Influences of dissolved oxygen concentration on biocathodic microbial communities in microbial fuel cells

Bioelectrochemistry 116 (2017) 39–51

Contents lists available at ScienceDirect

Bioelectrochemistry journal homepage: www.elsevier.com/locate/bioelechem

Influences of dissolved oxygen concentration on biocathodic microbial communities in microbial fuel cells Laura Rago a, Pierangela Cristiani b,⁎, Federica Villa c, Sarah Zecchin c, Alessandra Colombo a, Lucia Cavalca c, Andrea Schievano a a b c

Department of Agricultural and Environmental Science (DiSAA), Università degli Studi di Milano, Via Celoria 2, 20133 Milan, Italy RSE - Ricerca sul Sistema Energetico S.p.A., Sustainable Development and Energy Sources Department, Via Rubattino 54, 20134 Milan, Italy Department of Food, Environmental and Nutritional Sciences (DeFENS), Università delgi Studi di Milano, Via Celoria 2, 20133 Milan, Italy

a r t i c l e

i n f o

Article history: Received 28 February 2017 Received in revised form 1 April 2017 Accepted 5 April 2017 Available online 7 April 2017 Keywords: Biocathode Illumina 16S rRNA sequencing Spirulina Electroactive biofilms Oxygen reduction reaction ORR

a b s t r a c t Dissolved oxygen (DO) at cathodic interface is a critical factor influencing microbial fuel cells (MFC) performance. In this work, three MFCs were operated with cathode under different DO conditions: i) air–breathing (A-MFC); ii) water-submerged (W-MFC) and iii) assisted by photosynthetic microorganisms (P-MFC). A plateau of maximum current was reached at 1.06 ± 0.03 mA, 1.48 ± 0.06 mA and 1.66 ± 0.04 mA, increasing respectively for W-MFC, P-MFC and A-MFC. Electrochemical and microbiological tools (Illumina sequencing, confocal microscopy and biofilm cryosectioning) were used to explore anodic and cathodic biofilm in each MFC type. In all cases, biocathodes improved oxygen reduction reaction (ORR) as compared to abiotic condition and A-MFC was the best performing system. Photosynthetic cultures in the cathodic chamber supplied high DO level, up to 16 mgO2 L−1, which sustained aerobic microbial community in P-MFC biocathode. Halomonas, Pseudomonas and other microaerophilic genera reached N 50% of the total OTUs. The presence of sulfur reducing bacteria (Desulfuromonas) and purple non-sulfur bacteria in A-MFC biocathode suggested that the recirculation of sulfur compounds could shuttle electrons to sustain the reduction of oxygen as final electron acceptor. The low DO concentration limited the cathode in W-MFC. A model of two different possible microbial mechanisms is proposed which can drive predominantly cathodic ORR. © 2017 Elsevier B.V. All rights reserved.

1. Introduction In a microbial fuel cell (MFC), the bioanode or anodic biofilm, consists of anodophilic bacteria that anaerobically oxidize biodegradable organics in water solution. An electrochemical circuit transfers the electrons and ions, produced by the anodic semi-reaction, to the cathode. There, the products of the anodic semi-reaction are delivered to a terminal acceptor, usually the oxygen. Anodic reactions rely on the presence of exoelectrogenic bacteria, which are able to oxidize organic matter under anaerobic conditions, with a solid conductor as the electron acceptor. The final products of organic matter oxidation are CO2, alkaline salts and water. When a substrate is available at the anode, the cathodic reaction is often the rate determining step. The understanding and improvement of cathodic reactions are, therefore, key focuses for improving MFC performance. The amount of oxygen that may reach the cathode is a key parameter to obtain good power productions. Oxygen can be available to

⁎ Corresponding author. E-mail address: [email protected] (P. Cristiani).

http://dx.doi.org/10.1016/j.bioelechem.2017.04.001 1567-5394/© 2017 Elsevier B.V. All rights reserved.

cathodic reduction reactions mainly through two different mechanisms: abiotic or catalyzed by microorganisms. In abiotic cathodes, oxygen reduction reaction (ORR) is kinetically hindered as the gaseous oxygen reacts directly on the solid catalyst only at a triple-phase boundary, including electrolyte. The abiotic ORR requires very effective catalysts to meet the power requirements to provide enough energy. Although Pt-based catalysts and Pt-alloys showed good ORR performances, they need to be substituted due to precious metals high costs and availability. Efficient catalysts like Pt-loaded carbon [1] and Pt-free cathodes [2] performances in short and long term were recently studied. The duration over long-term utilization is probably the main issue for practical applications of abiotic cathodes. Biofilm formation on the cathode tend to cover abiotic catalytic sites where ORR occurs [3]. Over long-term operation, biofouling and salts depositions on both the solid conductor and the separator tend to clog the system, increase internal resistance, reduce the porosity and impede effective ORR [4]. When microorganisms, in addition to abiotic mechanisms, mediate ORR catalytic activity, the cathode is generally called biocathode [5]. In biocathode of MFCs, a large number of different red-ox reactions, including aerobic, microaerophilic and anaerobic pathways,

40

L. Rago et al. / Bioelectrochemistry 116 (2017) 39–51

simultaneously contribute to the overall electron transfer mechanisms from the conductor to O2. Microorganisms can interact directly with dissolved oxygen (DO). The limiting factor is the relatively low DO concentration in water (8 mg L−1 at 25 °C and 1 atm). Depending on the architectural features of the MFC (single- or double-chamber) and of the cathode itself (air-breathing or water-submerged), both biotic and abiotic mechanisms may concur to the overall electron flow for ORR and other related red-ox reactions. In single-chamber air-breathing cathode (A-MFCs), the gaseous oxygen is available at high concentration (20% of the air). The high overpotential of the electron transfer from the active sites of the solid cathode to gaseous O2 at a triple-phase boundary, affects the MFC performance. The formation of cathodic biofilm allows exploiting the microbial activity for the catalysis of ORR. A thick biofilm growing on the anolyte-side of cathodic surface in A-MFC, consumes DO diffusing from air side, preserving the anaerobic condition of the anolyte. Previous work [5,6] documented how oxygen is completely consumed inside a 1 cm-thick biofilm, which becomes completely anaerobic at the interface with the anolyte. Aerobic and anaerobic bacteria are found to cooperate in air breathing biocathodes, using in different possible ways oxygen as final electron acceptor. In particular, the bacteria involved in the sulfur cycle [7], or in the iron and manganese [8] are found playing a relevant electroactive role. Thus, the success of A-MFCs not only relies on the bioanodic community, but also on the cathodic biofilm [3]. Depending on biocathodic structure and reactions, bioanodic population may be significantly influenced. Although many studies have addressed biocathodic ORR in MFCs, these complex pathways are far to be clearly elucidated and documented in all relevant steps. In A-MFCs, the air-breathing biocathodic and the bioanodic microbial communities evolve contextually and synergistically, depending on the inoculum and the liquid media. Several studies investigated the microbial pools settled at cathode, documenting a wide range of electroactive microorganisms, selected from the common inoculum shared with the anode [7–9]. In water-cathode MFCs (W-MFCs) oxygen consumption rates at the cathode are generally higher than oxygen diffusion kinetics from air [10]. On the contrary, A-MFCs are not limited by low dissolved oxygen (DO) concentrations [11,12]. For this reason, A-MFCs have been largely preferred to W-MFCs to enhance current densities, especially for longterm operations. Recently, photosynthetic MFCs (P-MFCs) were proposed as alternative architecture, for different applications. On one side, photosynthetic microorganisms (PM) cultures (microalgae or Cyanobacteria) in the cathodic chamber work as oxygen supplier, to enhance cathodic reactions in W-MFCs [13–16]. A dense PM population with intense photosynthetic activity may easily reach DO concentrations above 20 mgO2 L−1 [17]. Moreover, using PM it would be possible not only to increase the cathodic DO concentration (from 8 mgO2 L−1 up to 20 mgO2 L−1) in WMFC, but also respect A-MFC. Based on the abovementioned assumptions, this study aimed at investigating the microbial community composition of electroactive biocathodes with different DO concentrations ad conditions, exploring possible biotic mechanisms potentially involved in ORR.

of aerobic and anaerobic mechanisms, both promoting the ORR as final electron acceptor, are proposed and discussed. 2.1. MFCs configuration Three reactors were built using Simple Pyrex® bottles (125 mL volume) as described elsewhere [18]: i) air-cathode MFC (A-MFC), ii) water-cathode-MFC (W-MFC), iii) Algae-cathode-MFC (P-MFC) (Fig. 1a). Electrodes were made of carbon cloth (SAATI C1, Appiano Gentile, Italy). Plain carbon cloth (4 × 10 cm) was rolled and placed at the bottom of the cell to serve as anode. Carbon cloth modified by a microporous layer (MPL) made of activated carbon/PTFE mixture was used for cathodes [19]. This MPL served to increase surface area for ORR and as a porous separator between anodic and cathodic compartment. Geometric surface area of the cathode exposed to the anolyte was 3.14 cm2. Anode and cathode were electrically connected through an external copper circuit under a load of 100 Ω. Connections were insulated with non-conductive epoxy resin. 2.2. Start-up phase A start-up phase served to enrich electroactive biofilms in A-MFC, W-MFC and P-MFC systems. All anodic chambers were inoculated in parallel with swine manure (approximately 30 gCOD L−1), diluted 1:10 (w/w) with tap water to obtain a concentration of about 3 gCOD L−1. The chemical composition of the anolyte at the beginning of the experiment was reported in a previous study (Colombo et al. 2017). 2.3. Spirulina culture The cathodic chamber of P-MFC (called P-bulk) was inoculated with cyanobacteria belonging to the genus Arthrospira maxima (i.e. Spirulina). The Spirulina culture was obtained from a full scale raceway-like plant in Northern Italy (Spirufarm srl, Cremona, Italy) and photo-autotrophically cultivated in 1.0 L Erlenmeyer flasks using Zarrouk's culture medium [20]. The medium has pH 8.6 and conductivity 18 ms cm−1, and it is free of organic compounds, except of EDTA used as chelating agent. The medium content (g L− 1) in MILLI-Q water was: 2.5 of NaNO3; 0.5 K2HPO4; 1 of K2SO4; 1 of NaCl; 0.2 of MgSO4·7H2O; 0.04 of CaCl2·2H2O; 0.01 of FeSO4·7H2O; 0.08 of EDTA; 16.8 of NaHCO3 and 1 mL of Micronutrient Stock solution. The Micronutrient stock solution content (g L−1) in MILLI-Q water was: 2.86 of H3BO3; 1.81 of MnCl2·4H2O; 0.222 of ZnSO3·4H2O; 0.0177 Na2MoO4 and 0.079 CuSO4·5H2O. Spirulina was incubated under stirring by means of a magnetic stirrer, under day-night illumination (photoperiod light:dark = 18:6, light intensity of around 60–80 μE m− 2 s− 1) by a white fluorescent lamp (6400 K) at a constant temperature (25 ± 1 °C) [21]. Artificial solar irradiation was supplied by two lamps (8 W/50 Hz, 6400 K) placed at 0.1 m distance. Dark conditions were maintained in the anodic compartments by covering glassy reactors with aluminum foil. 2.4. Experimental set-up

2. Materials and methods Three different types of single chamber MFCs (A-MFC, W-MFC and P-MFC) were operated for more than two months, until reaching maximized stable electrochemical performances. The anodes were observed by confocal microscopy. Cryosectioning of cathodic biofilms was used in combination with epifluorescence microscopy, to investigate biofilms structure through their thickness. Both anodic and cathodic biofilms were then collected and processed by MiSeq 16S rRNA Illumina sequencing tools. Based on the microbiological and the electrochemical data, the three biocathode microbial communities differed and their composition was related to the different DO concentrations. A model

All MFCs were operated in parallel in fed-batch mode at 25 ± 1 °C for nearly 80 days. Several consecutive batch cycles were run, each time adding sodium acetate as organic substrate in the anodic chamber, till a concentration of 3 g L−1 (2.34 gCOD L−1). Only the last two batch cycles (from 64 day to 77) were considered for this study (Fig. 1b). The W-MFC system served as control for the P-MFC, in order to investigate the effect of photosynthesis on DO concentrations and the O2 reduction reaction at the cathode. The cathodic chamber was initially filled with MilliQ water. Three times during the experimental period, water was completely replaced with fresh water. The electrochemical systems were characterized through anodic/cathodic polarization.

L. Rago et al. / Bioelectrochemistry 116 (2017) 39–51

41

Fig. 1. a. Schematics of the three MFC types used. b. Current intensity generation. Comparison of the current intensity over the last 2 cycles of experimentation period (from 64 to 77 days) for: A-MFC (———), W-MFC (.....), P-MFC (__). Triangles indicate new substrate addition (sodium acetate, 3 g L−1).

2.5. Chemical analyses pH, conductivity and DO in the bulk anodic and cathodic compartments were measured with a pH meter AMEL Instruments mod. 2335, a conductivity meter AMEL Instruments mod. 2131 and an oximeter AQUALYTIC mod. Al20Oxi, respectively. 2.6. Electrochemical analysis For each MFC, the potential difference across a load of 100 Ω (Rext) was recorded every 20 min using a multichannel Data Logger (Graphtech midi Logger GL820). The generated current (I) was then calculated by the eq. I = V / R, where I is the current flowing through the external resistance. Polarization curves of single electrodes were recorded in situ on anodes and cathodes using a three-electrode configuration. The anode or the cathode was used as working electrode. A platinum wire and an Ag/AgCl (sat. KCl) electrode were used as counter and reference electrode, respectively. A Luggin capillary was adopted to minimize the ohmic drop into the solution, when polarizations on cathode were recorded. Before recording polarization curves, MFCs were allowed to equilibrate at the OCP for at least 30 min. Potential was then varied at 10 mV/min from the OCP in the anodic or cathodic direction. An EG&G mod. 273A potentiostat/galvanostat was used to perform polarization curves. All the potentials throughout the text are referred to the Ag/AgCl (sat. KCl) electrode. 2.7. DNA extraction DNA samples were obtained from anodic and cathodic biofilms from each MFC at the end of the experiment. Small pieces of anodic carbon

cloth were cut and combined for DNA extraction. The cathodic biofilms samples were collected in sterile Eppendorf from the carbon cloth with a sterile spatula. The Spirulina liquid medium was recovered from PMFC cathodic chamber and consisted of a bulk sample (P-bulk), representative of the planktonic microbial community. P-bulk and cathode biofilm samples were centrifuged at 10,000g. The supernatant was eliminated to remove residues from the growth medium. Total DNA was extracted from approximately 0.25 g of samples using a PowerBiofilm DNA Isolation Kit (MoBio Laboratories, Inc., Carlsbad, CA) according to the manufacturer's instructions. Quantity and quality of the DNA were measured spectrophotometrically (BioPhotometer, Eppendorf). DNA was visualized under UV light in a 1% gel electrophoresis with TBE 0.5× (Tris-Borate 50 mM; EDTA 0.1 mM; pH 7.5–8). 2.8. Illumina MiSeq sequencing Genomic DNA was PCR amplified using a two-stage “targeted amplicon sequencing (TAS)” protocol [22,23]. The primers contained 5′ common sequence tags (known as common sequence 1 and 2, CS1 and CS2) as described previously [24]. Three primer sets were used for this study, including CS1_341F/CS2_806R (Bacteria), CS1_ARC344F/ CS2_ARC806R (Archaea), (Table 1). Genomic DNA was PCR amplified using a two-stage “targeted amplicon sequencing (TAS)” protocol [22, 23]. The primers contained 5′ common sequence tags (known as common sequence 1 and 2, CS1 and CS2) as described previously [24]. Three primer sets were used for 16S rRNA in this study, including CS1_341F/CS2_806R (Bacteria), CS1_ARC344F/CS2_ARC806R (Archaea), (Table 1). All reactions were performed in 10 μL volumes, with a final concentration of each primer of 1 μM. Reactions were made using the MyTaq HS 2× mastermix, and 28 cycles of PCR were performed (i.e., 95 °C for 5′, followed by 28 cycles of 95 °C for 30″; AT for 30″; 72 °C for 45″). All

42

L. Rago et al. / Bioelectrochemistry 116 (2017) 39–51

Table 1 Primers used for Illumina sequencing. Target

Primer

Sequence with CS1 or CS2

Reference

Bacteria

CS1_341F CS2_806R CS1_ARC344F CS2_ARC806F

ACACTGACGACATGGTTCTACACCTACGGGAGGCAGCAG TACGGTAGCAGAGACTTGGTCTGGACTACHVGGGTWTCTAAT ACACTGACGACATGGTTCTACAACGGGGYGCAGCAGGCGCGA ACACTGACGACATGGTTCTACAGGACTACVSGGGTATCTAAT

[25–27]

Archaea

reactions were verified using agarose gel electrophoresis. Subsequently, a second PCR amplification was performed in 10 μL reactions in 96-well plates. A mastermix for the entire plate was made using the MyTaq HS 2× mastermix. Each well received a separate primer pair with a unique 10-base barcode, obtained from the Access Array Barcode Library for Illumina (Fluidigm, South San Francisco, CA; Item# 100–4876). These AccessArray primers contained the CS1 and CS2 linkers at the 3′ ends of the oligonucleotides. Cycling conditions were as follows: 95 °C for 5 min, followed by 8 cycles of 95 °C for 30″, 60 °C for 30″ and 72 °C for 30″. A final, 7 min elongation step was performed at 72 °C. PCR products were purified using SequalPrep plates (Life Technologies) according to the manufacturer's instructions. Subsequently, these PCR products were quantified using a Quant-iT PicoGreen dsDNA Assay Kit (Thermo Fisher), implemented on a Genios Pro Fluorescence microplate reader (Tecan). PCR products were then pooled using PicoGreen quantification results, using an epMotion5075 liquid handling workstation (Eppendorf). The pooled libraries, with a 15% phiX spike-in, were loaded on to a MiSeq v3 flow cell, and sequenced using an Illumina MiSeq sequencer. Fluidigm sequencing primers, targeting the CS1 and CS2 linker regions, were used to initiate sequencing. De-multiplexing of reads was performed on instrument. Library preparation and pooling was performed at the DNA Services (DNAS) facility, Research Resources Center (RRC), University of Illinois at Chicago (UIC). Sequencing was performed at the W.M. Keck Center for Comparative and Functional Genomics at the University of Illinois at Urbana-Champaign (UIUC). Forward and reverse reads were merged using PEAR [25]. Ambiguous nucleotides and primer sequences were trimmed (quality threshold p = 0.01). After trimming, reads containing internal ambiguous nucleotides, lacking either primer and/or shorter than 300 bp were discarded. Chimeric sequences were identified with the USEARCH algorithm [26] and removed. Further analyses were performed with the QIIME tools [27]. Sequences with a similarity higher than 97% were grouped in Operational Taxonomic Units (OTUs) and representative sequences for each OTU were aligned to the SILVA SSU Ref dataset [28] using the PyNAST method [29]. After taxonomic assignment, OTU tables were generated for each sample. To compare the microbial diversity between the samples, weighted and unweighted UniFrac analysis was performed and clustering was calculated with Unweighted Pair Group Method with Arithmetic mean (UPGMA) [30,31]. 2.9. Biofilm imaging by Confocal Laser Scanning Microscopy (CLSM) The structure and the architecture of biofilms growing on anode surfaces (namely A-MFC, W-MFC and P-MFC anodic biofilms) and that growing on cathode surface from Spirulina culture side (namely Pbulk cathodic biofilm) were investigated by CLSM as previously reported by Villa et al. [32,33]. The lectin Concanavalin A-Texas Red conjugate (ConA, Invitrogen, Italy) was used to visualize the polysaccharide component of biofilm matrix (extracellular polymeric substances, EPS), whereas Syto 9 green fluorescent nucleic acid stain (Invitrogen, Italy) was used to display biofilm cells. Anode samples were incubated with 200 μg μL−1 ConA and 5 mM Sito-9 dye solution in ddH2O at room temperature in the dark for 30 min, and then rinsed. Confocal images were collected using a Leica TCS-SP5 confocal microscope (Leica Microsystems Heidelberg GmbH, Germany) and a 40 × 0.7 NA water immersion objective or a 1 × dry lens objective. Fluorescence was

[28]

excited and collected using the following laser lines and emission parameters: for Syto 9-stained cells, ex 488 nm laser, em 500 to 550 nm, and for ConA-stained EPS ex 561 nm laser, em 570 to 620 nm. In addition, the CLSM was used in reflectance mode with the 488 nm argon line for relief imaging of carbon fibre cloths. Captured images were analyzed with the software Imaris (Bitplane Scientific Software, Switzerland) for 3D reconstructions. A minimum of six biofilm images were collected for each sample and representative images are presented. The biovolumes and the mean thickness of biofilms were calculated using PHLIP, a freely available Matlab-based image analysis toolbox (http://phlip.sourceforge.net/phlip-ml). The biovolume represented the overall volume of a biofilm (μm3) and could be used to estimate its total biomass. It was defined as the number of foreground pixels in an image stack multiplied by the voxel volume, which is the product of the squared pixel size and the scanning step size [34]. The thickness parameter is widely used to describe the morphology of the biofilms. The function first applies a height projection transformation to the image stack where for every point in the xy plane the maximal height h of the corresponding foreground pixels in z direction is stored. The average of the resulting distribution of pixel height (h) is then calculated and represents the mean thickness [35]. 2.10. Biofilm cryosectioning and thickness measurements Biofilm cryosectioning was performed on cathodic biofilms (namely A-MFC, W-MFC and P-MFC cathodic biofilms) as reported by Villa et al. [32]. Briefly, biofilms on cathode surfaces were carefully covered with a layer of OCT (Tissue-Tek Optimum Cutting Temperature, VWR Scientific, USA) and placed on dry ice until completely frozen. The frozen samples were sectioned at − 19 °C using a Leica CM1850 cryostat (Leica Microsystems Heidelberg GmbH, Germany), and the 5-μm thick cryosections were mounted on Superfrost/Plus microscope slides (Fisher Scientific, USA). Biofilm cryosections were stained as reported for CLSM. Sections were observed using a Nikon Eclipse E800 microscope with a 10 × dry lens objective. The sections were viewed in the epifluorescence mode with red (to visualize the EPS matrix) and green (to visualize biofilm cells) filters. The free software ImageJ (https://imagej.nih.gov/ij/) performed the image analysis and biofilm thickness measurements. More than five images per sample were taken for microscope analysis. For each picture, the biofilm thickness was measured at three different locations randomly selected along the profile. These measurements were used to calculate the average thickness and the associated standard deviation. 3. Results and discussion 3.1. Current generation, DO concentrations and electrochemical characterization of MFCs Fig. 1b reports the current production of the three different MFCs over two representative acetate-fed cycles, recorded after acclimation when the three different MFCs were at the maximum of their performances. After each acetate addition, the current promptly reached an almost stable plateau in each MFC. W-MFC reached a lower current plateau of 1.06 ± 0.03 mA, which persisted for 6 days. Current trends of P-MFC and A-MFC were similar to each other, with a plateau of 1.48 ± 0.06 mA and 1.66 ± 0.04 mA respectively, both lasting 5 days.

L. Rago et al. / Bioelectrochemistry 116 (2017) 39–51

DO concentration was measured in different parts of the three different MFCs and the results are resumed in Table 2. On the bases of the DO values (Table 2), such different microbial pools should catalyze different aerobic/anaerobic chemical and biochemical reactions, but all of them with the oxygen as terminal acceptor. Anodic and cathodic polarization curves were recorded for all MFCs in the two acetate-fed cycles at maximum current production and they are reported in Fig. 2 (day 72) and in Fig. S1 of Supplementary information (day 66). The anodic and cathodic polarization curves of abiotic electrode before the biofilm settlement were also reported in Fig. 2. In all cases, anodic polarization of A-MFC, P-MFC and W-MFC gave higher currents as compared to abiotic anode, confirming the settlement of anodic biofilms. The bioanode polarization of A-MFC shows a peak at − 0.362 ± 0.01 vs. Ag/AgCl. For P-MFC, the peak is shifted to −0.207 ± 0.03 V vs. Ag/AgCl. After the biofilm settlement, A-MFC and P-MFC polarization curves of biocathodes exhibited higher current than abiotic cathode. This was not the case for W-MFC. At each potential, the best performing was the biocathode of A-MFC. In the case of P-MFC the cathode performance was similar to A-MFC for potentials higher than −0.3 V vs. Ag/AgCl. For potentials lower than −0.3 V vs. Ag/AgCl the behavior of curve changed, pointing out an oxygen diffusion-limited condition. Considering that the MFCs close circuit potentials varied in the range −300 to −400 mV vs. Ag/AgCl, it could be hypothesized that in the case of A-MFC, where no limitation affect the current, more than one cathodic reaction concurred. The sulfur cycle, and the formation of sulfides in particular, could play a role (see Fig. S2 Supplementary information) [36]. The best current generated by A-MFC (Fig. 1b) could be ascribed, therefore, to the optimal working condition for both electrodes. Differently in P-MFC, anode seems to work at potential far from the peak and cathode is limited by oxygen mass transport. 3.2. High-throughput microbial community analysis The results of the Illumina 16S rRNA gene amplicon sequencing showed relevant differences between anodic and cathodic biofilms and the planktonic sample. Hierarchical clustering analysis via the unweighted pair group method with arithmetic mean (UPGMA) (Fig. 3), confirmed that anodic, cathodic and P-bulk samples are clustered in three different groups. As expected, the P-bulk sample was different with respect to the other samples. Moreover, in both anodic and cathodic samples the distance between A-MFC and W-MFC was lower than the distance from P-MFC. This suggests that the specific conditions of P-MFC cathodic chamber, as e.g. the presence of a different medium, influenced the development of different microbial communities at both cathodic and anodic biofilms. The phyla representation (Fig. 4) shows that Archaea were more abundant in all anodic samples (A-MFC: 10% W-MFC: 8.9% and PMFC: 12.9%) than in cathodic samples (around 1% for all samples). All anodic chambers were inoculated in parallel with swine manure diluted 1:10 (w/w). Thus, the low Archaea presence in the cathodes, suggests that the specific cathodic conditions, aerobic and/or microaerophilic conditions [9], were inhibiting those microorganisms. No Archaea Table 2 Dissolved oxygen (DO) concentration in the three MFCs. Anodic bulk measures were under detection limit (UDL). A-MFC

W-MFC

P-MFC

Anodic bulk Cathodic bulk

UDL –

Cathode interface (from cathodic chamber)

21% atmospheric O2

UDL b4 mgO2 L−1 DO 2 mgO2 L−1 DO

UDL Up to 16 mgO2 L−1 DO 9 mgO2 L−1 DO

43

were detected in the P-bulk, probably due to the presence of oxygen (Table 2). The phylum Firmicutes was present in all MFC anodic and cathodic biofilms (around 15–20% in all cases). Firmicutes were already found specifically in the biofilms of bioelectrochemical reactors [37] and often associated to electrogenic activity [38]. On the contrary, only 0.3% was recorded for P-bulk. Proteobacteria were present at higher percentages in cathodic biofilms (around 55% for all MFCs) and in P-bulk sample (N40%) than anodic samples (around 20–25%). The results of genus distribution (Fig. 5) show that the anodic biofilms were different from cathodic and P-bulk and they were characterized mainly of well-known electrogenic and fermentative Bacteria, as well as Archaea. Also, the culture medium of Spirulina, present in the PMFC anodic chamber, induced major changes also in the bioanodic community, as confirmed by the higher distance between P-MFC and both W-MFC and A-MFC anodic samples (Fig. 3). Methanosarcina (around 4.5% in P-MFC and A-MFC and b 1% for WMFC anodes) and Methanosaeta (8.2% in P-MFC, 7.5 in W-MFC and 4.9% in A-MFC), are acetoclastic methanogenic Archaea and they were found in all anodic samples in this study. Methanogens were previously found in bioelectrochemical biofilms [39] and they were also associated to Direct Interspecies Electron Transfer (DIET) with the well-known exoelectrogenic bacteria Geobacteraceae [40]. DIET between Archaea and exoelectrogenic bacteria might contribute in increasing the electrogenesis. Methanogens are normally cultured in bicarbonate buffered medium: the higher presence of those genera in P-MFC anodic sample might be due to the higher presence of bicarbonate contained in Spirulina medium in the P-MFC cathodic chamber. Desulfuromonas genus was responsible of the main part of anode respiration in A-MFC (20% of total OTUs) and W-MFC (13%), but not in PMFC (only 3%). Desulfuromonas is a well-known Sulfur Reducing Bacteria (SRB) that was also studied to its exoelectrogenic ability [41]. Desulfumicrobium presence was interesting only in P-MFC anodic sample (3%) another well-known exoelectrogenic bacterial genus [42]. Clostridium sensu stricto 1 was present in all anodic samples. Several Clostridium species have been reported to be capable of electrogenic activity [43]. The presence of this Clostridium was more than double in PMFC anodic biofilm (12%), than in A-MFC and W-MFC (around 6% for both). Different fermentative bacteria were present in the anodic communities. Proteiniphilum (around 1–2.5% in the anodic samples) was another identified strictly anaerobic bacterium [44]. It is often found in anodic biofilms, also in bioelectrochemical systems fed with different substrates [39,45,46]. Microorganisms of the phylum Bacteroidetes, as for example vadinBC27 wastewater sludge, Petrimonas, uncultured vadinHA17 and uncultured VC2.1 Bac22, were found with an abundancy of around 25% in all anodic samples. Their presence is frequent in natural environments such as soils, anaerobic digestion sludge [47] and has also been reported in fermentative bioelectrochemical systems biofilms [45]. Besides their presence in the original inoculum (swine manure), microorganisms belonging to this phylum are known in biodegradation processes, for the breakdown of polymeric proteins and carbohydrates. Petrimonas and vadinBC27 wastewater sludge were also present in the cathodic samples. Also Anaerolineaceae (between 5 and 9% in all anodic samples) is known as a common fermentative bacteria family in anaerobic sludge [48]. In P-bulk, N 34% of the culture was composed of Arhtrospira genus (Spirulina) of Cyanobacteria phylum, added as inoculum to the cathodic media. Arthrospira was found only in the P-bulk planktonic sample and not in cathodic and anodic P-MFC biofilm ones. Although the alkalophilic and halophilic conditions in Cyanobacteria cultures are traditionally considered as a deterrent to avoid the growth of other microorganisms, in P-bulk the culture was constituted for N65% by other microorganisms. These other Bacteria present in the culture were not disturbing the Spirulina growth. Some of them derived from the P-

44

L. Rago et al. / Bioelectrochemistry 116 (2017) 39–51

abiotic

E/V (vs Ag/Cl)

A-MFC

E/V (vs Ag/Cl)

W-MFC

E/V (vs Ag/Cl)

P-MFC

E/V (vs Ag/Cl)

Fig. 2. Polarization curves of anodes (__) and cathodes (———): abiotic MFC before biofilm settlement; A-MFC, W-MFC and P-MFC after 72 operation days.

MFC cathodic biofilm, however at least 12 genera were found only in Pbulk and their presence in the other P-MFC samples were lower than 0.01% of the total of the OTUs. That suggests that those genera probably come from the starter inoculum of Spirulina culture. The Bacteria that were colonizing only the P-bulk were not able to colonize the electrode biofilms and more specifically the biocathode, pointing to a leaking of oxygen at P-MFC anodic chamber side. Oceanicaulis, for example, represented 14.2% of OTUs detected only in P-bulk. The species of this genus are normally obligated aerobic, halophilic (all strains grow with 20–100 g NaCl), gram-negative, nonspore-forming, chemo-organotrophic. Nitrate is reduced to nitrite by most strains [49]. All those conditions permitted to those microorganisms to live in Arhtrospira culture aerobic and halophilic medium, rich of nitrate. The Cryomorphaceae family of Bacteriodetes (5% of uncultured Cryomorphaceae in the P-bulk) has roles in aquatic ecosystem secondary production and are generally found in locations relatively rich in organic carbon [50]. Owenweeksia (1.2%) is part of Cryomorphaceae family, is strictly aerobic, having an oxidative type of metabolism [51] and the species of this genus were isolated, for example, from a sea-water

Fig. 3. Hierarchical clustering analysis by UPGMA of anodic and cathodic MFCs and P-bulk samples clustered in their own groups, with the UPGMA distance tree constructed at a distance of 0.05.

sample [52]. As Owenweeksia, also Urania-1B-19 marine sediment group was uniquely found in P-bulk (6.5%) and it is normally isolated from sea-water samples [53]. Other Bacteria, as Halomonas genus, were colonizing the P-bulk and all cathodic biofilms. Halomonas genus is easily differentiated from other genera by its ability to survive and grow in very high concentrations of NaCl [54]. Thus, the species of Halomonas genus are recognize as halotolerant [55], which means that they are capable to grow in a NaCl concentration between 0.1% and 32.5 (w/v) [54]. Often, the species of Halomonas genus are aerobic or facultative anaerobic heterotrophs [54,55], which justify its presence in all cathodes and also in P-bulk (2.7%). The highest presence of Halomonas was found in P-MFC cathode (27.4% versus around 12% for A-MFC and W-MFC) which confirms the more aerobic and halophilic conditions in this reactor. In fact, the high amount of salts contents in P-MFC was constituted of NaCl and NaHCO3 (contained in the Spirulina growth medium, 16 g L−1) as well as the NaCH3COOH that was continuously added to the anodic chamber to support electrodes biofilms growth. Genera of Rodhobacteraceae family were found only in P-bulk, AMFC and P-MFC. Rodhobacteraceae family (5.9% in P-bulk). This family comprises aerobic-, anaerobic, chemo- and photoheterotrophs purple non-sulfur bacteria (PNSB), performing anoxygenic photosynthesis. Roseinatronobacter (7.3% and 1.2% respectively in A-MFC and P-MFC cathodic samples) is a genus of Rodhobacteraceae family. Strains of this genus are strictly aerobic and obligate heterotrophic (acetate) alkaliphilic microorganisms (pH range from 8.5 to 10.4) and strains oxidize sulfide, thiosulfate, sulfite, and elemental sulfur to sulfate. The sulfur-oxidizing activity is maximized at high pH conditions [56]. Rodhospirillaceae (2.8% of uncultured in A-MFC cathode) is another PNSB of facultative anaerobes possessing the adaptive capacity to grow anaerobically in the light (by anoxygenic photosynthesis) and aerobically in darkness (by oxidative phosphorylation [57]. Caenispirillum of the family Rhodospirillaceae was 2.7% in the W-MFC cathode. PNSB were previously reported for air cathode MFCs [7,58] and it is favored by the diffusion of oxygen in the innermost layers of biocathodes. Alkalimonas genus was found in all cathodic samples and in P-bulk (7.7%). The OTUs were around 12% for A-MFC and W-MFC samples, but only 5.6% for P-MFC cathodic sample. Species of Alkalimonas genus were often identified as psychrotolerant, obligate alkaliphile, slightly halophilic, strictly aerobic isolated from deep-sea sediment [59]. Different strains of Alkalimonas were also associated to H2S production [60]. Azoarcus was ubiquitously found in all anodic and cathodic samples, but not in P-bulk. Azoarcus was previously found in cathodic MFC

L. Rago et al. / Bioelectrochemistry 116 (2017) 39–51

45

Fig. 4. Phylum distribution obtained by Illumina 16S rRNA gene amplicon sequencing of anodic and catodic biofilms and of planktonic cells (P-bulk).

biofilms [9]. Azoarcus is a genus of nitrogen-fixing bacteria common in soils and contaminated waters, usually with a strictly aerobic metabolism, exhibiting microaerophilic growth and growing well on salts of organic acids, but not on carbohydrates [61]. However, Azoarcus anaerobius (Strain LuFRes1T) a strictly anaerobic, nitrate-reducing

bacterium, was isolated in previous studies [62]. That knowledge might justify the presence of Azoarcus genus also in the P-MFC anode sample (it was b1% for A-MFC and W-MFC anodic samples), due to the probably diffusion of nitrate from cathodic chamber (the Cyanobacteria medium contents 2.5 g of NaNO3) to the anodic chamber.

Fig. 5. Genus representation of Illumina 16S rRNA gene amplicon sequencing results of anodic and cathodic biofilms, and P-bulk sample.

46

L. Rago et al. / Bioelectrochemistry 116 (2017) 39–51

The presence of oxidized compounds, such as nitrate, in anodic chamber was probably responsible to induce a shift of the peak of the anodic curve of P-MFC (Fig. 2). Azoarcus was ubiquitously found in all anodic and cathodic samples, but not in P-bulk. Azoarcus was previously found in cathodic MFC biofilms [9]. Azoarcus is a genus of nitrogen-fixing bacteria common in soils and contaminated waters, usually with a strictly aerobic metabolism, exhibiting microaerophilic growth and also on salts of organic acids, but not on carbohydrates [61]. However, Azoarcus anaerobius (Strain LuFRes1T) a strictly anaerobic, nitrate-reducing bacterium, was isolated in previous studies [62], thus justifying the presence of Azoarcus genus also in the P-MFC anode sample (b 1% in A-MFC and W-MFC anodic samples), were nitrate was probably present due to the diffusion from cathodic to the anodic chamber. The presence of oxidized compounds, such as nitrate, in anodic chamber was probably responsible to induce a shift of the peak of the anodic curve of P-MFC (Fig. 3). Pseudomonas was found with an abundancy around N5% only in the P-MFC and W-MFC cathodic samples, but not in A-MFC. This genus was commonly found in electrode biofilms and it was recognized often as an electroactive microorganisms [38,43]. Pseudomonas was defined as one of the most diverse and ubiquitous bacterial genera whose species have been isolated worldwide in all kinds of environments [63]. Pseudomonas was not present in A-MFC cathode because this part of the reactor was too anaerobic. On the contrary, the microaerophilic conditions in P-MFC and W-MFC, promoted the developing of this genus. Specifically, in P-MFC the high presence of oxygen was quickly reduced in the first layer of cathodic biofilm, mainly colonized by aerobic microorganisms. Moreover the extreme alkalophilic genera, i.e. Halomonas, better tolerate pH higher than 9, which is too high for Pseudomonas [64]. Erysipelothrix genus is a facultative anaerobe and it was also found ubiquitously in all cathodes, and its presence was due to the swine manure inoculum, since it is often associated to swine infections. Erysipelothrix was more present in P-MFC cathode (7%) than in other cathodic samples due to high amount of bicarbonate and so of CO2 in this sample, as the growth of such strains is improved by 5 to 10% carbon dioxide [65]. Its presence in A-MFC cathode (6%) suggests again that the internal layers of the cathodic biofilm were probably anaerobic.

3.3. Biofilm structural analyses Representative biofilm structures observed for the anodic surfaces are presented in Fig. 6. The images correspond to three-dimensional blend reconstructions obtained from confocal images series with the dedicated IMARIS software, including virtual shadow projections on the right-hand side to represent biofilm sections. The associated biovolumes and mean thickness calculated from the series of images are also included. The images displayed a marked structural heterogeneity in biofilms grown on anodic surfaces, showing few filamentous structures that interconnect bacterial clusters. The P-MFC anodic biofilms presented biovolume and thickness values that were statistically significantly higher than those of A-MFC and W-MFC anodic biofilms (P b 0.05). Furthermore, the measurements indicated that the contribution of the EPS matrix, in particular, the polysaccharide fraction of the EPS matrix, was around 50–60% in both A-MFC and W-MFC anodic biofilms, and it increased to an average value of 70% in the P-MFC anodic biofilms, indicating a significant contribution of EPS in these biofilms. According to previous reports, the EPS of the matrix encases the biofilm cells, interfaces them with the electrode, and also houses electroactive components of the biofilm matrix such as nanowires and c-type cytochromes with redox potential, showing a key role in the functioning of bioelectrochemical systems [66]. Polysaccharides of the EEPS matrix work as electroactive polymers, reaching conductance levels comparable with the synthetic ones [67,68]. In addition, polysaccharides of the EPS matrix can bind proteic components such as pili and other conductive elements. In a recent work, Li and colleagues [69] reported that polysaccharides and proteins were the main components of the electroactive bacterial EPS. Heme-binding proteins were identified in the matrix as the key redox species in the EPS of Shewanella oneidensis and Pseudomonas putida for electroactive bacterial extracellular electron transfer. Steidl et al. [70] showed that conductive pili permeate the biofilms to wire the cells to the conductive biofilm matrix and the underlying electrode, operating coordinately with cytochromes until the biofilm reaches a threshold thickness that limits the efficiency of the cytochrome pathway but not the functioning of the conductive pili network. Other works underlines that Pseudomonas genus are

Fig. 6. Confocal laser scanning imaging (photos) and related properties (table) of biofilms growing on anode surfaces (namely A-MFC, W-MFC and P-MFC anodic biofilms) and that growing on cathode surface from Spirulina culture side (namely P-bulk cathodic biofilm). Color key: Biofilm cells, green (Syto9); EPS matrix, red (ConA); surface, grey (reflection). Data in the Table represent the means + the SD of independent measurements. Letters provide the graphical representation for post hoc comparisons. According to post hoc analysis (Tukey's HSD, P b 0.05), means sharing the same letter are not significantly different from each other.

L. Rago et al. / Bioelectrochemistry 116 (2017) 39–51

known producers of EPS which contribute to the mechanical stability biofilms, mediate their adhesion to surfaces and transiently immobilizes biofilm cells [71]. These have been shown to colonize conductive surfaces and metals, including copper alloys [72]. Fig. 6 shows the biofilm growing on the cathode surface from Spirulina culture side (namely P-bulk cathodic biofilm). The carbon cloth cathode was colonized by a dense three-dimensional network of filamentous structures, attributable to Spirulina, embedded in a polysaccharide-rich matrix. It is interesting to note the linear form of Spirulina. Morphological change of Spirulina is most likely induced by various environmental stresses, including oxygen level, carbon dioxide level, light, and nutrient availability, which might play important roles in the induction of the cell-shape alteration [73,74]. A proteomic study identified that three transcriptional regulatory proteins, such as the quorum sensor LuxR, arginine repressor and ferric uptake regulator, were drastically increased in the uncoiled form [75]. It is worth noting that these proteins are generally up-regulated in biofilm form, suggesting that the linear variant might be associated to the biofilm lifestyle. Cryosectioning of cathodic biofilms was used in combination with epifluorescence microscopy to investigate the structure of the biofilms through their thickness. Five μm slices of biofilm cross-sections revealed that the fluorescently-labelled ConA mainly accumulated inside the cell-free void of mature microcolonies, demonstrating the presence of a polysaccharide-rich EPS fraction embedding cells. Images captured from frozen sections showed that all the cathodic biofilms retained similar morphological patterns, with a patchy architecture and empty holes at the bottom of the structure close to the carbon cloth. The P-MFC cathodic biofilm synthesized more polysaccharide-rich matrix (Fig. 7) compared to A-MFC and W-AMC cathodic biofilms (P b 0.05). Cryosections combined with microscopy revealed that P-MFC cathodic biofilm (biofilm thickness 926 ± 115 μm) was significantly thicker (P b 0.05) than those found on the A-MFC and W-AMC cathode (biofilm thickness 377 ± 59 μm and 368 ± 68 μm, respectively). All together these results indicated that the P-MFC cathode hosted the richer biofilm in term of thickness, biomass and production of extracellular polysaccharides. A thick biofilm growing on the anolyte-side of cathodic surface consumes DO diffusing, preserving the anaerobic condition of the anolyte [76]. Measurements of oxygen concentrations within a mixed-species biofilm showed that oxygen concentration in the biofilm continued to decrease with increasing depth, and was depleted completely at a depth of approximately 175 μm into the 220-μm-thick biofilm [77]. This data suggests that the 377-μm-thick biofilm observed on A-MFC cathode

47

has the potential to block oxygen crossover, improving the MFC performances. Although the 926-μm-thick biofilm on the P-MFC cathode limits oxygen diffusion, it might reduce MFC performance as reported by Behera et al. [78], suggesting that the power generation as well as biomass production is favored up to a certain thickness of biofilm on the cathode. As explained before, the EPS matrix was previously associated to electrogenic activity of the biofilm grown on the electrodes. Moreover, the presence of a biofilm thicker in P-MFC than A-MFC and W-MFC confirmed that a thicker layer of aerobic/microaerophilic Bacteria (N50% in P-MFC) growth in the biocathode due to the higher DO concentration (Table 2). 3.4. Predominant microbial cathodic reactions Scheme 1 reports two possible predominant microbial mechanisms and cascade reactions, which differently led to the ORR. The two mechanisms can occur single or synergistically inside the cathodic biofilm. The prevalence of one mechanism on the others depends of the presence of oxygen in the biofilm and on the potential at which the cathode operates in the MFC. The presence of aerobic, microaerophilic and anaerobic genera confirms the oxygen concentration gradient along biocathodes. Strong halophilic, as well as alkalophilic at cathodic interface (high pH and Na+), conditions induced higher presence of halophilic bacteria in all biocathodes. The absence of relevant nitrifying bacteria at the cathode indicates that the N-cycling was not a relevant mechanism at all cathodes. The bacterial pool of A-MFC biocathode resulted in larger part composed of anaerobic species. The difference in microbial population with respect P-MFC was particularly significant (Fig. 4). In P-MFC biocathode, microaerophilic bacteria should be the responsible of most ORR catalyses, consuming oxygen and generating metabolites with different redox reactions. According to previous studies [5,7,79], cathodic biofilms, while catalyzing ORR, may at the same time promote other cyclic red-ox mechanisms, such as sulfur compounds, facilitating the overall dispatch of electrons to oxygen. HS− can be produced by sulfur-reducing bacteria genera (SRB) as Desulfuromonas (found in all anodic biofilms of this experiment), but also by Alkalimonas genus. The oxidation of HS− leads to the formation of oxidized sulfur forms (S0, SO2− 3 , etc.) by several bacteria strains found in biocathodes, such as the PNSB (Rodhobacteraceae

Fig. 7. Cryosectioning images (photos) and properties (table) of cathodic biofilms (namely A-MFC, W-MFC and P-MFC cathodic biofilms). Color key: Biofilm cells, green (Syto9); EPS matrix, red (ConA). Data in the Table represent the means + the SD of independent measurements. Letters provide the graphical representation for post hoc comparisons. According to post hoc analysis (Tukey's HSD, P b 0.05), means sharing the same letter are not significantly different from each other.

48

L. Rago et al. / Bioelectrochemistry 116 (2017) 39–51

Scheme 1. Schematics of possible predominant microbial cathodic reactions.

and Rodhospirillaceae families). Also, oxidized forms of S can be further oxidized to sulfate. Sulfur-oxidizing activity has been studied in strains of PNSB that are able to oxidize sulfide, thiosulfate, sulfite and elemental sulfur to sulfate [56,80]. In previous studies [5,7,79], it was hypothesized that the same biofilm, able of perform ORR, may at the same time catalyze other reactions and promoting cyclic red-ox mechanisms, such as sulfur compounds, facilitating the dispatch of electrons to oxygen. In the A-MFC, the higher presence of Alkalimonas genus and PNSB at cathode, as well as SRB at the anode, suggests that the recirculation of sulfur was probably higher in this reactor. Alkalimonas are competitive to SRB species at the cathode probably because they had better tolerate high pH occurring in the cathodic area, air-side, where the ORR occurs. In fact, oxidation of acetate and reduction of sulfate by SRB is energetically unfavorable at pH higher than 12 [18] and the extreme alkaline condition limits their metabolism [81]. Thus, sulfur compounds reduction to HS− at the cathodic interface might have been mediated by Alkalimonas through electro-active interaction with the cathode (Scheme 1). In the A-MFC, the predominant role of biocathode would be to generate shuttles, such as sulfur compounds, produced by anaerobic and microaerophilic electroactive consortium. Those shuttles quickly move through the saline solution up to the air, where gaseous and dissolved oxygen concentration is not a limiting factor. In the case of P-MFC biocathode, the DO concentration was strongly enhanced due to the presence of Spirulina. Higher DO concentration in the P-MFC (Table 2) induced relevant changes in the microbial community of P-MFC biocathode. First, the bacterial community present in the

thicker P-MFC biocathode (Fig. 7) that was more aerobic and microaerophilic (N50% of the total OTUs) than the A-MFC and W-MFC cathodic communities. In P-MFC biocathode, the presence of the anaerobic consortium capable to recirculate sulfur compound was low. Thus, aerobic/microaerophilic electroactive bacteria community could play the principal role in ORR. In this case, the limiting factor was the DO concentration, which was consumed by the biocathode faster than the diffusion of the oxygen produced by Spirulina in the cathodic chamber (Fig. 2). The limited presence of DO concentration available for W-MFC biocathode undermined the current production in this reactor. In this case, both aerobic and shuttle-mediated ORR could occur, by the availability of the final electron acceptor. 4. Conclusions A-MFC, W-MFC and P-MFC showed complex biocathodes composed by both aerobic/microaerophilic and anaerobic communities. Microbial communities improved cathodic reactions doubling in all the reactors the current obtained abiotically. In fact, in A-MFC biocathode, the presence of SRB (i.e. Desulfuromonas), of genera able to reduce sulfur compounds (i.e. Alkalimonas) and of different PNSB (i.e. Rodhobacteraceae and Rodhospirellaceae families) able to oxidize reduced sulfur forms, indicates a relevant role of sulfuric compounds cycling. In P-MFC, as Spirulina increased DO concentrations, the cathodic biofilm was thicker than in the other systems and N 50% of the community was composed by

L. Rago et al. / Bioelectrochemistry 116 (2017) 39–51

aerobic and microaerophilic genera, such as Halomonas and Pseudomonas. These genera were probably participating in ORR through aerobic metabolism, with similar performances to A-MFC, but limited by DO availability. The limited DO concentration available in W-MFC biocathode restricted both aerobic and shuttle-mediated ORR, undermining the current production. The microbiological data suggest that both aerobic/microaerophilic and anaerobic processes concur in integrating the abiotic ORR reaction. Shuttles, such as oxidized and reduced sulfur compounds, are thought quickly diffuse through biofilm catalyzing, at the end, cathodic reactions towards ORR. Acknowledgments This work was entirely financed by the Italian Ministry of University and Research (MIUR) (SIR2014 Grant, project RBSI14JKU3, BioFuelCellApp) and by the Research Fund for the Italian Electrical System (July 29, 2009 - Decree of March 19, 2009). We also acknowledge Spirufarm srl and Dr. Antonino Idà for the Spirulina culture. Appendix A. Supplementary data Supplementary data to this article can be found online at http://dx. doi.org/10.1016/j.bioelechem.2017.04.001. References [1] G.G. Kumar, V.G.S. Sarathi, K.S. Nahm, Recent advances and challenges in the anode architecture and their modifications for the applications of microbial fuel cells, Biosens. Bioelectron. 43 (2013) 461–475, http://dx.doi.org/10.1016/j.bios.2012.12. 048. [2] M. Kodali, R. Gokhale, C. Santoro, A. Serov, K. Artyushkova, P. Atanassov, High performance platinum group metal-free cathode catalysts for microbial fuel cell (MFC), J. Electrochem. Soc. 164 (2017) H3041–H3046, http://dx.doi.org/10.1149/2. 0061703jes. [3] L. Huang, J.M. Regan, X. Quan, Electron transfer mechanisms, new applications, and performance of biocathode microbial fuel cells, Bioresour. Technol. 102 (2011) 316–323, http://dx.doi.org/10.1016/j.biortech.2010.06.096. [4] M. Santini, M. Guilizzoni, M. Lorenzi, P. Atanassov, E. Marsili, S. Fest-Santini, P. Cristiani, C. Santoro, Three-dimensional X-ray microcomputed tomography of carbonates and biofilm on operated cathode in single chamber microbial fuel cell, Biointerphases 10 (2015) 31009, http://dx.doi.org/10.1116/1.4930239. [5] P. Cristiani, M.L. Carvalho, E. Guerrini, M. Daghio, C. Santoro, B. Li, Cathodic and anodic biofilms in single chamber microbial fuel cells, Bioelectrochemistry 92 (2013) 6–13, http://dx.doi.org/10.1016/j.bioelechem.2013.01.005. [6] E. Guerrini, M. Grattieri, S.P. Trasatti, M. Bestetti, P. Cristiani, Performance explorations of single chamber microbial fuel cells by using various microelectrodes applied to biocathodes, Int. J. Hydrog. Energy 39 (2014) 21837–21846, http://dx.doi.org/10. 1016/j.ijhydene.2014.06.132. [7] P. Cristiani, A. Franzetti, I. Gandolfi, E. Guerrini, G. Bestetti, Bacterial DGGE fingerprints of biofilms on electrodes of membraneless microbial fuel cells, Int. Biodeterior. Biodegrad. 84 (2013) 211–219, http://dx.doi.org/10.1016/j.ibiod.2012. 05.040. [8] Z. He, L.T. Angenent, Application of bacterial biocathodes in microbial fuel cells, Electroanalysis 18 (2006) 2009–2015, http://dx.doi.org/10.1002/elan.200603628. [9] L. Rago, J. Guerrero, J.A. Baeza, A. Guisasola, 2-Bromoethanesulfonate degradation in bioelectrochemical systems, Bioelectrochemistry 105 (2015) 44–49, http://dx.doi. org/10.1016/j.bioelechem.2015.05.001. [10] B.H. Kim, I.S. Chang, G.M. Gadd, Challenges in microbial fuel cell development and operation, Appl. Microbiol. Biotechnol. 76 (2007) 485–494, http://dx.doi.org/10. 1007/s00253-007-1027-4. [11] W. He, X. Zhang, J. Liu, X. Zhu, Y. Feng, B. Logan, Microbial fuel cells with an integrated spacer and separate anode and cathode modules, Environ. Sci. Water Res. Technol. (2015)http://dx.doi.org/10.1039/C5EW00223K. [12] S. Srikanth, D. Pant, X. Dominguez-Benetton, I. Genné, K. Vanbroekhoven, P. Vermeiren, Y. Alvarez-Gallego, Gas diffusion electrodes manufactured by casting evaluation as air cathodes for microbial fuel cells (MFC), Materials (Basel) 9 (2016) 601, http://dx.doi.org/10.3390/ma9070601. [13] Y.C. Wu, Z.J. Wang, Y. Zheng, Y. Xiao, Z.H. Yang, F. Zhao, Light intensity affects the performance of photo microbial fuel cells with Desmodesmus sp. A8 as cathodic microorganism, Appl. Energy 116 (2014) 86–90, http://dx.doi.org/10.1016/j.apenergy. 2013.11.066. [14] A. González Del Campo, P. Cañizares, M.A. Rodrigo, F.J. Fernández, J. Lobato, Microbial fuel cell with an algae-assisted cathode: a preliminary assessment, J. Power Sources 242 (2013) 638–645, http://dx.doi.org/10.1016/j.jpowsour.2013.05.110. [15] I. Gajda, J. Greenman, C. Melhuish, I. Ieropoulos, Photosynthetic cathodes for microbial fuel cells, Int. J. Hydrog. Energy 38 (2013) 11559–11564, http://dx.doi.org/10. 1016/j.ijhydene.2013.02.111.

49

[16] A. Colombo, S. Marzorati, G. Lucchini, P. Cristiani, D. Pant, A. Schievano, Assisting cultivation of photosynthetic microorganisms by microbial fuel cells to enhance nutrients recovery from wastewater, Bioresour. Technol. (2017)http://dx.doi.org/10. 1016/j.biortech.2017.03.038. [17] A.P. Carvalho, L.A. Meireles, F.X. Malcata, Microalgal reactors: a review of enclosed system designs and performances, Biotechnol. Prog. 22 (2006) 1490–1506, http:// dx.doi.org/10.1021/bp060065r. [18] E. Guerrini, P. Cristiani, S.P.M. Trasatti, Relation of anodic and cathodic performance to pH variations in membraneless microbial fuel cells, Int. J. Hydrog. Energy 38 (2013) 345–353, http://dx.doi.org/10.1016/j.ijhydene.2012.10.001. [19] C. Santoro, K. Artyushkova, S. Babanova, P. Atanassov, I. Ieropoulos, M. Grattieri, P. Cristiani, S. Trasatti, B. Li, A.J. Schuler, Parameters characterization and optimization of activated carbon (AC) cathodes for microbial fuel cell application, Bioresour. Technol. 163 (2014) 54–63, http://dx.doi.org/10.1016/j.biortech.2014.03.091. [20] C. Zarrouk, Contribution a l'etude d'une cyanobacterie: influence de divers facteurs physiques et chimiques sur la croissance et la photosynthese de Spirulina maxima (Setchell et Gardner) Geitler, University of Paris, France, 1966. [21] F. Chen, Y. Zhang, High cell density mixotrophic culture of Spirulina platensis on glucose for phycocyanin production using a fed-batch system, Enzym. Microb. Technol. 20 (1997) 221–224, http://dx.doi.org/10.1016/S0141-0229(96)00116-0. [22] S.J. Green, R. Venkatramanan, A. Naqib, Deconstructing the polymerase chain reaction: understanding and correcting bias associated with primer degeneracies and primer-template mismatches, PLoS One 10 (2015) e0128122, http://dx.doi.org/10. 1371/journal.pone.0128122. [23] S.M. Bybee, H. Bracken-Grissom, B.D. Haynes, R.A. Hermansen, R.L. Byers, M.J. Clement, J.A. Udall, E.R. Wilcox, K.A. Crandall, Targeted amplicon sequencing (TAS): a scalable next-gen approach to multilocus, multitaxa phylogenetics, Genome Biol. Evol. 3 (2011) 1312–1323, http://dx.doi.org/10.1093/gbe/evr106. [24] P.V. Moonsamy, T. Williams, P. Bonella, C.L. Holcomb, B.N. Höglund, G. Hillman, D. Goodridge, G.S. Turenchalk, L.A. Blake, D.A. Daigle, B.B. Simen, A. Hamilton, A.P. May, H.A. Erlich, High throughput HLA genotyping using 454 sequencing and the Fluidigm Access Array™ system for simplified amplicon library preparation, Tissue Antigens 81 (2013) 141–149, http://dx.doi.org/10.1111/tan.12071. [25] J. Zhang, K. Kobert, T. Flouri, A. Stamatakis, PEAR: a fast and accurate Illumina Paired-End reAd mergeR, Bioinformatics 30 (2014) 614–620, http://dx.doi.org/10. 1093/bioinformatics/btt593. [26] R.C. Edgar, Search and clustering orders of magnitude faster than BLAST, Bioinformatics 26 (2010) 2460–2461, http://dx.doi.org/10.1093/bioinformatics/btq461. [27] J.G. Caporaso, J. Kuczynski, J. Stombaugh, K. Bittinger, F.D. Bushman, E.K. Costello, N. Fierer, A.G. Peña, J.K. Goodrich, J.I. Gordon, G.A. Huttley, S.T. Kelley, D. Knights, J.E. Koenig, R.E. Ley, C.A. Lozupone, D. McDonald, B.D. Muegge, M. Pirrung, J. Reeder, J.R. Sevinsky, P.J. Turnbaugh, W.A. Walters, J. Widmann, T. Yatsunenko, J. Zaneveld, R. Knight, QIIME allows analysis of high-throughput community sequencing data, Nat. Methods 7 (2010) 335–336, http://dx.doi.org/10.1038/nmeth.f.303. [28] C. Quast, E. Pruesse, P. Yilmaz, J. Gerken, T. Schweer, P. Yarza, J. Peplies, F.O. Glockner, The SILVA ribosomal RNA gene database project: improved data processing and web-based tools, Nucleic Acids Res. 41 (2013) D590–D596, http://dx.doi.org/10. 1093/nar/gks1219. [29] J.G. Caporaso, K. Bittinger, F.D. Bushman, T.Z. DeSantis, G.L. Andersen, R. Knight, PyNAST: a flexible tool for aligning sequences to a template alignment, Bioinformatics 26 (2010) 266–267, http://dx.doi.org/10.1093/bioinformatics/btp636. [30] M. Hamady, R. Knight, Microbial community profiling for human microbiome projects: tools, techniques, and challenges, Genome Res. 19 (2009) 1141–1152, http://dx.doi.org/10.1101/gr.085464.108. [31] P.H.A. Sneath, R.R. Sokal, Numerical Taxonomy. The Principles and Practice of Numerical Classification, W.H. Freeman and Company, San Francisco, USA, 1973. [32] F. Villa, W. Remelli, F. Forlani, M. Gambino, P. Landini, F. Cappitelli, Effects of chronic sub-lethal oxidative stress on biofilm formation by Azotobacter vinelandii, Biofouling 28 (2012) 823–833, http://dx.doi.org/10.1080/08927014.2012.715285. [33] F. Villa, B. Pitts, E. Lauchnor, F. Cappitelli, P.S. Stewart, Development of a laboratory model of a phototroph-heterotroph mixed-species biofilm at the stone/air interface, Front. Microbiol. 6 (2015)http://dx.doi.org/10.3389/fmicb.2015.01251. [34] L. Mueller, J. de Brouwer, J. Almeida, L. Stal, J. Xavier, Analysis of a marine phototrophic biofilm by confocal laser scanning microscopy using the new image quantification software PHLIP, BMC Ecol. 6 (2006) 1, http://dx.doi.org/10.1186/1472-6785-6-1. [35] J. Xavier, D. White, J. Almeida, Automated biofilm morphology quantification from confocal laser scanning microscopy imaging, Water Sci. Technol. 47 (2003) 31–37. [36] R.K. Thauer, K. Jungermann, K. Decker, Energy conservation in chemotrophic anaerobic bacteria, Bacteriol. Rev. 41 (1977) 100–180, http://dx.doi.org/10.1073/pnas. 0803850105. [37] P. Parameswaran, H. Zhang, C.I. Torres, B.E. Rittmann, R. Krajmalnik-Brown, Microbial community structure in a biofilm anode fed with a fermentable substrate: the significance of hydrogen scavengers, Biotechnol. Bioeng. 105 (2010) 69–78, http:// dx.doi.org/10.1002/bit.22508. [38] B.E. Logan, Exoelectrogenic bacteria that power microbial fuel cells, Nat. Rev. Microbiol. 7 (2009) 375–381, http://dx.doi.org/10.1038/nrmicro2113. [39] L. Rago, Y. Ruiz, J.A. Baeza, A. Guisasola, P. Cortés, Microbial community analysis in a long-term membrane-less microbial electrolysis cell with hydrogen and methane production, Bioelectrochemistry 106 (2015) 359–368, http://dx.doi.org/10.1016/j. bioelechem.2015.06.003. [40] M. Morita, N.S. Malvankar, A.E. Franks, D. Interspecies, E. Transfer, M. Wastewater, D. Aggregates, R.S.S. Feeds, A.S.M. Journal, Potential for Direct Interspecies Electron Transfer in Methanogenic, MBio (2011)http://dx.doi.org/10.1128/mBio.00159-11.Editor. [41] S. Ishii, K. Watanabe, S. Yabuki, B.E. Logan, Y. Sekiguchi, Comparison of electrode reduction activities of Geobacter sulfurreducens and an enriched consortium in an air-

50

[42]

[43]

[44]

[45]

[46]

[47]

[48]

[49]

[50]

[51]

[52]

[53]

[54]

[55]

[56]

[57] [58]

[59]

[60]

[61]

[62]

[63]

[64] [65]

[66]

[67] [68]

L. Rago et al. / Bioelectrochemistry 116 (2017) 39–51 cathode microbial fuel cell, Appl. Environ. Microbiol. 74 (2008) 7348–7355, http:// dx.doi.org/10.1128/AEM.01639-08. E.S. Heidrich, S.R. Edwards, J. Dolfing, S.E. Cotterill, T.P. Curtis, Performance of a pilot scale microbial electrolysis cell fed on domestic wastewater at ambient temperatures for a 12 month period, Bioresour. Technol. 173 (2014) 87–95, http://dx.doi. org/10.1016/j.biortech.2014.09.083. K. Rabaey, N. Boon, S.D. Siciliano, M. Verhaege, W. Verstraete, Biofuel cells select for microbial consortia that self-mediate electron transfer, Appl. Environ. Microbiol. 70 (2004) 5373–5382, http://dx.doi.org/10.1128/AEM.70.9.5373-5382.2004. S.Y. Chen, X.Z. Dong, Proteiniphilum acetatigenes gen. nov., sp nov., from a UASB reactor treating brewery wastewater, Int. J. Syst. Evol. Microbiol. 55 (2005) 2257–2261, http://dx.doi.org/10.1099/ijs.0.63807-0. N. Montpart, L. Rago, J.A. Baeza, A. Guisasola, Hydrogen production in single chamber microbial electrolysis cells with different complex substrates, Water Res. 68 (2015) 601–615, http://dx.doi.org/10.1016/j.watres.2014.10.026. N. Montpart, E. Ribot-Llobet, V.K. Garlapati, L. Rago, J.A. Baeza, A. Guisasola, Methanol opportunities for electricity and hydrogen production in bioelectrochemical systems, Int. J. Hydrog. Energy 39 (2014) 770–777, http://dx.doi.org/10.1016/j. ijhydene.2013.10.151. G. Zhao, F. Ma, T. Sun, S. Li, K. You, Z. Zhao, Analysis of microbial community in a fullscale biogas digester of cold region using high-throughput sequencing technology, Harbin Gongye Daxue Xuebao/Journal Harbin Inst. Technol. 46 (2014). B. Liang, L.-Y. Wang, S.M. Mbadinga, J.-F. Liu, S.-Z. Yang, J.-D. Gu, B.-Z. Mu, Anaerolineaceae and Methanosaeta turned to be the dominant microorganisms in alkanes-dependent methanogenic culture after long-term of incubation, AMB Express 5 (2015) 37, http://dx.doi.org/10.1186/s13568-015-0117-4. C. Strompl, Oceanicaulis alexandrii gen. nov., sp. nov., a novel stalked bacterium isolated from a culture of the dinoflagellate Alexandrium tamarense (Lebour) Balech, Int. J. Syst. Evol. Microbiol. 53 (2003) 1901–1906, http://dx.doi.org/10.1099/ijs.0.02635-0. J.P. Bowman, Family III. Cryomorphaceae Bergey's manual of systematic bacteriology, in: W. L., W. W., N.R. Krieg, J.T. Staley, D.R. Brown, B.P. Hedlund, B.J. Paster, N.L. Ward (Eds.), Bergey's Man. Syst. Bacteriol, second ed., vol. 4, Springer 2015, pp. 322–326. J.P. Bowman, Owenweeksia, Bergey's Manual of Systematics of Archaea and Bacteria, John Wiley & Sons, Ltd, Chichester, UK, 2015http://dx.doi.org/10.1002/ 9781118960608. K.W.K. Lau, Owenweeksia hongkongensis gen. nov., sp. nov., a novel marine bacterium of the phylum “Bacteroidetes”, Int. J. Syst. Evol. Microbiol. 55 (2005) 1051–1057, http://dx.doi.org/10.1099/ijs.0.63155-0. B. Zheng, L. Wang, L. Liu, Bacterial community structure and its regulating factors in the intertidal sediment along the Liaodong Bay of Bohai Sea, China, Microbiol. Res. 169 (2014) 585–592, http://dx.doi.org/10.1016/j.micres.2013.09.019. G. Garrity, J.T. Staley, D.R. Boone, P. De Vos, M. Goodfellow, F.A. Rainey, K.H. Schleifer, Bergey's Manual® of Systematic Bacteriology: Volume Two: The Proteobacteria, Springer Science & Business Media, 2006. S. Mnif, M. Chamkha, S. Sayadi, Isolation and characterization of Halomonas sp. strain C2SS100, a hydrocarbon-degrading bacterium under hypersaline conditions, J. Appl. Microbiol. 107 (2009) 785–794, http://dx.doi.org/10.1111/j.1365-2672.2009.04251.x. D.I. Sorokin, T. Turova, B. Kuznetsov, I. Briantseva, V. Gorlenko, Roseinatronobacter thiooxidans Gen. Nov., sp. Nov., a new alkaliphilic aerobic bacteriochlorophyllalpha-containing bacteria from a soda lake, Mikrobiologiia 59 (2000) 89–97. V.A. Saunders, Genetics of Rhodospirillaceae, Microbiol. Rev. 42 (1978) 357–384. A. Franzetti, M. Daghio, P. Parenti, T. Truppi, G. Bestetti, S.P. Trasatti, P. Cristiani, Monod kinetics degradation of low concentration residual organics in membraneless microbial fuel cells, J. Electrochem. Soc. 164 (2017) H3091–H3096, http://dx.doi.org/10.1149/2.0141703jes. A. Kurata, M. Miyazaki, T. Kobayashi, Y. Nogi, K. Horikoshi, Alkalimonas collagenimarina sp. nov., a psychrotolerant, obligate alkaliphile isolated from deep-sea sediment, Int. J. Syst. Evol. Microbiol. 57 (2007) 1549–1553, http://dx. doi.org/10.1099/ijs.0.65084-0. Y. Ma, Y. Xue, W.D. Grant, N.C. Collins, A.W. Duckworth, R.P. Van Steenbergen, B.E. Jones, Alkalimonas amylolytica gen. nov., sp. nov., and Alkalimonas delamerensis gen. nov., sp. nov., novel alkaliphilic bacteria from soda lakes in China and East Africa, Extremophiles 8 (2004) 193–200, http://dx.doi.org/10.1007/s00792-004-0377-4. B. Reinholdhurek, T. Hurek, M. Gillis, B. Hoste, M. Vancanneyt, K. Kersters, J. Deley, Azoarcus gen-nov, nitrogen-fixing proteobacteria associated with roots of kallar grass (Leptochloa-Fusca (L) Kunth), and description of 2 species, Azoarcus-indigens sp-nov and Azoarcus-communis sp-nov, Int. J. Syst. Bacteriol. 43 (1993) 574–584. N. Springer, W. Ludwig, B. Philipp, B. Schink, Azoarcus anaerobius sp. nov., a resorcinol-degrading, strictly anaerobic, denitrifying bacterium, Int. J. Syst. Bacteriol. 48 (1998) 953–956, http://dx.doi.org/10.1099/00207713-48-3-953. A. Peix, M.-H. Ramírez-Bahena, E. Velázquez, Historical evolution and current status of the taxonomy of genus Pseudomonas, Infect. Genet. Evol. 9 (2009) 1132–1147, http://dx.doi.org/10.1016/j.meegid.2009.08.001. K. Horikoshi, Microorganisms in Alkaline Environments, Wiley-VCH Verlag GmbH, 1991. E. Stackebrandt, A.C. Reboli, W.E. Farrar, The genus Erysipelothrix, in: M. Dworkin, S. Falkow, E. Rosenberg, K.-H. Schleifer, E. Stackebrandt (Eds.), Prokaryotes, vol. 4, Springer US, New York, NY 2006, pp. 492–510 (Bact. Firmicutes, Cyanobacteria) 10.1007/0-387-30744-3_13. A.P. Borole, G. Reguera, B. Ringeisen, Z.-W. Wang, Y. Feng, B.H. Kim, Electroactive biofilms: current status and future research needs, Energy Environ. Sci. 4 (2011) 4813, http://dx.doi.org/10.1039/c1ee02511b. V.L. Finkenstadt, Natural polysaccharides as electroactive polymers, Appl. Microbiol. Biotechnol. 67 (2005) 735–745, http://dx.doi.org/10.1007/s00253-005-1931-4. V. Guarino, S. Zuppolini, A. Borriello, L. Ambrosio, Electro-active polymers (EAPs): a promising route to design bio-organic/bioinspired platforms with on demand functionalities, Polymers (Basel) 8 (2016) 185, http://dx.doi.org/10.3390/polym8050185.

[69] S.W. Li, G.-P. Sheng, Y.-Y. Cheng, H.-Q. Yu, Redox properties of extracellular polymeric substances (EPS) from electroactive bacteria, Sci. Rep. 6 (2016) 39098, http://dx.doi.org/10.1038/srep39098. [70] R.J. Steidl, S. Lampa-Pastirk, G. Reguera, Mechanistic stratification in electroactive biofilms of Geobacter sulfurreducens mediated by pilus nanowires, Nat. Commun. 7 (2016) 12217, http://dx.doi.org/10.1038/ncomms12217. [71] H.C. Flemming, J. Wingender, The biofilm matrix, Nat. Rev. Microbiol. (2010)http:// dx.doi.org/10.1038/nrmicro2415. [72] M.L. Carvalho, J. Doma, M. Sztyler, I. Beech, P. Cristiani, The study of marine corrosion of copper alloys in chlorinated condenser cooling circuits: the role of microbiological components, Bioelectrochemistry 97 (2014) 2–6, http://dx.doi.org/10.1016/ j.bioelechem.2013.12.005. [73] K. Kamata, Z. Piao, S. Suzuki, T. Fujimori, W. Tajiri, K. Nagai, T. Iyoda, A. Yamada, T. Hayakawa, M. Ishiwara, S. Horaguchi, A. Belay, T. Tanaka, K. Takano, M. Hangyo, Spirulina-templated metal microcoils with controlled helical structures for THz electromagnetic responses, Sci. Rep. 4 (2014) 4919, http://dx.doi.org/10.1038/srep04919. [74] Z.P. Wang, Y. Zhao, Morphological reversion of Spirulina (Arthrospira) platensis (Cyanophyta): from linear to helical, J. Phycol. 41 (2005) 622–628, http://dx.doi. org/10.1111/j.1529-8817.2005.00087.x. [75] A. Hongsthong, M. Sirijuntarut, P. Prommeenate, S. Thammathorn, B. Bunnag, S. Cheevadhanarak, M. Tanticharoen, Revealing differentially expressed proteins in two morphological forms of Spirulina platensis by proteomic analysis, Mol. Biotechnol. 36 (2007) 123–130, http://dx.doi.org/10.1007/s12033-007-0013-5. [76] I. Gajda, J. Greenman, C. Melhuish, I. Ieropoulos, Self-sustainable electricity production from algae grown in a microbial fuel cell system, Biomass Bioenergy 82 (2015) 87–93, http://dx.doi.org/10.1016/j.biombioe.2015.05.017. [77] P.S. Stewart, M.J. Franklin, Physiological heterogeneity in biofilms, Nat. Rev. Microbiol. 6 (2008) 199–210, http://dx.doi.org/10.1038/nrmicro1838. [78] M. Behera, P.S. Jana, M.M. Ghangrekar, Performance evaluation of low cost microbial fuel cell fabricated using earthen pot with biotic and abiotic cathode, Bioresour. Technol. 101 (2010) 1183–1189, http://dx.doi.org/10.1016/j.biortech.2009.07.089. [79] Y. Sun, J. Wei, P. Liang, X. Huang, Electricity generation and microbial community changes in microbial fuel cells packed with different anodic materials, Bioresour. Technol. 102 (2011) 10886–10891, http://dx.doi.org/10.1016/j.biortech.2011.09.038. [80] W. Ghosh, B. Dam, Biochemistry and molecular biology of lithotrophic sulfur oxidation by taxonomically and ecologically diverse bacteria and archaea, FEMS Microbiol. Rev. 33 (2009) 999–1043, http://dx.doi.org/10.1111/j.1574-6976.2009.00187.x. [81] L. Zhang, P. De Schryver, B. De Gusseme, W. De Muynck, N. Boon, W. Verstraete, Chemical and biological technologies for hydrogen sulfide emission control in sewer systems: a review, Water Res. 42 (2008) 1–12, http://dx.doi.org/10.1016/j.watres.2007.07.013. Dr. Laura Rago obtained her PhD in Biotechnology at the Universitat Autònoma de Barcelona (Spain) in 2015. She earned her Biotechnology and Master's degree in Pharmaceutical, Veterinary and Medical Biotechnologies (respectively in 2008 and 2011) at Università Magna Græcia di Catanzaro (Italy). In 2013, she participated in a research stay at the Swette Center for Environmental Biotechnology in the Arizona State University (Tempe, USA). Now, she is a postdoctoral researcher at the DISAA at University of Milan. From 2014, she has authored around 10 peer-reviewed publications on microbiology of the bioelectrochemical systems. orcid.org/00000003-0698-9289

Dr. Pierangela Cristiani, Biologist at RSE SpA (Italian public-controlled Research Company for Energy fields), has a consolidated experiences of researches, cooperative projects and teaching on materials/microbes interactions. She is involved in the organization of several international conferences and she is chairing the WP “Microbial Corrosion” of the European Federation of Corrosion. Her current relevant activity includes the development of microbial fuel cells technology in collaboration with several university's Departments and wastewater plants. She is author of more than 100 publications, more than 50 peer-reviewed journal papers and 8 book chapters. orcid. org/0000-0001-6315-9690.

Dr. Federica Villa received her PhD degree in Chemistry, Biochemistry and Ecology of Pesticides at the University of Milan in 2010. She completed part of her research at the Center for Biofilm Engineering (USA) and at the Harvard School of Engineering and Applied Science (USA) where she specialized in biofilm analysis. In 2013, she received a fellowship from the European Union under the FP7 Marie Curie People Program IOF. Her major research interests include ecological and molecular aspects of microbial biofilms, antifouling strategies, and biofilm-mineral interactions. She has authored 38 international peer-reviewed publications and 3 book chapters. orcid.org/0000-0003-2930-4684

L. Rago et al. / Bioelectrochemistry 116 (2017) 39–51 Dr. Sarah Zecchin graduated in Biology as a bachelor and as a master student in 2010 and 2013 respectively. She started working on rice rhizospheric sulfate-reducing bacteria during her master traineeship at the Division of Microbial Ecology at the University of Vienna (Austria). During her PhD (obtained in 2017) in Food Systems at the University of Milano (Italy), she studied the rice rhizospheric microbial communities involved in arsenic contamination. She is currently working as a postdoctoral researcher at the Department of Biology of the University of Konstanz (Germany), dealing with novel species of sulfate-reducing bacteria living in rice rhizosphere. orcid.org/ 0000-0003-2851-1702

Dr. Alessandra Colombo obtained her PhD in Industrial Electrochemistry in 2010 at the Università degli Studi di Milano (Italy). In 2011, she joined the Electrochemistry and Corrosion group (Department of Chemistry, Università degli Studi di Milano), working in the field of corrosion and industrial electrochemistry. In 2014 she started to perform research on microbial fuel cells in the same group. From 2016, she is a Post-Doc researcher at the DiSAA Department at Università degli Studi di Milano, continuing the research on Bioelectrochemical Systems. She co-authored about 15 peer-reviewed papers and 25 conference proceedings. orcid.org/0000-0002-7276-5227

51 Dr. Lucia Cavalca is associate professor of General and Environmental Microbiology at the University of Milano. Her research is focused on microbial processes in the rhizosphere and in aquatic environments and on the exploitation of bacteria involved in metal removal from industrial effluents and ground water. She has been investigator in 14 national research programs and in 4 international programs. She has been coordinator of four national programs and of one international program. She authored 41 peerreviewed papers on international journals and two book chapters, and she is inventor of one Italian patent application. orcid.org/0000-0002-3512-1705

Dr. Andrea Schievano graduated in 2006 in Environmental Engineering at University of Padua (Italy) with a research project at Technical University of Denmark (DTU), Copenhagen DK. In 2010, he got his PhD degree in Agricultural Ecology and Engineering at University of Milan (Italy) and he won 2 Post-doc research fellowships (2010–2014) at the same institution. From 2015 he is Senior researcher, after being selected in the SIR (Scientific independence of young researchers) program of the Italian Ministry of University and Research (MIUR). He is author of around 40 scientific publications on international peer reviewed journals on waste bio-refineries and bio-electrochemical systems. orcid.org/0000-0003-3458-2654