Isolation and characterization of antagonist and agonist peptides to the human melanocortin 1 receptor

Peptides 26 (2005) 2302–2313

Isolation and characterization of antagonist and agonist peptides to the human melanocortin 1 receptor St´ephane Bonetto a , Isabelle Carlavan b , Daniel Baty a,∗ a

Institut de Biologie Structurale et Microbiologie, Laboratoire d’Ing´enierie des Syst`emes Macromol´eculaires, UPR9027, CNRS, 31 chemin Joseph Aiguier, 13402 Marseille Cedex 20, France b Galderma R&D Les templiers 2400 route des Colles 06410 Biot, France Received 8 March 2005; received in revised form 11 April 2005; accepted 12 April 2005 Available online 11 May 2005

Abstract We identified a large number of peptide mimotopes of the adrenocorticotropic hormone (ACTH) and the ␣-melanocyte stimulating hormone (␣-MSH) to analyze better the structure–function relationships of these hormones with the human MC1 receptor (hMC1R). We have investigated the use of phage-display technology to isolate specific peptides of this receptor by using three monoclonal anti-ACTH antibodies (mAbs). A library of 108 phage-peptides displaying randomized decapeptides was constructed and used to select phage-peptides that bind to mAbs. Forty-five phage-peptides have been isolated and from their amino acid sequences, we have identified two consensus sequences, EXFRWGKPA and WGXPVGKP, corresponding to the regions 5–13 and 9–16 of ACTH, respectively. A biological assay on cells expressing the hMC1-R was developed to determine the capacity of phage-peptides to stimulate the receptor. Only two phage-peptides showed detectable activity. Thirty-one peptides were synthesized to analyze their biological effect. We identified two weak agonists, EC50 = 16 and 11 ␮M, two strong agonists, EC50 = 25 and 14 nM and a partial antagonist, IC50 = 36 ␮M. This work confirmed the modulator agonist role of the regions 11–12 of ␣-MSH and ACTH, and the importance of the methionine residue at position 4 for the stimulation of the hMC1-R. We also identified analogues of the regions 8–17 of ACTH that exhibited a weak activator effect, and of one analogue of the N-terminal regions 1–9 of ACTH and ␣-MSH having a partial antagonist effect. These results may be useful in the development of potential agonists or antagonists of the hMC1R. © 2005 Elsevier Inc. All rights reserved. Keywords: Melanocortin; ␣-MSH; ACTH; Agoniste; Antagoniste; hMC1R; Phage-display; Mimotope

1. Introduction ␣-Melanocyte stimulating hormone (␣-MSH) is a linear peptide of 13 amino acids (Ac–Ser–Tyr–Ser–Met–Glu–His– Phe–Arg–Trp–Gly–Lys–Pro–Val–NH2 ). It is synthesized and released from the pars intermediate of the pituitary gland and large peripheral tissues in mammals [39]. This hormone belongs to a family of five peptides (␣-MSH, ␤-MSH, ␥MSH, ␦-MSH and adrenocorticotropic hormone (ACTH)) called melanocortins, which are derived from the proteolytic cleavage of the hormone precursor pro-opiomelanocortin [7,41]. ␣-MSH plays a significant biological role in pig∗

Corresponding author. Tel.: +33 4 91 16 41 17; fax: +33 4 91 71 21 24. E-mail address: [email protected] (D. Baty).

0196-9781/$ – see front matter © 2005 Elsevier Inc. All rights reserved. doi:10.1016/j.peptides.2005.04.002

ment dispersion in lower vertebrates and in melanogenesis in several mammalian cell types [23,40]. It has also been shown to have numerous neurophysiological and neuroimmunological activities [9,11,15,18,22,62,69]. The effects of ␣-MSH on pigmentation are mediated by the melanocortin 1 receptor (MC1R) [12,44], whereas ACTH regulated adrenal steroid production is mediated by the MC2R [8,14,44]. There are five receptor subtypes known in the melanocortin family (MC1R to MC5R). These receptors belong to the super family of G-protein coupled receptors (GPCRs). However, they have some atypical structural features compared with other GPCRs [49]. For example, the MC1R is part of the smallest known GPCR and presents a very short amino-terminal extracellular domain [14]. In spite of the complex distribution of melanocortin receptors, a relationship between these

S. Bonetto et al. / Peptides 26 (2005) 2302–2313

receptors and the biologic effects of their ligands has often been established. Moreover, the ability of different melanocortin hormones to stimulate more than one subtype of receptors with near equal potency make their study even more complicated. Many ␣-MSH analogues have been developed to understand the mechanisms of interaction of melanocortins with their receptors. However, many of these studies have used amphibian or reptilian bioassays, and are thus not necessarily valid for mammalian cellular systems. Many analogues have been identified with agonist or antagonist activities associated with prolonged activity and enhanced metabolic stability [2,3,5,26,27,30,34,35,50,65]. For example, NDP-MSH, a potent ␣-MSH analogue, is a 13 amino acid peptide containing a norleucine residue at position 4 and a d-phenylalanine residue at position 7 [55,57]. This peptide is 10 times more active than ␣-MSH in biological assays with lower vertebrate melanophores [28], and with all subtypes of mammalian receptors [29]. Cyclic compounds were also developed, such as MT-II, which has an activity comparable to that of NDPMSH [2,3]. This has led to the development of the first strong antagonists [35,38,58,60]. Despite the numerous structure–activity studies carried out during the last 20 years on the ␣-MSH analogues bound to their receptors, the binding and/or trigger response elements of the hormone have not yet been precisely characterized [10,29,31,45,47,50,53,54]. However, precise characterization should allow the development of more specific agonists and more powerful antagonists, facilitating the study of the physiological functions of different subtypes of receptors. All melanocortins contain the tetrapeptide His–Phe–Arg– Trp, called the pharmacophore, which is the smallest active fragment able to bind to the receptor and generate a melanotropic response [10,33]. Developing new peptide ligands for the MCR may require: (i) a rational approach using structural modeling and empirical design of melanocortins and their analogues; (ii) high throughput screening [37,51,64]. Phage-display technology is an alternative method for selecting proteins and peptides from libraries [16]. The genome of a filamentous bacteriophage is engineered to encode a random peptide or protein and display it on its surface [13,63]. Originally used for epitope mapping and now developed further [46,61], this allows the study of molecular interactions between peptides, structural domains or antibody fragments with proteins [6,17,19,52,66], nucleic acids [36], organic compounds such as biotin [24], steroid hormones [70] or carbohydrates [59]. Phage-display technology has already been used in the identification of new ligands, which bind human MC1 receptor (hMC1R) expressed at the surface of insect cells [64]. In this study, a partially randomized peptide library of low diversity (105 clones) was used to identify an ␣-MSH analogue highly selective for the MC1R (Ki = 7.6 nM), but with a weak agonist activity (EC50  10 ␮M). This peptide, called MS 04, was used as a lead in the design of new peptides [65].

2303

In our study, we used phage-display technology to select new ligands able to modulate the activity of the hMC1-R overexpressed at the surface of HEK-293 cells. As the hMC1R is very difficult to purify, we selected peptides using three mAbs directed against the N-terminal fragment of the human ACTH. The epitopes recognized by these mAbs are unknown. The screening of a decapeptide library expressed at the surface of the filamentous phage fd allowed us to identify 45 mimotopes of ACTH and ␣-MSH, classified into two groups on the basis of consensus sequences. The analysis of these mimotopes in the phage context (phage-peptide) in a bioactivity assay led to the identification of two strong phage-peptide agonists. The analysis of 31 synthetic peptides led to the characterization of two other weak agonists and one partial antagonist. This study should allow us to understand better the structure–function relationships of ACTH and ␣-MSH with hMC1R. The data obtained with the selected peptides may allow the development of stronger agonist or antagonist molecules.

2. Materials and methods 2.1. Cloning procedures and construction of the decameric library The replicative form (RF) of the fd-tet-DOG1 phage [32] was purified by CsCl-ethidium bromide gradient centrifugation [42]. After four phenol extractions and isopropanol precipitation, the RF (500 ␮g) was digested with ApalI (700 U) and NotI (700 U) (NE BioLabs, MA, USA). The digestion products were purified by phenol extraction and ethanol precipitation. We isolated double stranded DNA containing a degenerate sequence flanked by two cloning sites, by carrying out PCR with two oligonucleotides (Primer-31 and Primer77) mixed together in 100 ␮l PCR reaction buffer with 1 mM dNTP and 20 units of Dynazyme (Finn-zymes, Helsinki, Finland). We used 200 pmol of Primer-77 and 700 pmol of the template and Primer-33 for each reaction in a T Gradient thermocycler (Biometra, Goettingen, Germany). The DNA was denatured for 3 min at 95 ◦ C and subjected to 30 cycles of annealing (48 ◦ C for 1 min) and elongation (72 ◦ C for 1 min). The reaction product was then extracted, precipitated and digested 16 h at 37 ◦ C with ApalI (10 U) and NotI (10 U). The cleaved fragment was isolated by electrophoresis on a 15% (w/v) polyacrylamide gel, excised and purified by diffusion in PBS for 16 h at 20 ◦ C with gentle shaking. We ligated 300 ␮g of digested RF with 5 ␮g of purified fragment (molar ratio vector/insert 1:3), using T4 DNA ligase (6 U) (NE BioLabs, MA, USA) in a final volume of 200 ␮l for 16 h at 20 ◦ C. The ligation product was phenol extracted, ethanol precipitated and resuspended in 300 ␮l of TE buffer, and finally used to electrotranfect competent TG1 cells (StraTagen, WA, USA). For each transformation, 2 ␮l of ligation product was added to 40 ␮l of electrocompetent cells which were

2304

S. Bonetto et al. / Peptides 26 (2005) 2302–2313

electroporated with a micropulser (Bio-Rad, CA, USA) at 1700 V/cm, 200 ohms, 25 ␮F for 5 ms in 0.1 cm cuvette [20]. The efficiency of the transformation is about 106 clones/␮g of ligation product. Electroporated TG1 cells were then incubated for 1 h at 37 ◦ C in 1 ml of 2YT containing 20 ␮g tetracycline/ml then plated on 2YT agar plates containing 20 ␮g tetracycline/ml, and grown for 16 h at 37 ◦ C. The diversity of the library was controlled by sequencing the decapeptide region of 100 bacterial clones with the primer Fuse-3P (CCCTCATAGTTAGCGTAACG) in an ABI Prism analyser (Applied Biosystems, CA, USA). 2.2. Phage-peptides production Cells containing phage were grown for 16 h at 37 ◦ C in 500 ml of 2YT medium containing 20 ␮g tetracycline/ml. The culture was then centrifuged twice at 6000 × g and 7000 × g for 10 min at 4 ◦ C. The culture supernatant containing phage particles was precipitated twice with 0.15 vol. of 16.7% (w/v) PEG 8000, 3.3 M NaCl at 4 ◦ C, under slight agitation for 16 h and then 1 h, respectively. The solution was then centrifuged at 12,000 × g for 20 min at 4 ◦ C. The pellet containing phage was resuspended in 1 ml PBS buffer (0.14 M NaCl, 0.01 M phosphate buffer, pH 7.4). All produced phages were mixed, passed through a 0.45 ␮m pore filter and stored at 4 ◦ C. The titer of each production was estimated at 1 × 1013 transducing units (TU) per ml. 2.3. Biotinylation of antibodies We used three monoclonal anti-human ACTH (Nterminal) antibodies: A2H8 (Serotec, Oxford, UK), 57 (Research Diagnostic Inc., NJ, USA) and FZ10-A32 (Europa Bioproducts Ltd., Cambridge, UK) to isolate the phagepeptides. We dialyzed 500 ␮g of each mAb against PBS for 16 h at 4 ◦ C and biotinylated with biotin-7-NHS (Biotin Protein Labeling Kit; Roche Diagnostic, Basel Switzerland) according to the manufacturer’s instructions. The concentrations of biotinylated mAb were determined by colorimetic assay (Bio-Rad, CA, USA). Biotinylation efficiency was followed by ELISA using microtiter plates coated with streptavidin (ThermoLabsystem, Helsinki, Finland) and detected with a mAb anti-mouse horseradish peroxydase-conjugated antibody. The integrity of the antibodies was also verified by SDS/PAGE. 2.4. Selection of mimotopes A library sample containing 1011 infectious particles was subjected to three rounds of selection and amplification. For each round of affinity selection, 20 ␮g of the biotinylated mAbs was incubated with phage-peptides (previously equilibrated with 4% (w/v) powdered milk for 1 h at 20 ◦ C) in 500 ␮l of PBS for 1 h at 20 ◦ C with gentle shaking. This mixture was incubated with 1 mg of streptavidin-coated paramagnetic beads (Dynabeads M-280 Streptavidin; Dynal Biotech,

Oslo, Norway) (previously equilibrated with 4% (w/v) powdered milk for 2 h at 20 ◦ C) for 30 min at 20 ◦ C with gentle shaking. The beads were washed five times with PBS/4% powdered milk, five times with PBS/0.1% Tween-20 and five times with PBS, and finally resuspended in 100 ␮l of PBS. Specific phage-peptides were then amplified by infecting a logarithmic phase culture of the E. coli TG1 strain (
(lacpro), supE, thi, hsdD5/F , traD36, proAB, lacIq , lacZ
M15). Most of the eluted phages were grown for 16 h at 37 ◦ C in 100 ml 2YT containing 20 ␮g/ml tetracycline whereas a small portion was titered. After three rounds of selection, individual colonies containing phage were picked and grown for 16 h at 37 ◦ C in 96-well microtiter plates (Nunclon; Milian, Geneva, Switzerland). The plates were centrifuged (1000 × g) and we analyzed by ELISA specific binding to mAbs of the phagepeptides contained in the supernatants. 2.5. Phage-MSH construction The control phage-MSH was constructed by PCR using paired oligonucleotides 5 -MSH (TCGATCAAGCACAGTGCACAGTCCTACTCCATGGAGCATTTC) and 3 -MSH (GTGAAAGTTTCTGCGGCCGCACCACCGCCCACCGGCTTCCAGCGGAAATGCTCC ATGGAGTA). After amplification and purification of the product cleaved by ApalI and NotI, the fragment was ligated with the fd-tet-DOG1 between the peptide leader sequence and the fd-gene 3. This phage-control displayed at its surface the unmodified ␣-MSH peptide fused to the N-terminus of the phage protein 3. 2.6. Phage ELISA We analyzed the binding of antibodies to phage-peptides using ELISA. Microtiter plates (Maxisorp, Nunc) were coated by incubation with 100 ␮l of a 1:1000 dilution of mAb in 0.1 M NaHCO3 , pH 8.6 at 4 ◦ C for 16 h. The coated plates were washed twice with PBS/0.1% Tween-20 and incubated with 200 ␮l of blocking solution (4% powdered milk/0.1 M NaHCO3 ) for 2 h at 20 ◦ C with gentle shaking. The wells were washed three times with PBS/0.1% Tween20 and then three times with PBS. We mixed 150 ␮l of individual phage-peptide with 50 ␮l of PBS/8% powdered milk, added this to microtiter wells and incubated the plates for 2 h at 20 ◦ C with shaking. After washing three times with PBS/0.1% Tween-20 and three times with PBS, bound phage-peptides were detected by incubation with 100 ␮l of a mouse anti-M13 horseradish peroxidase-conjugated antibody (Amersham Pharmacia Biotech) diluted 1:5000 in PBS/4% powdered milk, for 1 h at 20 ◦ C with gentle shaking. After washing three times with PBS/0.1% Tween-20 and three times with PBS, bound antibodies were monitored by determining peroxidase activity using 3,3 -diaminobenzidine tetrahydrochloride used as the substrate, by measurement of absorbance at 405 nm. Each assay was performed in triplicate, subtracting the blank.

S. Bonetto et al. / Peptides 26 (2005) 2302–2313

2.7. Competitive binding assays between phage-peptides and hormones Phage-peptides from positive clones (obtained from phage ELISA) were produced for 16 h in 100 ml of 2YT, purified by PEG/NaCl precipitation and resuspended in 1 ml PBS buffer. Microtiter plates were incubated for 16 h at 4 ◦ C with mAbs (1 ␮g/ml) in 0.1 M NaHCO3 . ELISA was performed by incubation of the plates for 16 h at 4 ◦ C with the ␣-MSH (Sigma–Aldrich) or ACTH1–17 (fragments 1–17 of ACTH, Sigma–Aldrich) peptides, used as competitors, with phage-peptides. After washing, bound phages were detected as described above. Each competitive binding assay was performed in triplicate. Infected bacterial clones corresponding to positive phage-peptides were grown and the phage DNA was isolated and sequenced using ABI Prism apparatus. 2.8. Synthetic peptides N- and C-terminus modified (acetylation and amidation, respectively) peptides were purchased from Eurogentec (Seraing, Belgium). For bioassays, the peptides were resuspended in either PBS buffer or DMSO (100%) depending of their solubility, at a final concentration of 1 mM. 2.9. hMC1R plasmid construction Total RNA from normal human epidermal melanocytes (Cambrex Bioproducts, Verviers, Belgium) was extracted and purified (Qiashredder and RNeasy kits, Qiagen, Germany), then reverse-transcribed to produce the first-strand cDNA with the Omniscript RT Kit (Qiagen) according to the manufacturer’s instructions. The second strand was synthesized by PCR using AccuPrime Pfx DNA polymerase (Invitrogen, CA, USA) and two primers flanked by the two cloning sites KpnI (sense primer CGGGGTACCACCATGGCTGTGCAGGG ATCCCAG) and XhoI (antisense primer CGGCTCGAGTCACCAGGAGCATGTCAGCAC). The reaction product was then precipitated and digested with KpnI and XhoI. After electrophoresis on polyacrylamide gel and purification with Qiaquick PCR purification Kit (Qiagen), the gene fragment coding for hMC1R was inserted into the expression vector pcDNA3.1 (Invitrogen). 2.10. Transfection of the cell lines HEK-293 Stable transfections were performed using two plasmids: the pcDNA3.1hMC1 containing the human MC1R gene and the geneticin resistance gene, and the pCRE-Luc (Clontech, CA, USA) carrying the luciferase gene reporter. Approximately 7 × 106 mammalian HEK-293 cell lines [25] were plated in 10 cm dish and incubated for 16 h before transfection. The cells were cotransfected in OPTI-MEM medium with 10 ␮g of pCRE-Luc and 1 ␮g of pcDNA3.1hMC1, using Lipofectamine 2000 (Invitrogen) at a ratio of 1:3 (w/v) (cDNA/ Lipofectamine 2000) according to the manufac-

2305

turer’s instructions. After 16 h incubation, 1 mg/ml of G-418 (Geneticin, Invitrogen) was added to the medium and the cells were incubated for approximately 2 weeks at 37 ◦ C in a humidified atmosphere of 5% CO2 /air. The stable positive clones were selected by measuring the luciferase activity (Luminometer Nightowl, Berthold Technologies, Bad Wildbad, Germany). 2.11. Luciferase assay HEK-293 cells were cultivated in Dulbecco’s modified Eagle’s medium (DMEM; Invitrogen, Gibco) supplemented with 10% fetal bovine serum (Biochrom AG, Berlin, Germany), 2 mM l-glutamine (Gibco), 5000 IU penicillin, 50 ␮g/ml streptomycin and 1% non-essential amino acids, at 37 ◦ C in a humidified atmosphere of 5% CO2 /air. To perform the luciferase test, the cells were removed by trypsinization and incubated for 16 h at 37 ◦ C in 96-well cell culture microplates (Falcon; BD Biosciences, CA, USA) with 100 ␮l of DMEM (without phenol red) supplemented with 2% of delipided fetal serum and 2 mM l-glutamine, at a density of 2 × 104 cells per well. The following day, the positive phage-peptides or synthetic peptides, at the required concentration (maximum volume added per well was 30 ␮l) were added to each well and incubated for 6 h at 37 ◦ C to activate the reporter gene. For antagonist assays, 1 nM of ␣MSH was added with the peptide. One hundred microliters of the Steady-Glo Luciferase Assay System solution (Promega, WA, USA) was added to each well and luciferase activity was measured with a Top Count NXT luminescence counter (PerkinElmer, CT, USA). Each assay was performed in triplicate and for each measurement, the standard deviation never exceeded 5%.

3. Results 3.1. Selection of phage-peptides A decapeptide library was constructed by insertion of degenerate paired DNA fragments into a phage vector (Fig. 1). The library diversity was estimated at 1 × 108 different clones. The library was selected using three different biotinylated anti-ACTH mAbs to isolate mimotopes of the Nterminal fragment of ACTH, of which the first 13 residues correspond to the ␣-MSH. The mAb A2H8 was obtained with the immunogenic fragments 1–14 of ACTH. The mAbs 57 and FZ10-A37 were obtained with the N-terminal fragment of ACTH and had no cross-reaction with CLIP (fragments 17–39 of ACTH). After three cycles of selection and amplification with each mAb, the isolated phage-peptides were used to infect E. coli bacteria, which were then grown in 96-well microtiter plates. The resulting phage-peptides were characterized by ELISA to identify the positive clones that specifically bind to the mAbs. Competitive binding assays between phage-peptides and ACTH1–17 revealed that after

S. Bonetto et al. / Peptides 26 (2005) 2302–2313

2306

Fig. 1. Strategy for the random decapeptidic library construction. The Primer-31 and Primer-77 overlap by 18 nucleotides. N represents an equal mixture of the deoxynucleotides G, A, T and C; K represents an equal mixture of G or T; and M of C or A. Boxed residues, which include a glutamine residue (Q), the degenerate sequence X10 and the flexible linker GGAA, were fused to the protein 3 of the fd phage.

three rounds of amplification/selection approximately 90% of the clones bound specifically to the mAbs. However, after the third round, the amino acid sequences showed a very strong redundancy. Therefore, isolated phage-peptides were selected from the first and second round of selection to preserve diversity. This resulted also in approximately 80% of the phage-peptides binding specifically to the mAbs (Table 1). We sequenced 126 phage-peptides. Their sequences showed much less redundancy than for the third round of selection (data not shown) and resulted in 45 different sequences (Table 2). We have identified 30 different sequences binding to the mAb A2H8, 10 binding to the mAb 57 and 5 binding to the mAb FZ10-A32. A comparative study of the sequences obtained after selection with the mAb A2H8 revealed the consensus sequence EXFRWGKPA, which correspond to the fragments 5–13 of ACTH and ␣-MSH (ACTH/MSH). This sequence contained the His–Phe–Arg–Trp (residues 6–9) motif, the pharmacophore, which is recognized as the smallest active region common to all melanocortins [10,28,33]. Sequence analysis showed that all of the phage-peptides contained a tryptophan residue at position 9, 80% contained an arginine residue at position 8 and 27% contained the

Phe–Arg–Trp tripeptide (residues 7–9), whereas only one exhibited the entire pharmacophore. A glycine residue at position 10 was found in 45% of phage-peptides and 71% had an aspartic acid residue at position 5. Approximately 30% of the sequences contained a leucine residue at position 7 instead of a phenylalanine residue also present in 30% of the sequences. Only two peptides had a valine residue at position 13, whereas in 30% of the sequences, this was substituted by an alanine residue. Any residue can occupy position 6. Peptide 8 was the least like the ␣-MSH and its sequence was shifted toward the N-terminus region in comparison with the other selected peptides. The sequences obtained with both mAbs 57 and FZ10A32 also led us to identify a single consensus sequence, WGXPVGKP, which correspond to regions 9–16 of ACTH, which is located downstream from the pharmacophore. Instead of the lysine residue present in the ACTH at position 15, we found a hydrophobic leucine residue in 45% of the isolated peptides. Unlike the first consensus sequence obtained with the mAb A2H8, where a tryptophan residue was always found at position 9, the sequences obtained with the other mAbs showed two other aromatic residues at this position: a tyrosine residue in 36% of the peptides and a phenylala-

Table 1 Enrichment of positive phage-peptides isolated after selection/amplification rounds Round

1 2 3

mAb A2H8

mAb 57

mAb FZ10-A32

Positive phage-peptides (%)

Specific phage-peptides (%)

Positive phage-peptides (%)

Specific phage-peptides (%)

Positive phage-peptides (%)

Specific phage-peptides (%)

2.3 14.6 58.2

77.2 81.5 86.7

ND 9.0 43.6

ND 83.6 91.1

ND 3.1 39.8

ND 89.5 93.3

The number of positive phage-peptides was determined by ELISA after each selection/amplification round with three different mAbs. Each positive phagepeptide was analyzed by competitive binding assays with ACTH1–17 . The percentage of positive phage-peptides is the ratio between the number of total isolated phage-peptides and the number of phage-peptides determined by ELISA. The percentage of specific phage-peptides corresponded to the ratio of the number of positive phage-peptides and the number of specific phage-peptides determined by competition ELISA. ND: not determined.

S. Bonetto et al. / Peptides 26 (2005) 2302–2313

2307

Table 2 Sequences of selected phage-peptides and IC50 values determined by ELISA

a

The number in brackets indicates the number of selected phages. Phage-peptides 1–30, 31–40 and 41–45 are selected from the mAbs A2H8, 57 and FZ10A32, respectively. b The sequences have been aligned with the ACTH1–15 and ACTH5–19 . The identical residues are showed in bold. The minimal fragment to elicit a melanotropic response is boxed. c The apparent IC50 values (nM) were determined by competitive binding assays using ACTH1–17 (0.002–4.77 ␮M) as a competitor. The values correspond to the ACTH1–17 concentration required to inhibit 50% of the signal of phage-peptide binding to the mAb. ND: not determined.

nine residue in 29% of the peptides. A hydrophobic leucine residue at position 13 was found in 33% of the sequences instead of a valine residue, found in 40% of the sequences. A proline residue at position 12 and a glycine residue at position 14 were present in 80% of sequences. Any residue can occupy the position 11. 3.2. Binding specificity of selected phage-peptides Competition binding experiments were carried out using either the ACTH1–17 or the N-terminal acetylated and C-terminal amidated natural ␣-MSH peptide as competitors to determine the specific interactions between the selected

phage-peptides and the mAbs. We measured the competitor concentration required to inhibit 50% of the signal of the selected phage-peptides binding to the mAb, the apparent affinity (IC50 ). Examples of the competition curves obtained with the ACTH1–17 used as competitor are shown in Fig. 2A and B. The IC50 of the selected phage-peptides were between 5 and 1230 nM. The phage-peptides having the best affinity (i.e. the highest IC50 ) were the most frequently selected clones (Table 2). Competitive binding assays with the ␣-MSH were very different to those for the ACTH1–17 . The ACTH1–17 fully inhibited the phage-peptide binding (Fig. 2A and B), whereas with ␣-MSH, there was either only partial or no inhibition (Fig. 3).

2308

S. Bonetto et al. / Peptides 26 (2005) 2302–2313

Fig. 4. Functional activity of the phage-peptides at the hMC1R. The cells were incubated for 6 h with different concentrations of phages: 4.8 nM (black), 2.4 nM (dots), 1.6 nM (white) and 0.8 nM (dashes). ‘Phage-MSH’ corresponds to the unmodified MSH peptide; ‘fd’ corresponds to the phage wild-type without insertion. Experiments were performed in triplicate and each bar indicates the standard deviation.

Fig. 2. Competition of phage-peptides with the ACTH1–17 . The A2H8 (A) or A57 and FZ10-A32 (B) mAbs adsorbed onto microwells were incubated with the phage-peptides 2 (
), 8 (䊉), 13 (), 16 (♦), 17 (), 20 () or 32 (
), 34 (), 36 (), 42 (), 43 (䊉), 44 (♦), and serial dilutions of the ACTH1–17 peptide. S.D. < 5% for each measurement.

3.3. Biological activities of phage-peptides We investigated the capacity of the selected phagepeptides to stimulate hMC1R dependent cAMP signal transduction pathway. The stimulation of the receptor is directly correlated with the activity of the luciferase reporter gene. Ligand binding to the hMC1R leads to phosphorylation of the cAMP-responsive element-binding protein (CREB), which then binds to the cAMP-response element (CRE) of the reporter gene promoter. We tested the capacity of the phageMSH (not modified at the N- and C-terminus) to stimulate the hMC1R to determine the level of sensitivity of cellular acti-

Fig. 3. Competition of phage-peptides with the ␣-MSH. The A2H8, A57 or FZ10-A32 mAbs adsorbed onto microwells were incubated with the phagepeptides 2 (), 18 (), 22 (䊉), 32 (), 39 (♦), 44 (
), and serial dilutions of the ␣-MSH peptide. S.D. < 5% for each measurement.

vation assay. An agonist effect was observed at the tested concentrations (0.8–4.8 nM). At the maximum concentration of the phage-MSH, the luciferase activity was approximately 15 times greater than for the phage wild-type (fd) used as control (Fig. 4). At the same given concentration, the synthetic peptide ␣-MSH (modified at the N- and C-terminus) increased the levels of cAMP by 30–40 times (data not shown). Steric hindrance and/or the absence of post-translational modifications at the N- and C-terminus of the ␣-MSH in phages may explain this difference. We carried out this bioactivity assay with the 45 isolated phage-peptides. Only two phage-peptides (13 and 20) showed a detectable activation of the luciferase reporter gene. This activation was approximately three times greater than for the phage wild-type (Fig. 4). All other phage-peptides did not stimulate the hMC1R. Also, we saw no inhibition of hMC1R activity in the presence of 1 nM of ␣-MSH showing that these 45 phage-peptides had no antagonist effect (data not shown). 3.4. Biological activities of peptides We used the luciferase biological assay to analyze 31 of the 45 selected peptides, having been synthesized with same modifications at their terminus as found in the natural ␣-MSH. We analyzed the capacity of each peptide to activate and/or to block the cAMP-dependent pathways. Sixteen peptides had a very weak agonist activity, with EC50 values equal to or greater than 40 ␮M (Table 3). Peptides 16 (EVFRWSAASV) and 17 (VEMMRWGQTA) showed stronger agonist activity with EC50 values of 16 and 11 ␮M, respectively (Fig. 5A). Both peptides contained the residues Arg8 and Trp9 of the pharmacophore and a glutamic acid residue at position 5. We also identified two strong agonists, peptides 13 (LEHFRWMKPI) and 20 (RIENFRWQRP), with EC50 values of 14 and 25 nM, respectively (Fig. 5B). Among the 45 peptides selected, peptide 13 was most similar to ACTH/MSH. It contains seven residues identical to the ACTH/MSH sequences, Glu5, Lys11 and Pro12 residues

S. Bonetto et al. / Peptides 26 (2005) 2302–2313

2309

Table 3 Functional activity of the peptides at the hMC1R Peptide

a Peptide

␣-MSH 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 31 32 33 34 35 36

Ac-SYSMEHFRWGKPV-NH2 Ac-EWLRWLIYP-NH2 Ac-EFLGWGKAV-NH2 Ac-ESLRWDQRIG-NH2 Ac-EEMRWGRLLS-NH2 Ac-FCAVRWGLPC-NH2 Ac-LLRWGGLAV-NH2 Ac-EILRWGAIAP-NH2 Ac-SPRRSERLGW-NH2 Ac-ELFRWDTTHT-NH2 Ac-KDETWRWGR-NH2 Ac-NETRRWDILI-NH2 Ac-VGRWGDFWL-NH2 Ac-LEHFRWMKPI-NH2 Ac-DYVCWWKASV-NH2 Ac-DGRWGDFWL-NH2 Ac-EVFRWSAASV-NH2 Ac-VEMMRWGQTA-NH2 Ac-GGEEWFRWA-NH2 Ac-TEAFRWDMRA-NH2 Ac-RIENFRWQRP-NH2 Ac-DSLRWGKVPV-NH2 Ac-LLRWGVSAT-NH2 Ac-ELAHPFWERY-NH2 Ac-SPTWRWAPY-NH2 Ac-PELWHTPV-NH2 Ac-SYGHPLGKPH-NH2 Ac-HWGWPLGRLT-NH2 Ac-VWYQFPVGK-NH2 Ac-FGTPIGKPLR-NH2 Ac-FSAPVGKPGK-NH2 Ac-SYGRPLGKRL-NH2

sequence

Peptide activity

Luciferase activity b EC (nM) 50

Agonist Slight agonist None None Slight agonist Slight agonist (50% at 100 ␮M) Slight agonist Slight agonist (50% at 100 ␮m) Slight agonist Slight agonist (50% at 100 ␮m) None Slight agonist (50% at 100 ␮m) Slight agonist Full agonist None None Full agonist Full agonist Slight agonist Slight agonist Full agonist Slight agonist Slight agonist None Slight agonist None None Slight agonist None None None Slight agonist (30% at 40 ␮m)

0.2 ± 0.1 >100000 ND ND >100000 ≈100000 >100000 ≈100000 >100000 ≈100000 ND ≈100000 >100000 14 ± 2.0 ND ND 16000 ± 1600 11000 ± 2400 >100000 >100000 25 ± 3.0 >40000 >40000 ND >40000 ND ND >40000 ND ND ND >40000

a

All peptides were synthesized with their N-terminus acetylated and their C-terminus amidated. EC50 (effective concentration) values are the concentration of peptide that is able to generate 50% of maximum luciferase activity. ‘Slight agonist’ means some activity was detected (at 40 or 100 ␮M), but not enough to precisely determine the corresponding EC50 value. In these cases, the percent of activation at 40 or 100 ␮M peptide is indicated. ‘None’ means that activity is not detectable at any concentration and the luciferase activity was not determined (ND). b

and the pharmacophore His–Phe–Arg–Trp. It is also the only peptide to exhibit the complete pharmacophore. Peptide 20 contains only five identical residues with ACTH/MSH, the tripeptide Phe–Arg–Trp of the pharmacophore and the Glu5 and Pro12 residues. Also, at position 11, the lysine residue is substituted by the arginine, the other positively charged residue. Among the six peptides selected with the 57 and FZ10A32 mAbs, peptides 32 (HWGWPLGRLT) and 36 (SYGRPLGKRL) had very slight agonist activities (EC50 > 40 ␮M). Both peptides contain a proline residue at position 12, as seen for peptides 13 and 20. Also, peptide 32 contained only one residue present in the pharmacophore. We also analyzed the capacity of the 31 peptides to block the agonist effect of 1 nM of ␣-MSH. Only peptide 8 (SPRRSERLGW) showed weak partial antagonistic activity (IC50 = 36 ␮M). Even with 100 ␮M of peptide 8, only 30% of the activation by the ␣-MSH is inhibited (Fig. 6). Among all of the peptides tested, peptide 8 shows the least similarity with ACTH/MSH, with only the glutamic acid residue at position

5 and the tryptophan residue at position 9 being conserved. It corresponds to the regions 1–9 of ACTH/MSH. As we found for 30% of peptides selected with the mAb A2H8, it contains a leucine residue at position 7 instead of the phenylalanine residue.

4. Discussion We have used phage-display technology to isolate ACTH analogues recognized by anti-ACTH mAbs. As no anti-␣MSH monoclonal antibody exists, the selection was achieved using three mAbs able to recognize the N-terminal fragment of the ACTH (39 residues) of which the 13 first residues are identical to those of the ␣-MSH. Selection with the A2H8 mAb isolated 30 phage-peptides. Their amino acid sequences all contain a tryptophan residue at position 9 with most possessing a glutamic acid residue at position 5 and an arginine residue at position 8. One or more of these three residues are probably essential for the interaction between the A2H8 mAb

2310

S. Bonetto et al. / Peptides 26 (2005) 2302–2313

Fig. 5. Functional activity of the agonist peptides. The agonist activity of peptides determined from the cAMP-dependent luciferase activity. The cells transfected with the hMC1R were incubated for 6 h with different concentrations of each peptide (0.01 nM to 150 ␮M): (A) peptide16 () and peptide 17 (); (B) peptide 13 () and peptide 20 (); and ␣-MSH (䊉). The results are normalized to the maximum response of the ␣-MSH control peptide at 100 nM (100%). Assays were performed in triplicate and each bar indicates the standard deviation.

Fig. 6. Functional activity of the antagonist peptide. Partial antagonist activity of the peptide 8 determined from the cAMP-dependent luciferase activity. The transfected cells with the hMC1R were incubated for 6 h with different concentrations (3–400 ␮M) of peptide 8 and the ␣-MSH peptide at 1 nM. The results are normalized to the activity of the ␣-MSH control peptide at 1 nM (100%). Assays were performed in triplicate and each bar indicates the standard deviation.

and the ACTH. The other residues are more variable. For example, the phenylalanine at the position 7 may be substituted by another hydrophobic amino acid, often a leucine residue. Comparative analysis of the 10 sequences from the selection with the 57 mAbs and the 5 sequences from the selection with the FZ10-A32 mAbs revealed a consensus sequence WGXPVGKP corresponding to the regions 9–16 of the ACTH and located just downstream of the pharmacophore sequence. A comparison of the common regions 9–13 of the two consensus sequences EXFRWGKPA and WGXPVGKP revealed a large similarity. Competition binding analysis of the 45 positive phagepeptides produced different binding curves depending on the competitor used. In competition assays with the three mAbs, ACTH1–17 abolished binding of all the phage-peptides. These results are consistent with the fact that N-terminal fragments of ACTH have been used as immunogens. However, the ␣MSH peptide was not able to fully inhibit the binding between the mAbs and the phage-peptides. The phage-peptides selected with the A2H8 mAb were partially inhibited (30–50%) by 10 ␮M of ␣-MSH, whereas those selected with the 57 and FZ10-A32 mAbs were not inhibited at this concentration. These results seem logical, as the amino acid sequences of the peptides selected by the 57 and FZ10-A32 mAbs are expanded outside of the ␣-MSH sequence. However, they are more difficult to interpret for those peptides selected by the A2H8 mAb, where the amino acid sequences fully cover the ␣-MSH sequence. This suggests that the ACTH1–17 and ␣-MSH do not have the same three-dimensional structure. We have shown that the ␣-MSH displayed on the surface of a phage-control (phage-MSH) had a biological activity approximately 15-fold greater than that of a phage wild-type (fd). This is only two to three times less than for the natural hormone ␣-MSH (data not shown) as the deacetylated form of ␣-MSH at the hMC1R [43,67]. Among the 45 phagepeptides, we identified two peptides (13 and 20) that activated the hMC1R-dependent pathway. Only those peptides with an EC50 lower than 30 nM could be detected for their capacity to stimulate hMC1R in the phage context (see Table 3). We measured the bioactivity of 31 synthesized peptides. They were modified at N- and C-termini as for the ␣-MSH. We identified four peptides (peptides 13, 16, 17 and 20) among 25 peptides selected with A2H8 mAb with a full agonist activity, whereas the others had either very weak or no activity. One peptide (peptide 8) also exhibited an antagonist effect. Peptides 13 (LEHFRWMKPI) and 20 (RIENFRWQRP), for whose the activities were also detected for peptides in the phage context, are strong agonists, with EC50 values of 14 and 25 nM, respectively. As these two peptides have similar EC50 values, comparing their sequences could allow us to understand better the structure/function relationships of ACTH/MSH. Peptide 13 is very similar to ACTH/MSH and also contains the pharmacophore. Despite not possessing the full pharmacophore and having only five identical residues with ACTH/MSH, peptide 20 is almost as active as peptide 13. In peptide 20, the lysine residue at position 11

S. Bonetto et al. / Peptides 26 (2005) 2302–2313

in ACTH/MSH is substituted by another basic residue, arginine, whereas the proline residue at position 12 is present in both. The modifications at position 6 and the substitution by another charged residue at position 11 in peptide 20 does not seem to be the cause of the 100-fold decrease of activation of this peptide compared to the ␣-MSH, but rather the absence of the first three N-terminal residues or the substitutions of the Met, Gly and Val residues at the positions 4, 10 and 13, respectively. Studies have shown that residues 1–3 were not implicated in the stimulation of the MC1R [10,34,53]. Indeed, Sahm et al. confirmed that the regions 4–13 were as active as the ␣-MSH at the mMC1R, and that the fragments 5–13 were 1500 times less active [53]. They also showed that the compound [Ala4] ␣-MSH was 60 times less active than ␣-MSH [54]. Also, it has been shown that the Phe–Arg–Trp tripeptide was more active than the His–Phe–Arg–Trp tetrapeptide [29], suggesting a less important role of the His6 residue in the pharmacophore. Various substitutions at positions 10 and 13 have shown that these two residues are not essential for agonist activity [3,4,34,54]. Our results suggest that 100-fold decrease in activity of peptides 13 and 20 depend on the absence of the methionine residue at the position 4. Moreover, our results show that the histidine residue of the pharmacophore can be substituted without loss of the agonist activity and confirm the minor role of this residue for the agonist activity. Peptides 16 (EVFRWSAASV) and 17 (VEMMRWGQTA), whose activities were not detected when the peptides were in the phage context, exhibited similar, though weak, agonist effects, with EC50 values of 16 and 11 ␮M, respectively. These two peptides share four residues with ACTH/MSH. The 1000-fold difference in activities between peptides 16 and 17 and peptide 13 may depend on the substitutions at positions 6, 7 and 10–12. Comparing peptides 16 and 20 suggests that the loss of activity of peptide 16 depends on the substitution of a basic residue at position 11 and of a proline residue at position 12. It has been proposed that the regions 11 and 12 play a secondary effector role independent of the pharmacophore [21] and that the agonist effect of ␣-MSH decreases when this region is deleted or if substituted by alanine residues [41,53,67]. Our data confirm that the agonist activity depends on the presence of the methionine residue at position 4, a basic residue at position 11 and a proline residue at position 12. We analyzed the agonist activities of six peptides selected by the 57 and FZ10-A32 mAbs. Despite the absence of the pharmacophore in their sequences, we identified two peptides (32 and 36) with a weak agonist effect (EC50 > 40 ␮M). ACTH1–17 is 60 times more active than the ACTH1–10 and twice as active as the ␣-MSH [67,68]. These two analogues suggest the existence of a sequence in the regions 8–17 downstream from the pharmacophore of the ACTH able to stimulate the receptor. We analyzed 31 of the peptides to identify analogues exhibiting an antagonist activity. We identified one peptide (peptide 8: SPRRSERLGW) with a partial (IC50 = 36 ␮M;

2311

30% of inhibition at 100 ␮M of ␣-MSH) antagonist effect. Among all the peptides selected, peptide 8 is the least similar to ACTH/MSH. It has only one residue belonging to the pharmacophore and is also the only peptide whose the sequence is fully aligned with the first nine residues of ACTH/MSH. Previous studies have reported that the peptides 7–10 of ␣-MSH may generate antagonist activity on lizard skin but not on frog skin [56]. The peptide Met–Pro–Phe–Arg–Trp–Phe–Lys–Pro–Val–NH2 was shown to have an antagonist effect (5 ␮M) at the MC1R of amphibians [37]. Analogues [Ala6]-ACTH4–10 and [Pro8, Gly9, Pro10]-ACTH4–10 also exhibited an antagonist activity for the mMC3R, the hMC4R and the hMC5R [1]. In our study, we have shown that an analogue peptide of the regions 1–9 of ACTH/MSH may partially inhibit the stimulation effect of ␣-MSH at the hMC1R. However, the identification of only one peptide able to partially block the activity of the ␣-MSH does not allow us to identify the residues implicated in the antagonist function. It may be possible to carry out a peptide scanning approach from the peptide 8, for example, alanine scanning. From our data, it should be possible to construct a new random library based on the first 9 residues of the ␣-MSH. We should be able to identify new selections by a subtractive approach using whole cells overexpressing the hMC1R [48]. The newly selected peptides can then be analyzed for their antagonist effect to find stronger antagonists.

5. Conclusions Our work shows that the phage-display approach with mAbs allows the selection from a random library numerous peptido-mimetics of the N-terminal fragment of the ACTH with antagonist or agonist activities for the hMC1R. These studies have allowed us to reveal new information on the structure–function relationships of melanocortins with their receptor. Such studies offer the possibility of better understanding the elements responsible for triggering or blocking receptor function. The identification of mimotopes by phagedisplay technology offers a new way for the design and development of new agonists and antagonists of the hMC1R.

Acknowledgements This manuscript is dedicated to the memory of Serge Michel. We thank Martine Chartier for DNA sequencing, Christophe Ferret for technical support and Drs. Agn`es Goulet, Pascale Mauvais and Johannes Voegel for helpful discussions. We also thank Dr. Lee Leserman and Dr. Patrick Chames for critical reading of the manuscript. This work was supported by a grant from the French National Center for Scientific Research (CNRS) and Ipsogen SA. St´ephane Bonetto is a recipient of an industrial convention for research formation from the Research Ministry.

2312

S. Bonetto et al. / Peptides 26 (2005) 2302–2313

References [1] Adan RA, Oosterom J, Ludvigsdottir G, Brakkee JH, Burbach JP, Gispen WH. Identification of antagonists for melanocortin MC3, MC4 and MC5 receptors. Eur J Pharmacol 1994;269:331–7. [2] Al-Obeidi F, Hadley ME, Pettitt BM, Hruby VJ. Design of a new class of superpotent ␣-melanotropins based on quenched dynamic simulations. J Am Chem Soc 1989;111:3413–6. [3] Al-Obeidi F, Castrucci ALM, Hadley ME, Hruby VJ. Potent and prolonged acting cyclic lactam analogues of ␣-melanotropin: design based on molecular dynamics. J Med Chem 1989;32:2555–61. [4] Al-Obeidi F, Hruby VJ, Castrucci AM, Hadley ME. Design of potent linear ␣-melanotropin 4–10 analogues modified in positions 5 and 10. J Med Chem 1989;32:174–9. [5] Al-Obeidi F, Hruby VJ, Hadley ME, Sawyer TK, Castrucci ALM. Design, synthesis, and biologic activities of a potent and selective alpha-melanotropin antagonist. Int J Pept Protein Res 1990;35:228–34. [6] Balass M, Heldman Y, Cabilly S, Shmuel C, Givol D, KatchalskiKatzir E, et al. Identification of a hexapeptide that mimics a conformation-dependent binding site of acetylcholine receptor by use of a phage-epitope library. Proc Natl Acad Sci USA 1993;90: 10638–42. [7] Bertagna X, Nicholson WE, Sorenson GD, Pettengill OS, Mount CD, Orth DN. Corticotropin, lipotropin, and ␤-endorphin production by a human non-pituitary tumor in culture: evidence for a common precursor. Proc Natl Acad Sci USA 1978;75:5160–4. [8] Buckley DI, Ramachandran J. Characterization of corticotropin receptors on adrenocortical cells. Proc Natl Acad Sci USA 1981;78:7431–5. [9] Cannon JG, Tatro JB, Reichlin S, Dinarello CA. ␣-Melanocytestimulating hormone inhibits immunostimulatory and inflammatory action of interleukin-1. J Immunol 1986;137:2232–6. [10] Castrucci AM, Hadley ME, Sawyer TK, Wilkes BC, Al-Obeidi FA, Staples DJ, et al. Alpha-melanotropin: the minimal active sequence in the lizard skin bioassay. Gen Comp Endocrinol 1989;73:157– 63. [11] Ceriani G, Macalus A, Catana A, Lipton JM. Central neurogenic antiinflammatory action of ␣-MSH. Neuroendocrinology 1993;59: 138–43. [12] Chhajlani V, Wikberg JES. Molecular cloning and expression of the human melanocyte stimulating hormone receptor cDNA. FEBS Lett 1992;309:417–20. [13] Clackson T, Hoogenboom HR, Griffiths AD, Winter G. Making antibody fragments using phage display libraries. Nature 1991;352:624–8. [14] Cone RD, Mountjoy KG. Molecular genetics of the ACTH and melanocyte-stimulating hormone receptors. Trends Endocrinol Metab 1993;4:242–7. [15] Contreras PC, Takemori AE. Antagonism of morphine-induced analgesia, tolerance and dependence by ␣-MSH. J Pharmacol Exp Ther 1984;229:21–6. [16] Cortese R, Monaci P, Nicosia A, Luzzago A, Felici F, Galfre G, et al. Identification of biologically active peptides using random libraries displayed on phage. Curr Opin Biotechnol 1995;6:73–80. [17] Coulon S, Metais JY, Chartier M, Briand J-P, Baty D. Cyclic peptides selected by phage display mimic the natural epitope recognized by a monoclonal anti-colicin A antibody. J Pept Sci 2004;10:648– 58. [18] De Weid D, Jolles J. Neuropeptides derived from pro-opiomelanocortin: behavioral, physiological, and neurochemical effects. Physiol Rev 1982;62:976–1059. [19] Distefano MD, Zhong A, Cochran AG. Quantifying beta-sheet stability by phage display. J Mol Biol 2002;322:179–88. [20] Dower WJ, Miller JF, Regsdale CW. High efficiency transformation of E. coli by high voltage for electroporation. Nucleic Acids Res 1988;16:6127–45.

[21] Eberle AN, H¨ubscher W. Hormone-receptor intractions. Demonstration of two message sequence (active sites) in ␣-melanotropin. Helv Chim Acta 1979;62:2469–85. [22] Fan W, Boston RA, Kesterson RA, Hruby VJ, Cone RD. Role of melanocortinergic neurons in feeding and the agouti obesity syndrome. Nature 1997;385:165–8. [23] Geschwind II, Huseby RA, Nishioka R. The effect of melanocytestimulating hormone on coat color in the mouse. Recent Prog Horm Res 1972;28:91–130. [24] Giebel LB, Cass RT, Milligan DL, Young DC, Arze R, Johnson CR. Screening of cyclic peptide phage libraries identifies ligands that bind streptavidin with high affinities. Biochemistry 1995;34:15430–5. [25] Graham FL, Smiley J, Russel WC, Nairn R. Characteristics of a human cell line transformed by DNA from human adenovirus type 5. J Gen Virol 1977;36:59–74. [26] Haskell-luevano C, Shenderovich MD, Sharma SD, Nikiforovich GV, Hadley ME, Hruby VJ. Design, synthesis, biology and conformations of bicyclic ␣-melanotropin peptide analogues. J Med Chem 1995;38:1736–50. [27] Haskell-Luevano C, Boteju LW, Miwa H, Dickinson C, Gantz I, Yamada T, et al. Topographical modification of melanotropin peptide analogues with beta-methyltryptophan isomers at position 9 leads to differential potencies and prolonged biologic activities. J Med Chem 1995;38:4720–9. [28] Haskell-luevano C, Sawyer TK, Hendrata S, North C, Panahinia L, Stum M, et al. Truncation studies of ␣-meanotropin peptides identify tripeptide analogues exhibiting prolonged agonist bioactivity. Peptides 1996;17:995–1002. [29] Haskell-luevano C, Holder JR, Monck EK, Bauzo RM. Characterization of melanocortin NDP-MSH agonist peptide fragments at the mouse central and peripheral melanocortin receptors. J Med Chem 2001;44:2247–52. [30] Herpin TF, Yu G, Carlson KE, Morton GC, Wu X, Kang L, et al. Discovery of tyrosine-based potent and selective melanocortin-1 receptor small-molecule agonists with anti-inflammatory properties. J Med Chem 2003;46:1123–6. [31] Holder JR, Bauzo RM, Xiang Z, Haskell-Luevano C. Structure–activity relationships of the melanocortin tetrapeptide Ac-His-d-Phe-Arg-Trp-NH2 at the mouse melanocortin receptors. Part 2. Modifications at the Phe position. J Med Chem 2002;45: 3073–81. [32] Hoogenboom HR, Griffiths AD, Johnson KS, Chiswell DJ, Hudson P, Winter G. Multi-subunit proteins on the surface of filamentous phage: methodologies for displaying antibody (Fab) heavy and light chains. Nucleic Acids Res 1991;19:4133–7. [33] Hruby VJ, Wilkes BC, Hadley ME, Al-Obeidi F, Sawyer TK, Staples DJ, et al. ␣-Melanotropin: the minimal active sequence in the frog skin bioassay. J Med Chem 1987;30:2126–30. [34] Hruby VJ, Sharma SD, Toth K, Jaw JY, Al-Obeidi F, Sawyer TK, et al. Design, synthesis, and conformation of superpotent and prolonged acting melanotropins. Ann N Y Acad Sci 1993;680:51–63. [35] Hruby VJ, Lu D, Sharma SD, Castrucci AML, Kesterson RA, AlObeidi F, et al. Cyclic lactam ␣-melanotropin analogues of AcNle4-cyclo (Asp5, D-Phe7, Lys10) ␣-melanocyte-stimulating hormone (4–10)-NH2 with bulky aromatic amino acid at position 7 show high antagonist potency and selectivity at specific melanocortin receptors. J Med Chem 1995;38:3454–61. [36] Isalan M, Klug A, Choo Y. A rapid, generally, applicable method to engineer zinc fingers illustrated by targeting the HIV-1 promoter. Nat Biotechnol 2001;19:656–60. [37] Jayawickreme CK, Quillan JM, Graminski GF, Lerner MR. Discovery and structure-function analysis of ␣-melanocyte-stimulating hormone antagonists. J Biol Chem 1994;269:29846–54. [38] Kask A, Mutulis F, Muceniece R, Pahkla R, Mutule I, Wikberg JE, et al. Discovery of a novel superpotent and selective melanocortin 4 receptor antagonist (HS024): evaluation in vitro and in vivo. Endocrinology 1998;139:5006–14.

S. Bonetto et al. / Peptides 26 (2005) 2302–2313 [39] Lerner AB. Fitzpatrick TB Biochemistry of melanin formation. Physiol Rev 1950;30:91–126. [40] Levine N, Sheftel SN, Eylan T, Dorr RT, Hadley ME, Weinrach JC, et al. Induction of skin tanning by subcutaneous administration of a potent synthetic melanotropin. JAMA 1991;266:2730–6. [41] Mains RE, Eipper BA, Ling N. Common precursor to corticotropins and endorphins. Proc Natl Acad Sci USA 1977;74:3014–8. [42] Maniatis T, Fritsch EF, Sambrook J. Molecular cloning: a laboratory manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press; 1982. [43] McCormack AM, Carter RJ, Thody AJ, Shuster S. Des-acetyl MSH and gamma-MSH acts as partial agonist to alpha-MSH on the anolis melanophore. Peptides 1982;3:13–6. [44] Mounjoy KG, Robbins LS, Mortrud MT, Cone RD. The cloning of a family of genes that encode the melanocortin receptors. Science 1992;257:1248–51. [45] Oosterom J, Burbach JP, Gispen WH, Adan RA. Asp10 in Lys␥2-MSH determines selective activation of the melanocortin MC3 receptor. Eur J Pharmacol 1998;354:R9–11. [46] Parmley SF, Smith GP. Filamentous fusion phage cloning vectors for the study of epitopes and design of vaccines. Adv Exp Med Biol 1989;251:215–8. [47] Peng P-J, Sahm UG, Doherty RVM, Kinsman RG, Moss SH, Pouton CW. Binding and biological activity of C-terminally modified melanocortin peptides: a comparaison between their actions at rodent MC1 and MC3 receptors. Peptides 1997;18:1001–8. [48] Popkov M, Rader C, Barbas CF. Isolation of human prostate cancer cell reactive antibodies using phage display. J Immunol Methods 2004;291:137–51. [49] Probst WC, Snyder LA, Schuster DI, Brosius J, Sealfon SC. Sequence alignment of the G-protein coupled receptor superfamily. DNA Cell Biol 1992;11:1–20. [50] Prusis P, Muceniece R, Mutule I, Mutulis F, Wikberg JE. Design of new small cyclic melanocortin receptor-binding peptides using molecular modelling: role of the His residu in the melanocortin peptide core. Eur J Med Chem 2001;36:137–46. [51] Quillan JM, Jayawickreme CK, Lerner MR. Combinatorial diffusion assay used to identify topically active melanocyte-stimulating hormone receptor antagonists. Proc Natl Acad Sci USA 1995;92: 2894–8. [52] Rowley MJ, O’connor K, Wijeyewickrema L. Phage display for e´ pitope determination: a paradigm for identifying receptor-ligand interactions. Biotechnol Annu Rev 2004;10:151–88. [53] Sahm UG, Olivier GWJ, Branch SK, Moss SH, Pouton CW. Influence of ␣-MSH terminal amino acids on binding affinity and biological activity in melanoma cells. Peptides 1994;4:441–6. [54] Sahm UG, Olivier GWJ, Branch SK, Moss SH, Pouton CW. Synthesis and biological evaluation of ␣-MSH analogues susbtituted with alanine. Peptides 1994;15:1297–302. [55] Sawyer TK, Sanfilippo PJ, Hruby VJ, Engel MH, Heward CB, Burnett JB, et al. 4-Norleucine, 7-d-phenylalanine-alpha-melanocyte-

[56]

[57]

[58]

[59]

[60]

[61]

[62]

[63] [64]

[65]

[66]

[67]

[68]

[69]

[70]

2313

stimulating hormone: a highly potent alpha-melanotropin with ultralong biologic activity. Proc Natl Acad Sci USA 1980;77:5754–8. Sawyer TK, Staples DJ, Castrucci AM, Hadley ME, Al-Obeidi FA, Cody WL, et al. Alpha-melanocyte stimulating hormone message and inhibitory sequences: comparative structure-activity studies on melanocytes. Peptides 1990;11:351–7. Sawyer TK, Castrucci AM, Staples DJ, Affholter JA, Devaux AE, Hruby VJ, et al. Structure–activity relationships of [Nle4, dphe7] ␣MSH: discovery of a tripeptidyl agonist exhibiting sustained bioactivity. Ann N Y Acad Sci 1993;680:597–9. Schioth HB, Mutulis F, Muceniece R, Prusis P, Wikberg JES. Discovery of novel melanocortin 4 receptor selective MSH analogues. Br J Pharmacol 1998;124:75–82. Scott JK, Loganathan D, Easley RB, Gong X, Goldstein IJ. A family of concanavalin A-binding peptides from a hexapeptide epitope library. Proc Natl Acad Sci USA 1992;89:5388–402. Skuladottir GV, Jonsson L, Skarphedinsson JO, Mutilis F, Muceniece R, Raine A, et al. Long term orexigenic effects of a novel selective MC4 receptor antagonist. Br J Pharmacol 1999;126:27–34. Smith GP. Filamentous fusion phage: novel expression vectors that display cloned antigen on the virion surface. Science 1985;228:1315–7. Smith EM, Hughes TK, Hashemi F, Stefano GB. Immunosuppressive effects of corticotropin and melanotropin and their possible significance in human immunodeficiency virus infection. Proc Natl Acad Sci USA 1992;89:782–6. Smith GP, Scott JK. Library of peptides and proteins diplayed on filamentous phage. Methods Enzymol 1993;217:228–57. Szardenings M, T¨ornroth S, Mutulis F, Muceniece R, Kein¨anen K, Kuusinen A, et al. Phage display selection on whole cells yields a peptide specific for melanocortin receptor 1. J Biol Chem 1997;272:27943–8. Szardenings M, Muceniece R, Mutule I, Mutulis F, Wikberg JES. New highly specific agonist peptides for human melanocortin MC1 receptor. Peptides 2000;21:239–43. Tong AH, Drees B, Nardelli G, Bader GD, Brannetti B, Castagnoli L, et al. A combined experimental and computational strategy to define protein interaction for peptide recognition modules. Science 2002;295:321–4. Tsatmalia M, Wakamatsu K, Graham A, Thody AJ. Skin POMC peptides: their binding affinities and activation of the human MC1 receptor. Ann N Y Acad Sci 1999;885:466–9. Tsatmalia M, Yukitake J, Thody AJ. ACTH1-17 is a more potent agonist at the human MC1 receptor than alpha-MSH. Cell Mol Biol 1999;45:1029–34. Van Bergen P, Janssen PM, Hoogerhout P, De Wildt DJ, Versteeg DH. Cardiovascular effects of ␥-MSH/ACTH-like peptides: structure–activity relationship. Eur J Pharmacol 1995;294:795–803. Venkatesh N, Zaltsman Y, Somjen D, Gayer B, Boopathi E, Kasher R, et al. A synthetic peptide with estrogen-like activity derived from a phage-display peptide library. Peptides 2002;23:573–80.