Involvement of cross-linked ribosomal protein S19 oligomers and C5a receptor in definitive erythropoiesis

Experimental and Molecular Pathology 95 (2013) 364–375

Contents lists available at ScienceDirect

Experimental and Molecular Pathology journal homepage: www.elsevier.com/locate/yexmp

Involvement of cross-linked ribosomal protein S19 oligomers and C5a receptor in definitive erythropoiesis Jun Chen a, Rui Zhao a, Umeko Semba a, Masato Oda b, Tomoyasu Suzuki b, Ken Toba b, Shinichiro Hattori c, Seiji Okada c, Tetsuro Yamamoto a,⁎ a b c

Department of Molecular Pathology, Faculty of Life Science and Graduate School of Medical Sciences, Kumamoto University, Kumamoto, Japan First Department of Internal Medicine, Niigata University Medical and Dental Hospital, Niigata, Japan Division of Hematopoiesis, Center for AIDS Research, Kumamoto University, Kumamoto, Japan

a r t i c l e

i n f o

Article history: Received 10 May 2013 and in revised form 8 October 2013 Available online 30 October 2013 Keywords: Bone marrow C5a receptor Erythroblast Erythropoiesis Extraribosomal function Ribosomal protein S19

a b s t r a c t We performed a series of experiments under a working hypothesis that cross-linked oligomers of ribosomal protein S19 (RP S19) play an essential role in definitive erythropoiesis as a ligand of the C5a receptor of erythroblasts and macrophages. We found molecules functionally and immunologically indistinguishable from RP S19 oligomers in the extracellular fluid of porcine and guinea pig bone marrow. When an increased hematopoietic state was induced in guinea pigs by bloodletting, the bone marrow RP S19 oligomer concentration was concomitantly increased. However, when the RP S19 oligomers were immunologically neutralized or the C5a receptor was pharmacologically antagonized, hyper-erythropoiesis induced by bloodletting was prevented and the anemic state was retarded in guinea pigs. When the RP S19 oligomers were neutralized in mice after bloodletting, the reactive hyper proliferation of erythroblasts in the spleen was prevented. Proerythroblasts and erythroblasts prepared by bone marrow aspiration from healthy individuals were found to express significant levels of the C5a receptor and type 2 transglutaminase genes. Majority of erythroblasts in cord blood of healthy newborns bore the C5a receptor. Taken together, these results support our hypothesis. © 2013 Elsevier Inc. All rights reserved.

Introduction Ribosomal protein S19 (RP S19) is a 145-amino acid component of the small ribosome subunit that appears to be essential for ribosome biogenesis (Flygare et al., 2007; Idol et al., 2007). We have been elucidating the extraribosomal function of RP S19. Although RP S19 is a component of the ribosome, it is also present in blood plasma, forming a complex with prothrombin (Nishiura et al., 2011; Semba et al., 2010). Cellular RP S19 is inter-molecularly cross-linked by an intracellular transglutaminase during apoptosis, and plasma RP S19 is similarly cross-linked by activated coagulation factor XIII during blood coagulation, forming an isopeptide bond between Lys122 and Gln137 in both cases (Horino et al., 1998; Nishimura et al., 2001; Nishiura et al., 1999; Semba et al., 2010). The cellular RP S19 oligomers thus formed are then extracellularly released (Horino et al., 1998; Nishimura et al., 2001). The intermolecular crosslinkage confers a ligand capacity to these RP S19 oligomers for the

Abbreviations: APC, allophycocyanin; FITC, fluorescein isothiocyanate; FACS, fluorescence-activated cell sorting; HBSS, Hanks' balanced salt solution; PBS, phosphatebuffered saline; PE, phycoerythrin; PBGD, porphobilinogen deaminase; RT-PCR, reverse transcriptase-polymerase chain reaction; RP S19, ribosomal protein S19. ⁎ Corresponding author at: Department of Molecular Pathology, Faculty of Life Science, Kumamoto University, 1-1-1 Honjo, Center Ward, Kumamoto 8608556, Japan. Fax: +81 96 373 5308. E-mail address: [email protected] (T. Yamamoto). 0014-4800/$ – see front matter © 2013 Elsevier Inc. All rights reserved. http://dx.doi.org/10.1016/j.yexmp.2013.10.010

chemotactic C5a receptor of monocytes/macrophages (Nishiura et al., 1998), thereby recruiting these phagocytes, which then clear apoptotic cells or blood coagulum (Horino et al., 1998; Ota et al., 2011). The C5a receptor (CD88), a heptaherical, transmembrane G proteincoupled receptor, was initially identified as a receptor of the complement C5-derived anaphylatoxin, C5a (Gerard and Gerard, 1991). We previously revealed that the RP S19 oligomers possessed cross-immunoreactivity with C5a (Nishiura et al., 2010); however, different from C5a, the RP S19 oligomers do not attract neutrophils but rather promote apoptosis in neutrophils when ligate the C5a receptor (Nishiura et al., 2009). Furthermore, the C5a receptor is de novo synthesized in apoptosis-initiated cells, and the RP S19 oligomers promote the execution of apoptosis by a general autocrine mechanism (Nishiura et al., 2005, 2009). Thus, the RP S19 oligomers and the C5a receptor synchronize the execution of apoptosis and phagocyte recruitment in situ (Yamamoto, 2007). Recently, we encountered an interesting hypothesis that some elements of the apoptotic program would be used in the terminal differentiation of erythroblasts, lens epithelial cells and keratinocytes when they lose their nuclei and other organelles (Ishizaki et al., 1998). We then noticed several reports on the involvement of caspases, such as caspases 2, 3 and 7, at the maturation stage of erythroblasts in definitive erythropoiesis (Carlile et al., 2004; Droin et al., 2008; Kolbus et al., 2002; Zermati et al., 2001), although this seems to be still controversial (Chasis and Mohandas, 2008). We also found a report that DNase II in macrophages appears to be responsible for destroying the nuclear DNA

J. Chen et al. / Experimental and Molecular Pathology 95 (2013) 364–375

expelled from erythroid precursor cells, and, owing to severe anemia, no live DNase II-null mouse was born (Kawane et al., 2001). The process of definitive erythropoiesis is separated briefly into two stages, the proliferation stage and maturation stage. In the former stage, erythroid progenitors, such as burst-forming unit-erythroids and colony-forming unit-erythroids, extensively proliferate in response to erythropoietin and ultimately differentiate into morphological erythroid precursors, proerythroblasts (Prchal, 2010). Proerythroblasts then interact with a nursing macrophage, which is called the central macrophage, and step up the maturation stage until orthochromatic erythroblasts which are developed via basophilic erythroblasts and polychromatophilic erythroblasts, in this order, on the central macrophage. The cellular complex composed of a central macrophage and of proerythroblasts and erythroblasts is usually called the erythroblastic island. An orthochromatic erythroblast then separates into a reticulocyte and a pyrenocyte that contains the nucleus of erythroblast (McGrath et al., 2008). The former then leaves the erythroblastic island, and the latter is engulfed by the central macrophage or by other macrophages in the bone marrow in a membrane phosphatidylserine-dependent manner, as in the case of apoptotic cell engulfment (Yoshida et al., 2005). Based on the information and our experiments described above, we developed a working hypothesis that the RP S19 oligomers and the C5a receptor would play important roles in definitive erythropoiesis, such as the acceleration of erythroblast differentiation and interaction with macrophages to form erythroblastic islands resulted in the prompt clearance of the erythroblast-derived nuclei or pyrenocytes. To test the hypothesis, we recently established a co-culture system with artificially differentiated K562 cells to erythroblast-like cells and artificially differentiated HL-60 cells to macrophage-like cells mimicking the erythroblastic island. In this system, the C5a receptor is synthesized not only by the central macrophage-like HL-60-derived cells but also by the erythroblast-like K562-derived cells, and the RP S19 oligomers are generated by the erythroblast-like K562 cells. The macrophagelike cells and the erythroblast-like cells interacted each other making erythroblastic island-like cell clusters, and the cell cluster formation was prevented by immunologic neutralization of the RP S19 oligomers or by pharmacological blockade of the C5a receptor (Nishiura et al., 2012). The results obtained using the co-culture system strongly supported our working hypothesis. For this reason, we further examined our hypothesis by in vitro analyses with materials obtained from human, porcine and guinea pig bone marrow and new-born cord blood, and by in vivo experiments using guinea pigs and mice. The amino acid sequence of RP S19 is identical among human, guinea pig and porcine (Porcine genome sequencing project, 2009; Umeda et al., 2004), and only one amino acid residue differs in mouse (Willig et al., 1999). This indicates that it would be capable of extrapolating from the current experimental results with the guinea pig and the mouse to the human. Materials and methods Human materials A heparinised human bone marrow aspirate was obtained using a standard clinical method from 6 patients with non-hematopoietic disorders (age 28 to 38) after written informed consent was obtained. Their bone marrow aspirates were used for preparation of RNA of proerythroblasts and erythroblasts under permission of the ethical committee of Niigata University Medical School (approval number 368). Umbilical cord blood cells were collected during normal full-term deliveries after obtaining informed consent, according to institutional guidelines approved by The Faculty of Life Science, Kumamoto University. Peripheral blood used for leukocyte and plasma preparations was obtained from healthy volunteers (2 males and a female, age 30 to 35) among laboratory members in Kumamoto University after getting their informed consent.

365

Animals and animal materials Male Hartley strain guinea pigs with 210–550 g body weights and male Balb/cN mice (7 weeks old) with 20–22 g body weight, which are specific pathogen-free, were purchased from Kyudo Corp. (Kumamoto, Japan), and were maintained in the Center for Animal Resources and Development, Kumamoto University. The animal experiments were performed under the control of the Ethical Committee for Animal Experiments, Kumamoto University (approval number B-23-166). The femoral bones of young pigs that had been slaughtered on the previous day and kept in cold storage were provided by a regional meat industry company (Ootsuka Meat Company LTD, Kumamoto, Japan) under approval of the company for the experimental use. Reagents and others RPMI 1640 medium and Hanks' balanced salt solution (HBSS) were purchased from Nissui Pharm. Co. (Tokyo, Japan). Fetal bovine serum was a product of Gibco BRC (Paisley, Scotland). Ficoll-Paque Plus® was obtained from Amersham Biosciences KK (Tokyo, Japan). Bovine serum albumin was obtained from Sigma-Aldrich (St. Louis, MO). Allophycocyanin (APC)-conjugated anti-CD45 IgG (Anti-CD45 Ab-APC), phycoerythrin (PE)-conjugated anti-glycophorin A mouse IgG (antiCD235a Ab-PE) and fluorescein isothiocyanate (FITC)-conjugated antiC5a receptor mouse IgG (anti-CD88 Ab-FITC) were purchased from Biolegend (San Diego, CA). FITC-conjugated anti-mouse Ter 119 rat IgG monoclonal antibody was obtained from BD Biosciences (Franklin Lakes, NJ), and PE-conjugated anti-mouse C5a receptor (CD88) rat IgG monoclonal antibody was purchased from AbD Serotec (Raleigh, NC). A Ter 119 rat IgG monoclonal antibody (anti-mouse TER-119 purified) was obtained from eBioscience (San Diego, CA). The multiwell chambers for the chemotaxis assay were a product of Neuro Probe (Bethesda, MD). The Nucleopore filters were purchased from Nucleopore (Pleasant, CA). Unless otherwise specified, all of the other chemicals were obtained from Nacalai Tesque (Kyoto, Japan) or from Wako Pure Chemicals (Osaka, Japan). A recombinant C5a was prepared using an Escherichia coli expression system with the pET32a vector and Rosseta gami(B) Lys-S as the host bacterium, as described previously (Oda et al., 2008). A C5a receptor antagonistic peptide, NMePhe-Lys-Pro-dCha-dCha-dArg was prepared using the Fmoc method as described previously (Konteatis et al., 1994). Anti-RP S19 protein rabbit IgG and rabbit IgG against a synthetic Cterminal peptide of RP S19 (from Ala135 to His145, with a Cys at the Cterminus: Ala-Gly-Gln-Val-Ala-Ala-Ala-Asn-Lys-Lys-His-Cys) were prepared as described previously (Nishiura et al., 2005). Anti-C5a rabbit IgG were prepared as previously described (Nishiura et al., 2010). The IgG fractions of these antisera were prepared using a HiTrap™ Protein G HP column (Amersham) according to the manufacturer's instructions. Aliquots of the IgG antibodies and the control IgG were conjugated with biotin using biotin N-hydroxysuccinimide ester at pH 7.4 according to the instruction manual prepared by the manufacturer. For the preparation of immunobeads, aliquots of the anti-C5a, anti-RP S19 and anti-RP S19 peptide IgG antibodies and normal rabbit IgG were respectively conjugated to CNBr-activated Sepharose 4 Fast Flow (GE Healthcare Bio-Science, Piscataway, NJ) at pH 8.5 according to the manufacturer's instructions. Preparation of extracellular fluid of porcine bone marrow and partial purification of RP S19 oligomers in the extracellular fluid After cutting the bone cortex using an electric bone cutter, the hematopoietic bone marrow was gently spooned out and weighed in centrifuge tubes. An equal weight of cold phosphate-buffered saline (PBS) was added. The suspension was gently mixed and centrifuged at 10,000 ×g for 20 min at 4 °C. The suspension was separated into 3 layers: a lipid layer, liquid layer and precipitated cell layer, from top to bottom. The liquid layer was recovered using a long pipette, heat-treated for 30 min at

366

J. Chen et al. / Experimental and Molecular Pathology 95 (2013) 364–375

56 °C to denature proteases and their zymogens, and used as the bone marrow-washed fluid. A 60-ml sample of heat-treated bone marrow fluid was subjected to an ammonium sulphate cut at 40% saturation on ice. After centrifugation at 20,000 ×g for 20 min at 4 °C, the supernatant was extensively dialyzed against 10 mM phosphate buffer (pH 7.5) containing 40 mM NaCl at 4 °C. The dialyzed sample was applied to a DEAE-Toyopearl 650 M column (Ф 2.2 cm × 8 cm, bed volume of 30 ml) equilibrated with the dialysis buffer. The breakthrough fraction was dialyzed against 10 mM phosphate buffer (pH 6.0) containing 40 mM NaCl and applied to an SP-Toyopearl 650 M column (Ф 1.4 cm × 11 cm, bed volume of 18 ml) equilibrated with the dialysis buffer. After washing the column with the equilibration buffer, the bound molecules were eluted with 10 mM phosphate buffer (pH 6.0) containing 500 mM NaCl. Through this process, approximately 14 mg protein was recovered from 390 mg bone marrow plasma protein.

Table 1 List of primers used.

Preparation of human and mouse erythroblast-contained fractions

The expression levels of mRNA were measured by real-time quantitative reverse transcriptase-polymerase chain reaction (RT-PCR), as previously described (Yoshida et al., 2005). The primer sets are shown in Table 1. Porphobilinogen deaminase was measured as an internal standard, and the mRNA expression levels are indicated as the relative copy number/internal standard. A control gene was used to produce the standard concentration curve. The cDNA and diluted recombinant plasmids were measured using a LightCycler (Roche, Indianapolis, IN) and its software. A 3-step cycle procedure was used (denaturation at 95 °C for 5 s, annealing at 60 °C for 15 s, and extension and acquisition at 72 °C for 13 s) for 45 cycles.

Human erythroblast-contained fractions were prepared from bone marrow aspirate or from umbilical cord blood. In the former case, the heparinized bone marrow aspirate was obtained from 6 patients with non-hematopoietic disorders. High-density (over 1.080), intermediatedensity (1.070 to 1.080), and low-density (less than 1.070) cells were separated stepwise by centrifugation using Percoll (adjusted to 1.080 and 1.070, Amersham, Uppsala, Sweden). The glycophorin-A+ erythroid cells were purified from each density cell fraction using anti-human glycophorin-A labeled with PE (Immunotech, Marseilles, France) and the immunomagnetic sorting system (purity, 98.3 ± 1.7%) as previously described (Oda et al., 2010). In the preparation of erythroblast-contained cell fraction from cord blood of 3 healthy new-borns, the lymphocyteperipheral blood mononuclear cell fraction was separated by a density centrifugation with a highly cross-linked sucrose polymer, Pancoll human, at density 1077 g/l (PAN Biotech GmbH, Aidenbach, Germany) at 800 ×g for 15 min according to the manufacturer's instruction. CD45+ leukocyte lineage cells were sorted out by fluorescenceactivated cell sorting (FACS) method with the APC-conjugated antibody from the mononuclear cell fraction, and the remainder cell fraction was used as an erythroid precursor cell-contained fraction. Mouse erythroblast-contained fraction was prepared from the spleen. Spleen cells were teased out with a small fork bearing multiple needles, and red blood cells were burst in 115 mM CH3COONH4 containing 100 mM EDTA and 10 mM KHCO3 (3 ml/spleen) for 1 min at 22 °C. After hemoglobin and red blood cell debris were washed out by centrifugation, the nuclear cell fraction obtained was used as the erythroblast-contained cell fraction. FACS analyses The erythroblast-contained fraction of cord blood and the nucleated cell fraction of mouse spleen were treated with a set of PE-labeled antiglycophorin A mouse IgG and FITC-labeled anti-C5a receptor mouse IgG

Porphobilinogen deaminase C5a receptor Type 2 transglutaminase

Sense primer

Antisense primer

ccatgtctggtaacggcaat agtactttccaccaaaggtgttgt aggatatcacccacacctacaaat

cttcaaggagtgaacaaccagg agttgatgtaggcaaaggagacac tcacggtatttctcatagaggatg

or with a set of FITC-conjugated Ter 119 rat IgG and PE-conjugated anti-mouse C5a receptor rat IgG, respectively. These treated cell fractions were respectively subjected to FACS analysis using a FACS Caliber flow cytometer (BD, Tokyo, Japan) according to the manufacturer's instruction.

Quantitation of transcripts in erythroid precursor cells

Introduction of hyper-erythropoietic state in guinea pigs, systemic treatment of the animals, and preparation of bone marrow-flushed fluid Although relatively large-sized male guinea pigs (approximately 550 g body weight) were used in the preliminary experiments, smallsized guinea pigs (approximately 210 g body weight) were used in the experiment with the systemic treatment. Cardiac puncture was performed under ether anesthesia to abstract 10% of the circulating blood volume. The systemic administration of the anti-C5a rabbit IgG or the C5a receptor antagonist peptide was performed by an intraperitoneal bolas injection under ether anesthesia. Control guinea pigs were treated in the same way except for the injection with control rabbit IgG or with solvent vehicle. Femoral bones were separated, and both ends were cut off with a razor blade. A small syringe containing phosphate-buffered saline and one open-end of a femoral bone were connected with a plastic tube. The PBS was slowly applied to bone marrow by depressing the syringe plunger, and flushed drops were recovered from the other open end of the bone in a conical centrifuge tube on ice. The fluid in the conical tube was centrifuged at 12,000 ×g for 20 min at 4 °C, and the supernatant was recovered. The supernatant was immediately heat-treated for 30 min at 56 °C and used as the bone marrow-flushed fluid.

Fig. 1. Separation of RP S19 oligomers into SP-Toyopearl column chromatography eluate fraction from extracellular fluid of porcine bone marrow. According to the monocyte-selective chemotactic capacity, RP S19 oligomer-like molecules in porcine bone marrow tissue fluid were separated sequentially using ammonium sulphate fractionation, DEAE-Toyopearl column chromatography and SP-Toyopearl column chromatography. A. Chemoattraction capacity of the SP column eluate fraction for human peripheral blood monocytes. The assay was performed using a multi-well chamber method after serially diluted at magnitude (hatched columns). A recombinant human C5a was used as the positive control (solid columns), and phosphate-buffered saline (PBS) was used as the negative control (open column). The chemotactic capacity is shown as the leukocyte number counted in five microscopic high-power fields. Each experiment was performed in triplicate, and the column height indicates the mean value with S.D. bar. B. Immunologic identification of the monocyte chemotactic molecule. Aliquots of the SP column fraction were treated with either anti-C5a IgG beads (dark dot-pattern columns) or normal rabbit IgG beads (light dot-pattern columns) in a batch-wise way twice, and the monocyte chemotactic capacity remained was measured at the serial dilution. *** indicates P b 0.001. C. The same experiments as B were performed with anti-RP S19 peptide rabbit IgG beads (hatched columns) or with anti-RP S19 protein IgG beads (gray and hatched columns). *** indicates P b 0.001. D. Lack of chemoattraction capacity for neutrophils. The chemotactic capacity of the SP column fraction was also assessed for human peripheral blood neutrophils (checked columns). C5a (solid columns) and PBS (open column) are positive and negative controls, respectively. E. Western blotting analysis of the SP column fraction. The western blotting was performed with biotin-labeled anti-C5a rabbit IgG (a), with biotin-labeled anti-RP S19 peptide IgG (b) or with biotin-labeled control IgG (c) after 15% polyacrylamide gel electrophoresis in the presence of sodium dodecyl sulphate. The immunoreactive bands were visualized using an electrochemical method after treatment with biotinylated-horseradish peroxidase–streptavidin complex. The numbers at left side indicate molecular weights of immunoreactive bands calculated from the electrophoretic mobilities of marker proteins.

J. Chen et al. / Experimental and Molecular Pathology 95 (2013) 364–375

Leukocyte chemotaxis assays Mononuclear cells and neutrophils were isolated from the heparinized venous blood of healthy human donors according to the method of Fernandez et al (Fernandez and Hugli, 1978), as described previously (Matsubara et al., 1991). The mononuclear cell fraction contained monocytes at approximately 20%, and almost all of the cells in the neutrophil fraction were neutrophils. The mononuclear cells and neutrophils were

367

suspended at a cell density of 1 × 106 cells/ml in RPMI 1640 containing 10% fetal bovine serum and at a cell density of 2 × 106 cells/ml in HBSS containing 0.5% bovine serum albumin for the multiwell chamber assay, respectively. The multiwell chamber assay was performed according to the method of Falk et al (Falk et al., 1980) using a Nucleopore filter with a pore size of 5 μm for monocytes and 3 μm for neutrophils, as described previously (Matsubara et al., 1991). After incubation for 90 min, each membrane was separated, fixed with methanol, and stained with

368

J. Chen et al. / Experimental and Molecular Pathology 95 (2013) 364–375

Giemsa solution. The total number of monocytes or neutrophils migrated beyond the lower surface of the membrane was counted in five microscopic high-power fields. The results are expressed as the number of migrated monocytes or neutrophils with standard deviation.

Sodium dodecyl sulphate-polyacrylamide gel electrophoresis and western blotting Electrophoresis was performed using 15% polyacrylamide gels according to the method of Laemmli (Laemmli, 1970). The samples were applied to sodium dodecyl sulphate-polyacrylamide gel electrophoresis and transferred to an Immobilon-PSQ membrane. After treating with 1% Block Ace™ (Dainihonseiyaku, Osaka, Japan) for 1 h at 22 °C, the biotinylated rabbit IgG antibodies were reacted for 1 h at 22 °C. After incubation with biotinylated-horseradish peroxidase–streptavidin complex (Pathostain ABC-POD(M) Kit) for 30 min at 22 °C, the bound horseradish peroxidase was detected using ECL Plus Western blot detection system (Pharmacia, Uppsala, Sweden).

Measurement of red blood cell number and hemoglobin concentration Heparinized guinea pig cardiac blood was subjected for the measurement. The red blood cell number was counted using a microscopic hemocytometer after 200 fold dilution. Blood hemoglobin concentration was measured using the azide methemoglobin method. Red blood cells were lysed and liberated hemoglobin was oxidized in 33 mM phosphate buffer (pH 7.2) containing 0.9 mM potassium ferricyanide, 3 mM sodium azide and 0.1% Nonidet P40 at 250 fold diluted condition for 20 min at 22 °C. After centrifugation, methemoglobin concentration in the supernatant was spectrophotometrically measured at 542 nm wavelength. Statistical analysis The results of representative examinations were confirmed by multiple experiments with triplicate samples. Statistical significance was calculated by the non-parametric or parametric tests offered in the two way analysis of variance windows, respectively, using software SPSS Statistics (version 19, IBM). Values are expressed as mean ± S.D. or mean ± S.E. A P value b0.05 was considered statistically significant and shown as * P b 0.05, ** P b 0.01 and *** P b 0.001.

Histological examination Results Animals were killed under ether anesthesia, and femoral bones of the guinea pigs and the spleen of the mice were separated. After both ends were cut off, the bones were immersed in 10% formalin as in the case of the spleens. A trans-sectional piece at 5 mm thickness in middle portion of each fixed bone or a half-cut of each spleen was resected and embedded in paraffin. Paraffin sections were prepared at 5 μm thickness and stained with hematoxylin and eosin or subjected to immunohistochemistry with Ter 119 rat IgG. The second antibody used in the immunoperoxidase method was horseradish peroxidase-conjugated anti-rat IgG goat IgG Fab (Histofine Simple Stain™, Nichirei Bioscience, Tokyo, Japan), and the substrate of the peroxidase was diaminobenzidine. Microscopic pictures were prepared using an automatic microscope, Provis AX (Olympus), equipped with a digital CCD camera, Penguin 600CL (Pixera).

Presence of RP S19 oligomers in the extracellular fluid of porcine bone marrow We first obtained the extra-cellular fluid of bone marrow by washing the spooned-out marrow prepared from porcine femoral bones, as described above. To examine briefly the presence of RP S19 oligomers, we measured the monocyte chemotactic capacity in the bone marrowwashed solution. Because we observed a strong chemotactic capacity, we partially purified the monocyte chemotactic factor by ionic exchange column chromatography using, sequentially, a DEAE-Toyopearl column and an SP-Toyopearl column according to the purification process that we previously used for the separation of the RP S19 oligomers from rheumatoid arthritis synovial lesion extract (Nishiura et al., 1996). The

Fig. 2. The presence of RP S19 oligomers with monocyte chemotactic capacity in guinea pig bone marrow tissue fluid. Bone marrow-flushed fluid of a guinea pig femoral bone was pretreated with either the anti-C5a IgG beads (A) or the two types of anti-RP S19 IgG beads (B) in the same way as Fig. 1, and chemotactic capacity of each unbound fraction for human monocytes was measured. C5a (solid column) and PBS (open column) are positive and negative controls, respectively. The chemotactic capacity is shown as the leukocyte number counted in five microscopic high-power fields. Each experiment was performed in triplicate, and the column height indicates the mean value with S.D. bar. *** indicates P b 0.001.

J. Chen et al. / Experimental and Molecular Pathology 95 (2013) 364–375

369

monocyte chemotactic factor was recovered from the breakthrough fraction of the DEAE column, as was the case of the RP S19 oligomers (data not shown). When the breakthrough fraction was applied to the SP column, the monocyte chemotactic factor was bound to the column and eluted from the column with 10 mM phosphate buffer (pH 6.0) containing 500 mg/ml NaCl (Fig. 1A), as was the case of the RP S19 oligomers. To identify the monocyte chemotactic factor immunologically, we used rabbit antibodies raised against a recombinant human C5a because the antibodies recognize C5a and the RP S19 oligomers equally well but the RP S19 monomer much less (Nishiura et al., 2010). The monocyte chemotactic capacity in the eluate was absorbed by the anti-C5a rabbit IgG beads (Fig. 1B). To confirm the immunoabsorption experiment, we also performed the same experiment but with anti-RP S19 fragment peptide rabbit IgG beads and with anti-RP S19 protein rabbit IgG beads as described previously (Semba et al., 2010; Shi et al., 2005). The monocyte chemotactic capacity was also absorbed by these anti-RP Fig. 4. Immunologic neutralization of extracellular RP S19 oligomers in guinea pig bone marrow by systemic treatment with anti-C5a IgG. Two guinea pigs were intraperitoneally injected 1 mg/guinea pig (body weight approximately 210 g) of anti-human C5a IgG, and one guinea pig was of control rabbit IgG. After 24 h, the bone marrow-flushed solution of the femoral bones was prepared from each guinea pig, and the monocyte chemotactic capacities in the flush solutions were measured as Fig. 3. The experimental group is shown with thick and thin hatched columns, and the control guinea pig is shown with doted columns. C5a (solid column) and PBS (open column) are positive and negative controls, respectively. The chemotactic capacity is shown as the leukocyte number counted in five microscopic high-power fields. Each experiment was performed in triplicate, and the column height indicates the mean value with S.D. bar. ** indicates P b 0.01.

S19 beads (Fig. 1C). Importantly, this fraction did not attract neutrophils (Fig. 1D). These results excluded C5a as a candidate for the monocyte chemotactic factor in the bone marrow tissue fluid. We then subjected this fraction to western blot analyses using the anti-human C5a IgG or using the anti-RP S19 peptide IgG. As shown in Fig. 1E, the two different antibodies accordantly exhibited several immunoreactive bands with molecular weights of 16 kDa, 32 kDa, and 64 kDa, which corresponded to the monomer, dimer, and tetramer of RP S19, although the anti-RP S19 antibodies displayed the monomer with 16 kDa more strongly than did anti-human C5a IgG. A control membrane which had been prepared in the same way except for using biotin-labeled control IgG did not exhibit any band. These results collectively indicated the presence of a substantial amount of RP S19 oligomers in the extracellular fluid of porcine bone marrow. Introduction of increased erythropoietic state concomitant with enhanced generation of RP S19 oligomers in femoral bone marrow of guinea pigs by bloodletting stress We then expanded our research by means of the manipulation of guinea pigs in vivo. Before the manipulation studies, we confirmed that the RP S19 oligomers were also present in the extracellular fluid Fig. 3. Introduction of increased erythropoietic state concomitant with enhanced generation of RP S19 oligomers in bone marrow of guinea pigs by bloodletting. Cardiac puncture was performed under ether anesthesia to abstract 1.6 ml blood (10% of the circulating blood volume) from about 210 g body weight-guinea pigs. On 3 days after the bloodletting, the femoral bones were separated; one was used for histologic examination and the other was used for the bone marrow-flushed fluid preparation. A. A representative histologic picture of bone marrow at middle portion of a femoral bone at steady state (left side) or on 3 days after the bloodletting (right side). Paraffin sections at 5 μm thickness were stained with hematoxylin and eosin. The horizontal solid bars indicate 100 μm. B. Monocyte chemotactic capacities of the bone marrow extracellular fluid of the control guinea pigs (hatched columns) and the phlebotomized guinea pigs (checked columns) are shown. The chemotaxis assay was performed as described in Fig. 1A. C5a (solid column) and PBS (open column) are positive and negative controls, respectively. The chemotactic capacity is shown as the leukocyte number counted in five microscopic high-power fields. Each experiment was performed in triplicate, and the column height indicates the mean value with S.D. bar. The interpolated figure demonstrates concentration (logarithmic)–function (linear) relation curves to quantify the enhancement ratio of the monocyte chemotactic factor production upon the bloodletting. C. Western blot analyses of the bone marrow extracellular fluid of the normal and phlebotomized guinea pigs using either the biotin-labeled anti-C5a IgG (a, b), the biotin-labeled anti-RP S19 peptide IgG (c, d) or the biotin-labeled control rabbit IgG (e). The numbers at left sides indicate molecular weights of immunoreactive bands.

370

J. Chen et al. / Experimental and Molecular Pathology 95 (2013) 364–375

Fig. 5. Inhibition of bloodletting-induced erythropoietic response by immunologic neutralization of bone marrow RP S19 oligomers. Cardiac puncture was performed to abstract 10% of the circulating blood as Fig. 3 on day 0. The guinea pigs were then randomly separated into two groups (6 heads per group). One group was treated with the anti-human C5a IgG (1 mg/guinea pig), while the other was treated with the control rabbit IgG (1 mg/guinea pig), by the intraperitoneal boras injection on day 2. On day 4, cardiac puncture was performed again in each animal to sample blood. The animals were then killed and femoral bones were used for the histologic examination. A. Analysis of anemic state according to hemoglobin concentration. Hemoglobin concentrations of blood samples obtained on day 0 and on day 4 were measured using azide methemoglobin method and comparatively shown for each guinea pig. The anti-C5a IgG group is shown with the solid bars and the control IgG group is shown with the broken bars. B. Analysis of anemic state according to red blood cell number. The red blood cell number was counted using a microscopic hemocytometer for day 0 samples and for day 4 samples (3 guinea pigs per group in this case). C. A representative histologic picture of bone marrow on day 4 of the control IgG administrated group (left side) or of the RP S19 oligomer-neutralized group with the anti-human C5a IgG (right side) (hematoxylin and eosin staining). The horizontal solid bars indicate 100 μm.

Fig. 6. Bloodletting-induced enhanced erythropoietic response in the mouse spleen. The bloodletting was performed from a retro-orbital venous plexus abstracting 0.1 ml blood on day 0. The mice were intraperitoneally injected with 0.1 mg of either anti-human C5a IgG or control rabbit IgG on day 1, day 2 and day 3. On day 4, the spleen was observed. A. The spleen weight was compared between the control rabbit IgG-treated group (n = 7) and the anti-human C5a IgG-treated group (n = 6) as mean value with S.D. bar. ** indicates P b 0.01. The horizontal broken line denotes average weight (102 mg) of normal mice (body weight 22 g). B. Histological demonstration of a representative spleen in each group. Images of hematoxylin–eosin staining at a low-power magnification (a, b) and at a high-power magnification (e, f), and of immune-peroxidase staining with Ter 119 rat monoclonal antibody against mouse glycophorin A-associated protein on erythroblasts at a low-power magnification (b, d) and at a high-power magnification (g, h). C. Fluorescence-activated cell sorting (FACS) analysis of the nucleated cell fraction of teased out spleen cells using fluorescein isothiocyanate (FITC)-conjugated Ter 119 IgG (TER 119-FITC) and phycoerythrin (PE)-conjugated anti-mouse C5a receptor IgG (CD88-PE). A representative result with the spleen of the control IgG-treated group or of the anti-human C5a IgG-treated group is shown in a. Cell numbers of Ter 119+ erythroblasts (b) or of Ter 119+ and C5a receptor+ erythroblasts (c) were compared between the control-IgG-treated group (n = 4) and the anti-C5a receptor IgG-treated group (n = 3). The column height indicates the mean value with S.D. bar. ** indicates P b 0.01.

J. Chen et al. / Experimental and Molecular Pathology 95 (2013) 364–375

of guinea pig femoral bone marrow. The extracellular fluid of guinea pig bone marrow also possessed monocyte chemotactic capacity, which was absorbed with the anti-C5a IgG beads (Fig. 2A) or with the anti-

371

RP S19 peptide IgG beads and with the anti-RP S19 IgG beads (Fig. 2B). Similar to the porcine samples, the guinea pig bone marrow fluid did not attract neutrophils (data not shown).

372

J. Chen et al. / Experimental and Molecular Pathology 95 (2013) 364–375

If the RP S19 oligomers in bone marrow are involved in erythropoiesis, the concentration of the oligomers in the marrow would be increased when erythropoiesis should be enhanced. To examine this, we induced blood loss anemia in guinea pigs by cardiac bloodletting (10% of the total blood volume, 1.6 ml in the case of 210 g body weight) under ether anesthesia. When we daily measured the hemoglobin concentration of the cardiac blood, the guinea pigs suffered from an anemic state on day 1 and day 2 after the bloodletting (day 0) and then almost recovered to the previous steady state on day 3 or day 4 (data not shown). We, therefore, prepared histologic sections of femoral bone marrow on day 3 after the bloodletting. As shown in Fig. 3A, a hyper-erythropoietic state was histologically observed. We also prepared a flush fluid of the femoral bone marrow on day 3 after bloodletting and measured the concentration of the RP S19 oligomers as the monocyte chemotactic capacity. As shown in Fig. 3B, the monocyte chemotactic capacity increased approximately 8-fold when compared to the normal concentration, as based on the concentration–function relation curve (figure interpolation). Total protein concentrations in the flush fluids of the normal and the day 3 after the bloodletting were almost the same (about 10.0 as absorbance at 280 nm wavelength). We confirmed these results using western blotting. The immunoreactive bands corresponding to the RP S19 oligomers in the flush solution became significantly stronger on the day 3 (Fig. 3C). These results indicated that the concentration of RP S19 oligomers in bone marrow significantly increased concomitant with the enhancement of erythropoiesis. Inhibition of bloodletting-induced erythropoietic response by neutralization of bone marrow RP S19 oligomers by means of systemic antibody administration To obtain direct evidence for the participation of the RP S19 oligomers during erythropoiesis in the bloodletting-induced hyper-erythropoiesis, we attempted to inhibit the function of the RP S19 oligomers in the bone marrow. We preliminary examined whether systemic administration of the anti-human C5a antibodies with an intraperitoneal bolus injection was effective to neutralize the RP S19 oligomers in bone marrow. We intraperitoneally injected 1 mg/guinea pig (body weight approximately 210 g) of the anti-human C5a IgG into two guinea pigs or the control IgG into a guinea pig, prepared the bone marrow flush solution of the femoral bones after 24 h, and measured the monocyte chemotactic capacities in the flush solutions. As shown in Fig. 4, the monocyte chemotactic capacity was decreased to 1/10th by the anti-human C5a IgG administration when judged from the concentration–function relation curves. We next performed the experiment in which anemic state by the cardiac bloodletting (10% of the total blood volume) was induced (day 0), with the intraperitoneal injection of the anti-C5a IgG or with the control IgG (1 mg/guinea pig) by bolus on day 2. We then obtained blood samples by cardiac puncture on day 4 and measured the blood hemoglobin concentration and red blood cell number. We compared the hemoglobin concentration and the red blood cell number between the initially phlebotomized blood and the day 4 blood in each guinea pig. As shown in Fig. 5A and 5B, all of the guinea pigs in the neutralizing antibodytreated group were still suffering from severe anemia, whereas all of the guinea pigs of the control group recovered to the steady state level. On day 4, we prepared histological specimens of femoral bone marrow in the two groups. Typical histologic images are shown in Fig. 5C; the hyper-hematopoietic state expressed by the control group was scarcely observed in the neutralized group. Confirmation of the erythropoietic response prevention by immunologic neutralization of RP S19 oligomers in mice In the mouse, different from the guinea pig, hematopoiesis enhancement is typically observed in the spleen as an enhanced extramedullary hematopoiesis. We confirmed the involvement of the RP S19

oligomers in blood loss-induced erythropoietic response using mice. The bloodletting was performed from a retro-orbital venous plexus under anesthesia abstracting 0.1 ml blood using a 1 ml syringe with 27 gage needle on day 0. The mice were intraperitoneally injected with 0.1 mg in 0.1 ml PBS of either anti-human C5a IgG or control rabbit IgG on day 1, day 2 and day 3. On day 4, the animals were exsanguinated under anesthesia, and the spleen was resected. A significant splenomegaly (around 175 mg) was observed in the control IgG-treated group. Average spleen weight was 102 mg in 20–22 g body weight normal mice at age 7 weeks. Making a striking contrast, the spleen size of the anti-C5a IgGtreated group was similar to that of normal mice (Fig. 6A). We histologically compared the spleens between the groups. As shown in Fig. 6B (a, c, e and f), histology with hematoxylin–eosin staining demonstrated that the splenomegaly in the control IgG-treated group was due to a hyperplasia of the sub-capsular hematopoietic region, and that the hyperplasia of hematopoietic region was not seen in the antiC5a IgG treatment group. In the mouse, erythroblasts and reticulocytes can be immunologically identified with an antibody against Ter119 antigen, a glycophorin A-associated protein (Kina et al., 2000). We, therefore, compared the intensity of erythropoiesis at the splenic sub-capsular area between the control IgG-treated group and the anti-C5a IgG-treated group by means of immunohistochemistry with Ter 119 antibody. As shown in Fig. 6B (b, g), abundant Ter 119+ cells were present in the control IgG-treated group, indicating the erythropoietic response against the blood loss. Making a striking contrast, the Ter119+ cell number was obviously reduced concomitant to the reduced size of the sub-capsular region in the anti-C5a IgG-treated group (Fig. 6B d, h). We next quantitated the Ter 119+ cell number in the teased out nucleated cell fraction of the spleen and compared the cell number between the control IgG-treated group and anti-C5a IgG-treated group by means of FACS analysis. As shown in Fig. 6C (a, b), the Ter 119+ cell number of the anti-C5a IgG-treated group was only a half of the control IgG-treated group. Our current results observed in the guinea pigs and in the mice clearly indicated the involvement of the RP S19 oligomers in the bloodlettinginduced erythropoietic response. Because the RP S19 oligomers exhibit the functions as a ligand of the C5a receptor (CD88) (Yamamoto, 2007), we also quantitatively observed the C5a receptor bearing cells during the FACS analysis of the Ter 119+ cells in the spleen. As shown in Fig. 6C (a, c), about 75% of the Ter119+ cells were also CD88+, suggesting an effect of the RP S19 oligomers direct to erythroblasts in addition to the possible indirect effect via the central macrophage of erythroblastic island.

Inhibition of blood loss-induced erythropoietic response by systemic administration of C5a receptor antagonist The above result that majority of erythroblasts bore the C5a receptor on the cell surface must have suggested that the systemic administration of a C5a receptor antagonist would also retard the recovery from blood loss-induced anemia. We examined this assumption in our guinea pig bloodletting model. With reference to a previous report in rats (Recknagel et al., 2012), we intraperitoneally injected a C5a receptor antagonist, NMePhe-Lys-Pro-dCha-dChadArg, at 0.2 mg/guinea pig twice on day 2 and day 3 after the bloodletting (10% of the total blood volume) on day 0. Control guinea pigs were treated in the same way except for the injection of vehicle PBS instead of the antagonist solution. On day 4, we sampled the blood by cardiac puncture and measured the hemoglobin concentration and the red blood cell number. As shown in Fig. 7, the C5a receptor antagonist-treated guinea pigs were still suffering from anemia, whereas the vehicle-injected control animals recovered to the steady state level.

J. Chen et al. / Experimental and Molecular Pathology 95 (2013) 364–375

373

Fig. 7. Inhibition of blood loss-induced erythropoietic response by systemic administration of C5a receptor antagonist. Cardiac puncture was performed to abstract 10% of the circulating blood on day 0, and the guinea pigs were then randomly separated into two groups as Fig. 5. One group (6 guinea pigs, shown by solid bars) was treated with a C5a receptor antagonist, NMePhe-Lys-Pro-dCha-dCha-dArg, at 0.2 mg/guinea pig twice on day 2 and day 3 by intraperitoneal bolas injections, and the other group (3 guinea pigs, shown by broken bars) was treated in the same way but with vehicle PBS. On day 4, cardiac puncture was performed again in each animal to sample blood. The changes of hemoglobin concentration and blood cell number are shown in A and B, respectively.

Expression of C5a receptor gene in human erythroblasts We finally confirmed the C5a receptor gene expression in human erythroid precursor cells such as proerythroblasts and erythroblasts. We initially used human bone marrow cells for the mRNA analyses. In combination with centrifugal density fractionation and antibodybead separation for glycophorin A bearing cells, we separated the proerythroblasts and basophilic erythroblasts (low-density (less than 1.070) glycophorin A+ cells), polychromatophilic erythroblasts (intermediate-density (1.070–1.080) glycophorin A+ cells), and mature normochromatophilic erythroblasts (high-density (over 1.080) glycophorin A+ cells), as described previously (Oda et al., 2010). Using the total RNA preparation of each erythroblast fraction as the temperate, we performed a quantitative RT-PCR analysis for the C5a receptor mRNA. As shown in Fig. 8A (a), significant amounts of C5a receptor mRNA were detected in these erythroblast fractions. As described above, we presumed that the extracellular RP S19 oligomers are generated by the cross-linking action of type 2 transglutaminase in the maturating proerythroblasts and erythroblasts and then extracellularly released. If this is the case, the type 2 transglutaminase gene should be expressed in the erythrocyte precursors. We also examined this by quantitative RT-PCR utilizing the RNA preparation of each erythroblast fraction. As shown in Fig. 8A (b), significant expression of type 2 transglutaminase was observed in the proerythroblast and erythroblast fractions. It has been established that neonatal cord blood contains a significant number of erythroblasts (Hermansen, 2001). We prepared the nucleated cell fraction of cord blood from 3 healthy new-borns, removed CD45+ leukocyte lineage cells, and subjected the remained cell fraction to FACS analysis with a set of anti-glycophorin A (CD235a) IgG and antiC5a receptor (CD88) IgG. As shown in Fig. 8B (a, b), about 90% of the glycophorin A+ erythroblasts and proerythroblasts possessed the C5a receptor on the cell surface. Discussion In the present study, we found the presence of a monocyte chemoattraction factor in the extracellular fluid of porcine and guinea pig

bone marrow. The chemotactic factor did not attract neutrophils (Fig. 1D) but did react with anti-human C5a antibodies and anti-RP S19 antibodies (Figs. 1B, C and 2A, B) and demonstrated molecular sizes in increments of 16 kDa in our western blot analysis (Figs. 1E and 3C). Therefore, these molecules were indistinguishable from the cross-linked RP S19 oligomers functionally, immunologically and physicochemically (Yamamoto, 2000, 2007). The extracellular concentration of the RP S19 oligomers in bone marrow was increased several fold concomitant with the enhanced erythropoiesis that was caused by bloodletting (Fig. 3B). When the bone marrow RP S19 oligomers were neutralized by the systemic administration of anti-human C5a antibodies, the stress erythropoiesis in the bone marrow was prevented (Fig. 5C), resulting in a retardation of the anemic state (Figs. 5A, B). Similar results were observed on the extramedullary erythropoiesis in the mouse spleen upon the bloodletting (Fig. 6). The histological observation as well as FACS analysis of the mouse spleen with Ter 119 antibody indicated decrement of the erythroblast number when the RP S19 oligomers were immunologically neutralized. The previous study using the in vitro culture system indicated the role of the RP S19 oligomers played in the erythroblastic island formation (Nishiura et al., 2012) as described in the Introduction section. Iavarone et al. (2004) successfully observed erythroblastic islands in the mouse fetal liver by means of double immunostaining with Ter 119 for erythroblasts and F4/80 for central macrophages. Although we attempted to apply their method to observe the erythroblastic island in the adult mouse spleen, the immunologic reactivity of putative central macrophages was not good enough to be identified. In any case, when the present result with the reduced number of erythroblasts in the spleen of the RP S19 oligomer-neutralized group was concerned, a possibility raised is that erythroblasts which fail to interact with the central macrophage of erythroblastic island would undergo apoptosis. This should be experimentally tested in the future. The reason why we chose anti-human C5a antibodies rather than anti-RP S19 antibodies to neutralize the RP S19 oligomers in vivo was as follows: although anti-human C5a antibodies preferentially react to cross-linked RP S19 oligomers, anti-RP S19 antibodies react to both the RP S19 monomer and RP S19 oligomers (Nishiura et al., 2010). Due to the presence of RP S19 monomer in blood

374

J. Chen et al. / Experimental and Molecular Pathology 95 (2013) 364–375

Fig. 8. Presence of C5a receptor on the surface of human erythroblasts. A. C5a receptor and type 2 transglutaminase gene expressions in proerythroblast and erythroblast fractions of bone marrow aspirate. The erythroid precursor cells in heparinized bone marrow aspirate of 6 patients with non-hematopoietic disorders (age 28 to 38) were separated into 3 fractions according as the glycophorin A positivity (GPA) and the different densities. The low-density (less than 1.070) (GPA-L), intermediate-density (1.070 to 1.080) (GPA-I) and high-density (over 1.080) (GPA-H) fractions were composed of proerythroblasts and basophilic erythroblasts, polychromatophilic erythroblasts and mature normochromatophilic erythroblasts, respectively. After separation of the total RNA from each cell fraction, mRNA of C5a receptor (C5aR), type 2 transglutaminase (Transglut. 2) and porphobilinogen deaminase (PBGD) were measured by real-time quantitative reverse transcriptase-polymerase chain reaction using primers shown in Table 1. PBGD, which is a housekeeping gene, was measured as an internal standard, and the C5aR (a) and Transglut. 2 (b) mRNA expression levels are indicated as the relative copy number/PBGD (mean value with S.E. bar). B. Detection of C5a receptor on the cell surface of glycophorin A+ erythroblasts in umbilical cord blood. Circulating erythroblast-contained mononuclear cell fraction of cord blood of 3 healthy new-borns was prepared by a density centrifugation method, and CD45+ leukocyte lineage cells in it were sorted out by FACS. Remaining cells were subjected for FACS analysis with a set of PE-conjugated anti-glycophorin A IgG (CD235a-PE) and FITC-conjugated anti-C5a receptor IgG (CD88-FITC). A representative pattern is shown in a, and statistical data for 3 neonatal blood on the cell type ratio separated in each quadrant is shown in b. The column height indicates the mean value with S.D. bar. *** indicates P b 0.001.

plasma (Ota et al., 2011; Semba et al., 2010), the anti-RP S19 antibodies would be exhausted by the plasma RP S19 monomer before reaching the bone marrow extravascular tissue space. Thus, we successfully neutralized the bone marrow RP S19 oligomers by a bolus intraperitoneal injection of anti-human C5a IgG at 1 mg/guinea pig with body weights approximately 210 g or by daily injection for 3 days at 0.1 mg/mouse with body weight 20–22 g. The present experimental results indicated the involvement of RP S19 oligomers in blood loss-induced stress erythropoiesis. The other extraribosomal functions of the RP S19 oligomers, such as monocyte attraction and apoptosis promotion, are via C5a receptor

ligation. The effect of the RP S19 oligomers on erythropoiesis also seems to occur through the C5a receptor because the systemic administration of C5a receptor antagonist also retarded anemia after bloodletting (Fig. 7). As the C5a receptor-bearing cells are involved in erythropoiesis, one would assume the central macrophage of erythroblastic island. In addition to this, we expected the expression of the C5a receptor gene in proerythroblasts and erythroblasts present in the erythroblastic island to be analogous to the expression of this gene in the apoptosisinitiated cells. In the current study, we separated a fraction composed of proerythroblasts and basophilic erythroblasts, a polychromatophilic

J. Chen et al. / Experimental and Molecular Pathology 95 (2013) 364–375

erythroblast fraction and a mature normochromatophilic erythroblast fraction. The erythrocyte precursors in all of the fractions possessed significant amounts of the C5a receptor transcript (Fig. 8). The presence of the C5a receptor protein on the cell surface of the human erythroblasts was confirmed using neonatal cord blood (Fig. 8). The presence of RP S19 oligomers in the extracellular fluid of normal bone marrow of porcine and guinea pig and the existence of the C5a receptor on normal human as well as mouse erythroblasts suggest the involvement of RP S19 oligomers and C5a receptor in steady-state erythropoiesis. However, the evidence from our manipulation experiments in guinea pigs and in mice is limited to blood loss-induced stress erythropoiesis and does not address steady-state erythropoiesis. There are two reasons for why we have limited the manipulation study to stress erythropoiesis. First, the blood sampling itself would more or less cause blood loss in the small-sized experimental animals. Second, with regard to the life span of red blood cells (the durations in guinea pigs and in mouse are unknown, yet is 120 days in humans and 60 days in rats), the long-term immunologic neutralization of the RP S19 oligomers, which should be maintained for some weeks to induce a significant influence on the peripheral blood, might cause unexpected adverse effects. Conflict of interest statement This research was performed in part under a joint research program between Kumamoto University and Chugai Pharmaceutical Co., LTD. There is no matter to be disclosed about personal interest of the authors. Acknowledgments We thank Ms. T. Kubo for her technical assistance in the histological preparations. This work was supported by a Grant-in Aid for Scientific Research C (KAKENHI 21590441 to T. Y.) from the Ministry of Education, Culture, Sports, Science, and Technology, Japan. References Carlile, G.W., et al., 2004. Caspase-3 has a nonapoptotic function in erythroid maturation. Blood 103, 4310–4316. Chasis, J.A., Mohandas, N., 2008. Erythroblastic islands: niches for erythropoiesis. Blood 112, 470–478. Droin, N., et al., 2008. A role for caspases in the differentiation of erythroid cells and macrophages. Biochimie 90, 416–422. Falk, W., et al., 1980. A 48-well micro chemotaxis assembly for rapid and accurate measurement of leukocyte migration. J. Immunol. Methods 33, 239–247. Fernandez, H.N., Hugli, T.E., 1978. Primary structural analysis of the polypeptide portion of human C5a anaphylatoxin. Polypeptide sequence determination and assignment of the oligosaccharide attachment site in C5a. J. Biol. Chem. 253, 6955–6964. Flygare, J., et al., 2007. Human RPS19, the gene mutated in Diamond-Blackfan anemia, encodes a ribosomal protein required for the maturation of 40S ribosomal subunits. Blood 109, 980–986. Gerard, N.P., Gerard, C., 1991. The chemotactic receptor for human C5a anaphylatoxin. Nature 349, 614–617. Hermansen, M.C., 2001. Nucleated red blood cells in the fetus and newborn. Arch. Dis. Child. Fetal Neonatal Ed. 84, F211–F215. Horino, K., et al., 1998. A monocyte chemotactic factor, S19 ribosomal protein dimer, in phagocytic clearance of apoptotic cells. Lab. Invest. 78, 603–617. Iavarone, A., et al., 2004. Retinoblastoma promotes definitive erythropoiesis by repressing Id2 in fetal liver macrophages. Nature 432, 1040–1045. Idol, R.A., et al., 2007. Cells depleted for RPS19, a protein associated with Diamond Blackfan Anemia, show defects in 18S ribosomal RNA synthesis and small ribosomal subunit production. Blood Cells Mol. Dis. 39, 35–43. Ishizaki, Y., et al., 1998. A role for caspases in lens fiber differentiation. J. Cell Biol. 140, 153–158.

375

Kawane, K., et al., 2001. Requirement of DNase II for definitive erythropoiesis in the mouse fetal liver. Science 292, 1546–1549. Kina, T., et al., 2000. The monoclonal antibody TER-119 recognizes a molecule associated with glycophorin A and specifically marks the late stages of murine erythroid lineage. Br. J. Haematol. 109, 280–287. Kolbus, A., et al., 2002. Raf-1 antagonizes erythroid differentiation by restraining caspase activation. J. Exp. Med. 196, 1347–1353. Konteatis, Z.D., et al., 1994. Development of C5a receptor antagonists. Differential loss of functional responses. J. Immunol. 153, 4200–4205. Laemmli, U.K., 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227, 680–685. Matsubara, S., et al., 1991. Complement C4-derived monocyte-directed chemotaxisinhibitory factor. A molecular mechanism to cause polymorphonuclear leukocytepredominant infiltration in rheumatoid arthritis synovial cavities. Am. J. Pathol. 138, 1279–1291. McGrath, et al., 2008. Enucleation of primitive erythroid cells generates a transient population of “pyrenocytes” in the mammalian fetus. Blood 111, 2409–2417. Nishimura, T., et al., 2001. Apoptotic cells of an epithelial cell line, AsPC-1, release monocyte chemotactic S19 ribosomal protein dimer. J. Biochem. 129, 445–454. Nishiura, H., et al., 1996. Monocyte chemotactic factor in rheumatoid arthritis synovial tissue. Probably a cross-linked derivative of S19 ribosomal protein. J. Biol. Chem. 271, 878–882. Nishiura, H., et al., 1998. S19 ribosomal protein cross-linked dimer causes monocytepredominant infiltration by means of molecular mimicry to complement C5a. Lab. Invest. 78, 1615–1623. Nishiura, H., et al., 1999. Determination of the cross-linked residues in homodimerization of S19 ribosomal protein concomitant with exhibition of monocyte chemotactic activity. Lab. Invest. 79, 915–923. Nishiura, H., et al., 2005. S19 ribosomal protein dimer augments metal-induced apoptosis in a mouse fibroblastic cell line by ligation of the C5a receptor. J. Cell. Biochem. 94, 540–553. Nishiura, H., et al., 2009. Pro- and anti-apoptotic dual functions of the C5a receptor: involvement of regulator of G protein signaling 3 and extracellular signal-regulated kinase. Lab. Invest. 89, 676–694. Nishiura, H., et al., 2010. Base of molecular mimicry between human ribosomal protein S19 dimer and human C5a anaphylatoxin. Int. Immunopharmacol. 10, 1541–1547. Nishiura, H., et al., 2011. Maintenance of ribosomal protein S19 in plasma by complex formation with prothrombin. Eur. J. Haematol. 86, 436–441. Nishiura, H., et al., 2012. Dual functions of the C5a receptor as a connector for the K562 erythroblast-like cell-THP-1 macrophage-like cell island and as a sensor for the differentiation of the K562 erythroblast-like cell during hemin-induced erythropoiesis. Clin. Dev. Immunol. http://dx.doi.org/10.1155/2012/187080. Oda, Y., et al., 2008. Agonistic and antagonistic effects of C5a-chimera bearing S19 ribosomal protein tail portion on the C5a receptor of monocytes and neutrophils, respectively. J. Biochem. 144, 371–381. Oda, M., et al., 2010. Establishment of culturing system for ex-vivo expansion of angiogenic immature erythroid cells, and its application for treatment of patients with chronic severe lower limb ischemia. J. Mol. Cell. Cardiol. 49, 347–353. Ota, Y., et al., 2011. Role of ribosomal protein S19-like plasma protein in blood coagulum resorption. Exp. Mol. Pathol. 90, 19–28. Porcine genome sequencing project. Nov-2009 submitted to the EMBL/GenBank/DDBJ database. Prchal, J.T., 2010. Chap. 31 production of erythrocytes, Williams Hematology, 8th ed., pp. 435–447. Recknagel, S., et al., 2012. C5aR-antagonist significantly reduces the deleterious effect of a blunt chest trauma on fracture healing. J. Orthop. Res. 30, 581–586. Semba, U., et al., 2010. A plasma protein indistinguishable from ribosomal protein S19: conversion to a monocyte chemotactic factor by a factor XIIIa-catalyzed reaction on activated platelet membrane phosphatidylserine in association with blood coagulation. Am. J. Pathol. 176, 1542–1551. Shi, L., et al., 2005. Monocyte chemotactic S19 ribosomal protein dimer in atherosclerotic vascular lesion. Virchows Arch. 447, 747–755. Umeda, Y., et al., 2004. Guinea pig S19 ribosomal protein as precursor of C5a receptordirected monocyte-selective leukocyte chemotactic factor. Inflamm. Res. 53, 623–630. Willig, T.N., et al., 1999. RPS19 gene in Mus musculus and Drosophila melanogaster, and conserved features among 40 different species. Submitted (DEC-1999) to the EMBL/GenBank/DDBJ databases . Yamamoto, T., 2000. Molecular mechanism of monocyte predominant infiltration in chronic inflammation: mediation by a novel monocyte chemotactic factor, S19 ribosomal protein dimer. Pathol. Int. 50, 863–871. Yamamoto, T., 2007. Roles of the ribosomal protein S19 dimer and the C5a receptor in pathophysiological functions of phagocytic leukocytes. Pathol. Int. 57, 1–11. Yoshida, T., et al., 2005. Expression of immunological molecules by cardiomyocytes and inflammatory and interstitial cells in rat autoimmune myocarditis. Cardiovasc. Res. 68, 278–288. Zermati, Y., et al., 2001. Caspase activation is required for terminal erythroid differentiation. J. Exp. Med. 193, 247–254.