction or embedded in OCT Mounting Compound (VWR International, Leuven, Belgium) for immunofluorescence and stored at −80 °C until use. 1.2. RNA isolation from HSCR specimens Isolate II RNA Mini Kit was used for the extraction method to isolate total RNA from aganglionic and ganglionic HSCR as well as controls (n = 10 for each group) according to the manufacturer's protocol.
Spectrophotometrical quantification of total RNA was performed using a NanoDrop ND-1000 UV–Vis spectrophotometer (Thermo Scientific Fisher, Wilmington, DE). The RNA solution was stored at −80 °C until further use. 1.3. cDNA synthesis and quantitative polymerase chain reaction Reverse transcription of total RNA was carried out at 25 °C for 10 min, at 37 °C for 120 min and 85 °C for 5 min using a Transcriptor High Fidelity cDNA Synthesis Kit (Roche Diagnostics, West Sussex UK) according to the manufacturer's instruction. The resulting cDNA was used for quantitative real-time polymerase chain reaction (qRT-PCR) using a LightCycler 480 SYBR Green I Master (Roche Diagnostics, Mannheim, Germany) in a total reaction mix of 25 μl per well. The following gene-specific primers were used: Human PAR1 (Eurofins) sense primer 5′ TGCCTACTTTGCCTACCTCC and Human PAR1 anti-
Fig. 1. (a/b) qRT-PCR revealed significantly increased relative mRNA expression levels of PAR1 and PAR2 in the aganglionic HSCR specimens (n = 10) compared to normal control tissue (n = 10) (p b 0.003 by ANOVA). Results are presented as mean ± SEM. Western blotting and densitometry quantification of PAR-1/PAR-2 protein expression in HSCR specimens (n = 10) and controls. (c/d) Western blot results show that the quantitative increase of PAR-1 and PAR-2 transcripts in HSCR specimens resulted in increased amounts of PAR-1 and PAR-2 protein expression compared to normal controls. Equal loading of electrophoresis gels was confirmed by GAPDH staining. Values are given as mean ± SEM. *p b 0.05 by ANOVA.
Please cite this article as: C. Tomuschat, A.M. O'Donnell, D. Coyle, et al., Increased protease activated receptors in the colon of patients with Hirschsprung's disease, Journal of Pediatric Surgery, https://doi.org/10.1016/j.jpedsurg.2019.11.009
C. Tomuschat et al. / Journal of Pediatric Surgery xxx (xxxx) xxx
3
sense primer 5′ GTAGACGTACCTCTGGCAC as well Human PAR2 (Eurofins) sense primer 5′ GCGATCTTCTGCCATGGATG and Human PAR2 anti-sense primer 5′ AGATCAGGTACATGGCCAGG. For normalization purposes, real-time RT-PCR was performed for Glyceraldehyde 3 phosphate dehydrogenase (GAPDH). After 5 min of initial denaturation at 95 °C, 55 cycles of amplification for each primer were carried out. Each cycle included denaturation at 95 °C for 10s, annealing at 60 °C for 15 s, and elongation at 72 °C for 10s. Relative mRNA levels of gene expression were determined using a LightCycler 480 System (Roche Diagnostics). The relative changes in gene expression levels of PAR1/PAR2 were normalized against the level of GAPDH gene expression in each sample (ΔΔCT-method). Experiments were carried out in triplicate for each sample and primer.
by western blotting. Following western blotting, the membranes were blocked with 3% skimmed milk for 60 min before antibody detection. The primary antibodies; rabbit anti-PAR1 (Santa Cruz, Heidelberg, Germany) dilution 1:1000 and rabbit anti-PAR2 (Santa Cruz, Heidelberg, Germany) were used, and incubation was performed overnight at 4 °C. Following extensive washing four times in Phosphate-buffered saline (PBS - 0.05% Tween) the membranes were incubated with goat anti-rabbit IgG HRP-linked secondary Antibody (dilution 1:10000, Abcam, Cambridge, United Kingdom) followed by washing (four times in PBS-0.05% Tween). Detection was performed with the ECL Plus chemiluminescence kit (Thermo, Fisher Scientific, Dublin, Ireland). We used GAPDH (mouse anti-GAPDH, dilution 1:1000, Abcam, Cambridge, United Kingdom) as an additional loading control.
1.4. Protein extraction and Western blot
1.5. Immunofluorescence staining and confocal microscopy
Specimens of HSCR colon and control colon were homogenized in RIPA buffer (Radio-Immunoprecipitation Assay, Sigma-Aldrich Ltd., Wicklow, Ireland) containing 1% protease inhibitor cocktail (Sigma-Aldrich Ireland Ltd., Wicklow, Ireland). Protein concentrations were determined using a Bradford assay (Sigma-Aldrich Ireland Ltd.. Wicklow, Ireland). A total volume of 20 μl Laemmli Sample Buffer (SigmaAldrich, Ireland Ltd., Wicklow, Ireland) containing 10 μg protein was loaded in the 10% SDS-PAGE gel (NuPAGE Novex Bis-Tris gels, Invitrogen, Carlsbad, United States) for electrophoretic separation. The electrophoresis was performed in MES SDS (2-(N-morpholino) ethanesulfonic acid, sodium dodecyl sulfate) running buffer (Invitrogen, Carlsbad, United States). Proteins were then transferred to 0.45 μm nitrocellulose membrane (Millipore Corporation, Billerica, United Stated)
Frozen blocks of HSCR colon and normal control samples were sectioned transversely at a thickness of 10 μm, mounted on Superfrost® Plus slides (VWR International, Leuven, Belgium) and fixed with buffered 10% formalin for 10 min. Sections underwent cell membrane permeabilization with 1% TritonX-100 for 25 min at room temperature. After blocking with 5% BSA (Bovine serum albumin) for 30 min to avoid non-specific absorption, sections were incubated with primary antibodies: rabbit anti-PAR1 (1:100, BSA 5%), (Santa Cruz, Heidelberg, Germany), rabbit anti-PAR2 (1:100, BSA 5%), mouse anti-α-smooth muscle actin (1:200, 5% BSA), (Sigma-Aldrich, Ireland), mouse anti-ckit (1:300, 5% BSA) (Abcam, Cambridge United Kingdom), mouse antiPDGFRα (1:100, 5% BSA), (Santa Cruz, Heidelberg, Germany) and mouse HuD-1 (1:100, 5% BSA), (Molecular Probes) overnight at 4 °C.
Fig. 2. (a) PAR 1 and (b) PAR2 expression (green) in interstitial cells of cajal (red) of Hirschsprung's specimens compared to normal controls. C-Kit (red) was used to identify interstitial cells of cajal to show co-expression with PAR1 and PAR2 (scale bar 25 μm, original magnification ×63). (c) PAR1 and (d) PAR2 expression (green) in PDGFRα+ cells (red) of Hirschsprung's specimens compared to normal controls. PDGFRα (red) was used to identify PDGFRα+ cells to show co-expression with PAR1 and PAR2 (scale bar 25 μm, original magnification ×63).
Please cite this article as: C. Tomuschat, A.M. O'Donnell, D. Coyle, et al., Increased protease activated receptors in the colon of patients with Hirschsprung's disease, Journal of Pediatric Surgery, https://doi.org/10.1016/j.jpedsurg.2019.11.009
4
C. Tomuschat et al. / Journal of Pediatric Surgery xxx (xxxx) xxx
Sections were then washed in PBS-0.05% Tween and incubated with corresponding secondary antibodies (anti-rabbit Alexa Fluor® 488, dilution 1:1000 and anti-mouse Alexa Fluor®594, dilution 1:1000, Abcam, Cambridge, United Kingdom) for 1 h at room temperature. After washing, sections were counterstained with DAPI (4′,6diamidino-2-phenylindole) antibody, dilution 1:1000 (Roche Diagnostics GmbH, Mannheim, Germany) for 15 min, washed, mounted and coverslipped with Fluorescent Mounting Medium (DAKO Ltd., Cambridgeshire, United Kingdom). All sections were independently evaluated by two investigators with an LSM 700 confocal microscope (Carl Zeiss MicroImaging GmbH, Jena, Germany). 1.6. Statistical analysis A one-way ANOVA was conducted to determine a statistically significant difference between aganglionic, ganglionic and healthy controls. Data ± standard error. Specimens were classified into three groups: Aganglionic (n = 10), Ganglionic (n = 10) and normal controls (n = 10). 2. Results
PAR1 and PAR2 expression in HSCR patients was not significantly different from those patients who had HAEC compared to those who did. 2.2. Western blot Our Western blot results from three independent experiments showed that PAR1 and PAR2 protein was expressed in colon of patients with HSCR and the expression was (p b 0.05) (Fig. 1). Densitometry confirmed significantly increased PAR1 and PAR2 protein expression in the aganglionic and ganglionic bowel in HSCR compared to controls (p b 0.05). Equal loading of electrophoresis gels was confirmed by GAPDH staining of the stripped membranes. 2.3. Immunofluorescence staining and confocal microscopy PAR1 and PAR2 showed co-localization with Interstitial cells of Cajal and PDGFRα+ cells (Fig. 2), smooth muscle cells and the colonic epithelium (Fig. 3) as well as Confocal microscopy showed robust PAR-1 and PAR-2 expression in smooth muscles, ICCs, PDGFRα+ cells, enteric neurons and epithelium in the aganglionic and ganglionic colon compared to controls. (See Fig. 4.)
2.1. Relative mRNA expression levels of PAR1 and PAR2 in HSCR and controls
3. Discussion
The relative mRNA expression levels of PAR1 and PAR2 were significantly increased in aganglionic and ganglionic Hirschsprung's specimens compared to controls (p b 0.003) (Fig. 1).
Proteinases are abundant in the GI-tract and only the equilibrium between proteolytic activity and inhibition guarantee that the digestive function of the gut will not be damaged [17]. Proteases change the
Fig. 3. (a) PAR 1 and (b) PAR2 expression (green) in smooth muscle cells (red) of Hirschsprung's specimens compared to normal controls. α-SMA (red) was used to identify smooth muscle bundles to show co-expression with PAR1 and PAR2 (scale bar 25 μm, original magnification ×63). (c) PAR1 and (d) PAR2 expression (green) in the colonic epithelium (red) of Hirschsprung's specimens compared to normal controls. E-Cadherin (red) was used to identify colonic epithelium to show co-expression with PAR1 and PAR2 (scale bar 25 μm, original magnification ×63).
Please cite this article as: C. Tomuschat, A.M. O'Donnell, D. Coyle, et al., Increased protease activated receptors in the colon of patients with Hirschsprung's disease, Journal of Pediatric Surgery, https://doi.org/10.1016/j.jpedsurg.2019.11.009
C. Tomuschat et al. / Journal of Pediatric Surgery xxx (xxxx) xxx
5
Fig. 4. (a) PAR 1 and (b) PAR2 expression (green) in enteric neurons/ganglion cells (red) of Hirschsprung's specimens compared to normal controls. HuD1 (red) was used to identify enteric neurons/ganglion cells to show co-expression with PAR1 and PAR2 (scale bar 25 μm, original magnification ×63).
terminal domain of PARs and reveal a new, structural different domain. The structural change induces a binding signal from a coupled G-protein that finally enables a response [18, 19]. Animal studies have shown that PAR-1 and PAR-2 are the best characterized protease-activated receptors involved in signal transduction and inflammatory responses. PAR1 is activated mainly by thrombin, granzyme a, plasmin, trypsin IV,
cathepsin G and PAR-2 by trypsin, mast cell tryptase, trypsin IV and granzyme A [19]. It is essential to mention that PAR-1/2 receptors can also be activated by the same proteinases. The distribution within the gut mainly overlaps, but differences in expression reflect on their physiological function once activated. For instance, is the PAR-1 receptor is only found at the apical side of enterocytes, whereas the PAR-2 receptor
Please cite this article as: C. Tomuschat, A.M. O'Donnell, D. Coyle, et al., Increased protease activated receptors in the colon of patients with Hirschsprung's disease, Journal of Pediatric Surgery, https://doi.org/10.1016/j.jpedsurg.2019.11.009
6
C. Tomuschat et al. / Journal of Pediatric Surgery xxx (xxxx) xxx
is found at the apical and basolateral membrane of enterocytes. Once activated, the coupling to G-proteins induces the nuclear factor pathway (NFκB), which links PARs with inflammation [19–21]. PAR-1 and PAR2 mediate the release of many pro-inflammatory cytokines (IL-6 and IL-8) as well as chemokines such as CXCL1 and CXCL8 [19,22,23]. That includes the release of Il-8 in colonic epithelial cells [23]. These results are supported by Ghouzali et al., who showed that PAR-1 mediates an IL-8 exacerbation and − 2 activation in Caca-2 cells (human epithelial colorectal cells), which have been treated by agonists peptides of PARs, IL-1β and proteasome inhibitors such as bortezomib and MG132 [16]. Additionally, leukocyte migration and extravasation are linked to the activation of PAR receptors [24]. In a model of lung inflammation, it has been clearly shown that human epithelial cells after exposure to dust released significantly more pro-inflammatory cytokines than controls and that these effects were decreased by PAR-1/−2 inhibition [25]. The combined stimulation with PAR-agonists and PGE2 resulted in an additive release of IL-6 and IL-8, suggesting an essential role for PARs in early response and modulation of inflammation [26]. Interestingly, a reduction of pro-inflammatory mediators and improved survival could be achieved in a murine sepsis model due to a PAR2 deficiency and inhibitory effects of hirudin on thrombinmediated signaling [27]. Murine models of experimental colitis have shown a correlation between PAR agonist (e.g., activation) exposure and worsening of the disease with displaying of granulocyte infiltration, tissue damage and bacterial translocation [15, 18]. Bacterial pathogens such as Citrobacter rodentium or enterohemorrhagic E. coli produce serine proteases that activate PAR-2 with consecutive inflammation in the colonic epithelium [28, 29]. The activation of PAR-1 and PAR-2 induces acute colitis. However, it has also been shown that the activation of PAR-2 protects against chronic colitis [15]. The implications for HAEC and protective properties of PAR-2 are mainly speculative, but it is conceivable, that an imbalance inactivation of PAR receptors by different proteinases leads to a proinflammatory response. Mice, deficient for PAR-2 showed reduced levels of C. rodentium inflammation. This finding suggests a link for pathogen-induced host protease and PAR-2 in infectious colitis. The activation of PAR receptors by microbial proteases provides a mechanism of regulation of host cells (enterocytes) through microbes and release of pro-inflammatory cytokines [30]. That is, in so far of interest, that recent evidence suggests an altered microbiome in patients with HSCR [11]. Furthermore, the intestinal function of the colonic epithelial lining is affected by increased permeability and disruption of the tight junctions through activation of PAR-1 and PAR-2 [19, 31–33]. In the present study, we clearly show an upregulation of both PAR-1 and PAR-2 receptors in the ganglionic and aganglionic colon of patients with HSCR compared to controls. Excessive local release of PAR-1 and PAR-2 from microorganisms may trigger inflammatory responses leading to a pro-inflammatory phenotype resulting in the onset of HAEC. The abnormal ENS in patients with HSCR results in abnormal intestinal motility pattern. The increased expression of PAR-1 and PAR-2 receptors in the present study on hypertrophic nerves in the aganglionic bowel in HSCR specimens and enteric ganglion cells in the ganglionic bowel may adversely affect the ion transport across the epithelium. An increase of intraluminal Cl- secretion results in diarrhea and constitutes a prominent clinical symptom of HAEC. At least one study showed an increased chloride secretion through the activation and interplay of PAR-1 and PAR-2 and neural pathways [34]. Another effector pathway downstream of PAR activation includes mobilization of Ca2+ from the endoplasmatic reticulum into the cytosol of fibroblasts [19, 24]. The common mesenchymal origin of interstitial cells of Cajal (ICC) and PDGFRα+ cells and fibroblasts suggests an increase of Ca2+ transients in ICC and PDGFRα+ cells after PAR stimulation. It has been shown that high Ca2 + transients in ICCs affect
slow-wave currents and influence the excitability of smooth muscles [35]. In comparison, an increase of Ca2 + in PDGFRα + cells leads to an inhibitory modulation to maintain the phasic nature of contractions of smooth muscles [36]. PARs may affect the GI-motility due to an increase of Ca2 + −transients in interstitial cells. HAEC persists to be the most frequent cause of pre- and postoperative morbidity and mortality in HSCR [1]. Disruption of the intestinal barrier function which permits bacterial translocation has been developed as an attractive hypothesis in regards to the pathogenic mechanism of HAEC [37]. In this study, we show for the first time, that PAR-1 and PAR-2 gene and protein expression are significantly increased in the aganglionic and ganglionic specimens of HSCR specimens compared to healthy controls. The results of our study clearly showed that the ganglionic bowel specimens had significantly increased levels of PAR-1 and PAR-2, suggesting that the ganglionic bowel of these patients are not healthy. This finding may also explain why many patients with HSCR continue to have postoperative enterocolitis despite an adequately performed pull-through operation. However, PAR1 and PAR2 expression in HSCR patients was not significantly different from those patients who had HAEC compared to those who did. This is probably due to the low numbers of patients in our study. The upregulation of PAR-1 and PAR-2 in patients with HSCR, their possible role in early inflammatory response and intestinal permeability are supported by findings in patients with ulcerative colitis and underlines the potential relationships between HAEC and inflammatory bowel disease (IBD) [38]. Recent studies reported that patients with HSCR have an increased risk during lifetime to develop IBD compared to healthy controls, despite adequate surgery [39–41]. In conclusion, the findings of the present study implicate a role of PAR-1/−2 receptors in the development of HAEC. In light of recent data of an altered microbiome and impaired intestinal barrier function, further investigations are necessary to specify the interplay between the microbiome, proteases and PAR-1/−2 receptors on intestinal cells. References [1] Frykman PK, Kim S, Wester T, et al. Critical evaluation of the Hirschsprungassociated enterocolitis (HAEC) score: a multicenter study of 116 children with Hirschsprung disease. J Pediatr Surg 2018;53:708–17. [2] Demehri FR, Halaweish IF, Coran AG, et al. Hirschsprung-associated enterocolitis: pathogenesis, treatment and prevention. Pediatr Surg Int 2013;29:873–81. [3] Austin KM. The pathogenesis of Hirschsprung's disease-associated enterocolitis. Semin Pediatr Surg 2012;21:319–27. [4] Frykman PK, Short SS. Hirschsprung-associated enterocolitis: prevention and therapy. Semin Pediatr Surg 2012;21:328–35. [5] Gosain A. Established and emerging concepts in Hirschsprung's-associated enterocolitis. Pediatr Surg Int 2016;32:313–20. [6] Heuckeroth RO. Hirschsprung disease - integrating basic science and clinical medicine to improve outcomes. Nat Rev Gastroenterol Hepatol 2018;15:152–67. [7] Tomuschat C, O'Donnell AM, Coyle D, et al. Altered expression of a two-pore domain (K2P) mechano-gated potassium channel TREK-1 in Hirschsprung's disease. Pediatr Res 2016;80:729–33. [8] Tomuschat C, O'Donnell AM, Coyle D, et al. Reduction of hydrogen sulfide synthesis enzymes cystathionine-β-synthase and cystathionine-γ-lyase in the colon of patients with Hirschsprungs disease. J Pediatr Surg 2018;53:525–30. [9] Tomuschat C, O'Donnell AM, Coyle D, et al. Altered expression of ATP-sensitive K(+) channels in Hirschsprung's disease. J Pediatr Surg 2016;51:948–52. [10] Nakamura H, Tomuschat C, Coyle D, et al. Altered goblet cell function in Hirschsprung's disease. Pediatr Surg Int 2018;34:121–8. [11] Neuvonen MI, Korpela K, Kyrklund K, et al. Intestinal microbiota in Hirschsprung disease. J Pediatr Gastroenterol Nutr 2018;67(5):594–600. [12] Snoek SA, Verstege MI, Boeckxstaens GE, et al. The enteric nervous system as a regulator of intestinal epithelial barrier function in health and disease. Expert Rev Gastroenterol Hepatol 2010;4:637–51. [13] Palygin O, Ilatovskaya DV, Staruschenko A. Protease-activated receptors in kidney disease progression. Am J Physiol Renal Physiol 2016;311:F1140–4. [14] Saeed MA, Ng GZ, Däbritz J, et al. Protease-activated receptor 1 plays a Proinflammatory role in colitis by promoting Th17-related immunity. Inflamm Bowel Dis 2017; 23:593–602. [15] Vergnolle N. Clinical relevance of proteinase activated receptors (pars) in the gut. Gut 2005;54:867–74. [16] Ghouzali I, Azhar S, Bôle-Feysot C, et al. Proteasome inhibitors exacerbate interleukin-8 production induced by protease-activated receptor 2 in intestinal epithelial cells. Cytokine 2016;86:41–6.
Please cite this article as: C. Tomuschat, A.M. O'Donnell, D. Coyle, et al., Increased protease activated receptors in the colon of patients with Hirschsprung's disease, Journal of Pediatric Surgery, https://doi.org/10.1016/j.jpedsurg.2019.11.009
C. Tomuschat et al. / Journal of Pediatric Surgery xxx (xxxx) xxx [17] Vergnolle N, Wallace JL, Bunnett NW, et al. Protease-activated receptors in inflammation, neuronal signaling and pain. Trends Pharmacol Sci 2001;22:146–52. [18] Vergnolle N. Proteinase-activated receptors (PARs) in infection and inflammation in the gut. Int J Biochem Cell Biol 2008;40:1219–27. [19] Adams MN, Ramachandran R, Yau MK, et al. Structure, function and pathophysiology of protease activated receptors. Pharmacol Ther 2011;130:248–82. [20] Shpacovitch VM, Brzoska T, Buddenkotte J, et al. Agonists of proteinase-activated receptor 2 induce cytokine release and activation of nuclear transcription factor kappaB in human dermal microvascular endothelial cells. J Invest Dermatol 2002; 118:380–5. [21] Buddenkotte J, Stroh C, Engels IH, et al. Agonists of proteinase-activated receptor-2 stimulate upregulation of intercellular cell adhesion molecule-1 in primary human keratinocytes via activation of NF-kappa B. J Invest Dermatol 2005;124:38–45. [22] Lenardo MJ, Baltimore D, NF-kappa B. A pleiotropic mediator of inducible and tissuespecific gene control. Cell 1989;58:227–9. [23] Niu QX, Chen HQ, Chen ZY, et al. Induction of inflammatory cytokine release from human umbilical vein endothelial cells by agonists of proteinase-activated receptor-2. Clin Exp Pharmacol Physiol 2008;35:89–96. [24] Ossovskaya VS, Bunnett NW. Protease-activated receptors: contribution to physiology and disease. Physiol Rev 2004;84:579–621. [25] Romberger DJ, Heires AJ, Nordgren TM, et al. Proteases in agricultural dust induce lung inflammation through PAR-1 and PAR-2 activation. Am J Physiol Lung Cell Mol Physiol 2015;309:L388–99. [26] Asokananthan N, Lan RS, Graham PT, et al. Activation of protease-activated receptors (PARs)-1 and −2 promotes alpha-smooth muscle actin expression and release of cytokines from human lung fibroblasts. Physiol Rep 2015;3. [27] Pawlinski R, Mackman N. Tissue factor, coagulation proteases, and proteaseactivated receptors in endotoxemia and sepsis. Crit Care Med 2004;32: S293–7. [28] Hansen KK, Sherman PM, Cellars L, et al. A major role for proteolytic activity and proteinase-activated receptor-2 in the pathogenesis of infectious colitis. Proc Natl Acad Sci U S A 2005;102:8363–8. [29] Rothmeier AS, Ruf W. Protease-activated receptor 2 signaling in inflammation. Semin Immunopathol 2012;34:133–49.
7
[30] Amadesi S, Bunnett N. Protease-activated receptors: protease signaling in the gastrointestinal tract. Curr Opin Pharmacol 2004;4:551–6. [31] Cenac N, Garcia-Villar R, Ferrier L, et al. Proteinase-activated receptor-2-induced colonic inflammation in mice: possible involvement of afferent neurons, nitric oxide, and paracellular permeability. J Immunol 2003;170:4296–300. [32] Cenac N, Chin AC, Garcia-Villar R, et al. PAR2 activation alters colonic paracellular permeability in mice via IFN-gamma-dependent and -independent pathways. J Physiol 2004;558:913–25. [33] Chin AC, Vergnolle N, MacNaughton WK, et al. Proteinase-activated receptor 1 activation induces epithelial apoptosis and increases intestinal permeability. Proc Natl Acad Sci U S A 2003;100:11104–9. [34] Vergnolle N, Ferazzini M, D'Andrea MR, et al. Proteinase-activated receptors: novel signals for peripheral nerves. Trends Neurosci 2003;26:496–500. [35] Sanders KM, Ward SM, Koh SD. Interstitial cells: regulators of smooth muscle function. Physiol Rev 2014;94:859–907. [36] Kurahashi M, Nakano Y, Hennig GW, et al. Platelet-derived growth factor receptor α-positive cells in the tunica muscularis of human colon. J Cell Mol Med 2012;16: 1397–404. [37] Gosain A, Brinkman AS. Hirschsprung's associated enterocolitis. Curr Opin Pediatr 2015;27:364–9. [38] Kim JA, Choi SC, Yun KJ, et al. Expression of protease-activated receptor 2 in ulcerative colitis. Inflamm Bowel Dis 2003;9:224–9. [39] Levin DN, Marcon MA, Rintala RJ, et al. Inflammatory bowel disease manifesting after surgical treatment for Hirschsprung disease. J Pediatr Gastroenterol Nutr 2012;55:272–7. [40] Löf Granström A, Amin L, Arnell H, et al. Increased risk of inflammatory bowel disease in a population-based cohort study of patients with Hirschsprung disease. J Pediatr Gastroenterol Nutr 2018;66:398–401. [41] Nakamura H, Lim T, Puri P. Inflammatory bowel disease in patients with Hirschsprung's disease: a systematic review and meta-analysis. Pediatr Surg Int 2018;34:149–54.
Please cite this article as: C. Tomuschat, A.M. O'Donnell, D. Coyle, et al., Increased protease activated receptors in the colon of patients with Hirschsprung's disease, Journal of Pediatric Surgery, https://doi.org/10.1016/j.jpedsurg.2019.11.009
Contents lists available at ScienceDirect
Journal of Pediatric Surgery journal homepage: www.elsevier.com/locate/jpedsurg
Increased protease activated receptors in the colon of patients with Hirschsprung's disease Christian Tomuschat a,⁎, Anne Marie O'Donnell a, David Coyle a, Prem Puri a,b a b
National Children's Research Centre, Our Lady's Children's Hospital, Crumlin, Dublin, Ireland School of Medicine and Medical Science and Conway Institute of Biomedical Research, University College Dublin, Ireland
a r t i c l e
i n f o
Article history: Received 28 May 2019 Received in revised form 12 November 2019 Accepted 21 November 2019 Available online xxxx Key words: Hirschsprung's disease HAEC Proteases Protease-activated receptor PAR1 PAR2
a b s t r a c t Purpose: The pathophysiology of Hirschsprung's associated enterocolitis (HAEC) is not understood. Abnormal intestinal motility and altered intestinal epithelial barrier function have been suggested to play a key role in the causation of HAEC. Protease-activated receptors (PARs) 1 and 2, have been implicated in inflammatory reactions, intestinal permeability and modulation of motility in the gut. Methods: We investigated PAR-1 and PAR-2 protein expression in aganglionic and ganglionic regions of patients with Hirschsprung's Disease (HSCR) (n = 10) versus normal control colon (n = 10). Protein distribution was assessed by using immunofluorescence and confocal microscopy. Gene and protein expression were quantified using quantitative real-time polymerase chain reaction (qPCR), western blot analysis, and densitometry. Results: qPCR and Western blot analysis revealed that PAR-1 and PAR-2 expression was significantly increased in ganglionic and aganglionic bowel in HSCR compared to controls (p b 0.003). Confocal microscopy revealed strong PAR-1 and PAR-2 expression in smooth muscles, interstitial cells of Cajal (ICCs), platelet-derived growth factoralpha receptor-positive (PDGFRα +) cells, enteric neurons and epithelium in the ganglionic and aganglionic bowel compared to controls. Conclusion: Increased PAR-1 and PAR-2 expression in the colon of patients with HSCR suggests that excessive local release of PAR activating proteases may trigger inflammatory responses leading to HAEC. © 2019 Elsevier Inc. All rights reserved.
Hirschsprung's-associated enterocolitis (HAEC) is a severe and potentially life-threatening complication of Hirschsprung's Disease (HSCR) if left untreated [1]. Classical the condition is defined by abdominal distension, bilious vomiting, diarrhea, followed by fever and sepsis if left untreated [2]. Histologically, the colonic epithelium is inflamed, showing similarities to changes as seen in inflammatory conditions of the gut such as ulcerative colitis [3]. The incidence of HAEC lies between 30 and 60% and is even after adequate surgical resection common [4–6]. Recent evidence from our group implicates that the proximal ganglionic bowel of patients with HSCR is immunologically changed [7, 8]. However, despite recent efforts, the pathogenesis of HAEC is not entirely known. New hypotheses have been published to analyze the pathomechanism of HAEC. Mainly, these include altered motility, dysfunction of the colonic epithelium, an inadequate innate immune response and aberrant gut microbiota [9–11]. The combined function of mucin release, immunoglobulin production and epithelial junctions composition (TJ) in interplay with the enteric nervous network has emerged as the central pathophysiology leading to HAEC [2, 3, 12]. Protease-activated receptors (PARS) are G-protein coupled. They are activated by proteolytic cleavage by serine proteases. ⁎ Corresponding author at: National Children's Research Centre, Our Lady's Children's Hospital, Crumlin, Dublin 12, Ireland. Tel.: +353 14096420; fax +353 1455 201. E-mail address: [email protected] (C. Tomuschat).
There are four different types of PARs (PAR 1–4) [13]. PARs are widely distributed in the gastrointestinal tract and are involved in the regulation of motility under physiological and pathological conditions [14]. Activation of PAR1 and PAR2 is reported to contribute to inflammatory response and increased intestinal motility and secretions [15]. Activation of both PAR1 and PAR2 stimulates the release of proinflammatory mediators such as interleukin-6 (IL-6), interleukin (IL-8) and prostaglandin E2 (PGE2) [16]. We hypothesized that in the colon of patients with HSCR PAR1 and PAR2 are increased in their expression. 1. Material and methods 1.1. Tissue samples This study was approved by the Ethics Medical Research Committee, Our Lady's Children's Hospital (Ref GEN.292/12) and tissue samples were obtained with informed parenteral consent. We followed the protocol, as described in previous studies from our group [7, 9, 10]. HSCR specimens from 10 patients (7 male, three female, 3–14 mo) who underwent pull-through surgery were studied (Table 1). Delphi criteria for HAEC diagnosis were applied. Those patients who developed HAEC received one course of antibiotics and twice daily rectal washouts. Surgery has been postponed until the episode of HAEC has been resolved under treatment.
https://doi.org/10.1016/j.jpedsurg.2019.11.009 0022-3468/© 2019 Elsevier Inc. All rights reserved.
Please cite this article as: C. Tomuschat, A.M. O'Donnell, D. Coyle, et al., Increased protease activated receptors in the colon of patients with Hirschsprung's disease, Journal of Pediatric Surgery, https://doi.org/10.1016/j.jpedsurg.2019.11.009
2
C. Tomuschat et al. / Journal of Pediatric Surgery xxx (xxxx) xxx
Table 1 Clinical data of patients with Hirschsprung's disease.
1 2 3 4 5 6 7 8 9 10
Age at surgery (month)
Gender
Associated anomalies
Extent Aganglionosis
Colostomy prior to pullthrough
Enterocolitis Preoperative
Post pullthrough
10 8 3 14 5 7 4 5 5 5
Female Female Male Female Male Male Male Male Male Male
Trisomy 21, ASD, PDA Trisomy 21, ASD ASD ASD PDA Ligation
Longsegment Rectosigmoid Rectosigmoid Rectosigmoid Rectosigmoid Sub-total colonic Rectosigmoid Rectosigmoid Rectosigmoid Rectosigmoid
yes Yes Yes -
yes Yes Yes -
yes -
These specimens were divided into aganglionic and ganglionic samples. Ganglionic samples were taken from the most proximal margin of the pull-through specimen while aganglionic samples were taken from the most distal margin of the pull through specimens. Normal control samples included 10 specimens from patients who underwent sigmoid colostomy closure following anorectoplasty for imperforate anus (6 male, four female, 8–19 mo). Tissue specimens were either snapfrozen in liquid nitrogen and stored at − 80 °C for protein extraction or embedded in OCT Mounting Compound (VWR International, Leuven, Belgium) for immunofluorescence and stored at −80 °C until use. 1.2. RNA isolation from HSCR specimens Isolate II RNA Mini Kit was used for the extraction method to isolate total RNA from aganglionic and ganglionic HSCR as well as controls (n = 10 for each group) according to the manufacturer's protocol.
Spectrophotometrical quantification of total RNA was performed using a NanoDrop ND-1000 UV–Vis spectrophotometer (Thermo Scientific Fisher, Wilmington, DE). The RNA solution was stored at −80 °C until further use. 1.3. cDNA synthesis and quantitative polymerase chain reaction Reverse transcription of total RNA was carried out at 25 °C for 10 min, at 37 °C for 120 min and 85 °C for 5 min using a Transcriptor High Fidelity cDNA Synthesis Kit (Roche Diagnostics, West Sussex UK) according to the manufacturer's instruction. The resulting cDNA was used for quantitative real-time polymerase chain reaction (qRT-PCR) using a LightCycler 480 SYBR Green I Master (Roche Diagnostics, Mannheim, Germany) in a total reaction mix of 25 μl per well. The following gene-specific primers were used: Human PAR1 (Eurofins) sense primer 5′ TGCCTACTTTGCCTACCTCC and Human PAR1 anti-
Fig. 1. (a/b) qRT-PCR revealed significantly increased relative mRNA expression levels of PAR1 and PAR2 in the aganglionic HSCR specimens (n = 10) compared to normal control tissue (n = 10) (p b 0.003 by ANOVA). Results are presented as mean ± SEM. Western blotting and densitometry quantification of PAR-1/PAR-2 protein expression in HSCR specimens (n = 10) and controls. (c/d) Western blot results show that the quantitative increase of PAR-1 and PAR-2 transcripts in HSCR specimens resulted in increased amounts of PAR-1 and PAR-2 protein expression compared to normal controls. Equal loading of electrophoresis gels was confirmed by GAPDH staining. Values are given as mean ± SEM. *p b 0.05 by ANOVA.
Please cite this article as: C. Tomuschat, A.M. O'Donnell, D. Coyle, et al., Increased protease activated receptors in the colon of patients with Hirschsprung's disease, Journal of Pediatric Surgery, https://doi.org/10.1016/j.jpedsurg.2019.11.009
C. Tomuschat et al. / Journal of Pediatric Surgery xxx (xxxx) xxx
3
sense primer 5′ GTAGACGTACCTCTGGCAC as well Human PAR2 (Eurofins) sense primer 5′ GCGATCTTCTGCCATGGATG and Human PAR2 anti-sense primer 5′ AGATCAGGTACATGGCCAGG. For normalization purposes, real-time RT-PCR was performed for Glyceraldehyde 3 phosphate dehydrogenase (GAPDH). After 5 min of initial denaturation at 95 °C, 55 cycles of amplification for each primer were carried out. Each cycle included denaturation at 95 °C for 10s, annealing at 60 °C for 15 s, and elongation at 72 °C for 10s. Relative mRNA levels of gene expression were determined using a LightCycler 480 System (Roche Diagnostics). The relative changes in gene expression levels of PAR1/PAR2 were normalized against the level of GAPDH gene expression in each sample (ΔΔCT-method). Experiments were carried out in triplicate for each sample and primer.
by western blotting. Following western blotting, the membranes were blocked with 3% skimmed milk for 60 min before antibody detection. The primary antibodies; rabbit anti-PAR1 (Santa Cruz, Heidelberg, Germany) dilution 1:1000 and rabbit anti-PAR2 (Santa Cruz, Heidelberg, Germany) were used, and incubation was performed overnight at 4 °C. Following extensive washing four times in Phosphate-buffered saline (PBS - 0.05% Tween) the membranes were incubated with goat anti-rabbit IgG HRP-linked secondary Antibody (dilution 1:10000, Abcam, Cambridge, United Kingdom) followed by washing (four times in PBS-0.05% Tween). Detection was performed with the ECL Plus chemiluminescence kit (Thermo, Fisher Scientific, Dublin, Ireland). We used GAPDH (mouse anti-GAPDH, dilution 1:1000, Abcam, Cambridge, United Kingdom) as an additional loading control.
1.4. Protein extraction and Western blot
1.5. Immunofluorescence staining and confocal microscopy
Specimens of HSCR colon and control colon were homogenized in RIPA buffer (Radio-Immunoprecipitation Assay, Sigma-Aldrich Ltd., Wicklow, Ireland) containing 1% protease inhibitor cocktail (Sigma-Aldrich Ireland Ltd., Wicklow, Ireland). Protein concentrations were determined using a Bradford assay (Sigma-Aldrich Ireland Ltd.. Wicklow, Ireland). A total volume of 20 μl Laemmli Sample Buffer (SigmaAldrich, Ireland Ltd., Wicklow, Ireland) containing 10 μg protein was loaded in the 10% SDS-PAGE gel (NuPAGE Novex Bis-Tris gels, Invitrogen, Carlsbad, United States) for electrophoretic separation. The electrophoresis was performed in MES SDS (2-(N-morpholino) ethanesulfonic acid, sodium dodecyl sulfate) running buffer (Invitrogen, Carlsbad, United States). Proteins were then transferred to 0.45 μm nitrocellulose membrane (Millipore Corporation, Billerica, United Stated)
Frozen blocks of HSCR colon and normal control samples were sectioned transversely at a thickness of 10 μm, mounted on Superfrost® Plus slides (VWR International, Leuven, Belgium) and fixed with buffered 10% formalin for 10 min. Sections underwent cell membrane permeabilization with 1% TritonX-100 for 25 min at room temperature. After blocking with 5% BSA (Bovine serum albumin) for 30 min to avoid non-specific absorption, sections were incubated with primary antibodies: rabbit anti-PAR1 (1:100, BSA 5%), (Santa Cruz, Heidelberg, Germany), rabbit anti-PAR2 (1:100, BSA 5%), mouse anti-α-smooth muscle actin (1:200, 5% BSA), (Sigma-Aldrich, Ireland), mouse anti-ckit (1:300, 5% BSA) (Abcam, Cambridge United Kingdom), mouse antiPDGFRα (1:100, 5% BSA), (Santa Cruz, Heidelberg, Germany) and mouse HuD-1 (1:100, 5% BSA), (Molecular Probes) overnight at 4 °C.
Fig. 2. (a) PAR 1 and (b) PAR2 expression (green) in interstitial cells of cajal (red) of Hirschsprung's specimens compared to normal controls. C-Kit (red) was used to identify interstitial cells of cajal to show co-expression with PAR1 and PAR2 (scale bar 25 μm, original magnification ×63). (c) PAR1 and (d) PAR2 expression (green) in PDGFRα+ cells (red) of Hirschsprung's specimens compared to normal controls. PDGFRα (red) was used to identify PDGFRα+ cells to show co-expression with PAR1 and PAR2 (scale bar 25 μm, original magnification ×63).
Please cite this article as: C. Tomuschat, A.M. O'Donnell, D. Coyle, et al., Increased protease activated receptors in the colon of patients with Hirschsprung's disease, Journal of Pediatric Surgery, https://doi.org/10.1016/j.jpedsurg.2019.11.009
4
C. Tomuschat et al. / Journal of Pediatric Surgery xxx (xxxx) xxx
Sections were then washed in PBS-0.05% Tween and incubated with corresponding secondary antibodies (anti-rabbit Alexa Fluor® 488, dilution 1:1000 and anti-mouse Alexa Fluor®594, dilution 1:1000, Abcam, Cambridge, United Kingdom) for 1 h at room temperature. After washing, sections were counterstained with DAPI (4′,6diamidino-2-phenylindole) antibody, dilution 1:1000 (Roche Diagnostics GmbH, Mannheim, Germany) for 15 min, washed, mounted and coverslipped with Fluorescent Mounting Medium (DAKO Ltd., Cambridgeshire, United Kingdom). All sections were independently evaluated by two investigators with an LSM 700 confocal microscope (Carl Zeiss MicroImaging GmbH, Jena, Germany). 1.6. Statistical analysis A one-way ANOVA was conducted to determine a statistically significant difference between aganglionic, ganglionic and healthy controls. Data ± standard error. Specimens were classified into three groups: Aganglionic (n = 10), Ganglionic (n = 10) and normal controls (n = 10). 2. Results
PAR1 and PAR2 expression in HSCR patients was not significantly different from those patients who had HAEC compared to those who did. 2.2. Western blot Our Western blot results from three independent experiments showed that PAR1 and PAR2 protein was expressed in colon of patients with HSCR and the expression was (p b 0.05) (Fig. 1). Densitometry confirmed significantly increased PAR1 and PAR2 protein expression in the aganglionic and ganglionic bowel in HSCR compared to controls (p b 0.05). Equal loading of electrophoresis gels was confirmed by GAPDH staining of the stripped membranes. 2.3. Immunofluorescence staining and confocal microscopy PAR1 and PAR2 showed co-localization with Interstitial cells of Cajal and PDGFRα+ cells (Fig. 2), smooth muscle cells and the colonic epithelium (Fig. 3) as well as Confocal microscopy showed robust PAR-1 and PAR-2 expression in smooth muscles, ICCs, PDGFRα+ cells, enteric neurons and epithelium in the aganglionic and ganglionic colon compared to controls. (See Fig. 4.)
2.1. Relative mRNA expression levels of PAR1 and PAR2 in HSCR and controls
3. Discussion
The relative mRNA expression levels of PAR1 and PAR2 were significantly increased in aganglionic and ganglionic Hirschsprung's specimens compared to controls (p b 0.003) (Fig. 1).
Proteinases are abundant in the GI-tract and only the equilibrium between proteolytic activity and inhibition guarantee that the digestive function of the gut will not be damaged [17]. Proteases change the
Fig. 3. (a) PAR 1 and (b) PAR2 expression (green) in smooth muscle cells (red) of Hirschsprung's specimens compared to normal controls. α-SMA (red) was used to identify smooth muscle bundles to show co-expression with PAR1 and PAR2 (scale bar 25 μm, original magnification ×63). (c) PAR1 and (d) PAR2 expression (green) in the colonic epithelium (red) of Hirschsprung's specimens compared to normal controls. E-Cadherin (red) was used to identify colonic epithelium to show co-expression with PAR1 and PAR2 (scale bar 25 μm, original magnification ×63).
Please cite this article as: C. Tomuschat, A.M. O'Donnell, D. Coyle, et al., Increased protease activated receptors in the colon of patients with Hirschsprung's disease, Journal of Pediatric Surgery, https://doi.org/10.1016/j.jpedsurg.2019.11.009
C. Tomuschat et al. / Journal of Pediatric Surgery xxx (xxxx) xxx
5
Fig. 4. (a) PAR 1 and (b) PAR2 expression (green) in enteric neurons/ganglion cells (red) of Hirschsprung's specimens compared to normal controls. HuD1 (red) was used to identify enteric neurons/ganglion cells to show co-expression with PAR1 and PAR2 (scale bar 25 μm, original magnification ×63).
terminal domain of PARs and reveal a new, structural different domain. The structural change induces a binding signal from a coupled G-protein that finally enables a response [18, 19]. Animal studies have shown that PAR-1 and PAR-2 are the best characterized protease-activated receptors involved in signal transduction and inflammatory responses. PAR1 is activated mainly by thrombin, granzyme a, plasmin, trypsin IV,
cathepsin G and PAR-2 by trypsin, mast cell tryptase, trypsin IV and granzyme A [19]. It is essential to mention that PAR-1/2 receptors can also be activated by the same proteinases. The distribution within the gut mainly overlaps, but differences in expression reflect on their physiological function once activated. For instance, is the PAR-1 receptor is only found at the apical side of enterocytes, whereas the PAR-2 receptor
Please cite this article as: C. Tomuschat, A.M. O'Donnell, D. Coyle, et al., Increased protease activated receptors in the colon of patients with Hirschsprung's disease, Journal of Pediatric Surgery, https://doi.org/10.1016/j.jpedsurg.2019.11.009
6
C. Tomuschat et al. / Journal of Pediatric Surgery xxx (xxxx) xxx
is found at the apical and basolateral membrane of enterocytes. Once activated, the coupling to G-proteins induces the nuclear factor pathway (NFκB), which links PARs with inflammation [19–21]. PAR-1 and PAR2 mediate the release of many pro-inflammatory cytokines (IL-6 and IL-8) as well as chemokines such as CXCL1 and CXCL8 [19,22,23]. That includes the release of Il-8 in colonic epithelial cells [23]. These results are supported by Ghouzali et al., who showed that PAR-1 mediates an IL-8 exacerbation and − 2 activation in Caca-2 cells (human epithelial colorectal cells), which have been treated by agonists peptides of PARs, IL-1β and proteasome inhibitors such as bortezomib and MG132 [16]. Additionally, leukocyte migration and extravasation are linked to the activation of PAR receptors [24]. In a model of lung inflammation, it has been clearly shown that human epithelial cells after exposure to dust released significantly more pro-inflammatory cytokines than controls and that these effects were decreased by PAR-1/−2 inhibition [25]. The combined stimulation with PAR-agonists and PGE2 resulted in an additive release of IL-6 and IL-8, suggesting an essential role for PARs in early response and modulation of inflammation [26]. Interestingly, a reduction of pro-inflammatory mediators and improved survival could be achieved in a murine sepsis model due to a PAR2 deficiency and inhibitory effects of hirudin on thrombinmediated signaling [27]. Murine models of experimental colitis have shown a correlation between PAR agonist (e.g., activation) exposure and worsening of the disease with displaying of granulocyte infiltration, tissue damage and bacterial translocation [15, 18]. Bacterial pathogens such as Citrobacter rodentium or enterohemorrhagic E. coli produce serine proteases that activate PAR-2 with consecutive inflammation in the colonic epithelium [28, 29]. The activation of PAR-1 and PAR-2 induces acute colitis. However, it has also been shown that the activation of PAR-2 protects against chronic colitis [15]. The implications for HAEC and protective properties of PAR-2 are mainly speculative, but it is conceivable, that an imbalance inactivation of PAR receptors by different proteinases leads to a proinflammatory response. Mice, deficient for PAR-2 showed reduced levels of C. rodentium inflammation. This finding suggests a link for pathogen-induced host protease and PAR-2 in infectious colitis. The activation of PAR receptors by microbial proteases provides a mechanism of regulation of host cells (enterocytes) through microbes and release of pro-inflammatory cytokines [30]. That is, in so far of interest, that recent evidence suggests an altered microbiome in patients with HSCR [11]. Furthermore, the intestinal function of the colonic epithelial lining is affected by increased permeability and disruption of the tight junctions through activation of PAR-1 and PAR-2 [19, 31–33]. In the present study, we clearly show an upregulation of both PAR-1 and PAR-2 receptors in the ganglionic and aganglionic colon of patients with HSCR compared to controls. Excessive local release of PAR-1 and PAR-2 from microorganisms may trigger inflammatory responses leading to a pro-inflammatory phenotype resulting in the onset of HAEC. The abnormal ENS in patients with HSCR results in abnormal intestinal motility pattern. The increased expression of PAR-1 and PAR-2 receptors in the present study on hypertrophic nerves in the aganglionic bowel in HSCR specimens and enteric ganglion cells in the ganglionic bowel may adversely affect the ion transport across the epithelium. An increase of intraluminal Cl- secretion results in diarrhea and constitutes a prominent clinical symptom of HAEC. At least one study showed an increased chloride secretion through the activation and interplay of PAR-1 and PAR-2 and neural pathways [34]. Another effector pathway downstream of PAR activation includes mobilization of Ca2+ from the endoplasmatic reticulum into the cytosol of fibroblasts [19, 24]. The common mesenchymal origin of interstitial cells of Cajal (ICC) and PDGFRα+ cells and fibroblasts suggests an increase of Ca2+ transients in ICC and PDGFRα+ cells after PAR stimulation. It has been shown that high Ca2 + transients in ICCs affect
slow-wave currents and influence the excitability of smooth muscles [35]. In comparison, an increase of Ca2 + in PDGFRα + cells leads to an inhibitory modulation to maintain the phasic nature of contractions of smooth muscles [36]. PARs may affect the GI-motility due to an increase of Ca2 + −transients in interstitial cells. HAEC persists to be the most frequent cause of pre- and postoperative morbidity and mortality in HSCR [1]. Disruption of the intestinal barrier function which permits bacterial translocation has been developed as an attractive hypothesis in regards to the pathogenic mechanism of HAEC [37]. In this study, we show for the first time, that PAR-1 and PAR-2 gene and protein expression are significantly increased in the aganglionic and ganglionic specimens of HSCR specimens compared to healthy controls. The results of our study clearly showed that the ganglionic bowel specimens had significantly increased levels of PAR-1 and PAR-2, suggesting that the ganglionic bowel of these patients are not healthy. This finding may also explain why many patients with HSCR continue to have postoperative enterocolitis despite an adequately performed pull-through operation. However, PAR1 and PAR2 expression in HSCR patients was not significantly different from those patients who had HAEC compared to those who did. This is probably due to the low numbers of patients in our study. The upregulation of PAR-1 and PAR-2 in patients with HSCR, their possible role in early inflammatory response and intestinal permeability are supported by findings in patients with ulcerative colitis and underlines the potential relationships between HAEC and inflammatory bowel disease (IBD) [38]. Recent studies reported that patients with HSCR have an increased risk during lifetime to develop IBD compared to healthy controls, despite adequate surgery [39–41]. In conclusion, the findings of the present study implicate a role of PAR-1/−2 receptors in the development of HAEC. In light of recent data of an altered microbiome and impaired intestinal barrier function, further investigations are necessary to specify the interplay between the microbiome, proteases and PAR-1/−2 receptors on intestinal cells. References [1] Frykman PK, Kim S, Wester T, et al. Critical evaluation of the Hirschsprungassociated enterocolitis (HAEC) score: a multicenter study of 116 children with Hirschsprung disease. J Pediatr Surg 2018;53:708–17. [2] Demehri FR, Halaweish IF, Coran AG, et al. Hirschsprung-associated enterocolitis: pathogenesis, treatment and prevention. Pediatr Surg Int 2013;29:873–81. [3] Austin KM. The pathogenesis of Hirschsprung's disease-associated enterocolitis. Semin Pediatr Surg 2012;21:319–27. [4] Frykman PK, Short SS. Hirschsprung-associated enterocolitis: prevention and therapy. Semin Pediatr Surg 2012;21:328–35. [5] Gosain A. Established and emerging concepts in Hirschsprung's-associated enterocolitis. Pediatr Surg Int 2016;32:313–20. [6] Heuckeroth RO. Hirschsprung disease - integrating basic science and clinical medicine to improve outcomes. Nat Rev Gastroenterol Hepatol 2018;15:152–67. [7] Tomuschat C, O'Donnell AM, Coyle D, et al. Altered expression of a two-pore domain (K2P) mechano-gated potassium channel TREK-1 in Hirschsprung's disease. Pediatr Res 2016;80:729–33. [8] Tomuschat C, O'Donnell AM, Coyle D, et al. Reduction of hydrogen sulfide synthesis enzymes cystathionine-β-synthase and cystathionine-γ-lyase in the colon of patients with Hirschsprungs disease. J Pediatr Surg 2018;53:525–30. [9] Tomuschat C, O'Donnell AM, Coyle D, et al. Altered expression of ATP-sensitive K(+) channels in Hirschsprung's disease. J Pediatr Surg 2016;51:948–52. [10] Nakamura H, Tomuschat C, Coyle D, et al. Altered goblet cell function in Hirschsprung's disease. Pediatr Surg Int 2018;34:121–8. [11] Neuvonen MI, Korpela K, Kyrklund K, et al. Intestinal microbiota in Hirschsprung disease. J Pediatr Gastroenterol Nutr 2018;67(5):594–600. [12] Snoek SA, Verstege MI, Boeckxstaens GE, et al. The enteric nervous system as a regulator of intestinal epithelial barrier function in health and disease. Expert Rev Gastroenterol Hepatol 2010;4:637–51. [13] Palygin O, Ilatovskaya DV, Staruschenko A. Protease-activated receptors in kidney disease progression. Am J Physiol Renal Physiol 2016;311:F1140–4. [14] Saeed MA, Ng GZ, Däbritz J, et al. Protease-activated receptor 1 plays a Proinflammatory role in colitis by promoting Th17-related immunity. Inflamm Bowel Dis 2017; 23:593–602. [15] Vergnolle N. Clinical relevance of proteinase activated receptors (pars) in the gut. Gut 2005;54:867–74. [16] Ghouzali I, Azhar S, Bôle-Feysot C, et al. Proteasome inhibitors exacerbate interleukin-8 production induced by protease-activated receptor 2 in intestinal epithelial cells. Cytokine 2016;86:41–6.
Please cite this article as: C. Tomuschat, A.M. O'Donnell, D. Coyle, et al., Increased protease activated receptors in the colon of patients with Hirschsprung's disease, Journal of Pediatric Surgery, https://doi.org/10.1016/j.jpedsurg.2019.11.009
C. Tomuschat et al. / Journal of Pediatric Surgery xxx (xxxx) xxx [17] Vergnolle N, Wallace JL, Bunnett NW, et al. Protease-activated receptors in inflammation, neuronal signaling and pain. Trends Pharmacol Sci 2001;22:146–52. [18] Vergnolle N. Proteinase-activated receptors (PARs) in infection and inflammation in the gut. Int J Biochem Cell Biol 2008;40:1219–27. [19] Adams MN, Ramachandran R, Yau MK, et al. Structure, function and pathophysiology of protease activated receptors. Pharmacol Ther 2011;130:248–82. [20] Shpacovitch VM, Brzoska T, Buddenkotte J, et al. Agonists of proteinase-activated receptor 2 induce cytokine release and activation of nuclear transcription factor kappaB in human dermal microvascular endothelial cells. J Invest Dermatol 2002; 118:380–5. [21] Buddenkotte J, Stroh C, Engels IH, et al. Agonists of proteinase-activated receptor-2 stimulate upregulation of intercellular cell adhesion molecule-1 in primary human keratinocytes via activation of NF-kappa B. J Invest Dermatol 2005;124:38–45. [22] Lenardo MJ, Baltimore D, NF-kappa B. A pleiotropic mediator of inducible and tissuespecific gene control. Cell 1989;58:227–9. [23] Niu QX, Chen HQ, Chen ZY, et al. Induction of inflammatory cytokine release from human umbilical vein endothelial cells by agonists of proteinase-activated receptor-2. Clin Exp Pharmacol Physiol 2008;35:89–96. [24] Ossovskaya VS, Bunnett NW. Protease-activated receptors: contribution to physiology and disease. Physiol Rev 2004;84:579–621. [25] Romberger DJ, Heires AJ, Nordgren TM, et al. Proteases in agricultural dust induce lung inflammation through PAR-1 and PAR-2 activation. Am J Physiol Lung Cell Mol Physiol 2015;309:L388–99. [26] Asokananthan N, Lan RS, Graham PT, et al. Activation of protease-activated receptors (PARs)-1 and −2 promotes alpha-smooth muscle actin expression and release of cytokines from human lung fibroblasts. Physiol Rep 2015;3. [27] Pawlinski R, Mackman N. Tissue factor, coagulation proteases, and proteaseactivated receptors in endotoxemia and sepsis. Crit Care Med 2004;32: S293–7. [28] Hansen KK, Sherman PM, Cellars L, et al. A major role for proteolytic activity and proteinase-activated receptor-2 in the pathogenesis of infectious colitis. Proc Natl Acad Sci U S A 2005;102:8363–8. [29] Rothmeier AS, Ruf W. Protease-activated receptor 2 signaling in inflammation. Semin Immunopathol 2012;34:133–49.
7
[30] Amadesi S, Bunnett N. Protease-activated receptors: protease signaling in the gastrointestinal tract. Curr Opin Pharmacol 2004;4:551–6. [31] Cenac N, Garcia-Villar R, Ferrier L, et al. Proteinase-activated receptor-2-induced colonic inflammation in mice: possible involvement of afferent neurons, nitric oxide, and paracellular permeability. J Immunol 2003;170:4296–300. [32] Cenac N, Chin AC, Garcia-Villar R, et al. PAR2 activation alters colonic paracellular permeability in mice via IFN-gamma-dependent and -independent pathways. J Physiol 2004;558:913–25. [33] Chin AC, Vergnolle N, MacNaughton WK, et al. Proteinase-activated receptor 1 activation induces epithelial apoptosis and increases intestinal permeability. Proc Natl Acad Sci U S A 2003;100:11104–9. [34] Vergnolle N, Ferazzini M, D'Andrea MR, et al. Proteinase-activated receptors: novel signals for peripheral nerves. Trends Neurosci 2003;26:496–500. [35] Sanders KM, Ward SM, Koh SD. Interstitial cells: regulators of smooth muscle function. Physiol Rev 2014;94:859–907. [36] Kurahashi M, Nakano Y, Hennig GW, et al. Platelet-derived growth factor receptor α-positive cells in the tunica muscularis of human colon. J Cell Mol Med 2012;16: 1397–404. [37] Gosain A, Brinkman AS. Hirschsprung's associated enterocolitis. Curr Opin Pediatr 2015;27:364–9. [38] Kim JA, Choi SC, Yun KJ, et al. Expression of protease-activated receptor 2 in ulcerative colitis. Inflamm Bowel Dis 2003;9:224–9. [39] Levin DN, Marcon MA, Rintala RJ, et al. Inflammatory bowel disease manifesting after surgical treatment for Hirschsprung disease. J Pediatr Gastroenterol Nutr 2012;55:272–7. [40] Löf Granström A, Amin L, Arnell H, et al. Increased risk of inflammatory bowel disease in a population-based cohort study of patients with Hirschsprung disease. J Pediatr Gastroenterol Nutr 2018;66:398–401. [41] Nakamura H, Lim T, Puri P. Inflammatory bowel disease in patients with Hirschsprung's disease: a systematic review and meta-analysis. Pediatr Surg Int 2018;34:149–54.
Please cite this article as: C. Tomuschat, A.M. O'Donnell, D. Coyle, et al., Increased protease activated receptors in the colon of patients with Hirschsprung's disease, Journal of Pediatric Surgery, https://doi.org/10.1016/j.jpedsurg.2019.11.009