Inhibition of neuronal ferroptosis in the acute phase of intracerebral hemorrhage shows long-term cerebroprotective effects

Brain Research Bulletin 153 (2019) 122–132

Contents lists available at ScienceDirect

Brain Research Bulletin journal homepage: www.elsevier.com/locate/brainresbull

Inhibition of neuronal ferroptosis in the acute phase of intracerebral hemorrhage shows long-term cerebroprotective effects

T

Bin Chena,1, Zhenghong Chena,1, Mingjian Liua, Xiaorong Gaoa, Yijun Chenga, Yongxu Weia, ⁎ ⁎⁎ Zhebao Wua, Derong Cuib, , Hanbing Shanga, a b

Department of Neurosurgery, Rui Jin Hospital, Shanghai Jiao Tong University School of Medicine, Shanghai, People’s Republic of China Department of Anesthesiology, Shanghai Jiaotong University Affiliated Sixth People’s Hospital, Shanghai, People’s Republic of China

A R T I C LE I N FO

A B S T R A C T

Keywords: Intracerebral hemorrhage Ferroptosis Ferrostatin-1 Secondary brain injury Neuroprotection

Intracerebral hemorrhage (ICH) is a devastating subtype of stroke because it has few viable therapeutic options to intervene against primary or second brain injury. Recently, evidence has suggested that ferroptosis, a nonapoptotic form of cell death, is involved in ICH. In this study, we examined whether ICH-induced neuron death is partly ferroptotic in humans and assessed its temporal and spatial characteristics in mice. Furthermore, the ferroptosis inhibitor ferrostatin-1 (Fer-1) was used to examine the role of ferroptosis after ICH. Fold changes in ferroptosis-related gene expression, intracellular iron levels, malondialdehyde (MDA) levels, and both protein levels and cellular localization of cyclooxygenase-2 (COX-2) were measured to monitor ferroptosis. Transmission electron microscopy (TEM) was also performed to examine the ultrastructure of cells after ICH. We found that the expression level of prostaglandin-endoperoxide synthase (PTGS2) was increased in both in vitro and in vivo ICH models; by comparison, expression level of RPL8 was increased in human brain tissue. In mice, iron and MDA levels were significantly increased 3 h after ICH; COX-2 levels were increased at 12 h after ICH and peaked at 3 days after ICH; COX-2 colocalized with NeuN (a neuronal biomarker); and TEM showed that shrunken mitochondria were found at 3 h, 3 days, and 7 days after ICH. Moreover, ICH-induced neurological deficits, memory impairment and brain atrophy were reduced by Fer-1 treatment. Our results demonstrated that neuronal ferroptosis occurs during the acute phase of ICH in brain areas distant from the hematoma and that inhibition of ferroptosis by Fer-1 exerted a long-term cerebroprotective effect.

1. Introduction ICH is a subtype of stroke that is associated with high morbidity and mortality (Keep et al., 2012; Qureshi et al., 2009). ICH causes brain injury through primary physical disruption of the brain’s cellular architecture as well as through mass effect and secondary injury such as inflammation, edema, and cell death (Keep et al., 2012). Emerging data suggest that multiple cell-death pathways, including necrosis, apoptosis, autophagy and necroptosis, are involved in the surrounding hematoma and remote brain regions after ICH (Bobinger et al., 2017; He

et al., 2008; Matsushita et al., 2000). Several preclinical studies have shown promising results by inhibiting neuronal cell death, to date, however, all of these therapeutic strategies have failed in randomized controlled clinical trials (Bobinger et al., 2017). Moreover, the mechanisms and predominant process of cellular death in the perihematomal tissue are not defined (Castillo et al., 2002). Ferroptosis, a newly discovered iron-dependent form of programmed cell death caused by the accumulation of lipid-based reactive oxygen species (ROS) (Dixon et al., 2012), is involved in multiple physiological (such as, embryonic development) and pathological (such

Abbreviations: ICH, intracerebral hemorrhage; Fer-1, ferrostatin-1; MDA, malondialdehyde; COX-2, cyclooxygenase-2; TEM, transmission electron microscopy; IREB2, iron-responsive element-binding protein 2; CS, citrate synthase; RPL8, ribosomal protein L8; ATP5G3, ATP synthase F0 complex subunit C3; ACSF2, acyl-CoA synthetase family member 2; ROS, reactive oxygen species; qPCR, quantitative real-time PCR; T-SOD, total superoxide dismutase; MWM, Morris water maze; IF, immunofluorescence; mNSS, modified neurological severity score ⁎ Corresponding author at: Department of Anesthesiology, Shanghai Jiaotong University Affiliated Sixth People’s Hospital, No. 600, Yi Shan Road, Shanghai 200233, People’s Republic of China. ⁎⁎ Corresponding author at: Department of Neurosurgery, Rui Jin Hospital, Shanghai Jiao Tong University School of Medicine, No. 197, Rui Jin Er Road, Shanghai 200025, People’s Republic of China. E-mail addresses: [email protected] (D. Cui), [email protected] (H. Shang). 1 The first two authors contributed equally to this work. https://doi.org/10.1016/j.brainresbull.2019.08.013 Received 10 February 2019; Received in revised form 10 August 2019; Accepted 18 August 2019 Available online 20 August 2019 0361-9230/ © 2019 The Authors. Published by Elsevier Inc. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/BY-NC-ND/4.0/).

Brain Research Bulletin 153 (2019) 122–132

B. Chen, et al.

incubator with constant temperature 22–24 °C, as well as relative humidity 55–60%.

as, neurodegeneration and cancer) processes (Hirschhorn and Stockwell, 2018). A series of genes regulating iron or mitochondrial fatty-acid metabolism may be specifically required for ferroptosis. These genes include iron-responsive element-binding protein 2 (IREB2), citrate synthase (CS), ribosomal protein L8(RPL8), ATP synthase F0 complex subunit C3 (ATP5G3), acyl-CoA synthetase family member 2 (ACSF2) (Dixon et al., 2012), and prostaglandin-endoperoxide synthase (PTGS), which has been shown to be significantly upregulated after treatment with a ferroptosis inducer in mice (Yang et al., 2014). Moreover, suppression of activity of the oxido-metabolic driver activating transcription factor 4 (ATF4) was shown abrogates glutamate analog-induced ferroptosis and improves functional recovery after ICH (Karuppagounder et al., 2016; Zille and Kumar, 2019). However, there is a dearth of biomarkers to identify cells undergoing this process (Hirschhorn and Stockwell, 2018; Xie et al., 2016). The current method for measuring the ferroptotic process relies mainly on the observation of increased cellular ROS and iron levels and on, the ability of ferroptosis inducer (e.g., erastin, RSL3) and ferroptosis inhibitors (e.g., Fer-1, deferoxamine) to induce and block cell death(Hirschhorn and Stockwell, 2018; Xie et al., 2016). Shrunken mitochondria, as observed using transmission electron microscopy (TEM), served as a morphological feature that helps distinguish ferroptosis from apoptosis, necroptosis, and autophagy (Xie et al., 2016). Several studies have shown that ferroptosis is implicated in secondary brain injury after ICH in animal models, and accounts for 80% of total cell death in vitro (Li et al., 2017; Zhang et al., 2018; Zille et al., 2017). All these results demonstrated that ferroptosis may play an important role in neurological deficits after ICH. It is essential to investigate the biomechanism of ferroptosis in ICH. To date, no study has characterized the temporal and spatial features of ferroptotic cell death in experimental models of ICH. To investigate the evolution of neuron ferroptosis in ICH pathology, we characterized the temporal features and anatomical distribution of ferroptotic neurons after ICH induced by autologous blood infusion in mice; subsequently, we verified the correlation between ferroptosis and neurological deficits, memory impairment, and brain atrophy following ICH.

2.3. Drug administration Animals were randomly selected for treatments following ICH surgery. Fer-1 (Ferrostatin-1; Catalog#HY-100579, MedChemExpress) was dissolved in DMSO, then diluted to its final concentrations with 0.9% normal saline and injected i.p. at a dose of 2 mg/kg 3 h after ICH surgery (Linkermann et al., 2014; Zhang et al., 2018). The sham and vehicle-treated mice were received an equal volume of vehicle, which was also injected i.p. at the same time point. The drug was administered once daily for 21 days after ICH. 2.4. Experimental design There were 4 parts to the experimental design of this study. Part 1: To analyze ferroptosis-related gene expression profiles after ICH in vitro and in vivo, we performed quantitative real-time PCR (qPCR). Primary cortical neurons were treated with 0, 5, 10, 20, 40, 80, 160, 320, 500, or 800 μM hemin for 24 h, and cell viability was measured using a CCK-8 kit. Next, qPCR was performed to analyze mRNA (IREB2, CS, RPL8, ATP5G3, ACSF2 and PTGS2) expression in control and primary cortical neurons treated with 40 μM hemin, with or without 20 μM Fer-1 for 24 h. In vivo, we also analyzed the expression of ferroptosis-related mRNA in brain tissue from sham and ICH-affected mice and from control and ICH-affected humans. Part 2: To determine the time course of iron levels, MDA levels, TSOD activity, expression of COX-2 after ICH, we randomly divided 35 ICR mice into 7 groups (sham, ICH-3 h, ICH-12 h, ICH-24 h, ICH-3d, ICH-7d, ICH-14d). We measured intracellular iron levels, MDA level, TSOD activity, and COX-2 levels in perihematomal tissue using a commercial kit and Western blot analysis. In addition, we randomly divided 24 ICR mice into 8 groups (IF-sham, IF-ICH-12 h, IF-ICH-24, IF-ICH-3d; TEM-sham, TEM-ICH-3 h, TEM-ICH-3d, TEM-ICH-7d) and euthanized these mice for double immunofluorescence (IF) staining and TEM examination. Part 3: To determine the spatial characteristics of iron levels, MDA levels, T-SOD activity, and expression of COX-2 after ICH, we randomly divided 20 ICR mice into 4 groups (sham, ICH-3 h (for the MDA and TSOD tests), ICH-24 h (for the iron test), and ICH-3d (for the COX-2 test)). Intracellular iron levels, MDA levels, T-SOD activity, and COX-2 levels in the perihematomal tissue, hippocampus and cortex were measured. In addition, we randomly divided 12 ICR mice into 4 groups (IF-sham, IF-ICH-3d; TEM-sham, TEM-ICH-3d) and euthanized these ICR mice for double immunofluorescence (IF) staining and TEM examination. Part 4: We randomly divided 45 C57 mice into 3 groups (Sham + Vehicle, ICH + vehicle, ICH + Fer-1). We administered Fer-1 intraperitoneally at 3 h after ICH and then at 1-day intervals for up to 21 days after ICH. Sham control and vehicle treatment mice received an equal volume of vehicle at the same timepoint. We evaluated neurological severity scores at 1, 3, 7, 14, and 21 days after ICH. We also assessed memory function with the Morris water maze (MWM) at 1–6 days after ICH and 16–21 days after ICH. Then, we euthanized the mice for cresyl violet staining at 21 days after ICH.

2. Materials and methods 2.1. Animals All procedures were approved by the Institutional Animal Care and Use Committee of Shanghai Jiao Tong University, Shanghai, China. In this study, we used 91 eight-week-old male ICR mice and 45 eightweek-old male C57BL/6 mice (Shanghai Laboratory Animal Center, Shanghai, China). The mice were housed with free access to water and food under a 12/12-h light–dark cycle in the verified specific-pathogenfree animal facility of Shanghai Jiao Tong University. 2.2. ICH models The autologous blood infusion model of ICH was adopted as previously described with some modification (Rynkowski et al., 2008). Briefly, 8-week-old male ICR or C57 (in the Morris water maze) mice, were anesthetized with ketamine (dose, 100 mg/kg i.p.) and xylazine (dose, 10 mg/kg, i.p.). Then, each mouse was mounted in a stereotactic frame (RWD Life Science Co., Shenzhen, China) and the main anatomical landmarks of the skull were exposed. On the right side of the sagittal suture, 0.2 mm anterior and 2.3 mm lateral to the bregma, a 1 mm diameter burr hole was drilled through the skull to the endocranium. The needle was advanced 3.5 mm ventral to the skull surface. In a two-step procedure (5 μl–5 min interval −25 μl), 30 μl autologous whole blood was injected into the right striatum at a rate 2 μl/ min. The needle was left in place for 7 min to avoid reflux. The burr hole was closed with bone wax, and the skin was closed with interrupted sutures. Finally, the animals were placed in a comfortable

2.5. Primary neurons culture Primary cortical neurons were obtained from the cortices of E-18 prenatal embryos’ as previously described (Beaudoin et al., 2012), with some modification. Dissociated cells were plated on dishes precoated with poly-D-lysine (20 μg/ml, Catalog#P7405, Sigma-Aldrich) and cultured in Neurobasal medium (Catalog#21103-049, gibco) with B27 (2%, Catalog#17504-044, Gibco). The cells were seeded at a density of 6 × 105 cells per well in six-well plates in preparation for qPCR 123

Brain Research Bulletin 153 (2019) 122–132

B. Chen, et al.

analysis. The neurons were maintained in a CO2 incubator (5% CO2, 21% O2) at 37.0 ± 0.5 °C. Half of the culture medium was replaced with the same volume of fresh medium every 3 days. After 7–9 days in culture, the neurons developed well-differentiated axons and dendrites and were ready for the experiments. Using NeuN immunofluorescence, we confirmed that more than 90% of DAPI+ cells were NeuN+ neurons.

Table 2 Morris water maze spatial (hidden platform) start positions. Short-term test procedure

2.6. Cell viability Cell viability was investigated with a Cell Counting Kit-8 (CCK-8) (Catalog#C0038, Beyotime) assay according to the manufacturer’s instructions. Briefly, cells were seeded onto 96-well plates at 3 × 104 cells/well and cultured in cell incubator. After 24 h, the cells were exposed to 0, 5, 10, 20, 40, 80, 160, 320, or 500 μM hemin (Aladdin, Shanghai, China) for 24 h. Then, the medium was replaced with DMEM (containing 10 μl CCK-8 solution per 100 μl DMEM) and blank wells were also established as controls. After the plates were incubated for 3 h in the cell incubator, the optical density (OD) at 450 nm was measured by a microplate reader (BioTek, VT, USA). Six independent experiments were carried out, each including all treatments.

Trial 2

Trial 3

Trial 4

1 2 3 4 5 6 (probe test)

N SE NW E N NE

E N SE NW SE

SE NW E N E

NW E N SE NW

Day

Trial 1

Trial 2

Trial 3

Trial 4

16 17 18 19 20 21 (probe test)

S NW SE W S SW

W S NW SE NW

NW SE W S W

SE W S NW SE

buffer (containing RIPA, PMSF, protease inhibitor cocktail, phosphatase inhibitors), and stored at −20 ℃ for less than one week. Western blotting was performed as previously described (Liu et al., 2014). Total protein was extracted with RIPA lysate (Millipore, Bedford, MA, USA) and the protein concentration was determined with the Pierce™ BCA Protein Assay Kit (ThermoFisher Scientific, MA, USA). Equal amounts of protein (40 μg) were separated by 10% sodium dodecyl sulfatepolyacrylamide gel electrophoresis (SDS-PAGE) and then electrotransferred to a PVDF membrane (Millipore, Temecula, CA, USA). The blots were incubated with 5% skim milk at room temperature for 2 h, after which the appropriate primary antibodies, namely, rabbit antiCOX-2 antibody (1:1000, Catalog #ab15191, Abcam) and mouse antiβ-actin antibody (1:1000, Catalog #MA5-15739, Invitrogen), were added for incubation at 4 °C overnight. Subsequently, the membranes were washed with Tris-buffered saline containing 0.1% Triton X-100 (TBS-T) (3 × 15 min) and then incubated with the appropriate secondary antibodies, namely, goat anti-mouse IgG-HRP (1:5000, Catalog #HA1006 HUABIO) and goat anti-rabbit IgG-HRP (1:5000, Catalog #HA1001 HUABIO), at room temperature for 2 h. The membranes were washed, and the results were visualized with ECL solution (ThermoFisher Scientific, MA, USA). The signal was detected using a Tanon imaging system (Shanghai, China), and the densitometric values of the COX-2 and β-actin bands were analyzed with ImageJ 1.6.0 (NIH, MD, USA). All data shown are representative of five hemorrhagic brains per group.

Total RNA from primary cortical neurons and fresh mouse perihematomal tissue and frozen ICH-affected human brain tissue was extracted using TRIzol Reagent (Takara, Dalian, China). RNA concentrations and quality were verified using a spectrophotometer (Thermo Scientific, Multiskan GO, USA), and an OD 260/280 ratio greater than 1.8 was considered an indicator of good RNA quality. A genomic DNA (gDNA) elimination reaction was performed to remove residual gDNA contamination. Reverse transcription was conducted using the PrimeScript™ RT reagent kit (Catalog#RR047A, Takara) according to the manufacturer's protocol. All cDNAs were stored at −20 °C. IREB2, CS, RPL8, ATP5G3, ACSF2, and PTGS2 mRNA expression was quantified using SYBR® Premix Ex Taq™ (Tli RNaseH Plus) (Catalog #RR420A, Takara). The primers used were as follows (Table 1). PCR amplification was performed for 40 cycles, and data were collected using SDS software (Applied Biosystems, CA, USA). The data were normalized to the endogenous control β-actin in quadruplicate. The fold-change values were normalized to the control groups. 2.8. Western blotting The mice were sacrificed at 3, 12, and 24 h and 3, 7, and 14 days after blood infusion. Brain tissues surrounding the hematoma (ICH models) or surrounding the needle track (Sham models) were obtained, and the samples were weighed, placed in cold modified RIPA lysis

2.9. Double immunofluorescence staining

Table 1 Real-time PCR primers.

Mouse IREB2 CS RPL8 ATP5G3 ACSF2 PTGS2 Human IREB2 CS RPL8 ATP5G3 ACSF2 PTGS2 Endogenous β-actin

Trial 1

Long-term test procedure

2.7. RNA extraction and RT-PCR analysis

Gene

Day

Forward (5′-3′)

Reverse (3′-5′)

TGCAGTAAAACAGGGTGATTTG CTCTGAAACATCTGCCTAAGGA GGATCCCTACCGATTCAAGAAG ACAGTCTTTGGCAGTCTTATCA CTCTCAGTTCTGGAATGGTGAA ATTCCAAACCAGCAGACTCATA

TAAATTTCCTTGCCCGTAGAGT TAGTAGTTCATCTCCGTCATGC AAACATTGCCGATATTCAGCTG ACAAAAGAGACCCATAGCTTCA CACAGTTGTGTTCACAAGATGG CTTGAGTTTGAAGTGGTAACCG

GAGGCTGCAGAGCTGTACCA CGAGGCTTTAGTATCCCTGAAT TTTGTGTATTGCGGCAAGAAG ACAGTCTTTGGCAGTCTTATCA GACACCAGAGCAGTTGCGGATG TGTCAAAACCGAGGTGTATGTA control (mouse & human) CTACCTCATGAAGATCCTGACC

CTTTGGCAGCCCAGTCTCTG GTTGGGATATGTCCAGTTACCA GAGATAACGGTGGCATAGTTCC ACAAAAGAGACCCATAGCTTCA CCTCCAGTGCCTTCTTGCCATTG AACGTTCCAAAATCCCTTGAAG

Experimental groups at 12 h, 24 h, and 3 days after ICH, as well as the sham group (5 mice per group), were deeply anesthetized and perfused with 30 ml of phosphate-buffered saline (PBS), followed by 4% paraformaldehyde (PFA). After perfusion, the whole brains were obtained, flash frozen in −42 °C isopentane for 5 min, and then stored at −80 °C until use. The brains were cut to a thickness of 20 μm with a cryostat microtome (Leica, Solms, Germany), and the sections were stored at −80 °C. For double immunofluorescence staining, brain sections were washed in PBS and treated with 0.3% Triton X-100 for 10 min at room temperature, after which they were blocked with 10% bovine serum albumin (BSA) for 1 h at RT. Then, the sections were incubated overnight at 4 °C with primary antibodies, namely, rabbit anti-COX-2 (1:1000, Catalog #ab15191, Abcam) and mouse anti-NeuN (1:100, Catalog #MAB377, Millipore), for 12 h. After being washed with PBS, the sections were incubated with secondary antibodies at 37 °C for 1 h, after which the nuclei were counterstained with DAPI

CACAGCTTCTCTTTGATGTCAC

124

Brain Research Bulletin 153 (2019) 122–132

B. Chen, et al.

Fig. 1. Ferroptosis-related gene expression after intracranial hemorrhage (ICH) in vitro and in vivo. (A) Cell viability assay. Data are shown as the mean ± standard error of the mean (SEM), n = 6/group; *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001 vs control. (B) mRNA (IREB2, CS, RPL8, ATP5G3, ACSF2 and PTGS2) expression in vitro, (C) in mice and (D) in humans. Data are shown as the mean ± SEM, n = 4 samples/ group, *p < 0.05, **p < 0.01, ***p < 0.001 vs sham or control samples. #p < 0.05 vs hemin group.

(1:5000, Catalog #C1002, Beyotime). Three fields in each slice were captured using a confocal laser scanning microscope (Leica, Solms, Germany), and three evenly spaced slices per mouse brain were used. COX-2- and NeuN-positive cells were counted with ImageJ 1.6.0 (NIH, MD, USA) by an investigator who was blinded to the experimental design.

spectrophotometer (OD 532 nm). The result was expressed as nanomoles per microgram of total protein (nmol/mg prot), and the protein concentration was determined with a Pierce™ BCA Protein Assay Kit (ThermoFisher Scientific, MA, USA). MDA measurements are often correlated with measurements of superoxide dismutase (SOD), a key enzyme in the dismutation of superoxide radicals. Total SOD (T-SOD) activity in the perihematomal area, hippocampus and cortex were assessed using a commercial kit (Catalog #A001-1, Nanjing Jiancheng Bioengineering Institute). The blue product was measured at 550 nm. A SOD activity unit (U) was defined as the amount of SOD corresponding to a 50% SOD inhibition rate per milligram of tissue protein in 1 ml of reaction solution. The activity was expressed as units per microgram of total protein (U/mg prot), and the protein concentration was determined with a Pierce™ BCA Protein Assay Kit (ThermoFisher Scientific, MA, USA).

2.10. Electron microscopy Sham and ICH mice were deeply anesthetized and perfused with 4% paraformaldehyde and 2.5% glutaraldehyde in 0.1 M sodium cacodylate buffer (pH 7.4). A 1-mm-cube tissue block was obtained from the perihematoma area (or corresponding location in sham mice), hippocampus and cortex of the mice. Then the tissue blocks were immersed in 2.5% glutaraldehyde for 2 h at 4 ℃. The samples were subsequently postfixed with 1.0% OsO4 and dehydrated in ethyl alcohol. Then, the samples were infiltrated with propylene oxide, embedded in Eponate, and sectioned. The ultrathin sections were stained with 2% uranyl acetate and Reynolds’ lead citrate. TEM images were captured with a Philips CM 120 microscope.

2.13. Morris water maze Neurocognitive function was characterized with the MWM as described in Nature Protocols (Vorhees and Williams, 2006). All trials were performed in a room appropriate for behavioral experiment, with light, sound, and visual cues held constant. In briefly, the water maze apparatus was a circular tank (120 cm in diameter) with water maintained at approximately 20–22 ℃, and an escape platform (10 cm in diameter) made of polyvinyl chloride (PVC) was submerged 0.8 cm below the surface of the water. The water was opacified to obscure the submerged platform. The tank was virtually divided into four equal quadrants (north, east, south, west). Each of five spatial trail days consisted of four trials, and the start positions were randomly set as shown in Table 2. The mice were given 60 s (s) to find the platform and then allowed to remain on it for 15 s. If mouse failed to reach the platform within 60 s, it was directed to the platform and allowed to remain there for 15 s. Subsequently, on day 6, the probe test was performed, and the underwater platform was removed from the pool. In this procedure, mice were allowed to explore the pool for 30 s. To measure the long-term effect of Fer-1, we started the next stage of the water maze at 16 days

2.11. Measurement of the iron contents of brain tissues Tissue samples (100 mg) from the perihematomal area, hippocampus and cortex were taken after the larger specimens were washed twice in PBS. Intracellular iron levels of Fe(II) and total Fe(II) + Fe(III) were measured in the brain using an iron assay kit (Catalog #ab83366, Abcam) following the manufacturer’s instructions. 2.12. Quantitative determination of MDA and T-SOD For the measurement of lipid peroxidation, malondialdehyde (MDA) was quantified using an MDA detection kit (Catalog #A003, Nanjing Jiancheng Bioengineering Institute) according to the manufacturer’s instructions. MDA reacts with thiobarbituric acid (TBA) to generate an MDA-TBA adduct. This adduct was quantified colorimetrically with a 125

Brain Research Bulletin 153 (2019) 122–132

B. Chen, et al.

Fig. 2. Time course of intracellular iron levels, lipid peroxidation product levels, total superoxide dismutase (T-SOD) activity and COX-2 expression in perihematomal brain tissue. (A) Total intracellular iron and (B) ferrous iron (iron(II)) were measured in ng/μg protein. (C, D) Malondialdehyde (MDA) levels and T-SOD activity in the same samples were tested. Values were measured in nmol/mg protein and U/mg protein, respectively. (E) Western blot analysis of COX-2 expression in the indicated groups. (F) The results of densitometric analysis of the blots. Data are shown as the mean ± standard error of the mean (SEM), n = 5 mice/group, *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001 vs sham.

after ICH. Animal behavioral data were recorded using a computerized video tracking system (ANY-maze 6.0, Stoelting, Co., Wood Dale, IL, United States). During the swimming interval, all mice except the one being tested at the time were kept in heated cages. The experimental procedure was the same as described above, but the platform was moved to the southwest area, and new start positions were assigned.

mouse was evaluated by a person who was blinded to the experimental design. The brain volume between two adjacent sections was calculated n h with the formula: V = ∑1 ⎡ (sn + sn × sn + 1 + sn + 1) × 3 ⎤, where ⎦ ⎣ h = 200 μm and where Sn and Sn+1 are the areas of two adjacent brain sections. Atrophy volume was calculated as the contralateral brain volume minus the ipsilateral volume.

2.14. Neurological severity scores

2.16. Statistical analysis

The neurological status of the mice was examined at 1, 3, 7, 14, and 21 days after ICH. A modified neurological severity score (mNSS) test was performed as previously reported (Tang et al., 2014). This test was a composite of the beam balance tests (normal = 0; maximum = 6), a motor test (maximum = 6) and a test for the presence or absence of reflexes (maximum = 3). Neurological severity was graded on a scale of 0–15 (normal score = 0; maximum deficit score = 15).

All data are expressed as the mean ± standard error of the mean (SEM) in the text and figures. Statistical significance was evaluated using Student’s t-test. P-Values < 0.05 were taken to indicate statistical significance. Statistical analysis was performed using SAS (IBM, NY, USA). Statistical charts were drawn using GraphPad Prism 7 (GraphPad Software, CA, USA). 3. Results

2.15. Volumetric assessment of brain atrophy 3.1. Expression of ferroptosis-related genes in ICH models in vitro and in vivo

On day 21 after ICH, brain volume atrophy (n = 8 animals per group) was evaluated by Nissl staining. The preparation procedure for histological sections was the same as for immunofluorescence staining. Briefly, a series of 30-μm-thick coronal sections were obtained and mounted on slides, with an interval of 200 μm between sections. A total of 25–30 sections from each brain were obtained for cresyl violet staining. Images were taken at 2× magnification and the part were delineated using ImageJ software. The brain volume atrophy in each

In this study, experimental ICH models were established as described in mice and cultured primary neurons to explore the expressional changes in genes required for ferroptosis following ICH. Moreover, to investigate the profiles of these genes in humans after ICH, we obtained ICH-affected brain tissue from patients. Next, we performed qPCR to examine the mRNA expression of IREB2, CS, RPL8, 126

Brain Research Bulletin 153 (2019) 122–132

B. Chen, et al.

Fig. 3. Intracranial hemorrhage (ICH)-induced neuron ferroptosis. (A) Double immunofluorescence staining for COX-2 (green) and NeuN (red) in normal and ICH mouse brains at the indicated time points after ICH. Bar = 100 μm. (B) Percentage of COX-2+ neurons analysis of the images. Data are shown as the mean ± standard error of the mean (SEM), n = 5 mice/time point, ****p < 0.0001 vs sham. (C) Ultrastructure of neurons in sham and perihematomal tissue at 3 h, 3 d, and 7 d after ICH. Bar = 5 μm. n = 5 mice/time point, White arrows indicate normal mitochondria; red arrows indicate shrunken mitochondria.

127

Brain Research Bulletin 153 (2019) 122–132

B. Chen, et al.

Fig. 4. Intracellular iron levels and lipid peroxidation product levels were increased, while total superoxide dismutase (T-SOD) activity was decreased, in perihematomal and hippocampal tissue after intracranial hemorrhage (ICH). (A) Intracellular iron levels, (B) MDA levels, (C) T-SOD activity, and (D) Western blot analysis of COX-2 expression in the indicated brain areas in sham and 3 d post-ICH mice. (E) Densitometric analysis of the blots. Data are the mean ± SEM, N=5 mice/group. *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001vs sham. Per: perihematomal, Hip: hippocampus, Cor: cortex.

PTGS2 and can be used as a biomarker of ferroptosis. Western blot analysis of COX-2 protein indicated significant upregulation at 12 h after ICH and a peak at 3 days after ICH (Fig. 2E, F). Furthermore, double immunofluorescence staining showed that the proportion of COX-2-positive neurons was increased after ICH (Fig. 3A, B). These results suggest that ferroptosis may occur in the early stages of ICH. Next, TEM was performed to examine the ultrastructure of neurons after ICH. We observed shrunken mitochondria in neurons at 3 h, 3 days, and 7 days after ICH (Fig. 3C).

ATP5G3, ACSF2 and PTGS2 in the perihematomal tissue and in our primary cortical neuron model of ICH. In vitro, to find the median lethal dose (LD50) of hemin, we tested cell viability with a CCK-8 assay. The results showed that the toxicity of hemin was dose-dependent, and 40 μM hemin caused more than half of primary cortical neurons to die (Fig. 1A). Further qPCR analysis showed that hemin increased the expression of PTGS2 in primary neurons, and this effect was alleviated by Fer-1, a specific inhibitor of ferroptosis (Fig. 1B). Similarly, mRNA expression of PTGS2 was increased in the autologous blood infusion mouse model of ICH (Fig. 1C). In contrast to findings in the in vitro culture model and the in vivo mouse model, RPL8 mRNA levels were upregulated in human brain tissue after ICH, but PTGS2 was not (Fig. 1D). However, we did not find any significant changes in the expression of IREB2, CS, ATP5G3 or ACSF2 in vitro or in vivo.

3.3. Spatial characteristics of ferroptosis after ICH To investigate whether neuronal ferroptosis occurred in areas remote from the hematoma (i.e., the cortex and hippocampus), we obtained perihematomal, hippocampal and cortical brain tissue at different time points after the ICH mouse model was established. Similarly, we examined intracellular iron levels (in the ICH-24 h condition), MDA levels (in ICH-3 h), T-SOD activity (in ICH-3 h), expression and localization of COX-2 (in ICH-3d) and the ultrastructure of ferroptotic neurons (at ICH-3d). The results showed that the total iron concentrations (Fig. 4A) and MDA levels (Fig. 4B) were increased in the hippocampus as well as the perihematomal tissue. However, T-SOD activity was decreased (Fig. 4C). As expected, Western blotting showed that COX-2 protein was upregulated in the ICH-affected hippocampi compared with the hippocampi of the sham group (Fig. 4D, E). Immunofluorescence analysis showed that COX-2-positive neurons were significantly increased in the hippocampus after ICH (Fig. 5B, C). Interestingly, cortical tissue did not exhibit significant changes in intracellular iron levels, MDA levels, TSOD activity or COX-2. However, we observed shrunken mitochondria in neurons of the perihematomal, hippocampal and cortical tissue using TEM (Fig. 6).

3.2. Temporal characteristics of ferroptosis after ICH To investigate the temporal characteristics of ferroptosis after ICH, we examined the intracellular iron levels, MDA levels, T-SOD activity, and spatial and temporal distribution of cyclooxygenase-2 (COX-2) in ferroptotic neurons within hematoma-adjacent brain tissue, as well as the ultrastructure of those neurons. We found that the total iron(II) +iron(III) concentration was significantly elevated from 3 h after ICH to 7 days after ICH (Fig. 2A). In contrast to total iron, the concentration of ferrous iron (iron (II)) was reduced at 12 h after ICH and subsequently increased, peaking at 24 h after ICH (Fig. 2B). MDA is the most important end product of lipid peroxidation. We observed accumulation of MDA, with a peak 3 h after ICH (Fig. 2C). Similarly, T-SOD activity decreased dramatically at 3 h after ICH and returned to normal at 7 days after ICH (Fig. 2D). PTGS2 was the only ferroptosis-related gene upregulated after ICH, and the upregulation was alleviated by Fer-1 (Fig. 1C). This result was similar to the findings of a previous study. COX-2 is a gene product of 128

Brain Research Bulletin 153 (2019) 122–132

B. Chen, et al.

Fig. 5. Double immunofluorescence staining for COX-2 (green) and NeuN (red) in the indicated brain area of sham and 3 d post-ICH (intracranial hemorrhage) mice. (A) Diagram explaining the imaging protocol for the quantification of COX-2+ neurons. (B) Representative image of the indicated brain area. (C) Percentage of COX2+ neurons as calculated from the images. Bar = 100 μm. Data are mean ± standard error of the mean (SEM), n = 5 mice/group, ****p < 0.0001 vs corresponding tissue of sham group. Per: perihematomal, Hip: hippocampus, Cor: cortex.

brain volume atrophy, we sacrificed mice by injecting an overdose of chloral hydrate on day 21 of the study period, and we obtained whole brains for Nissl staining. The results showed that brain volume atrophy was significantly increased in both the ICH group and the Fer-1 treatment group compared with the sham group (Fig. 7B, C). However, the volume was decreased in the Fer-1 group compared with the ICH group (Fig. 7B, C). In summary, Fer-1 exerts long-term neuroprotective effects by alleviating neurological deficits, restoring memory function and moderating brain atrophy after ICH.

3.4. Fer-1 treatment improved neurobehavioral outcomes and moderated brain atrophy in the long term after ICH in vivo To further identify whether Fer-1 showed a neuroprotective effect after ICH in vivo, we injected Fer-1 or vehicle intraoperatively and once daily thereafter for 21 days after ICH. To evaluate the effect of Fer-1 administration on neurological deficit induced by ICH in mice, we determined mNSS values at 1, 3, 7, 14, and 21 days after ICH. The results clearly indicated that Fer-1 treatment significantly decreased mNSS values compared to those of the vehicle-treated ICH mice (Fig. 7A). To evaluate the effect of Fer-1 treatment on short-term (1–6 days after ICH) and long-term (16–21 days after ICH) memory function of mice, we conducted two stages of learning and memory testing using the MWM. In both stages, mice in the sham group showed normal learning ability, as indicated by a rapid decrease in latency during the training phase (Fig. 7D, G). In the first stage, including both the training phase and the probe test phase, ICH mice treated with Fer-1 showed no significant difference in latency to reach the platform site or number of transits across the former platform site compared to ICH mice treated with vehicle (P > 0.05, Fig. 7D, F). In the second stage, ICH mice in the Fer-1 treatment group showed a significant reduction in latency at 19, 20 and 21 days after ICH compared with ICH mice that received vehicle treatment (Fig. 7G, H). Animals in the Fer-1 group also spend an increased amount of time in the target quadrant where the escape platform was located (Fig. 7I). These data suggest that Fer-1 has longterm restorative effects on memory function in ICH mice. To evaluate

4. Discussion Ferroptosis is a newly reported form of iron-dependent programmed cell death driven by lipid peroxidation (Stockwell et al., 2017). Emerging data have revealed that ferroptosis is involved in multiple biological and pathological processes, such as amino acid (Angeli et al., 2017) and iron metabolism (Dixon and Stockwell, 2014) as well as degenerative and neoplastic diseases (Cardoso et al., 2016; Korytowski et al., 2017). Research is now demonstrating that ferroptosis is an important form of cell death in pathological neurological processes such as neurodegenerative disease (Do Van et al., 2016), hemorrhagic stroke (Li et al., 2017), and traumatic brain injury (TBI) (Xie et al., 2018). Currently, there is a dearth of specific molecular markers to identify cells undergoing this process in vitro or in vivo (Hirschhorn and Stockwell, 2018; Xie et al., 2016). In the study of ferroptosis, monitoring methods rely mainly on measuring of cellular ROS and iron levels and the ability 129

Brain Research Bulletin 153 (2019) 122–132

B. Chen, et al.

Fig. 6. Ultrastructure of neurons in the perihematomal area, hippocampus and cortex of sham and 3 d post-ICH (intracranial hemorrhage) mice. Bar = 5 μm. White arrows indicate normal mitochondria; red arrows indicate shrunken mitochondria. Per: perihematomal, Hip: hippocampus, Cor: cortex.

region-related functional significance of ICH-induced ferroptosis, which would partially reveal the pathological mechanism of cognitive deficits in patients with ICH. By monitoring the time-course of intracellular iron concentration, MDA levels, total SOD activity and expression of COX-2 in perihematoma brain tissue, we found that these indicators were significantly changed in the acute phase of ICH. Therefore, we speculate that neuronal ferroptosis may occur in the acute stage of ICH. In further support of this hypothesis, we found shrunken mitochondria in neurons within the perihematomal brain tissue at 3 h after ICH. Similarly, using the above detection methods, we observed features of neuronal ferroptosis in hippocampal tissue. In cortical tissue, we failed to detect any significant changes in intracellular iron concentrations, MDA levels, total SOD activity or expression of COX-2; shrunken mitochondria were the only sign of ferroptosis detected. We failed to observe any ultrastructural features of neuronal ferroptosis in human ICH-affected tissue because brain tissue generally requires perfusion in preparation for TEM. These data indicated that even brain tissue at a distance from the hematoma was affected by ICH and shared features of ferroptosis. Fer-1 is a potent and selective small-molecule inhibitor of ferroptosis (Gaschler and Hu, 2018), it was shown to inhibit oxidative lipid damage and cell death in diverse disease models (Skouta et al., 2014), such as, neurodegeneration, acute kidney injury, and other degenerative conditions (Gaschler and Hu, 2018). It was also shown to inhibit embryo development–related ferroptosis by intraperitoneal injection of fer-1 (Jiang et al., 2015). Although, the structure-activity relationship of ferrostatins was significantly explored (Gaschler and Hu, 2018). In the central nervous system, less pharmacodynamic data of fer-1 is available in in vivo studies. Evidence suggests that inflammatory mechanisms are involved in the progression of ICH-induced brain injury (Wang and Dore, 2007), many inflammatory agents increase both endothelial permeability and vessel diameter, together contributing to significant leak across the blood–brain barrier (Abbott, 2000; Keep et al., 2012). Altogether, in the pathological condition of ICH, the concentration of fer-1 in the brain may increase. Recently, Li et al. and Zhang et al. showed the neuroprotective effect of Fer-1 after ICH by striatum or cerebral ventricle injection of and intraperitoneal injection,

of ferroptosis inhibitors (e.g., fer-1) to block cell death. TEM is also considered a sensitive and accurate way to monitor ferroptosis, both in vitro and in vivo (Xie et al., 2016). It should be mentioned that TEM may not easily to distinguish between shrunken mitochondria and fission mitochondria. Because various cross-sections of mitochondria coexisted in the same field of view. Moreover, mitochondria are metabolic organelles that actively transform their ultrastructure (Buck et al., 2016). Fortunately, the smaller size of the mitochondrial is not the only feature to describe ferroptotic cells. Ferroptotic cells shown small mitochondria with condensed mitochondrial membrane densities, reduction or vanishing of mitochondria crista, as well as outer mitochondrial membrane rupture in electron micrograph (Xie et al., 2016). ICH is a catastrophic brain event that is associated with high mortality, and patients who survive usually have major neurological impairments because of secondary brain injury (Keep et al., 2012). ROS accumulation and iron overload are considered major contributors to ICH-induced secondary brain injury (Keep et al., 2012; Xi et al., 2006). Ferroptosis is driven by a set of unique genes, including IREB2, CS, RPL8, ATP5G3, ACSF2, and PTGS2 (Dixon et al., 2012; Yang et al., 2014). Our present data and those of Li, Q. et al. showed that among ferroptosis related genes had been analyzed PTGS2 was the only upregulated gene in the ICH cell model (Li et al., 2017). We also observed that PTGS2 was significantly upregulated in ICH mice. In contrast, among a set of genes mentioned above, the only gene with elevated expression in ICH-affected human brain tissue was RPL8. These studies indicated that ferroptosis may be used as a therapeutic target after ICH. Moreover, ferroptosis inhibitors (e.g. Fer-1) mitigated hemin-induced primary cortical neuron death by > 80% in vitro (Zille et al., 2017). Similarly, Fer-1 and other specific ferroptosis inhibitors, as well as upregulation of the antioxidant enzyme glutathione peroxidase 4 (GPX4) ameliorated ICH-induced brain injury by mediating ferroptosis (Li et al., 2017; Zhang et al., 2018). In addition to specific inhibitors, selenium drives a transcriptional adaptive program to block neuronal ferroptosis and improve function after hemorrhagic or ischemic stroke (Alim et al., 2019). However, the spatial and temporal features of ferroptosis induced by ICH still need further clarification. Addressing the above questions may clarify the therapeutic time window and the 130

Brain Research Bulletin 153 (2019) 122–132

B. Chen, et al.

Fig. 7. Fer-1 showed a long-term neuroprotective effect. (A) Modified neurological severity score (mNSS) assessment in the Sham + Vehicle, Intracranial Hemorrhage (ICH) + Vehicle, and ICH + Fer-1 groups at 1, 3, 7, 14 and 21 days after ICH. Data are the mean ± SEM, n = 15 mice/group. *p < 0.05, **p < 0.01, ICH + Vehicle group vs ICH + Fer-1 group. (B) Nissl-stained sections were used to measure the volume atrophy at 21 days after ICH. The dashed circle indicates the ipsilateral side. (C) Ipsilateral volume atrophy was calculated. Data are shown as the mean ± standard error of the mean (SEM), n = 8–10 mice/group *p < 0.05, **p < 0.01 vs sham group. #p < 0.05 vs ICH + Vehicle. (D, E, F) The Morris water maze (MWM) was used to assess the neurocognitive status of the indicated groups at 1˜6 days after ICH. (D) Mean escape latency assessed during the acquisition trials, (E) latency during the probe test, and (F) number of transits across the escape platform during the probe test. Data are shown as the mean ± SEM, n = 15 mice/group. There was no significant difference between groups. (G, H, I) The MWM was used to assess neurocognitive status in mice 16–21 days after ICH. (G) Mean escape latency assessed during the acquisition trials, (H) latency during the probe test, and (I) time spent in the target quadrant where the escape platform was located. Data are shown as the mean ± SEM, n = 15 mice/group. *p < 0.05 vs Sham + Vehicle group, # p < 0.05 vs ICH + Vehicle group.

5. Conclusion

respectively. (Li et al., 2017; Zhang et al., 2018). Interestingly, Karuppagounder et al. reported that systemic administration of N-acetylcysteinean, a US Food and Drug Administration–approved cysteine prodrug, improved functional recovery by inhibiting ferroptosis (Karuppagounder et al., 2018). Next, to further investigate the role of Fer-1 in alleviating neurological deficits, memory function impairment, and brain atrophy after mouse ICH, we assessed mNSS values, tested learning and memory function in the MWM, and performed Nissl staining were performed. To model a typical clinical scenario, we administered Fer-1 3 h after ICH, rather than before ICH. Fer-1 exerted a long-term neuroprotective effect that included alleviating neurological deficits, restoring memory function and moderating brain atrophy after ICH. In this study, we tested mice only at the age of 8 weeks, although stroke incidence increases with age. Whether ferroptosis is affected by age in our ICH model needs to be clarified. Additionally, we examined only one cell type in brain; future studies need to address astrocytes, microglia, oligodendrocytes and their cross-talk. Furthermore, there is a pressing need to determine molecular markers that would identify cells undergoing ferroptosis.

In summary, our study demonstrated that ferroptosis may be involved in the pathological process of human ICH. Our data revealed that ferroptosis occurs in the acute phase of ICH and that neuronal ferroptosis is present in even in brain areas distant from the hematoma. A treatment strategy targeting ferroptosis should probably be implemented in the acute phase of ICH. Furthermore, Fer-1 showed a long-term neuroprotective effect. We believe that our novel findings will provide a vital foundation for ferroptosis-based ICH treatment in the future.

Ethics approval The use of human tissue in this study was approved by the Ethics Committee of Ruijin Hospital. All animal experiments were approved by the Institutional Animal Care and Use Committee of Shanghai Jiao Tong University, Shanghai, China. 131

Brain Research Bulletin 153 (2019) 122–132

B. Chen, et al.

Declaration of conflicting interests

Karuppagounder, S.S., Alin, L., Chen, Y., Brand, D., Bourassa, M.W., Dietrich, K., Wilkinson, C.M., Nadeau, C.A., Kumar, A., Perry, S., Pinto, J.T., Darley-Usmar, V., Sanchez, S., Milne, G.L., Pratico, D., Holman, T.R., Carmichael, S.T., Coppola, G., Colbourne, F., Ratan, R.R., 2018. N-acetylcysteine targets 5 lipoxygenase-derived, toxic lipids and can synergize with PGE2 to inhibit ferroptosis and improve outcomes following hemorrhagic stroke in mice. Ann. Neurol. 84, 854–872. Keep, R.F., Hua, Y., Xi, G., 2012. Intracerebral haemorrhage: mechanisms of injury and therapeutic targets. Lancet Neurol. 11, 720–731. Korytowski, W., Toyokuni, S., Ito, F., Yamashita, K., Okazaki, Y., Akatsuka, S., 2017. Iron and thiol redox signaling in cancer: an exquisite balance to escape ferroptosis. Cell Biochem. Biophys. 108, 610–626. Li, Q., Han, X., Lan, X., Gao, Y., Wan, J., Durham, F., Cheng, T., Yang, J., Wang, Z., Jiang, C., Ying, M., Koehler, R.C., 2017. Inhibition of neuronal ferroptosis protects hemorrhagic brain. JCI Insight 2, e90777. Linkermann, A., Skouta, R., Himmerkus, N., Mulay, S.R., Dewitz, C., De Zen, F., Prokai, A., Zuchtriegel, G., Krombach, F., Welz, P.S., Weinlich, R., Vanden Berghe, T., Vandenabeele, P., Pasparakis, M., Bleich, M., Weinberg, J.M., Reichel, C.A., Brasen, J.H., Kunzendorf, U., Anders, H.J., Stockwell, B.R., Green, D.R., Krautwald, S., 2014. Synchronized renal tubular cell death involves ferroptosis. Proc. Natl. Acad. Sci. U. S. A. 111, 16836–16841. Liu, Z.-Q., Mahmood, T., Yang, P.-C., 2014. Western blot: technique, theory and trouble shooting. N. Am. J. Med. Sci. 6 160–160. Matsushita, K., Meng, W., Wang, X.Y., Asahi, M., Asahi, K., Moskowitz, M.A., Lo, E.H., 2000. Evidence for apoptosis after intracerebral hemorrhage in rat striatum. J. Cereb. Blood Flow Metab. 20, 396–404. Qureshi, A.I., Mendelow, A.D., Hanley, D.F., 2009. Intracerebral haemorrhage. Lancet 373, 1632–1644. Rynkowski, M.A., Kim, G.H., Komotar, R.J., Otten, M.L., Ducruet, A.F., Zacharia, B.E., Kellner, C.P., Hahn, D.K., Merkow, M.B., Garrett, M.C., Starke, R.M., Cho, B.M., Sosunov, S.A., Connolly, E.S., 2008. A mouse model of intracerebral hemorrhage using autologous blood infusion. Nat. Protoc. 3, 122–128. Skouta, R., Dixon, S.J., Wang, J., Dunn, D.E., Orman, M., Shimada, K., Rosenberg, P.A., Lo, D.C., Weinberg, J.M., Linkermann, A., Stockwell, B.R., 2014. Ferrostatins inhibit oxidative lipid damage and cell death in diverse disease models. J. Am. Chem. Soc. 136, 4551–4556. Stockwell, B.R., Friedmann Angeli, J.P., Bayir, H., Bush, A.I., Conrad, M., Dixon, S.J., Fulda, S., Gascon, S., Hatzios, S.K., Kagan, V.E., Noel, K., Jiang, X., Linkermann, A., Murphy, M.E., Overholtzer, M., Oyagi, A., Pagnussat, G.C., Park, J., Ran, Q., Rosenfeld, C.S., Salnikow, K., Tang, D., Torti, F.M., Torti, S.V., Toyokuni, S., Woerpel, K.A., Zhang, D.D., 2017. Ferroptosis: a regulated cell death Nexus linking metabolism, redox biology, and disease. Cell 171, 273–285. Tang, G., Liu, Y., Zhang, Z., Lu, Y., Wang, Y., Huang, J., Li, Y., Chen, X., Gu, X., Wang, Y., Yang, G.Y., 2014. Mesenchymal stem cells maintain blood–brain barrier integrity by inhibiting aquaporin-4 upregulation after cerebral ischemia. Stem Cells 32, 3150–3162. Vorhees, C.V., Williams, M.T., 2006. Morris water maze: procedures for assessing spatial and related forms of learning and memory. Nat. Protoc. 1, 848–858. Wang, J., Dore, S., 2007. Inflammation after intracerebral hemorrhage. J. Cereb. Blood Flow Metab. 27, 894–908. Xi, G.H., Keep, R.F., Hoff, J.T., 2006. Mechanisms of brain injury after intracerebral haemorrhage. Lancet Neurol. 5, 53–63. Xie, B.S., Wang, Y.Q., Lin, Y., Mao, Q., Feng, J.F., Gao, G.Y., Jiang, J.Y., 2018. Inhibition of ferroptosis attenuates tissue damage and improves long-term outcomes after traumatic brain injury in mice. CNS Neurosci. Ther. 25, 465–475. Xie, Y., Hou, W., Song, X., Yu, Y., Huang, J., Sun, X., Kang, R., Tang, D., 2016. Ferroptosis: process and function. Cell Death Differ. 23, 369–379. Yang, W.S., SriRamaratnam, R., Welsch, M.E., Shimada, K., Skouta, R., Viswanathan, V.S., Cheah, J.H., Clemons, P.A., Shamji, A.F., Clish, C.B., Brown, L.M., Girotti, A.W., Cornish, V.W., Schreiber, S.L., Stockwell, B.R., 2014. Regulation of ferroptotic cancer cell death by GPX4. Cell 156, 317–331. Zhang, Z., Wu, Y., Yuan, S., Zhang, P., Zhang, J., Li, H., Li, X., Shen, H., Wang, Z., Chen, G., 2018. Glutathione peroxidase 4 participates in secondary brain injury through mediating ferroptosis in a rat model of intracerebral hemorrhage. Brain Res. 1701, 112–125. Zille, M., Karuppagounder, S.S., Chen, Y., Gough, P.J., Bertin, J., Finger, J., Milner, T.A., Jonas, E.A., Ratan, R.R., 2017. Neuronal death after hemorrhagic stroke in vitro and in vivo shares features of ferroptosis and necroptosis. Stroke 48, 1033–1043. Zille, M., Kumar, A., 2019. Ferroptosis in neurons and Cancer cells is similar but differentially regulated by histone deacetylase inhibitors. eNeuro 6 Published online February 15, 2019.

The authors do not have any conflicts of interests. Acknowledgments This work was supported by grants from the Science and Technology Commission of Shanghai Municipality (16ZR1421200) and from the Shanghai Jiao Tong University Medicine-Engineering Research Fund (YG2016MS58). We sincerely thank Professor Guoyuan Yang from the Neuroscience and Neuroengineering Research Center of SJTU for providing facilities and venues for the research. References Abbott, N.J., 2000. Inflammatory mediators and modulation of blood-brain barrier permeability. Cell. Mol. Neurobiol. 20, 131–147. Alim, I., Caulfield, J.T., Chen, Y., Swarup, V., Geschwind, D.H., Ivanova, E., Seravalli, J., Ai, Y., Sansing, L.H., Ste Marie, E.J., Hondal, R.J., Mukherjee, S., Cave, J.W., Sagdullaev, B.T., Karuppagounder, S.S., Ratan, R.R., 2019. Selenium drives a transcriptional adaptive program to block ferroptosis and treat stroke. Cell 177, 1262–1279. Angeli, J.P., Shah, R., Pratt, D.A., Conrad, M., 2017. Ferroptosis inhibition: mechanisms and opportunities. Trends Pharmacol. Sci. 38, 489–498. Beaudoin 3rd, G.M., Lee, S.H., Singh, D., Yuan, Y., Ng, Y.G., Reichardt, L.F., Arikkath, J., 2012. Culturing pyramidal neurons from the early postnatal mouse hippocampus and cortex. Nat. Protoc. 7, 1741–1754. Bobinger, T., Burkardt, P., Huttner, H.B., Manaenko, A., 2017. Programmed cell death after intracerebral hemorrhage. Curr. Neuropharmacol. 16, 1267–1281. Buck, M.D., O’Sullivan, D., Klein Geltink, R.I., Curtis, J.D., Chang, C.H., Sanin, D.E., Qiu, J., Kretz, O., Braas, D., van der Windt, G.J., Chen, Q., Ching-Cheng Huang, S., O’Neill, C.M., Edelson, B.T., Pearce, E.J., Sesaki, H., Huber, T.B., Rambold, A.S., Pearce, E.L., 2016. Mitochondrial dynamics controls t cell fate through metabolic programming. Cell 166, 63–76. Cardoso, B.R., Hare, D.J., Bush, A.I., Roberts, B.R., 2016. Glutathione peroxidase 4: a new player in neurodegeneration? Mol. Psychiatry 22, 328–335. Castillo, J., Davalos, A., Alvarez-Sabin, J., Pumar, J.M., Leira, R., Silva, Y., Montaner, J., Kase, C.S., 2002. Molecular signatures of brain injury after intracerebral hemorrhage. Neurology 58, 624–629. Dixon, S.J., Lemberg, K.M., Lamprecht, M.R., Skouta, R., Zaitsev, E.M., Gleason, C.E., Patel, D.N., Bauer, A.J., Cantley, A.M., Yang, W.S., Morrison 3rd, B., Stockwell, B.R., 2012. Ferroptosis: an iron-dependent form of nonapoptotic cell death. Cell 149, 1060–1072. Dixon, S.J., Stockwell, B.R., 2014. The role of iron and reactive oxygen species in cell death. Nat. Chem. Biol. 10, 9–17. Do Van, B., Gouel, F., Jonneaux, A., Timmerman, K., Gele, P., Petrault, M., Bastide, M., Laloux, C., Moreau, C., Bordet, R., Devos, D., Devedjian, J.C., 2016. Ferroptosis, a newly characterized form of cell death in Parkinson’s disease that is regulated by PKC. Neurobiol. Dis. 94, 169–178. Gaschler, M.M., Hu, F., 2018. Determination of the subcellular localization and mechanism of action of ferrostatins in suppressing ferroptosis. ACS Chem. Biol. 13, 1013–1020. He, Y., Wan, S., Hua, Y., Keep, R.F., Xi, G., 2008. Autophagy after experimental intracerebral hemorrhage. J. Cereb. Blood Flow Metab. 28, 897–905. Hirschhorn, T., Stockwell, B.R., 2018. The development of the concept of ferroptosis. Free Radic. Biol. Med 2018.09.043. Jiang, L., Kon, N., Li, T., Wang, S.J., Su, T., Hibshoosh, H., Baer, R., Gu, W., 2015. Ferroptosis as a p53-mediated activity during tumour suppression. Nature 520, 57–62. Karuppagounder, S.S., Alim, I., Khim, S.J., Bourassa, M.W., Sleiman, S.F., John, R., Thinnes, C.C., Yeh, T.L., Demetriades, M., Neitemeier, S., Cruz, D., Gazaryan, I., Killilea, D.W., Morgenstern, L., Xi, G., Keep, R.F., Schallert, T., Tappero, R.V., Zhong, J., Cho, S., Maxfield, F.R., Holman, T.R., Culmsee, C., Fong, G.H., Su, Y., Ming, G.L., Song, H., Cave, J.W., Schofield, C.J., Colbourne, F., Coppola, G., Ratan, R.R., 2016. Therapeutic targeting of oxygen-sensing prolyl hydroxylases abrogates ATF4-dependent neuronal death and improves outcomes after brain hemorrhage in several rodent models. Sci. Transl. Med. 8, 328ra329.

132