Inducible preproenkephalin DNA binding proteins in the rat striatum

MOLECULAR

AND CELLULAR

2,427-b%

NEUROSCIENCES

(1991)

Inducible Preproenkephalin DNA Binding Proteins in the Rat Striatum EDMUND HSC

Tl l-060,

Departments State University

F. LA GAMMAS

of Pediatrics, of New

York

AND GARY

WEISINGER

Neurobiology and Behavior, and Cell and Developmental at Stony Brook, Stony Brook, New York 11794-8111

Received for publication

The molecular manifestation of whole animal and cellular adaptive responses results from stimulus-secretion-synthesis coupling to selected genes. Effects are mediated through receptor-linked, signal-transduction pathways involving trams-acting nuclear proteins binding to c&r-acting DNA regulatory elements. In the current report we have identified those striatal nuclear factors that footprint to the 5’ region of the rat preproenkephalin (ppEnk) gene and how they change following ppEnk induction. These studies demonstrate binding of Spl-like factors, as well as members of the Jun and Fos families of proteins. Unique footprints were also noted in the ppEnk-induced state in the region of GGTGGGGGAGCCTCCGG (-191 to -175) overlapping the consensus binding site for the brain-specific transcription factor @; a functional DNA element for the rat ppEnk gene. These observations illustrate that DNA-protein interactions both before and after gene induction can be resolved even in complex primary structures of the central nervous system. 0 1991 Academic Press. Inc.

INTRODUCTION

Complexity in the control of eukaryotic gene expression results from the interplay of a multitude of signal-transduction pathways with trans-acting nuclear factors interacting at an array of &-acting promoter elements [see reviews (30, 31, 43, 45)]. Since differences in type, availability, and ratio of endogenous transcription factors clearly exist between cells, relatively small differences in factor levels may result in synergistic, independent, or even opposing effects on gene expression in various tissues (e.g., the inhibition of c&n effects by Jun-B (3, 9, 57)). Although well studied in established cell lines in vitro, few of the issues regarding transcription factors and gene expression have been addressed for neuronal genes in the intact nervous system in Go. To approach this subject, we selected a transmitter gene for analysis in the intact animal. We chose a transmitter gene because of the fundamental importance of these biochemical messages in

June

Biology

17, 1991

overall brain function, as maturational signals during development, and in stress responsiveness (4, 23, 36, 37). Preproenkephalin (ppEnk) is a well-studied neuropeptide model of transmitter gene expression in a number of cell systems (11,13,14,28,29,33,36-38, and others). Its tissue-specific expression in primary cells involves cellspecific processes’governing RNA initiation and start site usage (33,65), RNA splicing (20,33,47,67), and, possibly, other mechanisms of regulation such as attenuation and/ or stabilization of the RNA transcripts. Additionally, in the nervous system, differences in tissue-specific expression are dramatic. For example, basal levels of ppEnk mRNA are at least lo-fold higher in the rat striatum than in the adrenal medulla (46). In contrast, although both respond to cholinergic and dopaminergic stimuli (1,2,23, 36,51,65), choline&c-inducible expression in the adrenal medulla can be augmented as much as lOO-fold (J. D. DeCristofaro, G. Weisinger, and E. F. La Gamma, Society for Neuroscience, Abstract 397, 1990; manuscript submitted). On the other hand, the maximal striatal increase in ppEnk RNA initiation is lo- to 15-fold as determined by Sl nuclease analysis following cholinergic treatments or handling stress (26, 27, 65). These observations implicate transcription initiation control mechanisms that may be neuronal cell type specific. The region of the human ppEnk gene binding APl transcription factor complexes (5,42) is essential to human ppEnk expression (as determined in heterologous transfection experiments) and is well conserved in the rat (14, 53). In view of this, the lo- to 15-fold induction of striatal ppEnk following choline+ drug treatment or handling stress (65), and the abundance of high expressing primary tissues [40% of cells positive after induction (63)], we undertook a study of basal and cholinergic drug-treated rat striatal nuclear factors that bind to the rat ppEnk promoter. Evidence is provided for striatal-derived Spllike, Fos-like, Jun-like, and other unique binding factors (e.g., 0) that footprint within the rat preproenkephalin promoter after induction. METHODS

Animal and whole animal treatments. g-week-old

1To whom correspondence should be addressed. 427

Sprague-Dawley

Groups of 8- to rats (Taconic Farms, Ger-

1044-74x/91 $3.00 Copyright 0 1991 by Academic Press, Inc. All rights of reproduction in any form reserved.

428

LA probe

tRNA

To

GAMMA

AND

N+O

WEISINGER

(homogenization buffer minus Triton X-100). Nuclear protein extraction was performed by resuspending the pellet in 0.1 ml of extraction buffer (50 mM Tris-HCl, pH 7.5,420 mM KCl, 5 n&f MgC&, 1 mM EDTA, 2 mM dithiothreitol (DTT), 0.1 mMphenylmethylsulfony1 fluride (PMSF), 20 mM NaF, 10% sucrose, and 20% glycerol) and incubating it for 1 h at 21°C. These nuclei were then subject to centrifugation at 12,700g at 4°C for 15 min. This supernatant was designated as the nuclear extract. This nuclear extract was snap frozen in liquid nitrogen as 20-~1 aliquots and stored until use at -80°C. Protein concentrations were determined using the method of Bradford (6). Labeled fragment preparation and gel retardation assay. A 299-bp XmnI-Sac1 fragment (-248 to +50), a 166-bp XmnI-PuuII fragment (-248 to -82), a 133-bp Bspl286-PuuII fragment (-213 to -82), or a 71-bp AuaIPvuII fragment (-153 to -82) of the 5’ untranscribed region of the rat ppEnk gene (39,53) were isolated from the plasmid pHU126 (provided courtesy of Dr. Haim Ro-

Striatum FIG. 1. Cholinergic initiation of striatal ppEnk transcripts. Sl protection assay showing the induction of the predominant E3 and E4 start sites following cholinergic agonist treatment for 4 days [see Methods and Ref. (65)]. Newly initiated transcripts increase more than lo-fold over baseline. tRNA lane shows no nonspecific bands; Probe is the result of RNA extracted from the striatum in the basal state with no Sl treatment; N + 0 (nicotine + oxotremorine) is RNA from the cholinergic drug-treated state. The positions of start site E3 (top set of bands) and site E4 (bottom set of bands) in the T, lane are slightly higher than those in the N + 0 lane due to temperature gradients across the gel [see Ref. (65)].

mantown, NY) were treated with nicotine (5 mg/kg SC q12h), oxotremorine (1 mg/kg SCq12h), both agents, saline vehicle, or no drug for 4 days (l&65). Twelve hours after the last injection the animals were sacrificed by COP narcosis/asphyxiation and brain striata were microdissected (39). Sl nuclease protection assay. Sl nuclease protection assays were used to evaluate start site usage and level of induction as described in Weisinger et al. (65). Nuclear extract preparation. Nuclear extracts were prepared using a protocol adapted from Dignam et al. (19, 39). Striatum (50 mg) was gently homogenized in 0.5 ml of homogenization buffer (50 mM Tris-HCl, pH 7.5, 1.5 mM MgC12, 2 mA4 2-mercaptoethanol, 10 mA4 NaF, 200 nut4 sucrose, and 0.1% Triton X-100) in a 1.5-ml Eppendorf centrifuge tube with 15 strokes of a hand-held, molded acrylic pestle. Cellular ghosts were allowed to swell on ice for 5 min, followed by five further pestle strokes. Nuclei were pelleted for 5 min at 16OOg at 4°C and the supernatant was saved as the “cytosolic” fraction. The remaining pellet was washed twice in 0.5 ml wash buffer

<

A3

<

A2

<

Al

FIG. 2. Gel retardation banding patterns before and after cholinergic drug treatment/handling stress. Gel retardation assays comparing striatal extracts from basal and cholinergic agonist (see Methods for dosage) treated rats using the radiolabeled 166-bp XmnI-PuuII ppEnk fragment (-248 to -82) from the rat promoter (numbering in all figures refers to Rosen et al. (531, see our changes in Fig. 8). The treatments are indicated above the lanes and refer to the animal groups used as sources for nuclear extract. The control lane is probe without any extract added. The letters on the right-hand side are for band identification in each of the lanes. The same labels are used throughout this study. Note that the doublet on either side of the arrow at B is later footprinted as a single region. At the level of gel shift resolution, no major differences in shifted bands can be detected between the different treatments although all treatments are associated with increased levels of ppEnk RNA.

INDUCIBLE STRIATUM:

ppENK

DNA BINDING

299 bp Probe

Extract

0

+

+

+

+

+

+

+

+

Competitor

0

0

+

+

+

+

+

+

+

SPl? SP17

FIG. 3. Spl or Spl-like molecules from rat striata bind to the rat preproenkephalin (ppEnk) promoter. Competition gel shift assay (SV40 regulatory region competition fragments) using the 299-bp XmnI-Sac1 fragment of the rat ppEnk promoter (-248 to +50) and striatal nuclear extracts from untreated rats. Competition was evident for two bands in the region of A2 and A3 (see nomenclature in Fig. 1) where the competing fragment contained the SV40 promoter (see Methods for description of SV40 fragments). Competition was significant for the SV40 promoter and proportional to the molar ratio of the DNA fragment. Compare lanes marked “Promoter + Enhancer” (50-fold excess) vs “Promoter Only” (35-fold excess) to intensity of bands in other lanes. No gel shift is noted when proteinase K is incubated with the extract during the binding reaction (39). The elimination of all gel shifts after proteinase K treatment indicates that DNA binding factors in retained bands are proteins.

sen, Jerusalem, Israel). These fragments were labeled at one end only with [T-~~P]ATP (NEN, 3000 Ci/mmol), using standard 5’ end-labeling techniques with T4 polynucleotide kinase after treatment with bacterial alkaline phosphatase (55). Unincorporated counts were removed by Sephadex G-50 spin column chromatography, followed by 5% polyacryamide gel electropharesis in TBE (25 m&f Tris, 25 n&f boric acid, and 0.5 n&f EDTA-Na2 - 2H20), autoradiography, and electroelution of the fragment. The eluted fragment was then treated with proteinase K, phenol-chloroform extracted, ethanol precipitated, and resuspended in 10 mM Tris (pH 8), 1 mh4 EDTA at 20 cps/ ~1 (hand-held Geiger counter). All labeled fragments were stored at -2O’C. The 5’ ppEnk probe (5-10 ng) was incubated at 21°C for 30 min with 5-10 c(g of nuclear extract in binding buffer (10 mM Tris-HCl, pH 7.5, 1 mM DTT, 1 n&f poly(dAEDTA, 5% glycerol, and l-4 pg poly(dA-dT) dT) (Pharmacia) in 10 mM Tris-HCl (pH 8). When antibodies (anti-Fos provided courtesy of Dr. Tom Curran, l

429

PROTEINS

Nutley, NJ, and anti&n from Dr. Dirk Bohman, University of California, San Francisco) or DNA competitors were used, they were added to the incubation mixture before the labeled ppEnk probe was added. The entire mixture was then resolved by electrophoresis through a 4% polyacrylamide gel in TAE (6.7 mM Tris-HCl, pH 6.8,3.3 mM sodium acetate, and 1 mM EDTA) at 150 V (constant voltage) with recycling buffer for 90 min (39, 66). Gels were dried and routinely autoradiographed for 12-24 h. DNA competitor fragments. DNA fragments, other than the XmnI-Sac1 and XmnI-PuuII ppEnk fragments used in the competition experiments, were derived either from pSV2CAT (22) or from plasmids (kindly provided by Dr. Walter Schaffner, Zurich, Switzerland) pJ2/3 (SV40 enhancer Core C), pJ193/8-2 (SV40 enhancer Core SphI), and pJ195/7.5 (SV40 enhancer Core PuuII) (56). The fragments from pSV2CAT were the 520-bp HindIII-AccI (SV40 enhancer and promoter), the 72-bp SphI-SphI (SV40 enhancer), and the 193-bp HindIIISphI (SV40 promoter) fragments. The plasmids from Dr. Schaffner were prepared as suggested (56). These fragments were used primarily because they are well studied and because of the availability of multimers of the enhancer region domain to allow for high molar ratios for binding site competition experiments. Methyl&on interference footprinting. End-labeled DNA fragments were partially methylated at purine residues by a modification (66) of the method of Maxam and Gilbert (43a), in which the dimethyl sulfate reaction was allowed to proceed for 3 min at 20°C and then was quenched with 1.5 M sodium acetate (pH 7), 1.0 M 2mercaptoethanol, and 0.1 mg/ml of poly(dA-dT) poly(dA-dT). The methylated DNA was precipitated twice with ethanol, washed with 70% ethanol, dried, and resuspended in 10 mM Tris-HCl (pH 8) and 1 mM EDTA. A 5-fold scaled-up DNA binding reaction between the methylated DNA and the striatal nuclear extracts was subjected to low ionic strength polyacrylamide gel electrophoresis (described above) after allowing 30 min for the binding to occur. After overnight autoradiography of the wet gel, the appropriate retained bands as well as the unbound DNA were recovered. The DNA from each band was electroeluted, phenol-chloroform-isoamyl alcohol extracted, precipitated with 20 pg yeast tRNA and 0.3 M sodium acetate (pH 7), and washed with 70% ethanol (-20” C) followed by vacuum drying and resuspension in 0.1 ml of 1.1 M piperidine. Reactions were incubated for 60 min at 90°C and the piperidine was removed by two ethanol precipitations and two l-ml 70% ethanol washes (66) as opposed to repeated lyophilizations in water. Equal amounts of radioactivity were subjected to electrophoresis through either 8 or 10% polyacrylamide-7 M urea sequencing gels (0.2 mm thick), followed by autoradiography at -70°C with an intensifying screen. When there was a need to validate the DNA sequence of the ppEnk probes used they were subcloned into Ml3 l

430

LA

GAMMA

AND

WEISINGER

166 bp 166 bp

-249

-81

-81

EXTRACT

0

c Fos Ab

00

++ +

FIG. 4. Basal rat striatal extract: Fos and Jun antibody competitors. Fos (left panel) and Jun (right panel) antibody competition gel retardation assays using striatal extracts from untreated (i.e., basal) rats and the rat 166-bp ppEnk promoter fragment (-248 to -82). Antibodies were used at a l/20 dilution of whole serum in each experiment and were added last to the binding reaction. A single high molecular weight Fos antibody competable band (left panel; arrowhead) was detected at the top of the gel only on long exposures. Neither the Fos antibody nor the m-peptide interact with fragment. The Jun antibody (right panel) competed two bands (A2 and A3) but not the lowest band on the gel (Al; see Fig. 1 for nomenclature of bands) from basal striatal extracts (bands identified by arrowheads). The antibody is directed at the non-DNA binding, COOH terminal of the Jun protein and appears to displace the two original band shifts (A2 and A3) to a higher region of the gel (visible at the top of the gel in last lane in the right panel; no arrowhead). This high molecular weight retained band is presumably a DNA/extract/antibody complex which is commonly referred to as a “super-shifted band.” In contrast, high concentrations of Jun antibody, in the absence of striatal extract (i.e.,
vectors (mp18 and mp19) and sequenced using standard dideoxy protocols (Sequenase II, USB). Reacted DNA fragments were resolved as above by electrophoresis and read after autoradiography. RESULTS

Drug Treatments, Nuclear Extracts, and Choice of Promoter Fragments Using conditions we previously defined for preparing primary rat tissue nuclear extracts (39), we demonstrated that ppEnk expression in rat chromaffin (low basal ppEnk expression) and brain striatum cells (high basal ppEnk expression) is correlated with tissue-specific nuclear factor binding patterns (39). In view of the major choline@ inputs to the striatum [see reviews (1, 23, 51)] and the more than lo-fold treatment associated induction of ppEnk RNA [Fig. 1; DeCristofaro et al., personal communication; Ref. (65); and the reports of other investigators (26,27)], we evaluated whether cholinergic agonisttreated rats evoked selective binding of different striatal nuclear factors to the ppEnk promoter. In this setting, although the gene is induced, additional studies are necessary to confirm the pharmacological specificity of the

cholinergic receptor basis of these responses. This can be evaluated best in tissue culture experiments where effective agonists and antagonists can be further analyzed in the absence of the blood-brain barrier. As summarized in the cartoon in Fig. 8, initial studies were performed using the same 299-bp XmnI-Sac1 ppEnk promoter region fragment [ -248 bp 5’ to +50 bp 3’ of the previously reported RNA cap site (53); “E4” start site in our report (65); see Fig. 8 for comparison of both numbering systems] as in our previous report (39). This fragment was cut in two parts and subsequent studies were carried out using both a 166-bp XmnI-PuuII fragment (-248 to -82 bp) and a 133-bp PuuII-Sac1 fragment (-81 bp 5’ to +50 bp) as end-labeled probes. Essentially no binding was seen using the smaller 133-bp fragment, hence essentially all of the data in the present study was generated using the 166-bp XmnI-PvuII fragment (-248 to -82), which contains homologous sequences to the human ppEnk CAMP and phorbol ester-inducible enhancer (11, 13,14,39,53). The absence of binding to the 133-bp fragment (PuuII-SacI) may indicate that the putative striatal factors in this region may be too unstable to bind under the conditions of study. However, in our other studies, we found that adrenal medullary nuclear extracts bind to this region (35a).

INDUCIBLE

ppENK

DNA

BINDING

PROTEINS

431

in affinity to be resolved by gel shift assay or, more simply, there was no change in factor affinity associated with this DNA fragment. These possibilities were further addressed by competition gel shift experiments as well as by dimethyl sulfate (DMS) interference DNA footprinting.

Spl-like Factors Are Present in Rat Striatum

< < <

0 A3

<

A2

<

Al

FIG. 6. Cholinergic agonist-treated rat striatal extract: Fos and Jun antibody competitors. Fos and Jun antibody competition gel retardation assays using striatal extracts from combined nicotine + oxotremorine-treated rats with radiolabeled rat ppEnk 166-bp fragment (-248 to -82). The antibodies were used as a l/20 dilution of whole serum (as in Fig. 3, see legend). In extracts from the cholinergic agonisttreated rats, even at long exposures (not shown), no high molecular weight Fos complexes were found in the nicotine + oxotremorine lane (N/Ox; compare to Basal lane). In fact, lower molecular weight complexes (possibly composed of the antigenically related Fos-related antigens; FRAs) were now observed to be competed by the anti-Fos antibody (note the new disappearance of the B dublet (smaller arrowheads) in the Fos antibody lane, which were not competed in the Basal state Figure 4). Jun was much less competable in these extracts, bands A2 and A3 (larger arrowheads) do not shift upward as in Fig. 3. Moreover, in the anti-&n lane, note the appearance of multiple, intense new bands not seen in the basal state (compare with Jun antibody lanes in Fig. 3). The band in the Jun antibody lane (at the upper arrowhead of the B doublet) comigrates with the high molecular weight band in the Jun antibody lane of Fig. 4, consistent with a so-called “super-shifted band.” The intense band at the top of the gel in the Jun antibody lane is unique to the induced state when antibody is present and may represent another super-shifted band.

Following each individual drug treatment (except in saline-treated control rats), animals displayed stereotypic behavioral responses which included head bobbing, tremulousness, tearing, and catatonia that persisted for up to 1 to 2 h before the animals returned to a freely moving and feeding state. Post-treatment behavioral patterns persisted for 1 to 2 h even after 4 days of cholinergic drug treatment. At the conclusion of the drug schedule, rats were sacrificed and extraction of striatal nuclear proteins was performed. No changes were detected in the position of retained striatal nuclear extract bands as visualized by gel retardation assay (Fig. 2). At the same time, a lo- to 15-fold rise in ppEnk RNA initiation was observed using Sl nuclease analysis [Fig. 1 and (65)]. This lack of change in gel retention patterns could be due to at least two possibilities. Either the changes were too subtle or too weak

To help identify which “native” striatal nuclear factors interact with the rat ppEnk promoter region, we conducted two types of competition gel shift experiments [oligonucleotide competitors (Spl studies; this section) and antibody competitors (Fos/Jun studies; next section below)]. As described in our previous report (39), standard gel shift studies were initiated using the same 299-bp XmnI-Sac1 ppEnk promoter region fragment (-248 bp 5’ to +50 bp). Subsequently, competition studies were performed using several regions of the SV40 early promoter and enhancer (Fig. 3). Those competitor fragments containing the SV40 early promoter were effective competitors; those containing multimers of the enhancer were not (lanes marked Promoter + Enhancer and Promoter Only). Competition was proportional, since bands were completely deleted at a 50-fold molar excess (lane marked: Promoter + Enhancer); but only partially competed at a 35-fold molar excess of the competing DNA fragment (lane marked Promoter Only; Fig. 3). As the SV40 promoter has five repeated binding sites for the transcription factor Spl (31), an Spl-like factor is likely to be present in nuclear extracts of the rat striatum. Indeed, only these two bands (A2 and A3) footprint an SPl consensus sequence (see below and Fig. 7). However, it is unlikely that the SPl protein per se is present in these extracts since the mobility shift we observed is well below that of the recognized molecular weight for SPl of approximately 100 kDa (31). Hence, a nuclear protein with similar binding characteristics must exist in the striatum. To also demonstrate specificity of binding to the ppEnk promoter, we performed a gel shift assay in the presence of a 50-fold molar excess of other specific and nonspecific fragments of DNA. As expected, unlabeled (“cold”) competitor ppEnk DNA fragment effectively competed for labeled ppEnk DNA binding for all nuclear factors (Fig. 3, last lane on the right: Cold 299-bp probe). This indicated that visualized bands in the other lanes resulted from ppEnk sequence-specific factor interactions. Similarly, no effect on retained banding pattern was visualized when using various concentrations of nonspecific DNA [e.g., poly(dA-dT) and poly(dI-dC) (39)].

Rat Striatal cFos-like and cJun-like Bind to 5’ ppEnk Sequences The transcription factor APl, from HeLa cell nuclear extracts (5,42), was shown to bind to the cAMP/phorbol ester inducible element, upstream of the human ppEnk gene (11, 12,61). In this second type of competition experiment a specific anti-Fos antibody [raised against the

432

LA STRIATIJM: G

F

A2

A3

BASAL

AND

(coding

strand)

WEISINGER

B CRE

I

-159

GAMMA

1 +

2

ITGGCGTp?GGGCaTGCGTCAI

?

AGCGTCGACAC

I

?

ACGTCCCC

I

SPl

CCCGCC

-173 -182 -189

STRIATUM:

BASAL

(non-coding

strand)

-215

-154

-

-142

-

7

TCTCAAAGATT

7

GAGCCCCCGGCGCACGACACCCCTGCA

we* h-m.1

-

- 87

FIG. 6. Basal striatal extract: DMS footprint. Basal striatal extracts were incubated with a #end-labeled (T4 kinase), partially G-methylated, XmnI-PvuII ppEnk fragment (166 bp: -248 to -82); labeled at the XmnI end [i.e., the coding strand (top)] or at the PuuII end of a similar fragment [133 bp: -213 to -82; Bspl286-PuuII fragment (bottom); i.e., noncoding strand]. The letters above each lane represent various band complexes that migrate to regions indicated in Fig. 1. The letters G and F (top and bottom panels), above the first two lanes, represent the protein free Maxam and Gilbert G > A reaction alone: G for the purified ppEnk probe, or F for the eluted, unretained “free” ppEnk band The other bands are defined in Fig. 1. Sequences footprinted are summarized to the right of the gel and are illustrated as a vertical cartoon stick figure with boxes representing larger protected regions. Note, bands that are present in the “G” ladder but not in the lanes that were reacted with nuclear extract indicate that a protein-protected point of contact exists between the nuclear protein and the DNA fragment. This results from an unmethylated species of probe interacting with the protein in that previously gel shifted band. The protected (i.e., “selected”) DNA is not susceptible to cleavage by piperdine in the footprint part of the assay. (Top) Using the basal extract, footprinting was evident on the coding strand over the CAMP and phorbol ester enhancer region (-101 to -83, CRE 1 + 2, top) as well as just 5’ to this region at AGCGTCGACAC

INDUCIBLE

ppENK

DNA

m-peptide of Fos protein (16)] or an anti-Jun antibody [anti-PEPB, COOH terminus directed (5)] was added to the reaction mixture to assess the relative contributions of the Jun-like and Fos-like proteins to the gel retardation patterns seen in Fig. 2. Typically, anti-Fos antibodies competed for a high molecular weight band in basal striatal extracts when using the 166-bp probe (Fig. 4, left panel, third lane; seen on long exposures-shown). Fos antibody alone or the mpeptide showed no banding (Fig. 4, left panel). In contrast, when using striatal extracts from cholinergic agonisttreated rats (Fig. 5), lower molecular weight complexes were competed by anti-Fos in the region of the doublet labeled B (Fig. 5, lane 4). Additionally, although an anti-Jun antibody competed for all bands except for Al in basal extracts (Fig. 4, right panel); this was not the case when extracts from cholinergic-treated rats were used (see lane marked cJun Ab, Fig. 5, lane 5). In striatal extracts from the cholinergic agonist-treated animals, not only was band Al not competable by the cJun antibody, but now, even the A2 and A3 bands were not eliminated. In both cases, the A2 and A3 bands show footprints over the region of the CRE2 site [APl site (11, 6); see Fig. 3 or below]. An increased number of bands in the Jun antibody lane of agonist treated rats suggested that either Jun-like striatal binding factors show a greater affinity for the DNA during induction or that a different population of factors was present. The overall increase in the number of new bands seen when using extracts from cholinergic-treated rats and incubated with the cJun antibody is consistent with a greater complexity of binding protein/DNA interaction in the induced state than in the basal condition (compare Fig. 4, right panel to Fig. 5). This is also reflected in an increased number of DMS-footprinted regions (compare Figs. 6 and 7; Table 1). One source of increased complexity may result from a mixture of low affinity homodimers (Jun/Jun) and high affinity heterodimers (Jun/Fos or Jun/Fos-related antigens) simultaneously binding to the ppEnk DNA as various subpopulations of protein complexes (see Discussion). Methyl&ion

Interference

(DMS) Footprinting

To further validate the potential interactions of Spllike, Fos-like, and Jun-like nuclear factors with the rat ppEnk promoter region and to deduce the footprinted sequence of other regions within the fragment, methylation interference footprinting experiments were performed (Figs. 6 and 7). For these experiments partially methylated

BINDING

PROTEINS

433

5’ 32P-end-labeled XmnI-PuuII (-248 to -82 labeled at the XmnI end), Bspl286-PuuII (-213 to -82), or AuaIPuuII (-153 to -82; labeled at the PuuII end) were used with extracts from both basal or combined nicotine + oxotremorine-treated rats. Individual retained bands were cut out of the wet gel following a gel shift experiment and processed separately to determine the footprinting pattern that led to their gel retardation (see Methods and legends to Figs. 6 and 7 for details). The nomenclature used in Figs. 6 and 7 reflect the banding pattern seen and defined in Fig. 2, except when the 71-bp Au&PuuII fragment (-153 to -82) was used. In the case of the 71-bp fragment, only one band was resolvable in the wet gel (labeled R to distinguish it in Fig. 7, bottom). In the basal state, as predicted by the previous series of competition studies (Figs. 3, 4, and 5), methylation interference footprint analysis revealed protected regions at sequences such as CRE 1 and 2 and at a Spl binding site (Fig. 6, top; lanes A2, A3, and B; Table 1). An example of two new sequences, whose functions remain to be determined, were footprinted in basal extracts at AGCGTCGACAC and ACGTCCC (Fig. 6, top; Table 1). These sites were present in the induced state as well (Fig. 7, top) and lie just 5’ of the CAMP and phorbol ester enhancer homology (CRE 1 and 2; Figs. 6 and 7, top). In addition, two enhancements were visible only in band B of the basal state and mapped next to CRE 1 in the region -105 to -102 and the other at -124, respectively. When the noncoding strand of the same ppEnk promoter fragment was used, three weak footprints were observed in lanes A2 and A3 (Fig. 6, bottom; no B band could be seen on overnight exposures of wet gels because of quenching of counts by the buffer). As in the coding strand, a protected site was evident just 5’ to CRE 2 as were two weaker protected regions indicated to the right of the autoradiograph (Fig. 6, Lanes A2 and A3; at the question marks; positions -154 to -128 and -207 to -197). There were no strongly footprinted bands in lane A3, although a very large region from approximately -215 to -120 showed a faint footprint. In the induced state (cholinergic drug treatments), footprints were still present but appeared stronger in the region of the CRE and at the Spl consensus sequence sites (one Spl site was protected using basal extracts and at least two sites with the induced extracts; compare Figs. 6 and 7, top; Table 1). In addition, the enhancement at -105 to -102 was no longer visible in lane B after cholinergic treatments (compare Figs. 6 and 7, top). Of interest is the newly recognized binding site visualized again

(-116 to -106; indicated by the ? in lanes A2, A3, and B, top; see Fig. 8 for our corrections to this sequence). Other protected regions present as weak footprinting over the SPl consensus primarily in lane B (top, centered around -159) and a second weak footprint at sequence ACGTCCCC at -131 to -124 in lanes A3 and B (top, indicated at the ?, centered around -129). The functional significance of the two regions indicated by the ? to the right of the panel remains to be determined. (Bottom) Only three weak footprints are noted on the noncoding strand (bottom) just 5’ to CRE2 at -91, in the region of -154 to -128, and between -207 and -197 in lane A2. A larger weak footprint is visualized between -215 and -120 in lane A3 only (see Results and Discussion for additional details).

434

LA

GAMMA

STRIATUM: G

F

Al

A2

A3

Nicotine

Nicotine (non-coding

F

WEISINGER

+

Oxotremorine

+

Oxotremorine

(coding

strand)

B

STRIATUM:

Ci

AND

strand)

R

CACGACACCCCTGCA

I

,-MC w-loo)

CREP

FIG. 7. Cholinergic-treated rat striatal extract: DMS footprint. This experiment was performed as described in the legend to Fig. 5 and under Methods except that the extracts used were from combined nicotine + oxotremorine-treated rats. Coding strand footprints (top and middle) were generated from the 166-hp XmnI-PuuII fragment (-248 to -82), 5’ end-labeled at the XmnI end. Noncoding strand footprints (bottom) were generated from the 71-bp Au&PuuII fragment (-153 to -82), 5’ end-labeled on the PvuII end Lanes G and F are Maxam and Gilbert G > A reaction for the parent probe (G) and the electroeluted free ppEnk probe (F) reacted with piperdine as in Fig. 5. (Top) A newly protected region, not previously recognized in the basal state, was observed in the region of GGTGGGGGAGCCTCCGG in lane A2 (around position -182), whereas AGCGTCGACAC (-116 to -106, in lanes A2, A3, and B) was visualized under both conditions (see Fig. 8 for our corrections to this sequence). Clear footprints were also noted over two Spl sites in A2, A3, and possibly B. Other regions are noted as indicated. The CRE region showed strong footprints in lanes A2, A3, and B without the intensification seen in Fig. 6 (lane B). See Results and Discussion for further comment. (Middle) The middle panel is a shorter exposure autoradiograph of the upper portion of the gel shown andis included to allow better visualization at the individual base level at the top of the gel. (Bottom) Only very weak footprints were evident on the noncoding strand (lower panel) at CRE2 with a second site noted at -142 to -128 (lane R, indicated by the question mark to the right of the autoradiograph). The lane was marked R since it was the only band visible in the wet gel in the gel retention assay portion of the protocol.

INDUCIBLE

ppENK

DNA

in the region of sequence ACGTCCC (-131 to -124 in lanes A2 and A3, centered around the missing G band at -129 in the induced state; Figure 7-top and middle). A similar site in the region of GGTGGGGGAGCCTCCGG (-191 to -175, centered around the missing G band at -182, Figure 7-top) was also evident further upstream and appeared in lane A2 only after choline@ drug treatment (Fig. 7, top; Table 1). These sequences are known to bind the brain-specific transcription factor p (34, 52) and both share binding characteristics with the consensus sequence for NF-kB [B-sequence: GGGGACTTTCC (34,

BINDING

435

PROTEINS

an increased complexity of binding protein/DNA interaction. In the course of conducting these experiments, we noted certain differences with the reported sequence of the rat ppEnk promoter (53). This finding was commented on by other investigators as well (33,34). Consequently, we resequenced this region (dideoxy method, Sequenase II kit, USB, OH; EMBL Accession Number X59136), and our corrections to this sequence, around the cAMP/phorbol ester enhancer homologous region, are reported in the legend to Fig. 8 with both numbering schemes.

WI.

When the noncoding strand was evaluated in conjunction with striatal nuclear extracts from the induced state the CRE 2 again showed a weak footprint in the only band visible on the wet gel of the retention assay (Fig. 7, bottom; Table 1). A second footprint was also evident between -142 and -128 (Fig. 7, bottom; at the question mark) in both the basal and the cholinergic drug-treated state. It is also of interest that Al (lowest molecular weight band footprinted in Fig. 7, top) shows no protected sequences over the 3’ half of the probe. The progressively higher molecular weight bands, when viewing the gel from bottom to top (slower mobility at top), are a rough estimate of relative molecular weight (Al < A2 < A3 < B) showing additively more protected regions consistent with

DISCUSSION

Mechanisms linking neural excitation and transmitter release to alterations in gene expression (i.e., stimulussecretion-synthesis coupling) constitute an important axiom of regulatory neurobiology. In this report steadystate levels of preproenkephalin RNA were changed using various combinations of stress and cholinergic agonist treatment as previously described by us [Fig. 1; J. D. DeCristofaro, G. Weisinger, and E. F. La Gamma, personal communication; Society for Neuroscience Abstract 397,199O; and Ref. (65)] and other investigators (26,27). After induction, the interaction between rat striatal nuclear factors with the rat ppEnk promoter were characterized. In these in uivo studies, we demonstrate DNA-

TABLE Summary Region

1

of Footprints

Basal

Cholinergic-induced

CREl+S

-lolTi%C&TA

6&&C

T&%TCA-”

CCC&G

ACGCAGT

Enhancement

ACCGCAT -W~GGGC-~M

region

-lOIT&k&TA ACCGCAT

&%CC

T&%TCA-”

CCC&G

ACGCAGT

CCCG -u6Ak6TC&ACAC-‘06 TCGCAGCTGTG

1 (3

-116A&ChTC8ACAC-‘Op TCGCAGCTGTG 4 -117 -122cc(-&c GGGCGG

“Beta

-“gCTGTGGGGAC&TCCCC+

2”

-iz4

GACACCCCTGCAGGGG -‘“CTCGGGGGCCGCGTGCTGTGGGGAC-‘”

2 (-3

GA&CCCCC&%CAC~ACACCCCTG -162c(y~cc-l57

SPl

GGGCGG

&ACACCCCT&A&GGG + Strand: No footprint - Strand:

NE

-163ccc~cc-167

- Strand:

NE

-‘BBCTC6CAC-162 - Strand: NE

3 (-2 “Beta

-‘“CTGTGGGGAC&TCCCC-i2’

-1Q1e~~e88GGA~~~~eCeG-17s - Strand: NE

1” -x’7AGAGTTTCTAA-187

4 (2

TCTCAAAeATT Note. The table is organized strand, bottom is the “minus”

from (3’-5’)

top to bottom in a 3’ (-82 bp) to 5’ (-249 bp) fashion. strand. 4, Base position of enhancement; G Footprinted

Top strand of each sequence G; NE = not examined.

is the “plus”

(5’-3’)

436

LA

El E2

GAMMA

AND

E3E4

-

20bp

FIG. 8. Unique features of the rat ppEnk promoter. In the course of these experiments we identified several differences with the previously published sequence of the rat ppEnk promoter (53). Our version is as follows (note that the underlined letters or spaces (deletions) are our corrections; EMBL Accession Number X59136): 5’CCAGCGTCGGAC@ZGGGCTGGCGTAGGGC TGCGTCAGCTGCAGCCCGTGGCATT3’ The sequence represents the region between -72 and -22 5’ of the first rat RNA cap site that we call El (65) or equivalently, at position -118 to -63, according to the numbering system of Rosen et al. (53). The figure compares numbering classification systems using our nomenclature based on the El start site as +l (top number in the parentheses) to that of Rosen et al. (53) (bottom number in the parentheses) which places the start site, by computer homology to the primary human RNA start site, further downstream at our E4 site. Restriction enzymes: X, Xmnl; B, Bsp1286; A, AvaI; P, PvuII; S, SacI; numbers 1 and 2 refer to CRE 1 and CRE 2 after Comb et al. (12).

protein interactions consistent with the involvement of many previously described truns-activators including SPllike, Fos-like, and Jun-like proteins. In the case of SPl, our interpretation of an SPl-like factor is based on several findings. There are two bands (Bands A2 and A3) competed by the complicated SV40 promoter (which contains five SPl consensus sequence repeats) in Fig. 3. It is these two bands (which comigrate to the same position using the 166-bp probe) that reveal an SPl footprint as well as other protected regions. Moreover, the Al band does not show a footprint at the SPl site (nor at the CRE), consistent with the specific nature of the interaction at the A2 and A3 bands. We also observed binding for Jun-like and Fos-like (30, 31, 43, 45) proteins in the A2, A3, and B bands as well as other novel nuclear factors [e.g., @ (34,52)]; however, note the absence of a footprint in the Al band for the entire CRE site (Fig. 6). Differences were also noted when comparing extracts from basal and cholinergic drug-treated rats. These features are summarized in Table 1 and discussed below. In the induced state, we observed a previously unrecognized protected sequence in the region GGTGGGGGAGCCTCCGG (-191 to -175, Table 1 and Fig. 7, Lane A2, centered around position -182), which also contains the binding site for the brain-specific transcription factor p (34, 52). Interestingly, the B factor shares DNA binding characteristics with the ubiquitous transcription factor NF-kB (34,52) and the site serves a function as a rat ppEnk regulatory element in the Jurkat Tcell line (52).

WEISINGER

To fully validate the functional significance of the various binding sites we have identified, additional functional analysis is necessary. This will require promoter deletion/ reporter studies, site-directed mutagenesis, in vitro transcription assay using neural cells, and transgenic animal studies. Nevertheless, the information we have obtained thus far has independently directed attention to the same relevant protein binding regions of the ppEnk promoter that were originally identified in in vitro systems (e.g., /3, ENKTFl, and ENKTF2). Therefore, although gel shifts with primary tissue extracts may be complex and difficult to resolve as single bands (even when using smaller promoter fragments, not shown), the approach has merit. Moreover, by choosing a relatively large promoter fragment (100 to 200 bp vs 30 to 50 bp), potential secondary DNA-factor structures (i.e., looping, folding) may be allowed to form during the incubation period. Consequently, our studies are remarkable for two principle reasons. First, the data demonstrates the feasibility and utility of using primary tissue extracts to obtain footprint results for comparison to in uitro model systems (Figs. 6 and 7). Second, the data establish this approach as an alternative method in molecular neuroscience for beginning to elucidate factor responses in uiuo at various genetic loci.

Comparison of Protein Binding between the Rat and Human ppEnk Promoter Region Comb and co-workers have shown that at least four HeLa cell-derived nuclear factors exist (e.g., APl and AP2), bind, and apparently serve a gene regulatory function at the human ppEnk CAMP and phorbol ester inducible element [CRE 1 and 2 (l&13,28,29)]. Now, using native rat striatal nuclear extracts and the rat ppEnk gene, we have confirmed footprints over the rat CREs using in uiuo derived nuclear extracts, as well as footprints at other 5’ regions of the ppEnk promoter. Additional regulatory significance for the CREs in uiuo is suggested by subtle changes in certain features of the footprints known as enhancements (see -101 to -83, Fig. 6 vs Fig. 7), which differ when comparing extracts from cholinergic drugtreated rats to those from the basal state. Even subtle differences are consistent with a change in properties of the bound proteins (Figs. 4-7). Comb and co-workers have also found that the human CRE region was necessary and sufficient for human ppEnk expression in response to CAMP and phorbol ester treatment in multiple cell types (11-13, 28, 29, 64). This suggestion contrasts with the functional CRE in the rat tyrosine hydroxylase promoter which, like the human glycoprotein alpha-subunit gene (17), requires other distal elements, and not just the CRE, to be expressed in a cell-specific fashion (8, 10). In the case of the rat ppEnk gene, treatments that increase CAMP levels in the explanted rat adrenal medulla appear to have a negative (inhibitory) effect on ppEnk mRNA and prohormone levels (18). This suggests that rat and human regulatory mechanisms differ and that there are

INDUCIBLE

ppENK

DNA

other more distal regulatory elements missing from the human constructs used in transfection paradigms.

Time-Dependent Changes in the Rat Striatul ppEnk Nucleoprotein Complex between Stimulated and Basal Rats In gel retardation experiments, the antibody to Fos recognizes a high molecular weight complex in extracts from untreated animals (the basal state; Fig. 4) but a lower molecular weight complex from extracts of cholinergic drug-treated rats (Fig. 5). These observations may result from several coincident events leading to several hypotheses or models to explain the result. First, as suggested by the difference in mobility shift in the antibody competition experiments (Figs. 4 and 5), Jun/Jun homodimers (21, 25,49,62) could initially predominate in the basal state followed by cholinergic induction of the higher affinity Fos/Jun heterodimer (15, 24, 58). Alternatively, a time-dependent change of striatal Fos protein to the smaller Fos-related antigens (FRAs) could result from the sustained high level induction of ppEnk transcription initiation over several days [Fig. 1; Refs. (18, 59, 60, 65); Decristofaro et al.; personal communication; ibid., 19901). A third model evokes a time- and stimulus-dependent change in Jun-related proteins [e.g., c-Jun, Jun-B, and Jun-D (3,9,54,57)]. This last hypothesis is quite plausible since Jun proteins are regulated differentially by growth factors, membrane depolarization, calcium ion influx, and cyclic nucleotides (3), yet all of them complex and bind at the APl consensus sequence (9, 54, 57). Indeed, the biochemical significance of several of these scenarios (homodimers, heterodimers, families of transcription factor proteins, and other factors) has already been demonstrated for the human ppEnk gene in cell model systems such as in the F9 teratocarcinoma cell line [discussed below (61)]. Further proof of these responses in uiuo will require additional experimental approaches.

Relationship to Biological Systems and Second Messenger Pathways Governing ppEnk Gene Expression In the rat striatum, as in the rat adrenal medulla (18), the native rat ppEnk gene appears to be negatively regulated by increased levels of CAMP because treatment with dopaminergic Dl-receptor antagonists or DB-receptor agonists is associated with both an increase in ppEnk mRNA and a decrease in CAMP levels in the striatum (23,32). For striatal cholinergic pathways, a similar adenylate cyclase inhibitory mechanism exists and may be affecting ppEnk mRNA levels in our studies via muscarinic receptor activation (oxotremorine acting at the M2 receptor/M3 gene product), but not through nicotinic receptor pathways (32, 44, 50). Thus, although only a hypothesis at this time, the role of CAMP in the rat appears to be complex and is not necessarily equivalent to its augmenting effects on the human promoter expressed in iso-

BINDING

437

PROTEINS

lated cell culture systems (11-13, 61, 64). Nevertheless, it is plausible that the basis of these differences may lie at the level of available trans-acting nuclear proteins. As already noted, cotransfection of both Fos + c-Jun can stimulate transcription of the human ppEnk gene in F9 teratocarcinoma cells while Fos + Jun-B are not synergistic (61). We speculate that the cumulative program of induction arising from an extracellular stimulus may augment or inhibit expression of this APl-dependent gene proportional to the ratio of the available (or inducible) Fos/Jun family of transcription factors. In another context, it is important to note that the choline@ drug treatments used may activate multiple transmitter pathways in several regions of the brain simultaneously. Consumate responses may well occur separately and independently of direct effects on enkephalin containing neurons per se. Consequently, in vivo changes in factor availability for binding to the ppEnk promoter does not necessarily imply that those factors originate only from enkephalin-positive neurons. Indeed, the presumed factor involvement may only reflect the availability of binding sites for any available striatal factors for the ppEnk gene. Further proof of factor interactions from enkephalinergic neurons can be done using in vitro methods for cell sorting enkephalin positive neurons. Then, in pure neuronal cultures, in vitro transcription assays or footprinting methodology can be applied directly. In summary, and in more general terms, since we are principally interested in the biochemical basis of brain function, the approach we outlined in this report permits two degrees of resolution for the complex patterns of DNA-protein interactions generated. If the phenomena we observe indeed reflect changes in enkephalinergic neurons, then the approach can be extended to include other concerns. For example, the combination gel shift and DMS footprint may prove useful for studying molecular mechanisms in healthy and disease states such as in Huntington’s disease and in Parkinson’s disease using extracts from human tissues. In these clinical syndromes a breakdown exists in the cholinergic interneuron input to the striatum, as well as in the influence of dopaminergic striatal afferents, respectively (1,51). Thus, it is plausible that relevant changes in behavior, neuronal activation, or second messenger pathway combinatorial effects can be dissected at the molecular level from intact structures, even from limited primary sources such as human brains. ACKNOWLEDGMENTS We are grateful to Tom Curran for his generous gift of ~-8’0s antibody directed against the m-peptide. We also thank Dirk Bohman for his cJun antibody (anti-PEP2) used in our studies. In addition, we thank Joe DeCristofaro for reviewing this manuscript and for his assistance in some of the whole animal cholinergic treatments. Finally, we are grateful to Marian Evinger for her critical commentary as well. This study was supported by grants from the National Science Foundation (Grant BNS8719872), the March of Dimes Foundation, and the Dysautonomia Foundation.

438

LA

GAMMA

AND

WEISINGER from isolated 1489.

REFERENCES 1.

Alexander, organization and cortex.

G. E., M. R. DeLong, and P. C. Strick (1986). Parallel of functionally segregated circuits linking basal ganglia Annu. Reu. Neurosci. 9: 357-381.

2. Artalejo,

3.

4. 5.

C. R., M. A. Ariano, R. L. Perlman, and A. P. Fox (1990). Activation of facilitation calcium channels in chromaffin cells by Dl dopamine receptors through a CAMP/protein kinase A dependent mechanism. Nature 348: 239-242. Bartel, D. P., M. Sheng, L. F. Lau, and M. E. Greenberg (1989). Growth factors and membrane depolarization activate distinct programs of early response gen expression: dissociation of fos and jun induction. Genes Deu. 3: 304-313. Black, I. B., J. E. Adler, C. F. Dreyfus, W. F. Friedman, E. F. La Gamma, and A. H. Roach (1987). Biochemistry of information storage in the nervous system. Science 243: 1263-1268. Bohmann, D., T. J. Bos, A. Admon, T. Nishimura, P. K. Vogt, and R. Tjian, (1987). Human proto-oncogene c-jun encodes a DNA binding protein with structural and functional properties of transcription factor AP-1. Science 238: 1386-1391.

6. Bradford,

M. M. (1976). A rapid sensitive method for the quantification of microgram quantities of protein utilizing the principle of protein dye binding. Anal. Biochem. 72: 248-254.

7. Byrd,

J. C., J. R. Naranjo, and I. Lindberg (1987). alin gene expression in the PC12 pheochromocytoma Stimulation by sodium butyrate. Endocrinology 1305.

Proenkephcell line: 121: 1299-

8. Cambi, 9.

10.

11.

12.

F., B. Fung, and D. Chikaraishi (1989). 5’ Flanking DNA sequences direct cell-specific expression of rat tyrosince hydroxylase. J. Neurochem. 53: 1656-1659. Chiu, R., P. Angel, and M. Karin (1989). Jun-B differs in its biological properties from, and is a negative regulator of, cJun. Cell 59: 979-986. Coker, G. T., L. Vinnedge, and K. L. O’Malley (1988). Characterization of rat and human tyrosince hydroxylase genes: Functional expression of both promoters in neuronal and non-neuronal cell types. Biochem. Biophys. Res. Commun. 167: 1341-1347. Comb, M., N. Mermod, S. E. Hyman, J. Pearlberg, M. E. Ross, and H. M. Goodman (1988). Proteins bound at adjacent DNA elements act synergistically to regulate human proenkephalin CAMP inducible transcription. EMBO J. 7: 3793-3805. Comb, M., N. C. Birnberg, A. Seasholtz, E. Herbert, and H. M. Goodman (1986). A cyclic AMP- and phorbol ester-inducible DNA element. Nature 323: 353-356.

13.

Comb, M., D. Liston, M. Martin, H. Rosen, Expression of the human preproenkephalin cells. EMBO J. 4: 3115-3122.

14.

Comb, M., H. Rosen, P. Seeburg, J. Adelman, and E. Herbert (1983). Primary structure of the human preproenkephalin gene. DNA 2: 213-229.

15.

T. Curran,

16.

T. Curran, C. Van Beveren, N. Ling, and I. M. Verma (1985). Viral and cellular fos proteins are complexed with a 39,OOOdalton cellular protein. Mol. Cell. Biol. 5(l): 167-172.

17.

Delegeane, A. M., L. H. Gerland, and P. L. Mellon (1987). Tissuespecific enhancer of the human glycoprotein hormone a-subunit gene: Dependence on CAMP-inducible elements. Mol. Cell. Biol. 7: 3994-4002.

18.

DeCristofaro, J. D., and E. F. LaGamma of adrenal opiate peptides by cholinergic

19.

D&am, J. D., R. M. Lebovitz, and R. G. Roeder (1983). Accurate transcription initiation by RNA polymerase II in a soluble extract

and J. I. Morgan

(1987).

21. 22. 23. 24.

26.

Acids

Res.

11: 1475-

Greenberg, M. E., E. B. Ziff, and L. A. Greene (1986). Stimulation of neuronal acetylcholine receptors induces rapid gene transcription. Science 234: 80-83. (1988). c&n of different Hong, J. S., Modulation drugs. Fed.

T. D., K. Georgopoulos, M. E. Greenberg, and P. Leder dimerizes with itself and with CFOS, forming complexes DNA binding affinities. Cell 65: 917-924. K. Yoshikawa, T. Kanamatsu, and S. L. Sabol (1985). of striatal enkephalinergic neurons by antipsychotic Proc. 44: 2535-2539.

27. Hong,

J. S., H.-Y. T. Yang, J. C. Gillin, and E. Costa (1980). Effects of long term administration of antipsychotic drugs on enkephhalinergic neurons. Adv. Biochem. Psychopharmacol. 24: 223-232.

28. Hyman,

S. E., M. Comb, J. Pearlberg, and H. M. Goodman (1989). An AP2 element acts synergistically with the cyclic AMPand phorbol ester-inducible enhancer of the human preproenkephalin gene. Mol. Cell. Biol. 9: 321-324.

29. Hyman,

30.

S. E., M. Comb, Y-S. Lin, J. Pearlberg, M. R. Green, and H. M. Goodman (1988). A common tram-acting factor is involved in transcriptional regulation of neurotransmitter genes by cyclic AMP. Mol. Cell. Biol. 8: 4225-4233. Johnson, P. F., and S. L. McKnight (1989). Eukaryotic transcription regulatory proteins. Annu. Reu. Biochem. 58: 799-839.

31.

Jones, N. C., P. W. J. Rigby, and E. B. Ziff (1988). Tram-acting protein factors and the regulation of eukaryotic transcription: Lessons from studies on DNA tumor viruses. Genes Deu. 2: 267-281.

32.

Kelly, E., and Dl-mediated linergic and Neurochem.

33.

Kilpatrick, D. L., S. A. Zinn, M. Fitzgerald, H. Higuchi, S. Sabol, and J. Meyerhardt (1990). Transcription of the rat and mouse preproenkephalin genes is initiated at distinct sites in spermatogenetic cells. Mol. Cell. Biol. 10: 3717-3726.

34.

Korner, M., A. Rattner, F. Mauxion, R. Sen, and Y. Citri (1989). A brain-specific transcription activator. Neuron 3: 563-572.

35.

Kouzarides, T., and E. Ziff (1989). Leucine zippers GCN4 dictate dimerization specificity and thereby binding. Nature 340: 568-571.

35a.

La Gamma, E. F., J. D. Cristofaro, and G. W. Weisinger (1991). Cholinergic agonist induced binding of adrenomedullary nuclear proteins to the rat preproenkephahn promoter. Mol. Cell. Neurosci., in press.

36.

La Gamma, E. F., J. D. DeCristofaro, B. L. Agarwal, and G. Weisinger (1989). Ontogeny of the opiate phenotype: An approach to defining transsynaptic mechanisms at the molecular level in the rat adrenal medulla. ht. J. Deu. Neurosci. 7(5): 499511. La Gamma, E. F., and J. D. DeCristofaro (1989a). Mechanisms of transsynaptic and glucocorticoid regulation of adrenal opiate peptides: A molecular developmental approach to stress-responsiveness. In The Molecular Biology of Stress (0. Zinder and S. Bresnitz, Eds.), pp 143-152. UCLA Press, Los Angeles, CA.

7(6):255-258.

35:203-210.

Nucleic

J. E., M. W. Collard, and J. Douglass (1989). Translational control of germ cell-expressed mRNA imposed by alternative splicing: Opioid gene expression in rat testis. Mol. Cell. Biol. 9: 4381-4389. Gentz, R., F. J. Rauscher, C. Abate, and T. Curran (1989). Parallel association of Fos and Jun leucine zippers juxtaposes DNA binding domains. Science 243: 1695-1699. Gorman, C., L. Moffat, and B. Howard (1982). Recombinant genomes which express chloramphenicol acetyltransferase in mammalian cells. Mol. Cell. Biol. 2: 1044-1051. Graybiel, A. M. (1990). Neurotransmitters and neuromodulators in the basal ganglia. Trends Neurosci. 13(7): 244-253.

25. Halazonetis,

of fos. BioEssays

(1990). Bimodal regulation mechanisms. Neuroscience

nuclei.

20. Garrett,

and E. Herbert (1985). gene in mouse pituitary

Memories

mammalian

37.

S. R. Nahorski (1986). Specific inhibition ofdopamine CAMP formation by dopamine D2, muscarinic choopiate receptor stimulation in rat striatal slices. J. 47: 1512-1516.

of fos, jun and control DNA

INDUCIBLE

38. La Gamma, of adrenal Mol. Brain 39.

40.

41.

ppENK

E. F., and I. B. Black (1989b). Transcriptional catecbolamine and opiate peptide transmitter Res. 5: 17-22.

DNA

La Gamma, E. F., J. D. (1988). Second messenger transmitter regulation in 292-298. La Gamma, E. F., J. D. McKelvy, and I. B. Black preproenkpbalin mRNA.

White, J. F. McKelvy, mechanisms governing the rat adrenal medulla.

53.

control genes.

La Gamma, E. F., N. K. Goldstein, J. B. Snyder, and G. Weisinger (1989c). Preproenkepbalin DNA-binding proteins in the rat: Banking region. Mol. Brain Res. 5: 131-140.

factor AP-1 interacts 49: 741-752.

43. Maniatis,

43a.

44.

45.

and with

T., S. Goodbourn, and tissue-specific

and I. B. Black opiate peptide Brain Res. 441:

55.

R. Tjian (1987). Purified TPA-inducible enhancer

S., J. Jiricny, and W. Schaffner (1987). can be dissected into multiple segments each type specificity. Genes Dev. 1: 65-74.

I., A. Guidotti, J. P. Schwartz, and E. Costa (1985). Rechanges the dynamic state of enkephalin stores in rat and adrenal medulla by different mechanisms. J. Neurosci.

5:3379-3385. 47.

Monstein, H-J., blot assay detects caudate nucleus 261.

48. Montminy, protein Nature 49.

Sheng, M., and M. E. Greenberg of c-fos and other immediate Neuron 4: 477-485.

59.

Sonnenberg, J. L., P. F. Macgregor-Leon, T. Curran, and J. I. Morgan (1989). Dynamic alterations occur in the levels and composition of transcription factor AP-1 complexes after seizure. Neuron 3:

M. Nau, S. Segal, J. Fedorko and J. Minna and c-fos stimulates the transforming and of c-jun. Cell 59: 967-997. (1990). The regulation and function early genes in the nervous system.

359-365. 60.

Sonnenberg, J. L., C. Mitchelmore, P. F. Macgregor-Leon, J. Hempstead, J. I. Morgan, and T. Curran (1989a). Glutamate receptors agonists increase the expression of fos, FRA and AP-1 DNA binding activity in the mammalian brain. J. Neurosci. Res.

24:72-80. 61.

Sonnenberg, J. L., F. J. Rauscher, (1989b). Regulation of proenkephalin

J. I. Morgan, and T. Curran by Fos and Jun. Science 246:

1622-1625. 62.

Turner, R., and R. Tjian (1989). Leucine repeats and an adjacent DNA binding domain mediate the formation of functional cFoscJun Heterodimers. Science 243: 1689-1694.

63. Uhl, G. R., B. Navia, and T. Geijer (1988). multiple proenkephalin and pheochromocytoma.

A high sensitive A-like mRNAs Biosci. Rep.

northern in human S(3): 255-

of preproenkephalin rons: High levels cortical afferents.

64. Van Nguyen,

Nakabeppu, Y., K. Ryder, activities of three murine 55: 907-915.

and D. Nathans (1988). jun proteins: Stimulation

DNA binding by fos. Cell

M. C., P. Onali, N. H. Neff, and E. Costa (1983). Adenylate cyclase activity of synaptic membranes from rat striatum: Inhibition by muscarinic receptor agonists. Mol. Pharmacol. 23: 393398. Penney, J. B., Jr., and A. B. Young (1983). Speculations on the functional anatomy of basal ganglia disorders. Annu. Rev. Neurosci.

6:73-94. 52. Rattner, A., M. Korner,

H. Rosen, P. A. Baeuerle, factor kB activates proenkephalin Mol. Cell. Biol. 11: 1017-1022.

(1990). proenupon a

65.

Weisinger, G., J. D. DeCristofaro, and E. F. La Gamma (1990). Multiple preproenkephalin transcriptional start sites are induced by stress and cholinergic pathways. J. Biol. Chem. 265(29): 17,38917,392.

66.

Weisinger, G., E. F. Remmers, P. Hearing, and K. B. Marcu (1988). Multiple negative elements upstream of the murine c-myc gene share nuclear factor binding sites with SV40 and polyoma enhancers. Oncogene 3: 635-646.

67. Yoshikawa, and Y. Citri Transcription

and J. Douglas (1988). Differential expression and prepredynorphin mRNAs in striatal neuof preproenkephalin expression depend on cerebral J. Neuroscience 8(12): 4755-4764.

T., L. Kobierski, M. Comb, and S. E. Hyman The effect of depolarization on expression of the human kephalin gene is synergistic with CAMP and dependent CAMP-inducible enhancer. J. Neurosci. lO(8): 2825-2833.

M. R., and Bilezikjian (1987). Binding of a nuclear to the CAMP response element of the somatostatin gene. 328: 175-178.

(1991). Nuclear in T lymphocytes.

SV40 enhancer a different cell

58.

50. Olianas,

51.

The with

Schutte, J., J. Viallet, (1989). Jun-B inhibits trans-acting activities

of in1237-

McKinney, M., D. Anderson, C. Forray, and E. E. El-Fakahany (1989). Characterization of the striatal M2 muscarinic receptor mediating inhibition of cyclic AMP using selective antagonists: A comparison with the brainstem M2 receptor. J. Phurmacol. Exp. Z’her. 250(2): 565-572. Mitchell, P. J., and R. Tjian (1989). Transcriptional regulation in mammalian cells by sequence-specific DNA binding proteins. Sci-

(1989). In Molecular Spring Harbor Press,

57.

transcription elements. Cell

and Fischer (1987). Regulation gene expression. Science 236:

(1984). Isolation and chargene. J. Biol. Chem. 259:

Sambrook, J., E. F. Fritsch, and T. Maniatis Cloning: A Laboratory Manual, 2nd ed. Cold Cold Spring Harbor, NY.

56. Schirm, White, J. E. Adler, J. E. Krause, J. F. (1985). Depolarization regulates adrenal Proc. Narl. Acad. Sci. USA 82: 8252-

ducible 1244. Maxam, A. M., and W. Gilbert (1980). Sequencing end-labeled DNA with base specific chemical cleavages. In Methods in Enzymology (L. Grossman and K. Moldave, Eds.), Vol. 65, pp. 499-560. Academic Press, San Diego.

Mochetti, serpine striatum

Rosen, H., J. Douglass, and E. Herbert acterization of the rat preproenkephalin 14,309-14,313.

K., A. Lanahan, E. Perez-Albueme, and D. Nathans (1989). Jun-D: A third member of the Jun gene family. Proc. Natl. Acad. Sci. USA 86: 1500-1503.

eme245:371-378. 46.

439

PROTEINS

54. Ryder, 5’

8255. 42. Lee, W., P. Mitcbel,

BINDING

K., K. Maruyama, T. Aizaws, and A. Yamamoto (1989). A new species of enkephalin precursor mRNA with a distinct 5’untranslated region in haploid germ cells. FEBS Z.&t. 246: 193196.