- Email: [email protected]
Influence of patient and donor cytokine genotypes on renal allograft rejection: evidence from a single centre study
Transplant Immunology 8 Ž2001. 259᎐265
Influence of patient and donor cytokine genotypes on renal allograft rejection: evidence from a single centre study K.L. Poole a,U , P.J. Gibbs b, P.R. Evans a , S.A. Sadek b, W.M. Howella a
Histocompatibility and Immunogenetics Laboratory, Southampton Uni¨ ersity Hospitals, Tremona Road, Southampton, SO16 6YD, UK b Wessex Renal and Transplant Unit, St. Mary’s Hospital, Portsmouth, PO3 6AD, UK Received 4 December 2000; accepted 5 January 2001
Abstract Cytokines are key immune mediators and it has been suggested that cytokine gene polymorphisms affecting expression influence rejection or tolerance. This study sought to examine this hypothesis with the aim of identifying predictive genotype markers for rejection. The study group consisted of 120 consecutive first cadaveric recipient᎐donor pairs transplanted at a single centre, between 1994 and 1997. PCR utilising sequence-specific primers ŽSSP. methodology was optimised for genotyping recipient and donor DNA for the following polymorphisms: tumour necrosis factor ŽTNF. -␣ Ž-308, GrA., interleukin ŽIL.-10 Žy1082, GrA., IL-4 Žy590, CrT., transforming growth factor ŽTGF. -1 Žq915, GrC.. Recipient᎐donor pairs were divided into rejectors Ž n s 28. and non-rejectors Ž n s 92.. Each group was further stratified according to number of rejection episodes and HLA-DR mismatching. Recipient᎐donor pairs both lacking the IL-4U T allele Žrecipient low producerrdonor low producer. were significantly increased in the rejector group Ž Ps 0.02.. Also, the combination of recipient IL-10UA negativerdonor IL-10UA positive Žrecipient high producerrdonor low producer., was significantly decreased in multiple rejectors Ž Ps 0.04.. No significant associations were detected between TNF-␣ and TGF-1, and rejection. This study suggests that the combination of recipient᎐donor IL-4 and IL-10 genotypes may be important in renal transplantation outcome. The results appear to corroborate the protective role of both of these cytokines, possibly due to their ability to suppress inflammation. However, due to conflicting results from this and other studies, a multi-centre collaborative study may be required to determine whether cytokine genotypes are significant, independent predictors of renal allograft rejection. 䊚 2001 Elsevier Science B.V. All rights reserved. Keywords: Cytokine gene polymorphism; Renal transplantation; Rejection
1. Introduction Despite the successes of renal transplantation, a graft failure rate of up to 13% in the first year, rising to 35% over 5 years still occurs w1x. Rejection accounts for most graft failures and continues to be a major problem despite HLA-matching and modern immunosuppressive regimes. It is clear that research into the U
Corresponding author. Immunology Section, Derriford Combined Laboratories, Derriford Hospital, Plymouth, PL6 8DH, UK. Tel.: q44-1752-792-390; fax: q44-1752-792-400. E-mail address: [email protected] ŽK.L. Poole..
prevention of rejection is imperative if donor kidneys are to be optimally utilised, so minimising re-transplantation. The precise role that cytokines play in rejection is still unclear. It is known that single nucleotide polymorphisms ŽSNPs. in the regulatory regions of the genes encoding cytokines exist, which may influence their expression w2x, by creating or interfering with a transcription factor binding site on the genomic DNA w3,4x. A small number of recent studies have suggested that some of these cytokine promoter and regulatory SNPs are associated with allograft rejection andror allograft survival. A single base substitution ŽGrA. at position y308
0966-3274r01r$ - see front matter 䊚 2001 Elsevier Science B.V. All rights reserved. PII: S 0 9 6 6 - 3 2 7 4 Ž 0 1 . 0 0 0 3 0 - 2
260
K.L. Poole et al. r Transplant Immunology 8 (2001) 259᎐265
of the TNF-␣ gene results in two different alleles, TNF1 and TNF2, associated with differential TNF-␣ expression w5᎐7x. In both heart transplantation w8x and liver transplantation w9x, the TNF2 high-producer phenotype has been reported to be associated with multiple rejection episodes. Similarly, in renal transplantation, TNF2 has been reported to be associated with acute rejection in HLA-DR mismatched allografts w2x. The IL-10 promoter contains a GrA SNP at position y1082, and the IL-10U G allele promotes transcription factor binding w4x. It is postulated that due to its ability to suppress inflammation, high producers of IL-10 are protected against acute rejection w4x. In heart transplantation this scenario has been reported to occur w8x, however, the opposite has been found in renal transplantation, with the high expressor IL-10U G genotype conferring an increased susceptibility to acute rejection w4,8x. IL-4, like IL-10, has immunosuppressive properties. A CrT SNP at position y590 of the IL-4 gene has been discovered, and the IL-4U T allele has been shown to be associated with an increase in expression levels in stimulated cells w10x. However, its influence on renal allograft rejection has not been investigated. A GrC SNP at position q915 of the gene for TGF-1 corresponds to codon 25 of the signal sequence, and is associated with differential TGF-1 expression. TGF-1 has both pro-inflammatory and immunosuppressive functions w4,11x. It has been hypothesised that the main involvement of TGF-1 in transplantation concerns chronic rejection, with indications of this being described in lung, heart, liver and kidney transplantation w12x, but the picture remains unclear.
2. Aims and objectives There are conflicting data in the literature on the influence of cytokine gene polymorphisms on allograft rejection, with most results based on recipient genotype alone. This study aimed to clarify the situation, by studying the effects of both recipient and donor genotype on the outcome of renal transplantation, in a single centre study of consecutive transplants, with all patients receiving standard triple immunosuppression.
Renal and Transplant Unit between April 1994 and April 1997 was selected for inclusion in this study. All patients were followed up for at least one year, and episodes of clinical rejection determined in the first year post-transplant. 3.1.2. Immunosuppression The recipients all commenced on a triple therapy regime of immunosuppression on the day of transplant. This comprised Cyclosporin A Ž8᎐10 mgrkg., Azathioprine Ž2 mgrkg. and Prednisolone Ž0.3 mgrkg., and was reduced over 6 months according to blood levels. Clinical rejection was identified as an increase in creatinine levels in the absence of infection, obstruction or evidence of drug toxicity, associated with a fall to within 10% of the baseline creatinine level after treatment. Patients with rejection were treated with one or two courses of methylprednisolone Ž3 = 0.5 g. in the first instance. Persistent acute vascular rejection ŽAVR., which proved steroid resistant, was treated with anti-thymocyte globulin ŽATG.. 3.1.3. Stratification of study group into rejectors and nonrejectors Out of the 120 transplants, 28 recipients Ž23.3%. suffered at least one rejection episode, and 21 of these were biopsy proven Ž75%., with the remaining seven clinically proven. This left 92 patients with no rejection. 3.1.4. HLA matching HLA-matching data were assessed, with an antigen mismatch defined as a difference between recipient and donor at either the broad or ‘split’ serological level. This analysis revealed that 82 of the 120 transplants Ž68.3%. were antigen-mismatched between recipient and donor for HLA-DR. The rejector group contained 21 DR-mismatched transplants Ž75%., whilst the non-rejector group contained 61 Ž66.3%., 7 of which were double antigen mismatches. No significant effect of HLA-mismatching on rejection was observed in this study group. 3.2. DNA extraction Stored DNA samples were prepared from EDTA or citrate whole blood by a rapid salting out DNA extraction method w13x, and were previously obtained for patient᎐donor clinical HLA-typing in our laboratory.
3. Materials and methods 3.3. PCR-SSP genotyping 3.1. Study group 3.1.1. Renal recipient and donor samples A consecutive series of 127 first cadaveric renal recipients and their donors Žfor whom stored DNA samples were available. transplanted at the Wessex
All cytokine genotyping methods were based on the polymerase chain reaction ŽPCR. technique utilising sequence-specific primers ŽSSP., and were similar to those previously published w14x. Each PCR contained an allele specific pair of primers, so that amplification
K.L. Poole et al. r Transplant Immunology 8 (2001) 259᎐265
261
Table 1 Primer sequences and PCR product sizes Primer id
Primer sequence 5⬘ ª 3⬘
TNF-␣ C1 Žcommon. TNF-␣ C2 Ždetects low producer. TNF-␣ C3 Ždetects high producer. IL-10 Žcommon. IL-10 G Ždetects high producer. IL-10 A Ždetects low producer. IL-4 Žcommon. IL-4 C Ždetects low producer. IL-4 T Ždetects high producer. TGF-1 Žcommon. TGF-1 G Ždetects high producer. TGF-1 C Ždetects low producer. 63 Control 64 Control HGH I Control HGH II control
TCTCGGTTTCTTCTCCATCG ATAGGTTTTGAGGGGCATGG ATAGGTTTTGAGGGGCATGA CTTGGATTAAATTGGCCTTAGA CTACTAAGGCTTCTTTGGGAG ACTACTAAGGCTTCTTTGGGAA AGTACAGGTGGCATCTTGGAAA CTAAACTTGGGAGAACATTGTC CTAAACTTGGGAGAACATTGTT GGCTCCGGTTCTGCACTC GTGCTGACGCCTGGCCG GTGCTGACGCCTGGCCC TGCCAAGTGGAGCACCCAA GCATCTTGCTCTGTGCAGAT GCCTTCCCAACCATTCCCTTA TCACGGATTTCTGTTGTGTTTC
only occurred if DNA containing the target sequence was present. Genotype was determined by the presence or absence of a PCR product of a specific known size ŽTable 1.. Internal control primers were included to control for false negative reactions. Ten-microliter PCR reactions, consisted of 1 = Reddy load reaction buffer ŽAdvanced Biotechnologies., 200 M each dNTPs ŽAmersham Pharmacia Biotech.., 1.5 mM MgCl 2 ŽAdvanced Biotechnologies., 0.025 units Thermoprime Plus DNA Polymerase ŽAdvanced Biotechnologies., 0.5 l DNA Ž50᎐100 ng., and 5 l of primer mix. Primer mix consisted of 2 M specific primers ŽTable 1. and varying concentrations of internal control primers ŽTable 1., depending on the cytokine genotyped. Two different sets of control primers were employed; for TNF-␣, IL-10 and IL-4, a primer pair that amplified a 796 base pair fragment of the third intron of the HLA DRB1 gene w15x was used Ž63r64. at concentrations of 0.6, 0.3 and 0.6 M, respectively, for TGF-1 a primer pair amplifying a 429-base pair fragment of the human growth hormone ŽHGH. gene w16x was used ŽHGH I and II. at a concentration of 0.4 M. Samples for TNF-␣, IL-10 and IL-4 genotyping underwent PCR in a 9600 Perkin-Elmer thermal cycler according to the following parameters: an initial 2-min denaturation step at 96⬚C, 10 cycles of 20 s denaturation at 96⬚C, 50 s at annealing temperature and 40 s extension at 72⬚C, followed by 20 cycles of 20 s denaturation at 96⬚C, 50 s annealing at 60⬚C and 40 s extension at 72⬚C, with a final 10⬚C soak. The annealing temperature for TNF-␣ and IL-10 was 65⬚C, for IL-4 an annealing temperature of 65.5⬚C was used. For TGF-1 genotyping, a PTC-200 Peltier ŽMJ Research.
PCR product size Žbase pairs.
184
258
156
233 796 429
thermal cycler was used, and the PCR programme progressed according to a previously described protocol w14x. The resulting PCR products were electrophoresed on a 2% agarose gel Ž0.5 grml ethidium bromide., and visualised using a dual intensity UV transilluminator. 3.4. Statistical methods Statistical analysis of the results was performed using 2 = 2 contingency tables and 2 or Fisher’s exact probability tests, where appropriate ŽUniversity of Southampton MedStat programme.. A P-value of less than 0.05 was considered significant, whilst a value of less than 0.10 indicated a trend.
4. Results 4.1. Definition of study group Of the 127 recipient᎐donor pairs initially studied, seven were excluded on the basis that full clinical data was not available on four transplants and three transplants failed within three days due to technical reasons. The final study group, therefore, consisted of 120 recipient᎐donor pairs, on which full clinical data were obtained. Individual DNA samples which were TNF2 positive included TNF2 homozygotes and TNF1rTNF2 heterozygotes, and these were classified as ‘high producers’ for TNF-␣. Thus, TNF2 negative, ‘low producers’, were TNF1 homozygotes. A similar strategy was adopted for the other cytokines, based on published evidence of genotype expression correlations w2x.
K.L. Poole et al. r Transplant Immunology 8 (2001) 259᎐265
262
4.2. Analysis of rejector and non-rejector groups
made by studying combinations of recipient TNF␣rIL-10 and IL-10rIL-4 genotypes. The analysis between cytokine genotype and rejection frequency showed a trend towards an increase in recipient IL10UA positive Žlow producer. genotype in the multiple rejector group Ž Ps 0.07, Table 3.. This trend was reversed in the HLA-DR-mismatched donor group, with a decrease in the IL-10UA positive Žlow producer. in the multiple rejectors group Ž Ps 0.06, Table 3.. No significant associations were observed for the combinations of recipient genotypes relating to rejection frequency.
The incidence of the cytokine genotypes was compared between rejectors and non-rejectors, in both recipients and donors. This analysis was repeated on the HLA-DR mismatched transplants. The rejector and non-rejector groups of recipients were also studied in relation to the combination of TNF-␣rIL-10 genotype, in order to provide a comparison with previously published results w2x. IL-10rIL-4 genotype combinations were also analysed due to significant rejection-related changes in their post-transplant expression ratios previously detected by our laboratory w17x. These analyses demonstrated a significant decrease in donor IL-4U T Žhigh producer. genotype in the rejector group Ž Ps 0.01, Table 2.. This same association was observed as a trend in the DR-mismatched rejector group Ž Ps 0.06, Table 2.. No associations were observed for the combinations of recipient genotypes in rejectors and non-rejectors.
4.4. Association of combined recipient and donor cytokine genotype with rejection Combinations of recipient and donor genotypes were analysed in order to determine if their interaction had a joint effect on transplant outcome. Each cytokine was assessed in the stratification group where the P-values obtained for recipients and donors had been closest to the level of significance. No associations were detected between combinations of recipient and donor TNF-␣ genotype or TGF-1 genotype and rejection. The combination of recipient IL-10UA negativerdonor IL-10UA positive Žrecipient high producerrdonor low producer. exhibited a significant decrease in multiple rejectors Ž Ps 0.04, Table 4.. The analysis for IL-4 indicated a significant association between the joint genotype of recipient IL-4U T negativerdonor IL-4U T negative Žrecipient low producerrdonor low producer. and rejection Ž Ps 0.02, Table 5..
4.3. Stratification of study group according to the number of rejection episodes The rejector group was further stratified relating to the number of rejection episodes. According to the precedent set by Sankaran et al. w2x, patients suffering two or more rejection episodes were classified as multiple rejectors, whilst patients who suffered one rejection episode were segregated with the non-rejectors. There were 14 Ž11.7%. recipients in the multiple rejector group, 11 Ž78.6%. of which were DR-mismatched. This left 106 Ž88.3%. transplant recipients in the group of one or no rejection episodes, 71 Ž67.0%. of these were DR-mismatched. Cytokine genotype frequencies were analysed in all transplants, and in DR-mismatched transplants. Further analyses of multiple rejection were
5. Discussion In this study, no significant association, or trend, was observed between recipient andror donor TNF-␣
Table 2 Analysis of donor IL-4 and TGF-1 genotype in rejectors and non-rejectors a Genotype
Donor IL-4
IL-4U T positive IL-4U T negative
Donor TGF-1
TGF-1U C positive TGF-1U C negative
a
All transplants
HLA-DR mismatched transplants
R
NR
P
R
NR
P
1 Ž3.6%. 27 Ž96.4%.
21 Ž22.8%. 71 Ž77.2%.
0.01
1 Ž4.8%. 20 Ž95.2%.
13 Ž21.3%. 48 Ž78.7%.
0.06
5 Ž17.9%. 23 Ž82.1%.
18 Ž19.6%. 74 Ž80.4%.
NS
1 Ž4.8%. 20 Ž95.2%.
12 Ž19.7%. 49 Ž80.3%.
0.08
Abbre¨ iations: R, rejectors; P, probability; NR, non-rejectors; NS, not significant.
K.L. Poole et al. r Transplant Immunology 8 (2001) 259᎐265
263
Table 3 Analysis of recipient and donor IL-10 genotype related to frequency of rejection episodesa Genotype
Recipient IL-10
All transplants
IL-10UA positive IL-10UA negative
Donor IL-10
IL-10UA positive IL-10UA negative
a
HLA-DR mismatched transplants
G 2R
F 1R
P
G 2R
F 1R
P
13 Ž92.9%. 1 Ž7.1%.
76 Ž71.7%. 30 Ž28.3%.
0.07
10 Ž90.9%. 1 Ž9.1%.
54 Ž76.1%. 17 Ž23.9%.
NS
9 Ž64.3%. 5 Ž35.7%.
85 Ž80.2%. 21 Ž19.8%.
NS
6 Ž54.5%. 5 Ž45.5%.
57 Ž80.3%. 14 Ž19.7%.
0.06
Abbre¨ iations: G 2R, two rejection episodes or more; F 1R, one rejection episode or less; NS, not significant; P, probability.
genotype and rejection, irrespective of HLA-DR mismatching status. This conflicts with data obtained from previous single-centre studies of TNF-␣ genotype and renal allograft rejection. One study reported a significant increase in the TNF2 high producer allele in
HLA-DR mismatched multiple rejectors, and concluded that TNF-␣ genotype could be an aid in predicting acute renal allograft rejection w2x. A further single centre study also looked at TNF-␣ polymorphism in renal transplantation, and concluded that possession of
Table 4 Analysis of combinations of recipient and donor IL-10 genotypea Recipientrdonor genotype
All transplants
HLA-DR mismatched transplants
G 2R
F 1R
P
G 2R
F 1R
P
rIL-10UA positiverdIL-10UA negative All others
4 Ž28.6%. 10 Ž71.4%.
14 Ž13.2%. 92 Ž86.8%.
0.1
4 Ž36.4%. 7 Ž63.6%.
11 Ž15.5%. 60 Ž84.5%.
0.09
rIL-10UA negativerdIL-10UA positive All others
0 Ž0.0%. 14 Ž100.0%.
23 Ž21.7%. 83 Ž78.3%.
0.04
0 Ž0.0%. 11 Ž100.0%.
14 Ž19.7%. 57 Ž80.3%.
NS
a
Abbre¨ iations: G 2R, two rejection episodes or more; F 1R, one rejection episode or less; r, recipient; NS, not significant; d, donor; P, probability.
Table 5 Analysis of combinations of recipient and donor IL-4 genotypea Recipientrdonor genotype
All transplants
HLA-DR mismatched transplants
R
NR
P
R
NR
P
rIL-4U T negativerdIL-4U T negative All others
23 Ž82.1%. 5 Ž17.9%.
55 Ž59.8%. 37 Ž40.2%.
0.02
17 Ž81.0%. 4 Ž19.0%.
38 Ž62.3%. 23 Ž37.7%.
0.07
rIL-4U T negativerdIL-4U T positive All others
1 Ž3.6%. 27 Ž96.4%.
15 Ž16.3%. 77 Ž83.7%.
0.06
1 Ž4.8%. 20 Ž95.2%.
12 Ž19.7%. 49 Ž80.3%.
0.08
a
Abbre¨ iations: R, rejectors; P, probability; r, recipient; NR, non-rejectors; d, donor.
264
K.L. Poole et al. r Transplant Immunology 8 (2001) 259᎐265
the high producer genotype was associated with acute rejection w18x. The effects of TGF-1 on transplantation have largely been limited to studies of lung allografts, with reports that the high producer allele is associated with fibrosis w19x, and thereby chronic rejection. However, in this study, no significant associations were observed between recipient andror donor TGF-1 genotype and rejection. When the study group was stratified according to the number of rejection episodes, a trend was observed towards an increase in the IL-10UA, low producer, recipient genotype in multiple rejectors ŽTable 3.. IL-10 is a Th2 type cytokine with anti-inflammatory action, so has been hypothesised to have a protective role against allograft rejection. Renal transplantation has previously provided a different picture, possibly due to different cell types or rejection methods involved, and Sankaran et al. w2x found an increase in the IL-10 high producer genotype in their HLA-DR mismatched multiple rejectors. Interestingly, in terms of donor IL-10 genotype, a similar analysis resulted in a trend in the opposite direction ŽTable 3., with a decrease in the IL-10UA allele in the multiple rejectors group. Sankaran et al. w2x observed no donor effect, and no further data is available on the effect of donor IL-10 genotype on rejection. If donor cytokine genotype is capable of influencing rejection or tolerance of an allograft, then it is plausible that the combination of recipient and donor genotypes may be important. For this reason, joint analyses for recipients and donors were performed for each cytokine. Results for IL-10, revealed that the combination of recipient high producerrdonor low producer Žrecipient IL-10UA negativerdonor IL-10UA positive. occurred at a significantly lower frequency in the multiple rejectors ŽTable 4.. This combination of IL-10 genotypes for recipient and donor may be interpreted as being protective against rejection. No association between recipient IL-4 genotype and rejection was demonstrated in this study. However, a donor effect on rejection was detected for IL-4 genotype. When all transplants were considered, there was a significant reduction in the IL-4U T high producer genotype in rejectors, in comparison with non-rejectors ŽTable 2.. Absence of the IL-4U T allele in both recipient and donor, i.e. recipient low producerrdonor low producer, was significantly increased in rejectors ŽTable 5.. This result appears to corroborate the role of IL-4 as a protective cytokine in renal transplantation, due to its ability to suppress inflammation. There has been little work conducted concerning IL-4 promoter gene polymorphism, so a comparison of these results with other investigations is limited. Work
conducted in our laboratory by Tan et al. w17x suggests differential expression of IL-4 in peripheral T-cells of rejectors and non-rejectors post renal-transplantation, and that IL-4 is very sensitive to immunosuppression. Also, the ratio between IL-4 and IL-10 showed significant changes, indicating the importance of these cytokines in monitoring rejection. Cytokines exert their effect on the immune system in an integrated manner, and this complexity complicates interpretation of results from studies such as this. However, no uniform message of the role of cytokine gene polymorphism in renal transplantation outcome has emerged as yet. Differing levels of inter-study immunosuppression may be a possible explanation for the lack of agreement between studies, as in this study there was consistent triple therapy, whereas Sankaran et al. w2x analysed transplants with a Cyclosporin A monotherapy regime. However, results obtained from the current study support a possible role for patient and donor SNPs associated with differential IL-10 and IL-4 expression in influencing renal allograft outcome. Conversely, our results do not indicate a significant role for patient or donor SNPs associated with TNF-␣ or TGF-1 expression in renal allograft rejection episodes. Based on these findings, further analyses of patient and donor cytokine genotypes in large allograft series is required, in order to demonstrate which cytokine genotypes show significant, independent influences on renal allograft rejection, before tailoring of immunosuppression regimes according to cytokine profiles is possible.
References w1x Gjertson DW. Look-up survival tables for renal transplantation. Clin Transplant 1997:337᎐83. w2x Sankaran D, Asderakis A, Ashraf S et al. Cytokine gene polymorphisms predict acute graft rejection following renal transplantation. Kidney Int 1999;56:281᎐288. w3x Hutchinson IV, Turner DM, Sankaran D, Awad MR, Sinnott PJ. Influence of cytokine genotypes on allograft rejection. Transplant Proc 1998;30:862᎐863. w4x Hutchinson IV, Turner D, Sankaran D, Awad M, Pravica V, Sinnott P. Cytokine genotypes in allograft rejection: guidelines for immunosuppression. Transplant Proc 1998;30:3991᎐3992. w5x Kroeger KM, Carville KS, Abraham LJ. The y308 tumour necrosis factor-␣ promoter polymorphism effects transcription. Mol Immunol 1997;34:391᎐399. w6x Wilson AG, Symons JA, McDowell TL, McDevitt HO, Duff GW. Effects of a polymorphism in the human tumour necrosis factor-␣ promoter on transcriptional activation. Proc Natl Acad Sci 1997;94:3195᎐3199. w7x Uglialoro AM, Turbay D, Pesavento PA et al. Identification of three new single nucleotide polymorphisms in the human tumour necrosis factor-␣ gene promoter. Tissue Antigen 1998;52:359᎐367.
K.L. Poole et al. r Transplant Immunology 8 (2001) 259᎐265 w8x Martell J. Cytokines and their effects on transplant rejection. Am Soc Histocompat Immunogenet Q 1999:10᎐11. w9x Bathgate AJ, Pravica V, Therapondos G, Plevris JN, Hayes PC, Hutchinson IV. The effect of polymorphisms in tumor necrosis factor-alpha, interleukin-10, and transforming growth factorbeta1 genes in acute hepatic allograft rejection. Transplantation 2000;69Ž7.:1237᎐1238. w10x Rosenwasser LJ, Klemm DJ, Dresback JK et al. Promoter polymorphisms in the chromosome 5 gene cluster in asthma and atopy. Clin Exp Allergy 1995;25:74᎐78. w11x Hutchinson IV, Pravica V, Perrey C, Sinnott P. Cytokine gene polymorphisms and relevance to forms of rejection. Transplant Proc 1999;31:734᎐736. w12x Hutchinson IV. The role of transforming growth factor-␣ in transplant rejection, Suppl 7A. Transplant Proc 1999;31:9S᎐13S. w13x Miller SA, Dykes DD, Polesky HF. A simple salting out procedure for extracting DNA from human nucleated cells. Nucl Acids Res 1988;16Ž3.:1215. w14x Perrey C, Turner SJ, Pravica V, Howell WM, Hutchinson IV. ARMS-PCR methodologies to determine IL-10, TNF-␣, TNF-
w15x
w16x
w17x
w18x
w19x
265
and TGF-1 gene polymorphisms. Transplant Immunol 1999;7:127᎐128. Bunce M, O’Neill CM, Barnardo MCNM et al. Phototyping: comprehensive DNA typing for HLA-A, B, C, DRB1, DRB3, DRB4, DRB5, & DQB1 by PCR with 144 primer mixes utilising SSP ŽPCR-SSP.. Tissue Antigen 1995;46:355᎐367. Aldener-Cannava A, Olerup O. HLA-DQB1 ‘low resolution’ typing by PCR amplification with sequence specific primers ŽPCR-SSP.. Eur J Immunogenet 1994;21:447᎐455. Tan LC, Howell WM, Smith JL, Sadek SA. Sequential monitoring of peripheral T-lymphocyte cytokine gene expression in the early post renal allograft period. Transplantation, in press. Pelletier R, Pravica V, Perrey C et al. Evidence for a genetic predisposition towards acute rejection after kidney and simultaneous kidney᎐pancreas transplantation. Transplantation 2000;70:674᎐680. El-Gamel A, Awad MR, Hasleton PS et al. Transforming growth factor-beta ŽTGF-1. genotype and lung allograft fibrosis. J Heart Lung Transplant 1999;18:517᎐523.
Influence of patient and donor cytokine genotypes on renal allograft rejection: evidence from a single centre study K.L. Poole a,U , P.J. Gibbs b, P.R. Evans a , S.A. Sadek b, W.M. Howella a
Histocompatibility and Immunogenetics Laboratory, Southampton Uni¨ ersity Hospitals, Tremona Road, Southampton, SO16 6YD, UK b Wessex Renal and Transplant Unit, St. Mary’s Hospital, Portsmouth, PO3 6AD, UK Received 4 December 2000; accepted 5 January 2001
Abstract Cytokines are key immune mediators and it has been suggested that cytokine gene polymorphisms affecting expression influence rejection or tolerance. This study sought to examine this hypothesis with the aim of identifying predictive genotype markers for rejection. The study group consisted of 120 consecutive first cadaveric recipient᎐donor pairs transplanted at a single centre, between 1994 and 1997. PCR utilising sequence-specific primers ŽSSP. methodology was optimised for genotyping recipient and donor DNA for the following polymorphisms: tumour necrosis factor ŽTNF. -␣ Ž-308, GrA., interleukin ŽIL.-10 Žy1082, GrA., IL-4 Žy590, CrT., transforming growth factor ŽTGF. -1 Žq915, GrC.. Recipient᎐donor pairs were divided into rejectors Ž n s 28. and non-rejectors Ž n s 92.. Each group was further stratified according to number of rejection episodes and HLA-DR mismatching. Recipient᎐donor pairs both lacking the IL-4U T allele Žrecipient low producerrdonor low producer. were significantly increased in the rejector group Ž Ps 0.02.. Also, the combination of recipient IL-10UA negativerdonor IL-10UA positive Žrecipient high producerrdonor low producer., was significantly decreased in multiple rejectors Ž Ps 0.04.. No significant associations were detected between TNF-␣ and TGF-1, and rejection. This study suggests that the combination of recipient᎐donor IL-4 and IL-10 genotypes may be important in renal transplantation outcome. The results appear to corroborate the protective role of both of these cytokines, possibly due to their ability to suppress inflammation. However, due to conflicting results from this and other studies, a multi-centre collaborative study may be required to determine whether cytokine genotypes are significant, independent predictors of renal allograft rejection. 䊚 2001 Elsevier Science B.V. All rights reserved. Keywords: Cytokine gene polymorphism; Renal transplantation; Rejection
1. Introduction Despite the successes of renal transplantation, a graft failure rate of up to 13% in the first year, rising to 35% over 5 years still occurs w1x. Rejection accounts for most graft failures and continues to be a major problem despite HLA-matching and modern immunosuppressive regimes. It is clear that research into the U
Corresponding author. Immunology Section, Derriford Combined Laboratories, Derriford Hospital, Plymouth, PL6 8DH, UK. Tel.: q44-1752-792-390; fax: q44-1752-792-400. E-mail address: [email protected] ŽK.L. Poole..
prevention of rejection is imperative if donor kidneys are to be optimally utilised, so minimising re-transplantation. The precise role that cytokines play in rejection is still unclear. It is known that single nucleotide polymorphisms ŽSNPs. in the regulatory regions of the genes encoding cytokines exist, which may influence their expression w2x, by creating or interfering with a transcription factor binding site on the genomic DNA w3,4x. A small number of recent studies have suggested that some of these cytokine promoter and regulatory SNPs are associated with allograft rejection andror allograft survival. A single base substitution ŽGrA. at position y308
0966-3274r01r$ - see front matter 䊚 2001 Elsevier Science B.V. All rights reserved. PII: S 0 9 6 6 - 3 2 7 4 Ž 0 1 . 0 0 0 3 0 - 2
260
K.L. Poole et al. r Transplant Immunology 8 (2001) 259᎐265
of the TNF-␣ gene results in two different alleles, TNF1 and TNF2, associated with differential TNF-␣ expression w5᎐7x. In both heart transplantation w8x and liver transplantation w9x, the TNF2 high-producer phenotype has been reported to be associated with multiple rejection episodes. Similarly, in renal transplantation, TNF2 has been reported to be associated with acute rejection in HLA-DR mismatched allografts w2x. The IL-10 promoter contains a GrA SNP at position y1082, and the IL-10U G allele promotes transcription factor binding w4x. It is postulated that due to its ability to suppress inflammation, high producers of IL-10 are protected against acute rejection w4x. In heart transplantation this scenario has been reported to occur w8x, however, the opposite has been found in renal transplantation, with the high expressor IL-10U G genotype conferring an increased susceptibility to acute rejection w4,8x. IL-4, like IL-10, has immunosuppressive properties. A CrT SNP at position y590 of the IL-4 gene has been discovered, and the IL-4U T allele has been shown to be associated with an increase in expression levels in stimulated cells w10x. However, its influence on renal allograft rejection has not been investigated. A GrC SNP at position q915 of the gene for TGF-1 corresponds to codon 25 of the signal sequence, and is associated with differential TGF-1 expression. TGF-1 has both pro-inflammatory and immunosuppressive functions w4,11x. It has been hypothesised that the main involvement of TGF-1 in transplantation concerns chronic rejection, with indications of this being described in lung, heart, liver and kidney transplantation w12x, but the picture remains unclear.
2. Aims and objectives There are conflicting data in the literature on the influence of cytokine gene polymorphisms on allograft rejection, with most results based on recipient genotype alone. This study aimed to clarify the situation, by studying the effects of both recipient and donor genotype on the outcome of renal transplantation, in a single centre study of consecutive transplants, with all patients receiving standard triple immunosuppression.
Renal and Transplant Unit between April 1994 and April 1997 was selected for inclusion in this study. All patients were followed up for at least one year, and episodes of clinical rejection determined in the first year post-transplant. 3.1.2. Immunosuppression The recipients all commenced on a triple therapy regime of immunosuppression on the day of transplant. This comprised Cyclosporin A Ž8᎐10 mgrkg., Azathioprine Ž2 mgrkg. and Prednisolone Ž0.3 mgrkg., and was reduced over 6 months according to blood levels. Clinical rejection was identified as an increase in creatinine levels in the absence of infection, obstruction or evidence of drug toxicity, associated with a fall to within 10% of the baseline creatinine level after treatment. Patients with rejection were treated with one or two courses of methylprednisolone Ž3 = 0.5 g. in the first instance. Persistent acute vascular rejection ŽAVR., which proved steroid resistant, was treated with anti-thymocyte globulin ŽATG.. 3.1.3. Stratification of study group into rejectors and nonrejectors Out of the 120 transplants, 28 recipients Ž23.3%. suffered at least one rejection episode, and 21 of these were biopsy proven Ž75%., with the remaining seven clinically proven. This left 92 patients with no rejection. 3.1.4. HLA matching HLA-matching data were assessed, with an antigen mismatch defined as a difference between recipient and donor at either the broad or ‘split’ serological level. This analysis revealed that 82 of the 120 transplants Ž68.3%. were antigen-mismatched between recipient and donor for HLA-DR. The rejector group contained 21 DR-mismatched transplants Ž75%., whilst the non-rejector group contained 61 Ž66.3%., 7 of which were double antigen mismatches. No significant effect of HLA-mismatching on rejection was observed in this study group. 3.2. DNA extraction Stored DNA samples were prepared from EDTA or citrate whole blood by a rapid salting out DNA extraction method w13x, and were previously obtained for patient᎐donor clinical HLA-typing in our laboratory.
3. Materials and methods 3.3. PCR-SSP genotyping 3.1. Study group 3.1.1. Renal recipient and donor samples A consecutive series of 127 first cadaveric renal recipients and their donors Žfor whom stored DNA samples were available. transplanted at the Wessex
All cytokine genotyping methods were based on the polymerase chain reaction ŽPCR. technique utilising sequence-specific primers ŽSSP., and were similar to those previously published w14x. Each PCR contained an allele specific pair of primers, so that amplification
K.L. Poole et al. r Transplant Immunology 8 (2001) 259᎐265
261
Table 1 Primer sequences and PCR product sizes Primer id
Primer sequence 5⬘ ª 3⬘
TNF-␣ C1 Žcommon. TNF-␣ C2 Ždetects low producer. TNF-␣ C3 Ždetects high producer. IL-10 Žcommon. IL-10 G Ždetects high producer. IL-10 A Ždetects low producer. IL-4 Žcommon. IL-4 C Ždetects low producer. IL-4 T Ždetects high producer. TGF-1 Žcommon. TGF-1 G Ždetects high producer. TGF-1 C Ždetects low producer. 63 Control 64 Control HGH I Control HGH II control
TCTCGGTTTCTTCTCCATCG ATAGGTTTTGAGGGGCATGG ATAGGTTTTGAGGGGCATGA CTTGGATTAAATTGGCCTTAGA CTACTAAGGCTTCTTTGGGAG ACTACTAAGGCTTCTTTGGGAA AGTACAGGTGGCATCTTGGAAA CTAAACTTGGGAGAACATTGTC CTAAACTTGGGAGAACATTGTT GGCTCCGGTTCTGCACTC GTGCTGACGCCTGGCCG GTGCTGACGCCTGGCCC TGCCAAGTGGAGCACCCAA GCATCTTGCTCTGTGCAGAT GCCTTCCCAACCATTCCCTTA TCACGGATTTCTGTTGTGTTTC
only occurred if DNA containing the target sequence was present. Genotype was determined by the presence or absence of a PCR product of a specific known size ŽTable 1.. Internal control primers were included to control for false negative reactions. Ten-microliter PCR reactions, consisted of 1 = Reddy load reaction buffer ŽAdvanced Biotechnologies., 200 M each dNTPs ŽAmersham Pharmacia Biotech.., 1.5 mM MgCl 2 ŽAdvanced Biotechnologies., 0.025 units Thermoprime Plus DNA Polymerase ŽAdvanced Biotechnologies., 0.5 l DNA Ž50᎐100 ng., and 5 l of primer mix. Primer mix consisted of 2 M specific primers ŽTable 1. and varying concentrations of internal control primers ŽTable 1., depending on the cytokine genotyped. Two different sets of control primers were employed; for TNF-␣, IL-10 and IL-4, a primer pair that amplified a 796 base pair fragment of the third intron of the HLA DRB1 gene w15x was used Ž63r64. at concentrations of 0.6, 0.3 and 0.6 M, respectively, for TGF-1 a primer pair amplifying a 429-base pair fragment of the human growth hormone ŽHGH. gene w16x was used ŽHGH I and II. at a concentration of 0.4 M. Samples for TNF-␣, IL-10 and IL-4 genotyping underwent PCR in a 9600 Perkin-Elmer thermal cycler according to the following parameters: an initial 2-min denaturation step at 96⬚C, 10 cycles of 20 s denaturation at 96⬚C, 50 s at annealing temperature and 40 s extension at 72⬚C, followed by 20 cycles of 20 s denaturation at 96⬚C, 50 s annealing at 60⬚C and 40 s extension at 72⬚C, with a final 10⬚C soak. The annealing temperature for TNF-␣ and IL-10 was 65⬚C, for IL-4 an annealing temperature of 65.5⬚C was used. For TGF-1 genotyping, a PTC-200 Peltier ŽMJ Research.
PCR product size Žbase pairs.
184
258
156
233 796 429
thermal cycler was used, and the PCR programme progressed according to a previously described protocol w14x. The resulting PCR products were electrophoresed on a 2% agarose gel Ž0.5 grml ethidium bromide., and visualised using a dual intensity UV transilluminator. 3.4. Statistical methods Statistical analysis of the results was performed using 2 = 2 contingency tables and 2 or Fisher’s exact probability tests, where appropriate ŽUniversity of Southampton MedStat programme.. A P-value of less than 0.05 was considered significant, whilst a value of less than 0.10 indicated a trend.
4. Results 4.1. Definition of study group Of the 127 recipient᎐donor pairs initially studied, seven were excluded on the basis that full clinical data was not available on four transplants and three transplants failed within three days due to technical reasons. The final study group, therefore, consisted of 120 recipient᎐donor pairs, on which full clinical data were obtained. Individual DNA samples which were TNF2 positive included TNF2 homozygotes and TNF1rTNF2 heterozygotes, and these were classified as ‘high producers’ for TNF-␣. Thus, TNF2 negative, ‘low producers’, were TNF1 homozygotes. A similar strategy was adopted for the other cytokines, based on published evidence of genotype expression correlations w2x.
K.L. Poole et al. r Transplant Immunology 8 (2001) 259᎐265
262
4.2. Analysis of rejector and non-rejector groups
made by studying combinations of recipient TNF␣rIL-10 and IL-10rIL-4 genotypes. The analysis between cytokine genotype and rejection frequency showed a trend towards an increase in recipient IL10UA positive Žlow producer. genotype in the multiple rejector group Ž Ps 0.07, Table 3.. This trend was reversed in the HLA-DR-mismatched donor group, with a decrease in the IL-10UA positive Žlow producer. in the multiple rejectors group Ž Ps 0.06, Table 3.. No significant associations were observed for the combinations of recipient genotypes relating to rejection frequency.
The incidence of the cytokine genotypes was compared between rejectors and non-rejectors, in both recipients and donors. This analysis was repeated on the HLA-DR mismatched transplants. The rejector and non-rejector groups of recipients were also studied in relation to the combination of TNF-␣rIL-10 genotype, in order to provide a comparison with previously published results w2x. IL-10rIL-4 genotype combinations were also analysed due to significant rejection-related changes in their post-transplant expression ratios previously detected by our laboratory w17x. These analyses demonstrated a significant decrease in donor IL-4U T Žhigh producer. genotype in the rejector group Ž Ps 0.01, Table 2.. This same association was observed as a trend in the DR-mismatched rejector group Ž Ps 0.06, Table 2.. No associations were observed for the combinations of recipient genotypes in rejectors and non-rejectors.
4.4. Association of combined recipient and donor cytokine genotype with rejection Combinations of recipient and donor genotypes were analysed in order to determine if their interaction had a joint effect on transplant outcome. Each cytokine was assessed in the stratification group where the P-values obtained for recipients and donors had been closest to the level of significance. No associations were detected between combinations of recipient and donor TNF-␣ genotype or TGF-1 genotype and rejection. The combination of recipient IL-10UA negativerdonor IL-10UA positive Žrecipient high producerrdonor low producer. exhibited a significant decrease in multiple rejectors Ž Ps 0.04, Table 4.. The analysis for IL-4 indicated a significant association between the joint genotype of recipient IL-4U T negativerdonor IL-4U T negative Žrecipient low producerrdonor low producer. and rejection Ž Ps 0.02, Table 5..
4.3. Stratification of study group according to the number of rejection episodes The rejector group was further stratified relating to the number of rejection episodes. According to the precedent set by Sankaran et al. w2x, patients suffering two or more rejection episodes were classified as multiple rejectors, whilst patients who suffered one rejection episode were segregated with the non-rejectors. There were 14 Ž11.7%. recipients in the multiple rejector group, 11 Ž78.6%. of which were DR-mismatched. This left 106 Ž88.3%. transplant recipients in the group of one or no rejection episodes, 71 Ž67.0%. of these were DR-mismatched. Cytokine genotype frequencies were analysed in all transplants, and in DR-mismatched transplants. Further analyses of multiple rejection were
5. Discussion In this study, no significant association, or trend, was observed between recipient andror donor TNF-␣
Table 2 Analysis of donor IL-4 and TGF-1 genotype in rejectors and non-rejectors a Genotype
Donor IL-4
IL-4U T positive IL-4U T negative
Donor TGF-1
TGF-1U C positive TGF-1U C negative
a
All transplants
HLA-DR mismatched transplants
R
NR
P
R
NR
P
1 Ž3.6%. 27 Ž96.4%.
21 Ž22.8%. 71 Ž77.2%.
0.01
1 Ž4.8%. 20 Ž95.2%.
13 Ž21.3%. 48 Ž78.7%.
0.06
5 Ž17.9%. 23 Ž82.1%.
18 Ž19.6%. 74 Ž80.4%.
NS
1 Ž4.8%. 20 Ž95.2%.
12 Ž19.7%. 49 Ž80.3%.
0.08
Abbre¨ iations: R, rejectors; P, probability; NR, non-rejectors; NS, not significant.
K.L. Poole et al. r Transplant Immunology 8 (2001) 259᎐265
263
Table 3 Analysis of recipient and donor IL-10 genotype related to frequency of rejection episodesa Genotype
Recipient IL-10
All transplants
IL-10UA positive IL-10UA negative
Donor IL-10
IL-10UA positive IL-10UA negative
a
HLA-DR mismatched transplants
G 2R
F 1R
P
G 2R
F 1R
P
13 Ž92.9%. 1 Ž7.1%.
76 Ž71.7%. 30 Ž28.3%.
0.07
10 Ž90.9%. 1 Ž9.1%.
54 Ž76.1%. 17 Ž23.9%.
NS
9 Ž64.3%. 5 Ž35.7%.
85 Ž80.2%. 21 Ž19.8%.
NS
6 Ž54.5%. 5 Ž45.5%.
57 Ž80.3%. 14 Ž19.7%.
0.06
Abbre¨ iations: G 2R, two rejection episodes or more; F 1R, one rejection episode or less; NS, not significant; P, probability.
genotype and rejection, irrespective of HLA-DR mismatching status. This conflicts with data obtained from previous single-centre studies of TNF-␣ genotype and renal allograft rejection. One study reported a significant increase in the TNF2 high producer allele in
HLA-DR mismatched multiple rejectors, and concluded that TNF-␣ genotype could be an aid in predicting acute renal allograft rejection w2x. A further single centre study also looked at TNF-␣ polymorphism in renal transplantation, and concluded that possession of
Table 4 Analysis of combinations of recipient and donor IL-10 genotypea Recipientrdonor genotype
All transplants
HLA-DR mismatched transplants
G 2R
F 1R
P
G 2R
F 1R
P
rIL-10UA positiverdIL-10UA negative All others
4 Ž28.6%. 10 Ž71.4%.
14 Ž13.2%. 92 Ž86.8%.
0.1
4 Ž36.4%. 7 Ž63.6%.
11 Ž15.5%. 60 Ž84.5%.
0.09
rIL-10UA negativerdIL-10UA positive All others
0 Ž0.0%. 14 Ž100.0%.
23 Ž21.7%. 83 Ž78.3%.
0.04
0 Ž0.0%. 11 Ž100.0%.
14 Ž19.7%. 57 Ž80.3%.
NS
a
Abbre¨ iations: G 2R, two rejection episodes or more; F 1R, one rejection episode or less; r, recipient; NS, not significant; d, donor; P, probability.
Table 5 Analysis of combinations of recipient and donor IL-4 genotypea Recipientrdonor genotype
All transplants
HLA-DR mismatched transplants
R
NR
P
R
NR
P
rIL-4U T negativerdIL-4U T negative All others
23 Ž82.1%. 5 Ž17.9%.
55 Ž59.8%. 37 Ž40.2%.
0.02
17 Ž81.0%. 4 Ž19.0%.
38 Ž62.3%. 23 Ž37.7%.
0.07
rIL-4U T negativerdIL-4U T positive All others
1 Ž3.6%. 27 Ž96.4%.
15 Ž16.3%. 77 Ž83.7%.
0.06
1 Ž4.8%. 20 Ž95.2%.
12 Ž19.7%. 49 Ž80.3%.
0.08
a
Abbre¨ iations: R, rejectors; P, probability; r, recipient; NR, non-rejectors; d, donor.
264
K.L. Poole et al. r Transplant Immunology 8 (2001) 259᎐265
the high producer genotype was associated with acute rejection w18x. The effects of TGF-1 on transplantation have largely been limited to studies of lung allografts, with reports that the high producer allele is associated with fibrosis w19x, and thereby chronic rejection. However, in this study, no significant associations were observed between recipient andror donor TGF-1 genotype and rejection. When the study group was stratified according to the number of rejection episodes, a trend was observed towards an increase in the IL-10UA, low producer, recipient genotype in multiple rejectors ŽTable 3.. IL-10 is a Th2 type cytokine with anti-inflammatory action, so has been hypothesised to have a protective role against allograft rejection. Renal transplantation has previously provided a different picture, possibly due to different cell types or rejection methods involved, and Sankaran et al. w2x found an increase in the IL-10 high producer genotype in their HLA-DR mismatched multiple rejectors. Interestingly, in terms of donor IL-10 genotype, a similar analysis resulted in a trend in the opposite direction ŽTable 3., with a decrease in the IL-10UA allele in the multiple rejectors group. Sankaran et al. w2x observed no donor effect, and no further data is available on the effect of donor IL-10 genotype on rejection. If donor cytokine genotype is capable of influencing rejection or tolerance of an allograft, then it is plausible that the combination of recipient and donor genotypes may be important. For this reason, joint analyses for recipients and donors were performed for each cytokine. Results for IL-10, revealed that the combination of recipient high producerrdonor low producer Žrecipient IL-10UA negativerdonor IL-10UA positive. occurred at a significantly lower frequency in the multiple rejectors ŽTable 4.. This combination of IL-10 genotypes for recipient and donor may be interpreted as being protective against rejection. No association between recipient IL-4 genotype and rejection was demonstrated in this study. However, a donor effect on rejection was detected for IL-4 genotype. When all transplants were considered, there was a significant reduction in the IL-4U T high producer genotype in rejectors, in comparison with non-rejectors ŽTable 2.. Absence of the IL-4U T allele in both recipient and donor, i.e. recipient low producerrdonor low producer, was significantly increased in rejectors ŽTable 5.. This result appears to corroborate the role of IL-4 as a protective cytokine in renal transplantation, due to its ability to suppress inflammation. There has been little work conducted concerning IL-4 promoter gene polymorphism, so a comparison of these results with other investigations is limited. Work
conducted in our laboratory by Tan et al. w17x suggests differential expression of IL-4 in peripheral T-cells of rejectors and non-rejectors post renal-transplantation, and that IL-4 is very sensitive to immunosuppression. Also, the ratio between IL-4 and IL-10 showed significant changes, indicating the importance of these cytokines in monitoring rejection. Cytokines exert their effect on the immune system in an integrated manner, and this complexity complicates interpretation of results from studies such as this. However, no uniform message of the role of cytokine gene polymorphism in renal transplantation outcome has emerged as yet. Differing levels of inter-study immunosuppression may be a possible explanation for the lack of agreement between studies, as in this study there was consistent triple therapy, whereas Sankaran et al. w2x analysed transplants with a Cyclosporin A monotherapy regime. However, results obtained from the current study support a possible role for patient and donor SNPs associated with differential IL-10 and IL-4 expression in influencing renal allograft outcome. Conversely, our results do not indicate a significant role for patient or donor SNPs associated with TNF-␣ or TGF-1 expression in renal allograft rejection episodes. Based on these findings, further analyses of patient and donor cytokine genotypes in large allograft series is required, in order to demonstrate which cytokine genotypes show significant, independent influences on renal allograft rejection, before tailoring of immunosuppression regimes according to cytokine profiles is possible.
References w1x Gjertson DW. Look-up survival tables for renal transplantation. Clin Transplant 1997:337᎐83. w2x Sankaran D, Asderakis A, Ashraf S et al. Cytokine gene polymorphisms predict acute graft rejection following renal transplantation. Kidney Int 1999;56:281᎐288. w3x Hutchinson IV, Turner DM, Sankaran D, Awad MR, Sinnott PJ. Influence of cytokine genotypes on allograft rejection. Transplant Proc 1998;30:862᎐863. w4x Hutchinson IV, Turner D, Sankaran D, Awad M, Pravica V, Sinnott P. Cytokine genotypes in allograft rejection: guidelines for immunosuppression. Transplant Proc 1998;30:3991᎐3992. w5x Kroeger KM, Carville KS, Abraham LJ. The y308 tumour necrosis factor-␣ promoter polymorphism effects transcription. Mol Immunol 1997;34:391᎐399. w6x Wilson AG, Symons JA, McDowell TL, McDevitt HO, Duff GW. Effects of a polymorphism in the human tumour necrosis factor-␣ promoter on transcriptional activation. Proc Natl Acad Sci 1997;94:3195᎐3199. w7x Uglialoro AM, Turbay D, Pesavento PA et al. Identification of three new single nucleotide polymorphisms in the human tumour necrosis factor-␣ gene promoter. Tissue Antigen 1998;52:359᎐367.
K.L. Poole et al. r Transplant Immunology 8 (2001) 259᎐265 w8x Martell J. Cytokines and their effects on transplant rejection. Am Soc Histocompat Immunogenet Q 1999:10᎐11. w9x Bathgate AJ, Pravica V, Therapondos G, Plevris JN, Hayes PC, Hutchinson IV. The effect of polymorphisms in tumor necrosis factor-alpha, interleukin-10, and transforming growth factorbeta1 genes in acute hepatic allograft rejection. Transplantation 2000;69Ž7.:1237᎐1238. w10x Rosenwasser LJ, Klemm DJ, Dresback JK et al. Promoter polymorphisms in the chromosome 5 gene cluster in asthma and atopy. Clin Exp Allergy 1995;25:74᎐78. w11x Hutchinson IV, Pravica V, Perrey C, Sinnott P. Cytokine gene polymorphisms and relevance to forms of rejection. Transplant Proc 1999;31:734᎐736. w12x Hutchinson IV. The role of transforming growth factor-␣ in transplant rejection, Suppl 7A. Transplant Proc 1999;31:9S᎐13S. w13x Miller SA, Dykes DD, Polesky HF. A simple salting out procedure for extracting DNA from human nucleated cells. Nucl Acids Res 1988;16Ž3.:1215. w14x Perrey C, Turner SJ, Pravica V, Howell WM, Hutchinson IV. ARMS-PCR methodologies to determine IL-10, TNF-␣, TNF-
w15x
w16x
w17x
w18x
w19x
265
and TGF-1 gene polymorphisms. Transplant Immunol 1999;7:127᎐128. Bunce M, O’Neill CM, Barnardo MCNM et al. Phototyping: comprehensive DNA typing for HLA-A, B, C, DRB1, DRB3, DRB4, DRB5, & DQB1 by PCR with 144 primer mixes utilising SSP ŽPCR-SSP.. Tissue Antigen 1995;46:355᎐367. Aldener-Cannava A, Olerup O. HLA-DQB1 ‘low resolution’ typing by PCR amplification with sequence specific primers ŽPCR-SSP.. Eur J Immunogenet 1994;21:447᎐455. Tan LC, Howell WM, Smith JL, Sadek SA. Sequential monitoring of peripheral T-lymphocyte cytokine gene expression in the early post renal allograft period. Transplantation, in press. Pelletier R, Pravica V, Perrey C et al. Evidence for a genetic predisposition towards acute rejection after kidney and simultaneous kidney᎐pancreas transplantation. Transplantation 2000;70:674᎐680. El-Gamel A, Awad MR, Hasleton PS et al. Transforming growth factor-beta ŽTGF-1. genotype and lung allograft fibrosis. J Heart Lung Transplant 1999;18:517᎐523.