Infectious laryngotracheitis virus (ILTV) vaccine intake evaluation by detection of virus amplification in feather pulps of vaccinated chickens

G Model

ARTICLE IN PRESS

JVAC 17284 1–4

Vaccine xxx (2016) xxx–xxx

Contents lists available at ScienceDirect

Vaccine journal homepage: www.elsevier.com/locate/vaccine

Infectious laryngotracheitis virus (ILTV) vaccine intake evaluation by detection of virus amplification in feather pulps of vaccinated chickens

1

2

3

Q1

4

I. Davidson a,∗ , I. Raibshtein a , A. Altori a , N. Elkin b a

5

Q2

6

b

Division of Avian Diseases, Kimron Veterinary Institute, P.O. Box 12, Bet Dagan 50250, Israel Biovac, Biological Laboratories, Ltd, Israel

7

a r t i c l e

8 23

i n f o

a b s t r a c t

9

Article history: Received 28 October 2015 Received in revised form 30 December 2015 Accepted 5 January 2016 Available online xxx

10 11 12 13 14 15 16

22

Keywords: Infectious laryngotracheitis virus Feathers Nested real-time PCR Live vaccine Systemic spread

24

1. Introduction

17 18 19 20 21

Infectious laryngotracheitis (ILT) is a respiratory disease of poultry caused by an alphaherpesvirus, ILTV. The live vaccine is applied worldwide by drinking water or by the respiratory route, and by the vent application in Israel. No system of direct evaluation of the efficacy of vaccination exists today, except of antibody elicitation, which is an indirect indication of vaccination intake and might happen due to environment exposure. We suggest for the first time an assay for evaluating the accuracy of the vaccination process by spotting the spread of the live vaccine systemically, namely by virus detection in the feather shafts of the vaccinated birds. The feathers are particularly beneficial as they are easy to collect, non-lethal for the bird, therefore advantageous for monitoring purposes. Moreover, the continuous survey of the vaccine virus unveiled the different kinetics of viremia by the different vaccination routes; while after the vent vaccination the systemic viremia peaks during the first week afterwards, after two consecutive vaccine administration by drinking water with 6 day interval, the vireamia peaks only after the second administration. A robust amplification was needed because the vaccine ILTV was present in the bird in minute quantities compared to the wild-type virus. For the vaccine virus identification in feather shafts a nested real-time PCR for the TK ILTV gene was developed. The sensitivity of detection of the nested rtPCR was greater by 1000 compared to conventional nested PCR and 10 times that real-time PCR. © 2016 Published by Elsevier Ltd.

Q4

Avian infectious laryngotracheitis (ILT) is an upper respiratory disease of poultry caused by Gallid herpesvirus I, genus Iltovirus, subfamily Alphaherpesvirinae, family Herpesviridae, reviewed by Garcia et al. [1]. The disease severity varied from mild to acute with mortality rates that can reach up to 70%. The clinical signs include spasms of coughing and gasping with nasal and oral discharge, conjunctivitis, and reduced egg production, whereas in severe forms of ILT the clinical signs include gasping with efforts to inhale, coughing, excretion of bloody mucus, dyspnea up to suffocation and fast mortality. In addition, infected birds become latently infected and virus is spread horizontally by respiratory secretions without clinical signs.

25 26 27 28 29 30 31 32 33 34 35 36

Q3

∗

Corresponding author at: Division of Avian Diseases, Kimron Veterinary Institute, P.O. Box 12, Bet Dagan 50250, Israel. Tel.: +972 3 9681602; fax: +972 3 9681739/753. E-mail address: [email protected] (I. Davidson).

The main site of ILTV latency is the trigeminal ganglion and the latent infection is not manifested by clinical signs. The virus can be reactivated in chickens as a result of the presence of stress factors during growth, such as rehousing with unfamiliar birds, lay onset, mixed infection with various avian pathogens, and more [2,3]. Protection against ILT is achieved by vaccination, mostly with live vaccines, in which ILTV was attenuated in vitro, or which contains naturally avirulent strains of ILTV. Vaccines may be administered twice via eye-drop, spray and or by drinking water at 7 and 15 weeks-old. Alternatively, the cloacal vent-application was found very effective and is successfully practiced in Israel by administration at 8 weeks-old chickens [4]. Although live ILTV vaccines are used worldwide, the incidence of ILT is growing in many parts of the world. A number of distinctive biological ILTV features cause difficulties in the disease control: (a) ILTV can establish a latent carrier state in recovered and in vaccinated birds [5] from which the virus can become reactivated due to stressful physiological conditions, rehousing, onset of lay, and more. Reactivation leads then to ILTV intensive shedding and horizontal infection induction [6,7]. (b) Although vaccination provide protection against disease, sterilizing

http://dx.doi.org/10.1016/j.vaccine.2016.01.006 0264-410X/© 2016 Published by Elsevier Ltd.

Please cite this article in press as: Davidson I, et al. Infectious laryngotracheitis virus (ILTV) vaccine intake evaluation by detection of virus amplification in feather pulps of vaccinated chickens. Vaccine (2016), http://dx.doi.org/10.1016/j.vaccine.2016.01.006

37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56

G Model JVAC 17284 1–4 2

57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122

ARTICLE IN PRESS I. Davidson et al. / Vaccine xxx (2016) xxx–xxx

immunity cannot be achieved and virus shed continues; (c) ILTV vaccine viruses can regain virulence in unevenly vaccinated flocks where recirculation of vaccine viruses in unvaccinated birds causes disease [4,8,9]; (d) disease in unvaccinated chickens can occur due to insufficient attenuation of ILTV vaccines. Recent studies tried to disclose the complexity of ILT pathology by reviewing the wild-type ILTV tissue tropism and kinetics in naturally and experimentally infected chickens. While Zhao et al. [10] demonstrated the ILTV DNA by real-time PCR in almost all the bird organs from the first day post infection (dpi) until 28 dpi, the virus was found in a more restricted pattern by Wang et al. [11], i.e., in only eight internal organs for a shorter time interval. Sivaseelan et al. [12] examined only the respiratory tract and evidenced the virus greater affinity toward the middle portion of the trachea and the conjunctiva. While the only examination of blood for the presence of ILTV was reported by Bagust et al. [13] by virus isolation, the use of molecular assays enabled the detection of vaccine viruses in organs which represent the blood content, i.e., the spleen, thymus and bursa, in experimentally-infected chickens [14]. In addition, the ILTV vaccine viruses were demonstrated in ILTV replication target organs, like the eye-conjuctiva, trachea, trigeminal ganglia and the caecal tonsils [14,15]. To our knowledge, no previous studies on the uptake kinetics of ILTV live vaccine viruses in commercial flocks were reported, nor simple and non-invasive sampling methods, that do not require bird killing, like the feather sampling reported now. These studies indicated that the ILTV circulates systematically within the chicken body after infection and replicates within various organs of the chicken. On that basis we hypothesized that the virus might have reached the blood tissue that resides within the feather follicles and shafts. As the feather shafts might be an advantageous organ for ILTV detection without the need of invasive blood sampling or bird slaughter, the feathers of vaccinated or of ILTV- infected chickens might serve for virus identification, similarly to other avian viruses, like Marek’s disease virus, chicken anemia virus, avian leucosis virus, high pathogenic avian influenza virus, as reviewed by Davidson [16,17]. The importance of vaccination in the chicken protection against the devastating ILT accentuates the need for effective surveillance tools to assess that vaccination is done in a manner that ensures the highest possible coverage of the flock. Monitoring of ILTV vaccine viruses after vaccination might provide a tool to evaluate the vaccination process. No surveillance method for ILTV vaccines administered via spray or via drinking water exists today. However, for vent application of ILT vaccines, the local red and swallowed area indicates a transient inflammation at the site of application in the vent, denoted “take”, and that feature enables the vaccine uptake efficacy monitoring in a subjective and insensitive manner [4]. To provide a novel and effective tool for vaccine administration evaluation, we explored the feather shafts as a site of vaccine virus presence after vaccination with the live ILTV vaccine. While ILTV systemic spread was demonstrated lately, no study explored the systemic ILTV vaccine virus systemic spread during the viremic stage following vaccination, until the vaccine virus enter latency. The present study extends our previous partial findings of ILTV vaccine virus in feather shafts of commercial chicken flocks [18] by the examination of experimentally controlled vaccination of commercial flocks by two vaccination modes, including the drinking water and vent vaccination routes. As previous findings [18] indicated that the vaccine virus quantities in the bird are much lower than those of wild-type strains, for the first time for avian viruses we employed a novel assay, the nested real-time PCR amplification, used before to demonstrate environmental pathogens [19–21].

Table 1 Evaluation of the ILTV nrtPCR as compared to nested end-point and to real-time PCR on the amplification of ILTV vaccine virus DNA. ILTV vaccine DNA dilution

Conventional nested PCR

Real-time PCR (Ct)

Nested real-time PCR (Ct)

10−2 10−3 10−4 10−5 10−6 10−7 10−8 10−9 10−10

Positive Positive Positive Positive Negative Negative Negative Negative Negative

19.9 23.5 27.3 30.7 35.0 36.4 Not detected Not detected Not detected

4.7 4.5 4.9 6.2 9.5 12.6 22.6 Not detected Not detected

2. Methods

123

2.1. ILTV vaccination protocols

124

ILT vaccination was performed at a commercial pullet farm by commercial vaccination teams using the Vir101 vaccine (Biovac, Ltd., Or Akiva, Israel). The commercial vaccine consists a live virus, strain Zamberg, grown in Specific Pathogen Free embryonated eggs (chicken embryo origin, CEO). The vent application was applied to 8 weeks-old pullets, while the double drinking water application was performed was given to 8–9 weeks-old pullets with 6 days interval between the procedures. The birds were deprived of drinking water 2 h before the drinking water vaccination, to encourage water drinking and enable synchronization of the vaccine administration. 2.2. Feather sampling protocol and nucleic acid purification For each vaccination route 10 randomly chosen birds were sampled. The flock that received the vent vaccination was sampled on days 3, 6, 10 and 12 after, while the flock that was vaccinated by drinking water was sampled on days 2, 5, 7, 13 and 15 after the second drinking-water vaccine administration. At each sampling point two groups containing about 20–30 feathers from 5 birds each were collected. In order to reflect a comprehensively the viremic status of the flock, at each sampling time DNA was prepared from 5 groups of 4–5 feather pulps each, which were gathered from both feather pools. By that assemblage feathers of more than one bird were included in each time point. The pulps contained in bloody feather shafts were removed and total DNA was purified by the Maxwell® AS1030 Tissue DNA purification kit (Promega, Ltd., Madison, WI, USA) according to the manufacturer instructions. 2.2.1. Development of the ILTV nested real-time PCR The vaccine virus used in the present study to develop the ILTV nested real-time PCR (nrtPCR) was previously used as the positive control to detect ILTV in feathers shafts by the TK gene nested endpoint PCR for ILTV [18] and also used to compare the sensitivity of detection by the conventional nested PCR real-time PCR (Davidson et al., unpublished) and the nested real-time PCR (Table 1). Briefly, a commercial ILTV vaccine bottle that contained 500 lyophilized doses was dissolved with 2000 ␮l PBS. A volume of 400 ␮l (representing 100 vaccine doses) served for DNA purification by the Maxwell® AS1020 Cell DNA purification kit (Promega, Ltd., Madison, WI, U.S.A.), according to the manufacturer instructions. The titration was started with purified DNA that represented one vaccine dose in the original vaccine bottle. The ILTV vaccine virus was amplified in two steps: Step I: The second amplification step of the conventional nested PCR that targeted the thymidine kinase (TK) gene, according to Han and Kim [22] as described in our previous study [18]. The PCR ILTV-TK gene internal primers (TKPD2)

Please cite this article in press as: Davidson I, et al. Infectious laryngotracheitis virus (ILTV) vaccine intake evaluation by detection of virus amplification in feather pulps of vaccinated chickens. Vaccine (2016), http://dx.doi.org/10.1016/j.vaccine.2016.01.006

125 126 127 128 129 130 131 132 133 134

135

136 137 138 139 140 141 142 143 144 145 146 147 148 149

150 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 166 167 168

G Model

ARTICLE IN PRESS

JVAC 17284 1–4

I. Davidson et al. / Vaccine xxx (2016) xxx–xxx

Posive samples - %

3

Table 2 Amplification of ILTV in feather shafts of commercial chickens by nrtPCR after vaccination by vent application or by double vaccine administration by drinking water.

100

Vaccination by vent application

50

Vent applicaon – Day 0

0 3

6

12

10

3 13.1

6 13.3

10 12.0

12 15.7

Vaccination by drinking water at day 0 + day 6

100 50

Sampling days post vaccination Mean Ct in positive samples

Drinking water– Days 0 + 6

Sampling days post vaccination Mean Ct in positive samples

2

5

7

13

15

Not detected

Not detected

Not detected

11.4

12.0

0 2

5

7

13

15

Days of sampling

Fig. 1. The degree of nrtPCR positive feather shafts pools during about 2 weeks post the commercial ILTV vaccination by either vent, or by two administration cycles in the drinking water with a 6 day-interval in-between.

187

amplified a 1024 bp product and were: 5 -GTTCGAGAACGATGACTCC and 5 -GCATTGTAGCGCTCTACTG. Step II: The amplicon of the first amplification served as the template for a real-time PCR, as described by us previously [23]. The primers and probes amplified a 108 bp amplicon, based on the ILTV genomic region reported by Corney et al. [24]. Additional modifications were made based on the Samberg ILTV strain (Acc. No. DQ522947): Forward: 5 CAAAATGTTCACGGGGAAAGA-3 , Reverse: 5 -GAGGCCATGTGCTGGTAAGTAAA-3 and a dually labeled probe, 5 -CAL Fluor Gold 540 –AAACTCGCGACGGTATTGAAA – BHQ1-3 . The amplification mix at a volume of 20 ␮l contained 10 ␮l of Mastermix (Quanta BioSciences, Inc. Gaithersburg, MD, USA), 1 ␮l of each of the 2 primers and probe, at a concentration of 500 nm for the primers, 250 nm for the probes and 2 ␮l of the DNA control, or the examined samples. The cycling conditions were: 3 min at 95 ◦ C and 40 cycles of 10 s at 95 ◦ C and 45 s at 60 ◦ C. Assays were performed on a StepOne real-time PCR system (Applied Biosystems, Ltd. Foster City, CA, USA).

188

3. Results

169 170 171 172 173 174 175 176 177 178 179 180 181 182 183 184 185 186

189 190

191 192 193 194 195 196 197 198 199

200 201

202 203 204 205 206 207 208

3.1. Sensitivity of detection by the nested real-time PCR compared to conventional nested PCR and real-time PCR Table 1 shows the sensitivity of detection by the nested realtime PCR compared to conventional nested PCR and to real-time PCR on a similar DNA preparation of ILTV vaccine DNA in 10-fold dilution, up to 10−10 . While the real-time amplification increased the sensitivity of detection of the conventional nested PCR by 100-fold, (from the 10−5 dilution to 10−7 ), by the nrtPCR a supplementary a 10-fold sensitization was noted. In addition, a notable increase in the signal intensity was record for all the vaccine DNA dilutions as compared to the real-time PCR. 3.2. ILTV vaccine virus detection in feather shafts of ILTV vaccinated chickens Fig. 1 shows the degree of nrtPCR positive feather shafts pools during about 2 weeks post the commercial ILTV vaccination by either vent, or by two administration cycles in the drinking water with a 6 day-interval in-between. In both cases the ILTV vaccine virus viremia peaked at about a week after the vent application and the second administration by drinking water. It seems that positive feather shaft pools could be detected for at least 12 days post

vent vaccination, however, it is not possible to assess the length of viremia caused by the double vaccine administration in drinking water, as monitoring lasted for only 15 days. While by the vent application not all feathers shafts were positive, reflecting previous findings [18], the positivity rate of the birds that received vaccination via two cycles of drinking water was maximal. To evaluate the viremia fluctuation over time, Table 2 shows the actual amplification by the nrtPCR by the Ct values. It seems that once the vaccine virus viremia was established systemically, the virus can be steadily detected in the feather shaft pools without fluctuation, at least for the time duration employed in the present study. 4. Discussion By the application of the nrtPCR a significant increase in amplification sensitivity was accomplished as compared to the rtPCR, noted by both the ability to detect amplification in a 10-fold higher dilution, but also by decreased Ct values at each dilution compared to real-time amplification. It is most plausible that the limit of detection would be at even higher DNA dilutions, unless the limitation imposed by the fact that the nrtPCR amplified the second step of the conventional nested PCR. While by the conventional nested PCR, denoted by visualization of ethidium bromide-stained DNA band on agarose gels was at the 10−5 DNA dilution, amplicon molecules might be present even at lower dilutions which were invisible on the gels. The nrtPCR amplicons could be created only up to the 10−8 dilution, most probably limiting the detection limit. The need to sensitize the ILTV vaccine detection assay for monitoring the vaccine virus following administration was based on our previous findings that indicated that in clinical cases of acute infections the virus was abundant in vivo, while after vaccination it could be detected in minute quantities in the bird [18]. By increasing the sensitivity of ILTV detection, shown in the present study for the first time, we were able to monitor efficiently the dynamic systemic spread of the ILTV vaccine virus. In light of worldwide economically important ILTV in poultry, and the ILT vaccination efficacy monitoring, the present report is novel in several aspects. First, to our knowledge limited studies characterized previously the systemic spread of ILTV in chickens [10–12] and no study explored the feathers as a site for ILTV identification, except our previous introductory study [18]. Second, for the first time, the viremic stage of the live ILTV vaccine was monitored and its systemic dynamics was indicated following two vaccination procedures. Third, the feather shafts were highlighted as an easy accessible and non-invasive mean of vaccination efficacy evaluation, enabling the establishment of a quality control for the ILTV vaccination process on a flock basis. The uniformity of the Ct values in the positive feather shafts demonstrated in the present study indicated that the vaccine virus viremic state was steady once the systemic viremia was created. That feature would be a remarkable advantage for the

Please cite this article in press as: Davidson I, et al. Infectious laryngotracheitis virus (ILTV) vaccine intake evaluation by detection of virus amplification in feather pulps of vaccinated chickens. Vaccine (2016), http://dx.doi.org/10.1016/j.vaccine.2016.01.006

209 210 211 212 213 214 215 216 217 218 219

220

221 222 223 224 225 226 227 228 229 230 231 232 233 234 235 236 237 238 239 240 241 242 243 244 245 246 247 248 249 250 251 252 253 254 255 256 257

G Model JVAC 17284 1–4

ARTICLE IN PRESS I. Davidson et al. / Vaccine xxx (2016) xxx–xxx

4

269

vaccination efficacy evaluation, because eventual fluctuations in virus amplification would have a reduced impact. Although by the vent application a faster viremia seemed to be established, a double vaccine administration by drinking water, which is less laborious, seems to be followed by a higher rate and longer viremia. Typically to herpesviruses, live ILTV vaccine viruses reside for the bird lifetime as latent and immune protection is mostly cellular. The method of live vaccine virus systemic replication evaluation provided a tool to assess the use of various means of vaccination by the veterinary authorities. Finally, the implementation of the novel high sensitive nrtPCR assay is original for ILTV and opens new horizons of educated control of infections in commercial flocks.

270

Acknowledgements

258 259 260 261 262 263 264 265 266 267 268

271

We are indebted and grateful also to Ms. Itzhak Mandel and Aly Abu-Griban for providing the samples of vaccinated flocks.

272 273 274

275

276 277 278 279 280 281 282 283 284 285 286 287 288 289 290 291 292 293 294 295 296

Conflict of interest: None. References [1] Garcia M, Spatz S, Guy JS. Infectious laryngotracheitis. In: Swayne DE, Glisson JR, McDougald LR, Nolan LK, Suarez DL, Nair V, editors. Diseases of poultry. 13th ed. Ames, Iowa: Wiley-Blackwell, Iowa State Press; 2013. p. 161–80. [2] Bagust TJ. Laryngotracheitis (Gallid-1) herpesvirus infection in the chicken. Latency establishment by wild and vaccine strains of ILT virus. Avian Pathol 1986;15:581–95. [3] Hughes CS, Williams RA, Gaskell RM, Jordan FTW, Bradbury JM, Bennett M, et al. Latency and reactivation of infectious laryngotracheitis vaccine virus. Arch Virol 1991;121:213–8. [4] Samberg Y, Cuperstein E, Bendheim U, Aronovici I. The development of a vaccine against avian infectious laryngotracheitis. I. Modification of a laryngotracheitis virus. Refu Vet 1971;26:54–9. [5] Williams RA, Bennet M, Bradbury JM, Gaskell RM, Jones RC, Jordan FTW. Demonstration of sites of latency of infectious laryngotracheitis virus using the polymerase chain reaction. J Gen Virol 1992;73: 2415–20. [6] Guy JS, Barnes HJ, Smith LG. Increased virulence of modified-live infectious laryngotracheitis vaccine virus following bird-to-bird passage. Avian Dis 1991;35:348–55. [7] Hughes CS, Gaskell RM, Jones RC, Bradbury JM, Jordan FTW. Effects of certain stress factors on the reexcresion of infectious laryngotracheitis virus from latently infected carrier birds. Res Vet Sci 1989;46:274–6.

[8] Guy JS, Barnes HJ, Smith LG. Virulence of infectious laryngotracheitis viruses: comparison of modified-live vaccine viruses and North Carolina field isolates. Avian Dis 1990;34:106–13. [9] Menendez KR, Garcia M, Spatz S, Tablante NL. Molecular epidemiology of infectious laryngotracheitis: a review. Avian Pathol 2014;43:108–17. [10] Zhao Y, Kong C, Cui X, Cui H, Shi X, Zhang X, et al. Detection of infectious laryngotracheitis virus by real-time PCR in naturally and experimentally infected chickens. PLOS ONE 2013;8:e67598. [11] Wang LG, Ma J, Xue CY, Wang W, Guo C, Chen F, et al. Dynamic distribution and tissue tropism of infectious laryngotracheitis virus in experimentally infected chickens. Arch Virol 2013;158(3):659–66. [12] Sivaseelan S, Rajan T, Malmarugan S, Balasubramaniam GA, Madheswaran R. Tissue tropism and pathobiology of infectious laryngotracheitis virus in natural cases of chickens. Israel J Vet Med 2014;69:197–202. [13] Bagust TJ, Calnek BW, FaheyF K.J. Gallid-1 herpesvirus infection in the chicken. 3. Reinvestigation of the pathogenesis of infectious laryngotracheitis in acute and early post-acute respiratory disease. Avian Dis 1986;30:179–80. [14] Oldoni I, Rodriguez-Avila A, Riblet SM, Zavala G, Garcia M-C. Pathogenicity and growth characteristics of selected infectious laryngotracheitis virus strains from the United States. Avian Pathol 2009;38:47–53. [15] Rodriguez-Avila A, Oldoni I, Riblet S, Garcia M-C. Replication and transmission of live attenuated Infectious Laryngotracheitis virus (ILTV) vaccines. Avian Dis 2007;51:905–11. [16] Davidson I, Skoda I. The impact of feathers on the detection and study of DNA viral pathogens in commercial poultry. World’s Poult Sci Assoc J 2005;61:407–17. [17] Davidson I. Diverse uses of feathers with emphasis on diagnosis of avian viral infections and vaccine virus monitoring. Braz J Vet Sci 2009;11:139–48. [18] Davidson I, Nagar S, Ribshtein I, Shkoda I, Perk S, Garcia M-C. Detection of wildand vaccine-type avian infectious laryngotracheitis virus in clinical samples and feather shafts of commercial chickens. Avian Dis 2009;53:618–23. [19] Hu Y, Arsov I. Nested real-time PCR for hepatitis A detection. Lett Appl Microbiol 2009;49:615–9. [20] Perrott P, Smith G, Ristovski Z, et al. A nested real-time PCR assay has an increased sensitivity suitable for detection of viruses in aerosol studies. J Appl Q5 Microbiol 2009;106:1438–47. [21] Tran TM, Aghili A, Li S, Ongoiba A, et al. A nested real-time PCR assay for the quantification of Plasmodium falciparum DNA extracted from dried blood spots. Malaria J 2014;13:393–401. [22] Han MG, Kim SJ. Efficacy of live virus vaccines against Infectious laryngotracheitis assessed by polymerase chain reaction-restriction fragment length polymorphism. Avian Dis 2003;47:261–71. [23] Davidson I, Raibstein I, Altory A. Differential diagnosis of fowlpox and infectious laryngotracheitis viruses in chicken diphtheritic manifestations by mono and duplex real-time polymerase chain reaction. Avian Pathol 2015;44:1–4, http://dx.doi.org/10.1080/03079457.2014.977223. http://www. tandfonline.com/loi/cavp20. [24] Corney BG, Diallo IS, Wright de Jong AJ, Hewitson GR, Tolosa MX, Rodwell BJ, et al. Detection and quantitation of gallid herpesvirus I in avian samples by Taq nuclease assay utilizing minor groove binder technology. Avian Pathol 2010;39:47–52.

Please cite this article in press as: Davidson I, et al. Infectious laryngotracheitis virus (ILTV) vaccine intake evaluation by detection of virus amplification in feather pulps of vaccinated chickens. Vaccine (2016), http://dx.doi.org/10.1016/j.vaccine.2016.01.006

297 298 299 300 301 302 303 304 305 306 307 308 309 310 311 312 313 314 315 316 317 318 319 320 321 322 323 324 325 326 327 328 329 330 331 332 333 334 335 336 337 338 339 340 341 342 343 344 345 346 347