Interleukin-15-mediated inflammation promotes non-alcoholic fatty liver disease

Cytokine xxx (2016) xxx–xxx

Contents lists available at ScienceDirect

Cytokine journal homepage: www.journals.elsevier.com/cytokine

Interleukin-15-mediated inflammation promotes non-alcoholic fatty liver disease Yuneivy Cepero-Donates a, Grégory Lacraz a,b, Farnaz Ghobadi a, Volatiana Rakotoarivelo a, Sakina Orkhis a, Marian Mayhue a, Yi-Guang Chen c, Marek Rola-Pleszczynski a,e, Alfredo Menendez d,e, Subburaj Ilangumaran a,e, Sheela Ramanathan a,e,⇑ a

Division of Immunology, Departments of Pediatrics, Université de Sherbrooke, Sherbrooke, Québec, QC J1H 5N4, Canada Hubrecht Institute, University Medical Center, Utrecht, The Netherlands Department of Pediatrics, Max McGee National Research Center for Juvenile Diabetes, Medical College of Wisconsin, Milwaukee, USA d Department of Microbiology and Infectious Diseases, Université de Sherbrooke, Sherbrooke, Québec, QC J1H 5N4, Canada e CRCHUS, Sherbrooke, Québec, QC J1H 5N4, Canada b c

a r t i c l e

i n f o

Article history: Received 11 October 2015 Received in revised form 26 January 2016 Accepted 27 January 2016 Available online xxxx Keywords: Interleukin-15 NAFLD Mice Liver Inflammation

a b s t r a c t Interleukin-15 (IL-15) is essential for the homeostasis of lymphoid cells particularly memory CD8+ T cells and NK cells. These cells are abundant in the liver, and are implicated in obesity-associated pathogenic processes. Here we characterized obesity-associated metabolic and cellular changes in the liver of mice lacking IL-15 or IL-15Ra. High fat diet-induced accumulation of lipids was diminished in the livers of mice deficient for IL-15 or IL-15Ra. Expression of enzymes involved in the transport of lipids in the liver showed modest differences. More strikingly, the liver tissues of IL15-KO and IL15Ra-KO mice showed decreased expression of chemokines CCl2, CCL5 and CXCL10 and reduced infiltration of mononuclear cells. In vitro, IL-15 stimulation induced chemokine gene expression in wildtype hepatocytes, but not in IL15Ra-deficient hepatocytes. Our results show that IL-15 is implicated in the high fat diet-induced lipid accumulation and inflammation in the liver, leading to fatty liver disease. Ó 2016 Published by Elsevier Ltd.

1. Introduction With the worldwide increase in the incidence of obesity, nonalcoholic fatty liver disease (NAFLD) is emerging as one of the most prevalent disorder of the liver [1–3]. NAFLD is mainly asymptomatic but has a wide pathological spectrum ranging from ‘simple’ steatosis to non-alcoholic steatohepatitis (NASH), which can progress to cirrhosis [4,5]. The main predisposing factors to NAFLD are obesity, diabetes, hyperlipidemia, and hypertension. Fat accumulation increases the susceptibility of the liver to factors that promote inflammation thereby precipitating NASH [6]. These factors include cytokine overproduction, lipid peroxidation, hepatocyte organelle (particularly mitochondria) malfunction and Abbreviations: NAFLD, non-alcoholic fatty liver disease; IHL, intrahepatic lymphocytes; NASH, non-alcoholic steatohepatitis; PPAR, peroxisome proliferatoractivated receptor; ER, endoplasmic reticulum. ⇑ Corresponding author at: Immunology Division, Department of Pediatrics, Faculty of Medicine and Health Sciences, Université de Sherbrooke, 3001 North 12th Avenue, Sherbrooke, QC J1H 5N4, Canada. E-mail address: [email protected] (S. Ramanathan).

peroxisome proliferator-activated receptor (PPAR) dysfunction in the nucleus [5]. In the context of insulin resistance, the development of NAFLD depends on the interaction between the liver and peripheral tissues, including the skeletal muscle and adipose tissues, but the molecular mechanism is not fully elucidated. In insulin-resistant subjects, increased lipolysis in the adipose tissues increases the circulating free-fatty acids that are incorporated into hepatic triglyceride [7]. De novo hepatic lipogenesis is also upregulated by the activation of several lipogenic transcription factors, including sterol regulatory element-binding protein 1c [8]. Free fatty acid toxicity has been partially explained by endoplasmic reticulum (ER) stress and apoptosis induced by metabolites, including ceramides and diacyglycerols. ER stress as well as serum-free fatty acids, cytokines, etc., can activate c-Jun N-terminal kinase 1 (JNK1), which phosphorylate insulin receptor substrate 1 (IRS1) at an inhibitory site, and induce proinflammatory cytokines in target cells such as macrophages leading to insulin resistance [9]. NASH and insulin resistance are extensively related to a cytokine imbalance towards proinflammatory microenvironment in the liver. Bacteria translocated

http://dx.doi.org/10.1016/j.cyto.2016.01.020 1043-4666/Ó 2016 Published by Elsevier Ltd.

Please cite this article in press as: Y. Cepero-Donates et al., Interleukin-15-mediated inflammation promotes non-alcoholic fatty liver disease, Cytokine (2016), http://dx.doi.org/10.1016/j.cyto.2016.01.020

2

Y. Cepero-Donates et al. / Cytokine xxx (2016) xxx–xxx

from the intestines, fatty acids derived from the diet and lipolysis in adipose tissue activate toll-like receptors (TLRs) in the liver, resulting in the activation of the cells of the innate immune system [10]. In NAFLD, proinflammatory cytokines such as TNFa activate the liver-resident macrophages, Kupffer cells (KC) [11], and their inactivation prevents the development of alcoholic fatty liver and NAFLD [5]. Furthermore, other immune cells in the liver such as NK and NKT cells contribute to the inflammatory process [12]. Interleukin-15 (IL-15) belongs to the cc family of cytokines [13]. The IL-15 receptor (IL-15R) complex consists of 3 subunits: the ligand-binding IL-15Ra chain (CD215), the b chain (CD122; also used by IL-2), and the common chain (cc – CD132; used by all IL2 family cytokines) [14]. The biological activities of IL-15 are mostly mediated by the IL-15:IL-15Ra complex, produced by the same cell and ‘trans-presented’ to responder cells expressing IL15Rbcc [15,16]. IL-15 is well characterized as a growth factor for T lymphocytes and also influences many other immune cells [17,18]. Notably, IL-15 promotes the survival of memory CD8+ T cells [19]. IL-15 also promotes the generation and maintenance NK cells, NKT cells, cd T cells and certain T cell subsets in the gut [20,21]. IL-15 enhances survival of DCs and macrophages, and activates them to produce cytokines that facilitate a robust immune response [22–24]. The above-mentioned cell types are present in the liver in abundance [25] and influence the course of NAFLD [26,27]. In this study we show that absence of IL-15 or IL-15Ra prevents the development of NAFLD in mice.

2. Materials and methods 2.1. Mice

2.4. Isolation of intrahepatic lymphocytes (IHL) and flow cytometric analyses At sacrifice, the livers were collected and rinsed with Krebs–Ri nger–Buffer (KRB, 154 mM NaCl, 5.6 mM KCl, 5.5 mM Glucose, 20.1 mM HEPES, 25 mM NaHCO3, pH 7.4). The liver tissues were digested in pre-warmed (37 °C) KRB supplemented with 2 mM CaCl2, 2 mM MgCl2, 300 CDU (casein digestion units)/mL Collagenase IV (Worthington) and 150 U/mL DNase I (Sigma) using gentle MACS Dissociator (Miltenyi Biotec) according to the instruction of the manufacturer. The homogenized liver samples were gently agitated on a rocking shaker for 30 min at room temperature. The tubes were left on a stand for 1 min to precipitate undigested liver tissue and the supernatants were passed through 40 lm cell strainer. Cells were resuspended in 25 ml of cold PEB buffer (0.5% Bovine serum albumin and 2 mM EDTA in Phosphate buffered saline (PBS)) and centrifuged at 50g for 5 min at 4 °C to eliminate contaminating hepatocytes. The supernatant was centrifuged at 300g for 10 min at 4 °C to collect the lymphocytes for FACS analysis [28]. Data was acquired on FACSCanto flow cytometer (BD Biosciences San Diego, CA) and was analysed using FlowJo software from TreeStar Inc (Ashland, OR). 2.5. Isolation and stimulation of primary hepatocytes Primary hepatocytes isolation was carried out in 6–8 weeks-old mice as described previously [29]. Primary hepatocytes were starved overnight in DMEM-F12 with 0.1% FCS and stimulated with hIL-15 (20 ng/ml) for 12 h. Subsequently, the cells were washed twice and RNA extraction was performed. 2.6. Assessment of mitochondrial respiration in hepatocytes

/

Wild type (WT) C57BL/6 mice were from Charles River. Il15 mice have been already described [28]. Il15ra / mice were purchased from Jackson Laboratory and bred into C57BL/6 background for more than ten generations. Mice were maintained in filtertopped cages in a specific pathogen-free facility and fed with standard chow diet and water unless specified otherwise. Only male mice were used in this study. All experiments were carried out with the approval of the institutional ethics committee.

2.2. Reagents Abs against mouse CD3, CD8a, CD4, CD44, CD62L, NK1.1 conjugated to flurochromes were purchased from eBioscience (San Diego, CA), BD Biosciences (San Jose, CA) or Biolegend (San Diego, CA). Mouse CD1d tetramer pre-loaded with PBS57 (an a –GalCer analog – which work the same way as a – GalCer; CD1dPBS57) conjugated to PE was obtained from NIH tetramer core facility. Recombinant hIL-15 was obtained from R&D systems. Tissue culture media and FCS were obtained from Sigma.

2.3. Induction of NAFLD in mice To induce hepatic steatosis, 8-weeks old WT, Il15 / and Il15ra / mice, were maintained on high fat diet (HFD) (Research Diets, New Brunswick, NJ, USA; D12492: 20%kcal protein, 20% carbohydrate and 60% fat). Mice fed with normal control diet (NCD) were used as controls. Mice were maintained on NCD or HFD for 16 weeks before sacrifice. The weight of liver was measured at sacrifice. Aliquots of tissues were stored in formalin for histology, in OCT for immunohistochemistry and snap frozen in liquid nitrogen for RNA and protein extraction.

The assays using Seahorse XF extracellular flux analyzer were carried out following the manufacturer’s instructions. To determine how IL-15 deficiency changes the capacity of hepatocytes to oxidize FAs, we used the XF Palmitate–Bovine serum albumin (BSA) Fatty Acid Oxidation (FAO) substrate according to company’s protocol. Palmitate-BSA FAO integrates the XF Cell Mito Stress Test with the BSA Control and XF Palmitate reagent. Primary hepatocytes were isolated as described in Section 2.4 and seeded in a 96 well plate. The day before the assay, the growth medium was exchanged for substrate-limited medium (DMEM, 0.5 mM Glucose, 1.0 mM GlutaMAXTM (life technologies), 0.5 mM carnitine and 1% FCS) and incubated ON. Next, cells were kept in FAO medium (Krebs–Henseleit Buffer (KHB) with 2.5 mM glucose, 0.5 mM carnitine and 5 mM HEPES) for 45 min and BSA control or Palmitate-BSA substrate was added. XF Cell Mito Stress Test analysis was performed. 2.7. Histology At sacrifice, livers were fixed in formalin. Some tissue sections were kept frozen in OCT for immunohistochemistry or lipids staining. Lipid staining was carried out on tissue samples fixed in OCT using Sudan Black, a basic dye that combine with acidic groups in lipids compound, including phospholipids. The slides were washed in water and mounted with aqueous mounting media (VectaMountTM). Images were taken using automatic tissue slide scanning (Hamamatsu NanoZoomer Digital Pathology (NDP) system). 2.8. Quantitative PCR Snap-frozen liver samples were homogenized in TRIzolÒ (Life Technologies) using mixer mill MM 400 (Retsch, Hann, Germany).

Please cite this article in press as: Y. Cepero-Donates et al., Interleukin-15-mediated inflammation promotes non-alcoholic fatty liver disease, Cytokine (2016), http://dx.doi.org/10.1016/j.cyto.2016.01.020

3

Y. Cepero-Donates et al. / Cytokine xxx (2016) xxx–xxx Table 1 Sequence of primers used in this study. Gene

Sense

Anti-sense

36B4 Ppara Cd36 Cpt1a Acadm Pparg Pgc1a Cox4i1 Tnfa iNos F4/80 Cd68 Ccl5 Ccl2 Cxcl10

TCTGGAGGGTGTCCGCAAC CGGGAACAAGACGTTGTCAT TTG TAC CTA TAC TGT GGC TAA ATG AG CATCCCAGGCAAAGAGACA TGT CGA ACA CAA CAC TCG AAA TGC TGT TAT GGG TGA AAC TCT G CCC TGC CAT TGT TAA GAC C TCACTGCGCTCGTTCTGAT CGTCGTAGCAAACCACCAAG AATCTTGGAGCGAGTTGTGG CTTTGGCTATGGGCTTCCAGTC CTTCCCACAGGCAGCACAG TGCAGAGGACTCTGAGACAGC CAGGTCCCTGTCATGCTTCT CCAAGTGCTGCCGTCATTTTC

CTTGACCTTTTCAGTAAGTGG CAGATAAGGGACTTTCCAGGTC CTT GTG TTT TGA ACA TTT CTG CTT AAGCGACCTTTGTGGTAGACA CTG CTG TTC CGT CAA CTC AA CTG TGT CAA CCA TGG TAA TTTC TT TGC TGC TGT TCC TGT TTT C CGATCGAAAGTATGAGGGATG GAGATAGCAAATCGGCTGACG CAGGAAGTAGGTGAGGGCTTG GCAAGGAGGACAGAGTTTATCGTG AATGATGAGAGGCAGCAAGAGG GAGTGGTGTCCGAGCCATA GTGGGGCGTTAACTGCAT GGCTCGCAGGGATGATTTCAA

The cultured hepatocytes were directly lysed in TRIzolÒ. The first strand was synthesized from 1 lg total RNA using QuantitectÒ (Qiagen, Mississauga). The selected primers were examined for the efficiency and melting curve. Primers’s sequences are shown in Table 1. Quantitative PCR analysis was carried out using MyQi5Ò cycler (Bio-Rad) using SYBR Green Supermix (Bio-Rad). Fold induction was calculated based on the expression of the housekeeping gene 36B4, as the internal control and WT mice on NCD as the control group for all in vivo experiments. For in vitro experiments, we used the same housekeeping gene and the controls were nonstimulated primary cells from WT mice. 2.9. Statistical analysis Statistical analyses were performed using GraphPad Prism 6 software. The values are presented as mean ± standard error of the mean. The statistical significance (p value) was calculated by non-parametric comparison between two groups (Mann Whitney test) or two-way ANOVA with Tukey’s multiple comparisons test. 3. Results 3.1. IL-15 and IL-15Ra deficiency prevent hepatic steatosis We examined the role of IL-15 in the development of hepatic steatosis in mice maintained on HFD. To this end, aged-matched wild type, Il15 / and Il15ra / mice were fed either NCD or HFD for 16 weeks. High-fat diets are widely used to promote hepatic steatosis and NASH in rodents [30]. We first evaluated whether HFD induced fat accumulation in the liver. While the weight of livers of WT mice maintained on HFD was significantly higher when compared to that of WT mice maintained on NCD (Fig. 1A), IL-15 and Il-15Ra deficient mice exhibited no such increase. The increased weight in the control mice maintained on HFD was possibly the result of an increase in the lipid content in the liver. Livers from WT mice fed with NCD exhibited normal hepatic architecture whereas the livers from HFD fed mice, revealed extensive steatosis (Fig. 1B left, top). Frozen liver sections stained with Sudan Black showed an increased lipid deposition in the parenchyma of livers from WT mice maintained on HFD (Fig. 1B right, top). However, liver sections from IL-15 or IL-15Ra deficient mice maintained on HFD did not show steatosis and showed minimal increase in Sudan Black staining compared to mice of the same genotype maintained on NCD (Fig. 1B middle and bottom). These results suggest that the absence of IL-15 prevents the accumulation of lipids in the liver of mice maintained on HFD regimen.

3.2. IL-15 suppresses mitochondrial respiration in mouse primary hepatocytes The above results showed that Il15 / and Il15ra / mice were relatively resistant to diet-induced fat accumulation in the liver. Therefore, we studied the possible role of IL-15 in the regulation of metabolism in the liver. We examined the expression of transcription factors that are implicated in obesity-related pathologies. PPARs are ligand-dependent transcription factors and three members of this family have been identified, namely PPARa, PPARb/d, and PPARc [31]. PPARc is the master regulator of adipogenesis, since it regulates the transcription of a wide number of genes involved in cellular differentiation and lipid accumulation [31]. PPARc coactivator 1-alpha (PGC1a), permits the interaction of PPARc protein with multiple transcription factors, and has been related to metabolic dysfunction in mitochondria [32]. On the other hand, it has been shown that Ppara deficiency is related to the development of liver pathologies in different contexts [33]. Our results showed that induction of Ppara mRNA was significantly higher in WT than in Il15 / mice maintained on HFD, while Pparg levels were increased in Il15 / mice (Fig. 2A). Although the expression of Pgc1a also showed a tendency to be increased in Il15 / mice following HFD, it was not statistically significant. These results indicated that the induction of Pparg gene by HFD in the liver is dependent on the availability of IL-15. To verify whether IL-15 has a role in fatty acid (FA) metabolism, we evaluated the expression of FA transporters and the proteins that regulate lipid metabolism in the liver. We observed that the expression of Cd36, the transporter of lipids across the plasma membrane, was significantly increased in WT mice compared to IL-15 or IL-15Ra deficient mice (Fig. 2A). The expression of genes involved in the transport of fatty acids across the mitochondrial membrane hepatic carnytyl palmitoyl transferase – Cpt1a) and their breakdown (Acadm) was increased in mice maintained on HFD, but the differences between WT and IL-15 or IL-15Ra deficient were not significant (Fig. 2A). These observations suggest that IL-15 signalling regulates metabolic processes in the liver and particularly, the cellular uptake of FAs. Oxidation of fatty acid is a metabolic process that takes place in mitochondria. Hence, a potential increase in mitochondrial activity can also increase fat utilization. Changes in substrate utilization and reduced mitochondrial respiratory capacity following exposure to HFD are the key components in the development of obesity-related metabolic disease [34]. Since oxidative metabolism is a key pathway for FA degradation, we evaluated oxygen consumption in primary hepatocytes isolated from WT Il15 / and

Please cite this article in press as: Y. Cepero-Donates et al., Interleukin-15-mediated inflammation promotes non-alcoholic fatty liver disease, Cytokine (2016), http://dx.doi.org/10.1016/j.cyto.2016.01.020

4

Y. Cepero-Donates et al. / Cytokine xxx (2016) xxx–xxx

Fig. 1. Lipid accumulation in the liver is decreased in the absence of IL-15 or IL-15Ra. (A) Liver weight was measured in mice maintained on either normal control diet (NCD) or high fat diet (HFD) for 16 weeks. Values are expressed as mean ± SD. Mann Whitney test N = 8 per group; p < 0.01(⁄⁄), p < 0.001(⁄⁄⁄), ns (not significant). (B) Sections of liver tissues collected from the indicate mice maintained on NCD or HFD for 16 weeks were stained with Sudan Black. Representative images from at least 4 mice for each group are shown. Magnification 10.

Il15ra / mice in the presence of exogenous palmitate. We observed that palmitate supplementation did not increase the oxygen consumption rate in hepatocytes from WT and Il15ra / mice, but hepatocytes from Il15 / showed a significant increase in oxygen consumption rate (OCR) (Fig. 2B). Collectively, the above results indicate that endogenous IL-15 attenuates FA oxidation in hepatocytes leading to fat accumulation in the liver. 3.3. HFD promotes infiltration of leukocytes in the liver Inflammatory macrophages have been implicated in the context of obesity and NAFLD. Their infiltration in different tissues is associated with insulin resistance, type 2 diabetes and other complications of metabolic syndrome and obesity [35,36]. The expression of Cd68 and F4/80 that are markers of macrophages, was increased in the liver of HFD-fed WT mice (Fig. 3A). Similarly, the total number of leukocytes infiltrating the obese liver was increased by 8–10fold (Fig. 3B). As a consequence, even if the frequency of CD4+ and CD8+ T cell subsets were not different, their numbers were increased by 5-fold. Interestingly, within the CD8+ subset, the frequency of CD44hiCD62Llo cells that represent the memory subset was increased in mice maintained on HFD (Fig. 3B). Within the IL-15 dependent innate lymphoid subsets, the frequency of NK and NKT cells were comparable in the livers of mice maintained on NCD and HFD. However, their absolute numbers were increased in mice maintained on HFD (Fig. 3C). NKT cells can be divided into

two groups: type I NKT cells, which express an invariant TCR (Va14/Ja18) and are readily detectable by a-galactosylceramide analog loaded CD1d tetramers (CD3+ CD1d-PBS57 tetramer+ NK1.1+), and type II NKT cells which express a more diverse Tcell receptor repertoire (CD3+ NK1.1+) and cannot be directly identified [37]. The frequency of NKT cells expressing the invariant chain was significantly decreased in the IHL, while their numbers were slightly elevated in mice maintained on HFD. As there was no significant difference observed in the spleen of the same animals, these results suggest that the inflammatory environment of the livers of mice maintained on HFD might have promoted the expansion of these cells in situ. On the other hand, the livers of IL-15KO mice maintained on HFD showed minimal differences in CD4+ or CD8+ T cells (Fig. 4; data not shown). As expected NK, NKT and iNKT cells were barely detected in the livers of IL-15 deficient mice (Fig. 4). 3.4. HFD induces the expression of chemokines in the liver in an IL-15dependent manner The increase in the infiltration of macrophages, T cells, NK and NKT cells suggested that the fatty liver might be a source of proinflammatory mediators and chemokines that can mediate the recruitment of immune cells. While the expression of Tnfa and iNos was significantly increase in WT mice maintained on HFD, the increase was not observed in the in the livers of IL-15-deficient

Please cite this article in press as: Y. Cepero-Donates et al., Interleukin-15-mediated inflammation promotes non-alcoholic fatty liver disease, Cytokine (2016), http://dx.doi.org/10.1016/j.cyto.2016.01.020

Y. Cepero-Donates et al. / Cytokine xxx (2016) xxx–xxx

5

Fig. 2. Expression of genes involved in metabolism in the livers of Il15 / and Il15ra / mice maintained on HFD. (A) The expression of Pparg, Pgc1a, Ppara, Cd36, Cpt1a and Acadm and (B) fatty acid oxidation in hepatocytes from WT and Il15 / primary hepatocytes was assessed following the addition of palmitate-BSA or BSA. Seahorse mitochondrial stress test was performed according to manufacturer’s instructions. Data is represented as mean ± SD of 12 values obtained from 2 independent experiments. Mann Whitney test; p < 0.05(⁄). (C) Cox4i1 genes in livers from WT, Il15 / and Il15ra / mice maintained on NCD or HFD for 16 weeks was evaluated by qRT-PCR. Values are expressed as the means ± SD. Mann Whitney test N = 4; p < 0.05(⁄), p < 0.01(⁄⁄), ns = not significant.

mice maintained on HFD (Fig. 5A). Similarly, the expression of chemokines revealed an increase in the expression of Ccl2, Cxcl10 and Ccl5 in the livers of WT mice maintained on HFD (Fig. 5B). However, these increases were not observed in the livers of IL-15 and IL-15Ra deficient mice maintained on HFD (Fig. 5B), suggesting that signalling through IL-15 upregulates the expression of chemokines in response to HFD. To determine whether the upregulation of chemokines was the consequence of the direct effect of IL-15 on hepatocytes, primary hepatocytes isolated from WT and IL-15Ra deficient mice were stimulated with IL-15 and the expression of mRNA for chemokines were analysed by qRT-PCR. Exogenous IL-15 increased the expression of chemokines in hepatocytes from WT mice but not in the hepatocytes from IL15Ra deficient mice (Fig. 5C). These observations suggest that IL15 induces the expression of chemokines in hepatocytes.

4. Discussion IL-15 is implicated in the pathogenesis of different autoimmune diseases like rheumatoid arthritis, type 1 diabetes and inflammatory bowel disease [38–40]. In this study we demonstrate a pathogenic role for IL-15 in NAFLD. IL-15 can act on lymphocytes, myeloid cells and on non-hematopoietic cells [13]. Our results show that absence of IL-15 decreases the accumulation of fat, inflammation and recruitment of immune cells in mice maintained on HFD. IL-15 also directly acts on hepatocytes to induce the expression of chemokines that may be responsible for the recruitment of immune cells. An increase in circulating non-esterified fatty acids (NEFA) can contribute to NAFLD development in obese subjects. Triacylglycerol (TG) stored in adipose tissue is hydrolyzed to NEFA and

Please cite this article in press as: Y. Cepero-Donates et al., Interleukin-15-mediated inflammation promotes non-alcoholic fatty liver disease, Cytokine (2016), http://dx.doi.org/10.1016/j.cyto.2016.01.020

6

Y. Cepero-Donates et al. / Cytokine xxx (2016) xxx–xxx

Fig. 3. HFD increases the total number of intra-hepatic leucocytes. (A) The expression of F4/80 and CD68 was determined by qRT-PCR in the samples detailed in Fig. 2. (B and C) Mice were maintained on NCD (N) or HFD (H) for 16 weeks and IHLs were isolated. The phenotype of the lymphocytes from one representative mouse from each group is shown. The graphs represent the average frequency and the total cell numbers of the indicated subset. (B) T cell subsets; (C) NK, NKT and iNKT subsets. The total number of lymphocytes was determined in each experiment and the cell number for each subset was calculated. Data are pooled from three independent experiments (mean ± SD). Mann Whitney test, p < 0.05(⁄), p < 0.01(⁄⁄), p < 0.001(⁄⁄⁄).

transported to target tissues for utilization. NEFAs from adipose tissue can be used as an energy source by many tissues, including liver and skeletal muscles. In hepatocytes, their fate differs

depending on energy needs, hormone balance and substrate availability, i.e. they can be re-packaged into TGs and exported as very low density lipoproteins (VLDL), stored within the liver, or

Please cite this article in press as: Y. Cepero-Donates et al., Interleukin-15-mediated inflammation promotes non-alcoholic fatty liver disease, Cytokine (2016), http://dx.doi.org/10.1016/j.cyto.2016.01.020

Y. Cepero-Donates et al. / Cytokine xxx (2016) xxx–xxx

7

Fig. 4. NK, NKT and iNKT cells are not present in the liver of IL-15 deficient mice. Il15 / mice were maintained on NCD (N) or HFD (H) for 16 weeks and IHLs were isolated. The phenotype of the lymphocytes from one representative mouse from each group is shown as described in Fig. 3. Four mice per group were analysed.

converted to ketones [41]. The excess of TG produced in the liver are stored as fat within hepatocytes, leading to lipid deposition observed in fatty liver diseases [42]. The increased microvesicular and macrovesicular fat deposition in the liver parenchyma of WT mice after HFD, but not in Il15 / or Il15ra / mice indicates that IL-15 promotes lipid deposition in the liver under dietary conditions that promote obesity. Day and James have proposed that while lipid deposition in the liver is the first of the 2 ‘hits’ needed for NASH development, the second hit represents all the factors that contributes to liver inflammation [6]. Our results show that IL-15 promotes dietinduced NAFLD by modulating lipid metabolism as well as by perpetuating the inflammatory responses in the liver. Lipid metabo-

lism is controlled by different transcription factors. These include factors that regulate lipid storage and utilization, namely Pparg and Ppara [43]. Previous reports showed that hepatocyte- or macrophage-specific deletion of Pparg protects mice against dietinduced hepatic steatosis, suggesting a pro-steatotic role of PPARc in parenchymal and non-parenchymal cells [44]. Therefore, the reduced Pparg expression in the liver of IL-15 deficient mice on HFD could contribute, at least in part, to the reduced hepatic lipid storage in these mice. In contrast to Pparg, Ppara expression is increased in the livers of IL-15 deficient mice under HFD regimen, suggesting a possible increase in fatty acid oxidation [45]. Methionine choline-deficient diet results in liver injury similar to human NASH. Ppara deficient mice fed with this diet develop

Please cite this article in press as: Y. Cepero-Donates et al., Interleukin-15-mediated inflammation promotes non-alcoholic fatty liver disease, Cytokine (2016), http://dx.doi.org/10.1016/j.cyto.2016.01.020

8

Y. Cepero-Donates et al. / Cytokine xxx (2016) xxx–xxx

Fig. 5. Expression of markers of inflammation and chemokines is reduced in the livers of Il15 / and Il15ra / mice maintained on HFD. The expression Tnfa and iNos (A) and chemokine (B) genes were evaluated in liver samples from WT, Il15 / and Il15ra / mice that were maintained on HFD or NCD for 16 weeks. Values are expressed as the means ± SEM. Mann Whitney test N = 4; p < 0.05(⁄), p < 0.01(⁄⁄), ND = not done. (C) Primary hepatocytes isolated from WT and Il15ra / mice were cultured with or without 20 ng/ml of IL-15 for 72 h. The expression the indicated genes were evaluated. Values are expressed as the means ± SEM from 3 independent experiments. Tukey’s multiple comparisons test; p < 0.05(⁄), ns, not significant.

severe hepatic steatosis and steatohepatitis. Consequently, PPARa agonist treatment reverses steatohepatitis in mice with established NASH [45]. Hence, increased Ppara expression in the liver of IL-15 KO mice on HFD, could act in synergy with reduced Pparg expression and prevent hepatic fat deposition. Hepatic steatosis can be a consequence of increased lipid synthesis, impairment in fatty acid oxidation and/or lipid uptake, via overexpression of the FAs transporters. CD36 is a plasma membrane lipid transporter is under the transcriptional control of PPARc, and has been related to fat accumulation in the liver [43]. The lower level of Cd36 expression in Il15 / mice compared to WT mice, suggests that IL-15 promotes FA intake by liver cells. Within cells, FAs are catabolized by b-oxidation mainly in the mitochondria and also in peroxisomes to generate energy. The genes encoding enzymes involved in the beta-oxidation pathway in liver are transcriptionally regulated by PPARa. Cpt1a is a key enzyme in the carnitine-dependent FA transport across the mitochondrial inner membrane and its deficiency results in a decreased

rate of FA b-oxidation [46]. The higher basal level of Cpt1a in IL-15 KO mice suggests that IL-15 attenuates FA oxidation in the liver at the level of FA import into the mitochondria. Thus, in the absence of IL-15 oxidative metabolism may be increased. Collectively our results show that IL-15 deficiency attenuates the HFD-induced expression of genes involved in lipid uptake (Pparg, Cd36), but enhances the expression of genes implicated in lipid utilization (Ppara) and FA transport into mitochondria (Cpt1a) as well as mitochondrial beta-oxidation. IL-15 has been extensively studied as an inflammatory cytokine, critical for the development, homeostasis and functioning of the cells of the innate and adaptive immune system [47,48]. Besides phagocytic cells, IL-15 is also produced by the liver, hepatocytes cell lines and by hepatoma cell lines [49,50]. Additionally, in agreement with a pathogenic role of IL-15 in obesity, circulating levels of IL-15 are increased in obese insulin resistant subjects and decreased after weigh loss [51]. In contrast to the above studies and our own findings, Barra et al., found that Il15 / mice exhibit

Please cite this article in press as: Y. Cepero-Donates et al., Interleukin-15-mediated inflammation promotes non-alcoholic fatty liver disease, Cytokine (2016), http://dx.doi.org/10.1016/j.cyto.2016.01.020

Y. Cepero-Donates et al. / Cytokine xxx (2016) xxx–xxx

higher amounts of body fat than control mice [52]. Although the reasons for these completely contradictory conclusions are unclear, it is noteworthy that Barra et al., observed the antiobesity effect of IL-15 in female IL-15 KO mice fed with NCD, whereas we observed the pro-obesity role of IL-15 in male IL-15 KO mice fed with HFD. As both mice strains are in C57BL/6 background, a possible explanation for these different findings could be the gender of the mice, the food regimen used, and influence by the gut microbiota. Nonetheless in vitro data on isolated primary hepatocytes strongly support a pro-obesity role of IL-15, at least under conditions of excess dietary fat. Healthy liver contains large number of macrophages and lymphocytes that include not only NK and NKT cells but also CD4+ and CD8+ T cells [53]. In pathological conditions, there is an increase in lymphocytes in the liver parenchyma. While the frequencies of CD4+ and CD8+ T cell populations are not modified in the liver of WT mice after HFD, their total numbers are significantly increased as a consequence of lipid-rich diet (Fig. 3). T cells are critical to the progression of liver disease, even though their antigen specificity is not known [54]. The increase in effector CD8+ T cells (CD44hiCD62Llo) in the liver, but not in the spleen of WT mice fed with HFD (Fig. 3) suggests that under the experimental conditions of HFD-induced liver pathologies, liver-derived neo-antigens might activate CD8+ IHL. Alternatively, it is possible that these CD8+ T cells with activated phenotype are terminally differentiated effector cells that die in the liver by apoptosis [55]. Nevertheless, HFD promotes the infiltration of activated CD8+ T cells in the liver and these cells, in turn, can contribute to the inflammatory process. Given that HFD induces Il15 gene expression in the liver and that IL-15 is implicated in the homeostatic expansion of CD8+ T cells with memory phenotype in general including liver [56], the reduction of these cell types in the liver is a direct consequence of IL-15 deficiency (Fig. 4). The increase in the total numbers of NK and NK T cells in the liver may be the consequence of the increase in the inflammatory response (Fig. 3). As they are IL-15 dependent, they are absent in IL-15 deficient mice (Fig. 4). In human subjects, hepatic NK cells were higher in NASH, but in established NAFLD their numbers were reduced [57]. In the pathogenesis of NAFLD, hepatic NK cells may have two different roles. First, an anti-fibrotic effect mediated by the elimination of hepatic stellate cells and second, activated NK cell-mediated killing of hepatocytes and cholangiocytes via TRAIL (tumor necrosis factor-related apoptosis-inducing ligand) [5]. On the other hand, a protective role has been proposed for NKT cells NAFLD [37,58–61]. As these cells are absent in the livers of IL15 deficient mice, it is evident that the protective effect of the absence of IL-15 cannot be attributed to these cell types. Rather, the protective effect may be due a general reduction in the recruitment/maintenance of immune cells in the absence of IL-15. One of the striking observations is that in IL-15 deficient mice, upregulation of chemokines was not observed in the liver following HFD regimen (Fig. 5). Infiltration of immune cells to the site of inflammation (here the liver) is initiated by the expression of a variety of chemokines [62]. For example, in alcoholic hepatitis, the expression of several CC and CXC chemokines has been reported [63]. On the other hand, chemokine and chemokines receptors expression in NAFLD and NASH is not well characterized, even though the inflammatory conditions are similar and likely to induce a similar spectrum of chemokines. Primary human hepatocytes stimulated with palmitic acid showed a dose-dependent lipid accumulation, and corresponding dose-dependent induction of Ccl5 [64]. Incubation of irradiated hepatocytes with TNFa or IL1b upregulated the expression of Ccl2 or Cxcl10 and Ccl2 [65]. We also observed an increase in the expression of Ccl5 and Cxcl10 in isolated primary hepatocytes following stimulation with IL-15, indicating that at least part of their expression in HFD-fed WT mice

9

could be derived from hepatocytes. Whereas induction of Cxcl10 occurred in both WT and IL-15Ra KO hepatocytes, Ccl5 induction occurred only in WT primary hepatocytes (Fig. 5). Hence, it appears that differential IL-15 signalling can occur in the presence or absence of IL-15Ra, leading to differential chemokine gene expression and possibly other functions. In contrast to Ccl5 and Cxcl10, IL15 stimulation did not induce any significant expression Ccl2, suggesting that the expression of this chemokine in the total liver is mediated by other liver resident cells or is stimulated by another factors induced by IL-15. TNFa from Kupffer cells (KC) in the liver regulates HFD or fructose-induced alterations in hepatocyte FA oxidation, triglyceride accumulation, and insulin responsiveness [66]. Similarly, treatment with insulin-like growth factor (IGF) prevented liver failure by inhibiting TNFa production and reducing the induction of iNOS [67]. Our results suggest that IL-15 may act upstream of Tnfa and iNOS in obesity (Fig. 3) as they were not upregulated in IL-15 deficient mice maintained on HFD. The increased accumulation of macrophages may be the consequence of the upregulation of two macrophage chemotactic factors Ccl2 and Cxcl10 in WT mice fed with HFD. As discussed earlier, obesity-associated pathologies decrease life expectancy and quality. Even though lifestyle changes, such as lower calorie intake and physical activity are quite helpful, medical and surgical interventions still remain as options for some people with morbid obesity. Moreover, NAFLD is treated by weight loss and therapies against insulin resistance or dyslipidemia. Of importance, although NAFLD is the most common liver disease in the US, no pharmacological therapies have been approved by the FDA so far [68]. Our results presented here suggest that IL-15 could potentially be a novel target for developing new therapies against NAFLD.

Acknowledgements This work was funded by CIHR operating grant to SR. YCD is a recipient of studentship ‘Professeur Cossette’ from the Faculty of Medicine. GL is a recipient of post-doctoral fellowship from CIHR. YCD, GL, VR and MM carried out the experiments. YCD, SI, SR and AM planned the experiments. YGC provided expertise on NKT cells. YCD and SR wrote the manuscript.

References [1] M. Ahmed, Non-alcoholic fatty liver disease in 2015, World J. Hepatol. 7 (2015) 1450–1459. [2] M. Lazo, R. Hernaez, M.S. Eberhardt, S. Bonekamp, I. Kamel, E. Guallar, et al., Prevalence of nonalcoholic fatty liver disease in the United States: the third national health and nutrition examination survey, 1988–1994, Am. J. Epidemiol. 178 (2013) 38–45. [3] V.W. Wong, Nonalcoholic fatty liver disease in Asia: a story of growth, J. Gastroenterol. Hepatol. 28 (2013) 18–23. [4] D.W. Haslam, W.P. James, Obesity Lancet 366 (2005) 1197–1209. [5] Y.T. Zhan, W. An, Roles of liver innate immune cells in nonalcoholic fatty liver disease, World J. Gastroenterol.: WJG 16 (2010) 4652–4660. [6] C.P. Day, O.F. James, Steatohepatitis: a tale of two ‘‘hits”?, Gastroenterology 114 (1998) 842–845 [7] L.A. Adams, P. Angulo, K.D. Lindor, Nonalcoholic fatty liver disease, CMAJ: Can. Med. Assoc. J. = Journal de l’Association medicale canadienne 172 (2005) 899– 905. [8] M. Laplante, D.M. Sabatini, MTORC1 activates SREBP-1c and uncouples lipogenesis from gluconeogenesis, Proc. Natl. Acad. Sci. U.S.A. 107 (2010) 3281–3282. [9] B.W. Smith, L.A. Adams, Nonalcoholic fatty liver disease and diabetes mellitus: pathogenesis and treatment, Nat. Rev. Endocrinol. 7 (2011) 456–465. [10] I. Wolowczuk, C. Verwaerde, O. Viltart, A. Delanoye, M. Delacre, B. Pot, et al., Feeding our immune system: impact on metabolism, Clin. Dev. Immunol. 2008 (2008) 639803. [11] G.L. Su, Lipopolysaccharides in liver injury: molecular mechanisms of Kupffer cell activation, Am. J. Physiol. Gastrointest. Liver Physiol. 283 (2002) G256– G265.

Please cite this article in press as: Y. Cepero-Donates et al., Interleukin-15-mediated inflammation promotes non-alcoholic fatty liver disease, Cytokine (2016), http://dx.doi.org/10.1016/j.cyto.2016.01.020

10

Y. Cepero-Donates et al. / Cytokine xxx (2016) xxx–xxx

[12] X. Hou, R. Zhou, H. Wei, R. Sun, Z. Tian, NKG2D-retinoic acid early inducible-1 recognition between natural killer cells and Kupffer cells in a novel murine natural killer cell-dependent fulminant hepatitis, Hepatology 49 (2009) 940– 949. [13] T.A. Waldmann, The biology of interleukin-2 and interleukin-15: implications for cancer therapy and vaccine design, Nat. Rev. Immunol. 6 (2006) 595–601. [14] Y.W. He, T.R. Malek, The structure and function of gamma c-dependent cytokines and receptors: regulation of T lymphocyte development and homeostasis, Crit. Rev. Immunol. 18 (1998) 503–524. [15] S. Dubois, J. Mariner, T.A. Waldmann, Y. Tagaya, IL-15Ralpha recycles and presents IL-15 In trans to neighboring cells, Immunity 17 (2002) 537–547. [16] J.P. Lodolce, P.R. Burkett, D.L. Boone, M. Chien, A. Ma, T cell-independent interleukin 15Ralpha signals are required for bystander proliferation, J. Exp. Med. 194 (2001) 1187–1194. [17] W.E. Carson, J.G. Giri, M.J. Lindemann, M.L. Linett, M. Ahdieh, R. Paxton, et al., Interleukin (IL) 15 is a novel cytokine that activates human natural killer cells via components of the IL-2 receptor, J. Exp. Med. 180 (1994) 1395–1403. [18] J.G. Giri, M. Ahdieh, J. Eisenman, K. Shanebeck, K. Grabstein, S. Kumaki, et al., Utilization of the beta and gamma chains of the IL-2 receptor by the novel cytokine IL-15, EMBO J. 13 (1994) 2822–2830. [19] J.P. Lodolce, D.L. Boone, S. Chai, R.E. Swain, T. Dassopoulos, S. Trettin, et al., IL15 receptor maintains lymphoid homeostasis by supporting lymphocyte homing and proliferation, Immunity 9 (1998) 669–676. [20] M.K. Kennedy, M. Glaccum, S.N. Brown, E.A. Butz, J.L. Viney, M. Embers, et al., Reversible defects in natural killer and memory CD8 T cell lineages in interleukin 15-deficient mice, J. Exp. Med. 191 (2000) 771–780. [21] T.A. Fehniger, M.A. Caligiuri, Interleukin 15: biology and relevance to human disease, Blood 97 (2001) 14–32. [22] T.A. Waldmann, Y. Tagaya, The multifaceted regulation of interleukin-15 expression and the role of this cytokine in NK cell differentiation and host response to intracellular pathogens, Annu. Rev. Immunol. 17 (1999) 19–49. [23] S.P. Dubois, T.A. Waldmann, J.R. Muller, Survival adjustment of mature dendritic cells by IL-15, Proc. Natl. Acad. Sci. U.S.A. 102 (2005) 8662–8667. [24] S. Kuwajima, T. Sato, K. Ishida, H. Tada, H. Tezuka, T. Ohteki, Interleukin 15dependent crosstalk between conventional and plasmacytoid dendritic cells is essential for CpG-induced immune activation, Nat. Immunol. 7 (2006) 740– 746. [25] I.N. Crispe, The liver as a lymphoid organ, Annu. Rev. Immunol. 27 (2009) 147– 163. [26] V. Bieghs, C. Trautwein, The innate immune response during liver inflammation and metabolic disease, Trends Immunol. 34 (2013) 446–452. [27] V. Kumar, NKT-cell subsets: promoters and protectors in inflammatory liver disease, J. Hepatol. 59 (2013) 618–620. [28] S. Ramanathan, J. Gagnon, C. Leblanc, R. Rottapel, S. Ilangumaran, Suppressor of cytokine signaling 1 stringently regulates distinct functions of IL-7 and IL-15 in vivo during T lymphocyte development and homeostasis, J. Immunol. 176 (2006) 4029–4041. [29] Y. Gui, M. Yeganeh, S. Ramanathan, C. Leblanc, V. Pomerleau, G. Ferbeyre, et al., SOCS1 controls liver regeneration by regulating HGF signaling in hepatocytes, J. Hepatol. 55 (2011) 1300–1308. [30] A. Nakamura, Y. Terauchi, Lessons from mouse models of high-fat diet-induced NAFLD, Int. J. Mol. Sci. 14 (2013) 21240–21257. [31] M. Aprile, M.R. Ambrosio, V. D’Esposito, F. Beguinot, P. Formisano, V. Costa, et al., PPARG in human adipogenesis: differential contribution of canonical transcripts and dominant negative isoforms, PPAR Res. 2014 (2014) 537865. [32] Y. Zhang, L.W. Castellani, C.J. Sinal, F.J. Gonzalez, P.A. Edwards, Peroxisome proliferator-activated receptor-gamma coactivator 1alpha (PGC-1alpha) regulates triglyceride metabolism by activation of the nuclear receptor FXR, Genes Dev. 18 (2004) 157–169. [33] H.H. Li, J.B. Tyburski, Y.W. Wang, S. Strawn, B.H. Moon, B.V. Kallakury, et al., Modulation of fatty acid and bile acid metabolism by peroxisome proliferatoractivated receptor alpha protects against alcoholic liver disease, Alcohol. Clin. Exp. Res. (2014). [34] E.M. Morris, M.R. Jackman, G.M. Meers, G.C. Johnson, J.L. Lopez, P.S. MacLean, et al., Reduced hepatic mitochondrial respiration following acute high-fat diet is prevented by PGC-1alpha overexpression, Am. J. Physiol. Gastrointest. Liver Physiol. 305 (2013) G868–G880. [35] H. Sell, C. Habich, J. Eckel, Adaptive immunity in obesity and insulin resistance, Nat. Rev. Endocrinol. 8 (2012) 709–716. [36] A.C. Tosello-Trampont, S.G. Landes, V. Nguyen, T.I. Novobrantseva, Y.S. Hahn, Kuppfer cells trigger nonalcoholic steatohepatitis development in dietinduced mouse model through tumor necrosis factor-alpha production, J. Biol. Chem. 287 (2012) 40161–40172. [37] B.V. Martin-Murphy, Q. You, H. Wang, B.A. De La Houssaye, T.P. Reilly, J.E. Friedman, et al., Mice lacking natural killer T cells are more susceptible to metabolic alterations following high fat diet feeding, PLoS ONE 9 (2014) e80949. [38] I.B. McInnes, F.Y. Liew, Interleukin 15: a proinflammatory role in rheumatoid arthritis synovitis, Immunol. Today 19 (1998) 75–79. [39] S. Yokoyama, N. Watanabe, N. Sato, P.Y. Perera, L. Filkoski, T. Tanaka, et al., Antibody-mediated blockade of IL-15 reverses the autoimmune intestinal damage in transgenic mice that overexpress IL-15 in enterocytes, Proc. Natl. Acad. Sci. U.S.A. 106 (2009) 15849–15854. [40] D. Bobbala, X.L. Chen, C. Leblanc, M. Mayhue, J. Stankova, T. Tanaka, et al., Interleukin-15 plays an essential role in the pathogenesis of autoimmune diabetes in the NOD mouse, Diabetologia 55 (2012) 3010–3020.

[41] P. Nguyen, V. Leray, M. Diez, S. Serisier, J. Le Bloc’h, B. Siliart, et al., Liver lipid metabolism, J. Animal Physiol. Animal Nutr. 92 (2008) 272–283. [42] J.D. Browning, J.D. Horton, Molecular mediators of hepatic steatosis and liver injury, J. Clin. Invest. 114 (2004) 147–152. [43] M.C. Wheeler, N. Gekakis, Hsp90 modulates PPARgamma activity in a mouse model of non-alcoholic fatty liver disease, J. Lipid Res. (2014). [44] E. Moran-Salvador, M. Lopez-Parra, V. Garcia-Alonso, E. Titos, M. MartinezClemente, A. Gonzalez-Periz, et al., Role for PPARgamma in obesity-induced hepatic steatosis as determined by hepatocyte- and macrophage-specific conditional knockouts, FASEB J. 25 (2011) 2538–2550. [45] P. Lefebvre, G. Chinetti, J.C. Fruchart, B. Staels, Sorting out the roles of PPAR alpha in energy metabolism and vascular homeostasis, J. Clin. Invest. 116 (2006) 571–580. [46] F. Assimacopoulos-Jeannet, S. Thumelin, E. Roche, V. Esser, J.D. McGarry, M. Prentki, Fatty acids rapidly induce the carnitine palmitoyltransferase I gene in the pancreatic beta-cell line INS-1, J. Biol. Chem. 272 (1997) 1659– 1664. [47] H. Kanegane, G. Tosato, Activation of naive and memory T cells by interleukin15, Blood 88 (1996) 230–235. [48] T.A. Stoklasek, K.S. Schluns, L. Lefrancois, Combined IL-15/IL-15Ralpha immunotherapy maximizes IL-15 activity in vivo, J. Immunol. 177 (2006) 6072–6080. [49] L. Golden-Mason, A.M. Kelly, D.G. Doherty, O. Traynor, G. McEntee, J. Kelly, et al., Hepatic interleuklin 15 (IL-15) expression: implications for local NK/NKT cell homeostasis and development, Clin. Exp. Immunol. 138 (2004) 94–101. [50] M.P. Correia, E.M. Cardoso, C.F. Pereira, R. Neves, M. Uhrberg, F.A. Arosa, Hepatocytes and IL-15: a favorable microenvironment for T cell survival and CD8+ T cell differentiation, J. Immunol. 182 (2009) 6149–6159. [51] T. Christiansen, S.K. Paulsen, J.M. Bruun, S.B. Pedersen, B. Richelsen, Exercise training versus diet-induced weight-loss on metabolic risk factors and inflammatory markers in obese subjects: a 12-week randomized intervention study, Am. J. Physiol. Endocrinol. Metab. 298 (2010) E824– E831. [52] N.G. Barra, S. Reid, R. MacKenzie, G. Werstuck, B.L. Trigatti, C. Richards, et al., Interleukin-15 contributes to the regulation of murine adipose tissue and human adipocytes, Obesity (Silver Spring. 18 (2010) 1601–1607. [53] M.A. Exley, M.J. Koziel, To be or not to be NKT: natural killer T cells in the liver, Hepatology 40 (2004) 1033–1040. [54] P.F. Lalor, J. Faint, Y. Aarbodem, S.G. Hubscher, D.H. Adams, The role of cytokines and chemokines in the development of steatohepatitis, Semin. Liver Dis. 27 (2007) 173–193. [55] W.Z. Mehal, A.E. Juedes, I.N. Crispe, Selective retention of activated CD8+ T cells by the normal liver, J. Immunol. 163 (1999) 3202–3210. [56] A.M. Ring, J.X. Lin, D. Feng, S. Mitra, M. Rickert, G.R. Bowman, et al., Mechanistic and structural insight into the functional dichotomy between IL-2 and IL-15, Nat. Immunol. 13 (2012) 1187–1195. [57] A. Kahraman, M. Schlattjan, P. Kocabayoglu, S. Yildiz-Meziletoglu, M. Schlensak, C.D. Fingas, et al., Major histocompatibility complex class Irelated chains A and B (MIC A/B): a novel role in nonalcoholic steatohepatitis, Hepatology 51 (2010) 92–102. [58] M. Guebre-Xabier, S. Yang, H.Z. Lin, R. Schwenk, U. Krzych, A.M. Diehl, Altered hepatic lymphocyte subpopulations in obesity-related murine fatty livers: potential mechanism for sensitization to liver damage, Hepatology 31 (2000) 633–640. [59] M. Kremer, I.N. Hines, Natural killer T cells and non-alcoholic fatty liver disease: fat chews on the immune system, World J. Gastroenterol.: WJG 14 (2008) 487–488. [60] K. Tajiri, Y. Shimizu, K. Tsuneyama, T. Sugiyama, Role of liver-infiltrating CD3+ CD56+ natural killer T cells in the pathogenesis of nonalcoholic fatty liver disease, Eur. J. Gastroenterol. Hepatol. 21 (2009) 673–680. [61] L. Lynch, M. Nowak, B. Varghese, J. Clark, A.E. Hogan, V. Toxavidis, et al., Adipose tissue invariant NKT cells protect against diet-induced obesity and metabolic disorder through regulatory cytokine production, Immunity 37 (2012) 574–587. [62] M.D. Rutkowski, J.A. DeLeo, The role of cytokines in the initiation and maintenance of chronic pain, Drug News Perspect 15 (2002) 626–632. [63] J. Maltby, S. Wright, G. Bird, N. Sheron, Chemokine levels in human liver homogenates: associations between GRO alpha and histopathological evidence of alcoholic hepatitis, Hepatology 24 (1996) 1156–1160. [64] G. Kirovski, E. Gabele, C. Dorn, L. Moleda, C. Niessen, T.S. Weiss, et al., Hepatic steatosis causes induction of the chemokine RANTES in the absence of significant hepatic inflammation, Int. J. Clin. Exp. Pathol. 3 (2010) 675– 680. [65] F. Moriconi, H. Christiansen, D. Raddatz, J. Dudas, R.M. Hermann, M. RaveFrank, et al., Effect of radiation on gene expression of rat liver chemokines: in vivo and in vitro studies, Radiat. Res. 169 (2008) 162–169. [66] W. Huang, A. Metlakunta, N. Dedousis, P. Zhang, I. Sipula, J.J. Dube, et al., Depletion of liver Kupffer cells prevents the development of diet-induced hepatic steatosis and insulin resistance, Diabetes 59 (2010) 347–357. [67] T. Hijikawa, M. Kaibori, Y. Uchida, M. Yamada, K. Matsui, T. Ozaki, et al., Insulin-like growth factor 1 prevents liver injury through the inhibition of TNF-alpha and iNOS induction in D-galactosamine and LPS-treated rats, Shock 29 (2008) 740–747. [68] K.G. Tolman, A.S. Dalpiaz, Treatment of non-alcoholic fatty liver disease, Ther. Clin. Risk Manage. 3 (2007) 1153–1163.

Please cite this article in press as: Y. Cepero-Donates et al., Interleukin-15-mediated inflammation promotes non-alcoholic fatty liver disease, Cytokine (2016), http://dx.doi.org/10.1016/j.cyto.2016.01.020