- Email: [email protected]
Isolation and Characterization of Human Dental Pulp Stem Cells from Cryopreserved Pulp Tissues Obtained from Teeth with Irreversible Pulpitis
Basic Research—Biology
Isolation and Characterization of Human Dental Pulp Stem Cells from Cryopreserved Pulp Tissues Obtained from Teeth with Irreversible Pulpitis Azin Malekfar, BDS,* Kusum S. Valli, MDS,* Mohammad Mahboob Kanafi, PhD,† and Ramesh R. Bhonde, PhD† Abstract Introduction: Human dental pulp stem cells (DPSCs) are becoming an attractive target for therapeutic purposes because of their neural crest origin and propensity. Although DPSCs can be successfully cryopreserved, there are hardly any reports on cryopreservation of dental pulp tissues obtained from teeth diagnosed with symptomatic irreversible pulpitis during endodontic treatment and isolation and characterization of DPSCs from such cryopreserved pulp. The aim of this study was to cryopreserve the said pulp tissues to propagate and characterize isolated DPSCs. Methods: A medium consisting of 90% fetal bovine serum and 10% dimethyl sulfoxide was used for cryopreservation of pulp tissues. DPSCs were isolated from fresh and cryopreserved pulp tissues using an enzymatic method. Cell viability and proliferation were determined using the MTT [3-(4,5dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide] assay. DPSC migration and interaction were analyzed with the wound healing assay. Mesenchymal characteristics of DPSCs were verified by flow cytometric analysis of cell surface CD markers. The osteogenic and adipogenic potential of DPSCs was shown by von Kossa and oil red O staining methods, respectively, and the polymerase chain reaction method. Result: We found no significant difference in CD marker expression and osteogenic and adipogenic differentiation potential of DPSCs obtained from fresh and cryopreserved dental pulp tissue. Conclusions: Our study shows that dental pulp can be successfully cryopreserved without losing normal characteristics and differentiation potential of their DPSCs, thus making them suitable for dental banking and future therapeutic purposes. (J Endod 2015;-:1–6)
Key Words Cryopreservation, dental pulp, dental pulp stem cells, endodontics, mesenchymal stem cells, stem cell banking
D
ental pulp stem/progenitor cells originating from neural crests exist in the pulp tissue of teeth (1). In 2000, Dr Gronthos and colleagues identified stem cells in human dental tissues for the first time and reported isolation of postnatal human dental pulp stem cells (DPSCs) by enzymatic treatment (2). These DPSCs were found to be capable of differentiating into neural-like cells in vitro and were also capable of forming ectopic dentin and associated pulp tissue in vivo (3). Subsequent studies revealed that these newly identified cells are a clonogenic and rapidly proliferative population of mesenchymal stem cells (MSCs). By definition, MSCs have the ability to differentiate into osteoblasts, adipocytes, and chondrocytes; adhere to plastic tissue culture dishes; and express CD105, CD73, and CD90 but not CD45, CD34, CD14 or CD11b, CD79a or CD19, or HLA-DR surface molecules (4). All of these vital features of MSCs have been observed in DPSCs and confirmed through several characterization studies (5, 6). Dental pulp tissue is an attractive source of MSCs because it is a noncontroversial and readily accessible source. Because regeneration and maintenance are reliant on MSCs (7), these features of DPSCs bring to light their promise in the field of tissue engineering and regenerative medicine, in particular regenerative endodontics (revascularization/pulpal regeneration) (8). It is known that DPSCs possess immunomodulatory effects (9) and can be obtained from inflamed dental pulps as well. Alongi et al (10) showed that DPSCs isolated from inflamed pulps can express higher levels of MSC markers CD90 and CD105 in comparison with those from normal pulps. Because successful isolation of DPSCs has been limited to 5 days after tooth extraction, it is important to optimize their isolation and preservation (11). It is well documented that cryopreserved whole teeth can be used as a possible source of DPSCs (12, 13). In 1 of these related studies, scientists cryopreserved whole teeth after excavating microchannels into the tooth with laser piercing to allow the cryopreservative access to the dental pulp and preserve the cells. Their data showed that isolated DPSCs from these cryopreserved teeth exhibit MSC morphology, immunophenotype, viability, and a proliferation rate comparable with those of cells isolated from fresh, noncryopreserved teeth (13). In another study, instead of whole teeth cryopreservation, it has been shown that cryopreserved dental pulp tissues of deciduous teeth are also a feasible stem cell resource for isolation of dental stem cells from human exfoliated deciduous teeth (14). To develop DPSC banking, the primary step is to identify and select the best accessible sources of pulp tissue for isolation of DPSCs. Although isolation of DPSCs from teeth diagnosed with irreversible pulpitis is almost impractical immediately after endodontic therapy, it has been proven that the inflammatory process does not affect the
From the *Department of Conservative Dentistry and Endodontics, Sri Rajiv Gandhi College of Dental Sciences and Hospital; and †Manipal Institute of Regenerative Medicine, Manipal University, Bangalore, India. Address requests for reprints to Dr Ramesh R. Bhonde, Manipal Institute of Regenerative Medicine, Manipal University, Bangalore 560065, India. E-mail address: [email protected] 0099-2399/$ - see front matter Copyright ª 2015 American Association of Endodontists. http://dx.doi.org/10.1016/j.joen.2015.10.001
JOE — Volume -, Number -, - 2015
Cryopreservation of Dental Pulp for Banking
1
Basic Research—Biology properties of the DPSCs (15). Therefore, cryopreservation of pulp tissues from teeth with irreversible pulpitis and subsequent isolation of DPSCs from them would be an alternative with therapeutic value to overcome this issue. Hence, in the present study, we aimed to evaluate whether cryopreserved inflamed pulp tissues of permanent teeth with irreversible pulpitis are a retrievable and practical DPSC source? With this aim, we attempted to compare characterization of DPSCs isolated from cryopreserved and noncryopreserved (fresh) pulp tissues of permanent teeth with symptomatic irreversible pulpitis.
Materials and Methods Pulp tissues were obtained during root canal treatment of human permanent carious molar teeth of 15- to 30-year-old patients with symptomatic irreversible pulpitis at the Department of Conservative Dentistry and Endodontics, Sri Rajiv Gandhi College of Dental Sciences and Hospital, RGC Campus, Bangalore, India. Informed consent was obtained from donors, and the protocol was approved by the Institutional Ethical Committee of Sri Rajiv Gandhi College of Dental Sciences and Hospital.
Isolation of DPSCs DPSCs were isolated from cryopreserved (n = 10) and noncryopreserved (fresh) human dental pulp tissues (n = 10). Dental pulp tissues were washed 2 to 3 times with Dulbecco phosphate-buffered saline solution under the laminar flow chamber. Then, 2-mg/mL collagenase blends (Sigma-Aldrich, St Louis, MO) were added, and the tissues were minced to smaller pieces to increase the surface area for better enzyme action. Then, minced tissues were kept in the incubator (5% CO2, 37 C) for 1 hour. After incubation, the action of enzymes was neutralized by addition of the culture medium. The samples were then centrifuged at 400g for 5 minutes, and cell pellets were collected and plated in 24-well plates and kept in the incubator. Cultures were fed with fresh media every 48 hours. DPSCs were cultured in knockout Dulbecco modified Eagle medium (Gibco, Grand Island, NY) supplemented with 10% fetal bovine serum (Hyclone, Logan, UT), 5 mmol/L L-glutamine (Gibco), and 50 U/mL penicillin streptomycin (Gibco). Cryopreservation of Dental Pulp Tissues Dental pulp tissues were mixed with chilled cryopreserved medium (4 C) and kept overnight at 80 C. The cryopreserved medium consisted of 10% dimethyl sulfoxide (Sigma-Aldrich) and 90% fetal bovine serum (Hyclone). They were transferred into liquid nitrogen in a controlled cooling manner enabling a cooling rate of 1 C/min and stored. After 3 months of storage, the cryopreserved pulps were thawed out, and DPSCs were isolated using the previously mentioned method.
Growth Kinetic Study The growth kinetic study was performed by calculating population doubling (PD), cumulative population doubling (CPD), and population doubling time (TD). DPSCs were dissociated with 0.25% trypsin (Gibco) and counted using the trypan blue exclusion method on a Neubauer hemocytometer at the end of each passage once cells were about 90% confluent, and then they were replated for the subsequent passages. The PD and TD were determined by the following formulas, respectively: PD = LogNhLogNi/Log2 and TD = t*Log2/LogNhLogNi, where Ni = number of cells at seeding time, Nh = number of cells at harvesting time, and t = culture time (in hours), and CPD = PD of each passage + PD of previous passage. MTT Assay It was a 2-day protocol. On the first day, 7500 cells mixed with 100 mL growth media were seeded into each well of a 96-well plate and incubated overnight. The next day 20 mL of 5 mg/mL MTT [3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide] was added to each well, and cells were incubated for 3.5 hours at 37 C in the culture hood. Then, media was removed, and 150 mL MTT solvent was added. The plate was covered with tinfoil, and cells were agitated on an orbital shaker for 15 minutes. Absorbance was read at 590 nm with a reference filter of 620 nm. Wound Healing Assay The effects of cryopreservation of pulp on the migration of stem cells were examined via the wound healing assay. For this purpose, DPSCs were mechanically scratched with a sterile pipette tip in 6-well plastic dishes to remove a certain portion of cells. The migratory ability of the cells was assessed by counting the number of cells within the scratched wound at 0, 12, 24, 36, and 48 hours. Flow Cytometric Analysis Flow cytometry with DPSCs was performed to characterize these cells for a candidate set of MSC-specific surface markers. Cells were harvested and counted; then, 10 mL phycoerythrin/fluorescein isothiocyanate (PE/FITC) tagged antibodies were added into the appropriate number of cells. Samples were stained for 1 hour at 4 C and then washed with fluorescence-activated cell sorting (FACS) buffer for 5 minutes. To fix the cells, 4% paraformaldehyde was added to the pellet and resuspended. The following markers were used for immunostaining: CD166-PE, CD 105 FITC, CD73PE, CD90-PE, CD34-FITC, CD19-PE, CD45-PE, and HLA-DR-PE (Table 1). Data analysis was optimized against control cells incubated with specific isotypes immunoglobulin (Ig) G1-PE, IgG2aPE, and IgG1-FITC on FACS Calibur (BD Biosciences, Franklin Lakes, NJ). Cells were identified by light scatter for 10,000 gated events and analyzed using BD Cell Quest Pro software (BD Biosciences).
TABLE 1. The List of Conjugated Antibodies Used in the Study Antigen
Antibody
Dilution
Brand
Application
CD166 CD105 CD90 CD73 CD45 CD34 CD19 HLA DR
PE conjugated antihuman CD16 FITC conjugated antihuman CD105 PE conjugated antihuman CD90 PE conjugated antihuman CD73 PE conjugated antihuman CD45 FITC conjugated antihuman CD34 PE conjugated antihuman CD19 PE conjugated antihuman HLA-DR
1:20 1:20 1:20 1:20 1:20 1:20 1:20 1:20
BD Biosciences BD Biosciences BD Biosciences BD Biosciences BD Biosciences BD Biosciences BD Biosciences BD Biosciences
Immunophenotyping by flow cytometry Immunophenotyping by flow cytometry Immunophenotyping by flow cytometry Immunophenotyping by flow cytometry Immunophenotyping by flow cytometry Immunophenotyping by flow cytometry Immunophenotyping by flow cytometry Immunophenotyping by flow cytometry
FITC, fluorescein isothiocyanate; HLA-DR, human leukocyte antigen-DR; PE, phycoerythrin.
2
Malekfar et al.
JOE — Volume -, Number -, - 2015
Basic Research—Biology TABLE 2. Primer Sequence for Reverse-transcription Polymerase Chain Reaction Gene name OCN OPN PPARG AP2 GAPDH
50 -Sequence-30 Forward AGCAAAGGTGCAGCCTTTGT Reverse GCGCCTGGGTCTCTTCACT Forward GCCGACCAAGGAAAACTCACT Reverse GGCACAGGTGATGCCTAGGA Forward CAGTGTGAATTACAGCAAACC Reverse ACAGTGTATCAGTGAAGGAAT Forward GGTGGTGGAATGCGTCATG Reverse CAACGTCCCTTGGCTTATGC Forward CTCACTGGCATGGCCTTCCG Reverse ACCACCCTGTTGCTGTAGCC
Product size 63 71 100
was reversed transcribed, and polymerase chain reaction (PCR) amplification of target message RNA was performed using the Thermo Scientific PCR kit (Thermo Scientific, Waltham, MA). The amplified PCR product specificity was analyzed using 1.5% agarose gel. Densitometric quantification was performed from the image of the PCR product using ImageJ software (National Institutes of Health, Bethesda, MD), and normalized values (with glyceraldehyde-3-phosphate dehydrogenase [GAPDH] as the internal control) were plotted. The PCR oligonucleotide primers and annealing temperature are listed in Table 2.
71 95
Osteogenic Differentiation For osteogenic differentiation, DPSCs were seeded at 3000 cells/cm2 in 24-well plates and allowed to be at about 90% confluence. Then, cells were induced with an osteogenic differentiation kit per the manufacturer’s instructions (Lonza, Walkersiville, MD). Accumulation of calcium was assessed by von Kossa staining on the 21st day after induction. Adipogenic Differentiation The cultures were initiated at 3000 cells/cm2 in 24-well plates and allowed to reach 90% confluency. Thereafter, an adipogenic differentiation kit (Lonza) was used, and oil red O staining was conducted after 3 weeks to visualize lipid droplets. RNA Isolation and Reverse-transcription Polymerase Chain Reaction Total RNA was extracted from osteogenic and adipogenic differentiated DPSCs using the Qiagen RNeasy Mini Kit (Qiagen, Hilden, Germany) according to the protocol therein. About 1 mg total RNA
Statistical Analysis Results were presented as the mean of at least 10 sample replicates (n = 10) the standard error of the mean and experiments repeated in triplicates. Statistical comparisons were performed using the Student t test. A P value #.01 was considered significant.
Results Morphologic Analysis The culture protocol, as described previously, allowed reproducible isolation of DPSCs from both cryopreserved and noncryopreserved pulp tissues. Within 8 to 14 days after the isolation process, DPSCs appeared as adherent cells on the bottom of culture dishes. The isolation success rate was 60% and 80% for DPSCs from cryopreserved and noncryopreserved pulp tissue groups, respectively. The cell morphology of cultured DPSCs was confirmed using phase contrast microscopy. Homogenous DPSCs from both groups showed morphologic features similar to fibroblasts. Proliferation Rate A mean PD of 4.29 1.12 and 4.68 1.68 was calculated for DPSCs from cryopreserved and noncryopreserved pulp tissue groups, respectively, after 10 successive passages (Fig. 1A).
Figure 1. Quantitative analysis of proliferation of DPSCs. The graphs represent the results of (A) PD, (B) CPD, (C) TD, and (D) MTT assay.
JOE — Volume -, Number -, - 2015
Cryopreservation of Dental Pulp for Banking
3
Basic Research—Biology We also estimated the CPD of DPSCs at the end of 10 passages. The CPDs ranged between 45.21 3.65 for DPSCs from cryopreserved pulps and 47.69 5.32 for DPSCs from noncryopreserved pulps. The difference was not significant (Fig. 1B). After 10 passages, a mean TD of 49.71 3.82 hours and 46.54 7.69 hours was recorded for DPSCs from cryopreserved and noncryopreserved pulp tissue groups, respectively (Fig. 1C).
MTT Assay The cell viability assay with MTT indicated an almost similar proliferation rate for both DPSC groups isolated from cryopreserved and noncryopreserved pulp tissues as shown in Figure 1D. Statistical analysis also confirmed that there is not any significant difference between these 2 groups. Wound Healing Assay There was no significant difference in the number of migrated cells in the 2 DPSC groups that were isolated from cryopreserved and noncryopreserved pulp tissues (Fig. 2D). Flow Cytometric Profile All the surface markers tested were similarly expressed on DPSCs irrespective of the freezing mix used in the process of pulp tissues as a source of isolated cells. Both the populations of DPSCs were positive for
mesenchymal markers CD166, CD105, CD90, and CD73 and negative for CD45, CD34, CD19, and HLA-DR (Fig. 2A–C).
Multilineage Differentiation DPSCs from both groups were examined for their in vitro differentiation capacity along osteogenic and adipogenic lineages. DPSCs at passage 7 were used. No noticeable distinction in von Kossa and oil red O staining was observed between the 2 groups (Fig. 3A and B). Afterward, the osteoblast gene expression pattern for osteocalcin and osteopontin and the adipogenic gene expression pattern for adipocyte protein 2 and human peroxisome proliferator–activated receptor gamma in both groups of DPSCs were analyzed at the messenger RNA level. Similar to von Kossa and oil red O staining results, the conducted PCR did not show any differences in osteogenic and adipogenic potentials of these 2 groups (Fig. 4A and B).
Discussion Although the process involved in the isolation of MSCs is complicated, clinically appropriate processing for banking of the resources can provide immense advantages for cell therapy with a reduction of the number of recruitments essential for cell processing. Cryopreservation of stem cells has offered several services
Figure 2. Flow cytometric analyses. (A and B) Histograms and (C) graphs show that DPSCs isolated from both cryopreserved and noncryopreserved pulp tissues were immunonegative for CD45, CD34, CD19, and HLA-DR but expressed cell surface antigens CD166, CD105, CD90, and CD73. (D) Wound healing assay; comparison of the number of migrated DPSC in 2 different groups.
4
Malekfar et al.
JOE — Volume -, Number -, - 2015
Basic Research—Biology
Figure 3. DPSC differentiation. In vitro osteogenesis and adipogenesis evidenced by mineralized matrix deposition stained with (A) von Kossa stain and (B) oil red O stain, respectively, in obtained DPSCs from cryopreserved and noncryopreserved pulp tissues 3 weeks after induction.
such as long-term storage, adjusting a therapeutic cell dose, and reducing contamination for safety and quality in the clinical applications (14). This approach has been used widely and successfully in bone marrow transplantation and hematopoietic stem cells transplantation (16, 17). Therefore, cryopreserved storing and banking of MSC resources would be a variable, indispensable, and practical approach for stem cell–based therapy.
It is documented that DPSC isolation is possible for at least 120 hours after tooth extraction if teeth are stored at 4 C in a variety of collection/transport media, indicating that processing immediately after extraction may not be necessary for successful banking of DPSCs. Studies also showed that by the recovery of viable DPSCs after cryopreservation of intact teeth, minimal processing may be required for the banking of samples with no instant plans for expansion (18).
Figure 4. (A) Semiquantitative RT-PCR of osteoblast and adipoblast differentiation gene markers and (B) densitometric quantification of the image of the PCR product using ImageJ software.
JOE — Volume -, Number -, - 2015
Cryopreservation of Dental Pulp for Banking
5
Basic Research—Biology At the end of each endodontic treatment, obtained pulp tissues can be considered as a valuable starting source for the isolation of DPSCs besides those from extracted teeth. It is documented that seeded pulp cells on polyglycolic acid are able to form a tissue analogous to the indigenous pulp (19). These findings afford new prospects on the possibility of generating pulp and dentin in pulpless canals that are referred for regenerative endodontics. In the present study, we assessed the possibility of isolation of DPSCs from 3-month cryopreserved pulp tissues obtained from endodontic treatment and compared the characteristics of isolated cells with those of DPSCs from noncryopreserved pulp tissues. DPSCs with fibroblastic morphology as previously described were isolated from both groups; the media used in the study was knockout DMEM as reported earlier (20, 21). The successful isolation rate of DPSCs was considered altered with a significant reduction in the cryopreserved group, an incident that was observed in other studies (22). This phenomenon may be caused by the resisting damage caused by ice crystals during the freezing procedure (23). Nevertheless, further investigation on freezing optimization may improve the successful isolation rate of DPSCs from cryopreserved pulp tissues because in a study that applied a novel programmable freezer coupled to a magnetic field for cryopreservation, the isolation rate of DPSCs from magnetically cryopreserved teeth improved to 73% (12). However, there was no significant difference in morphology between cells isolated from cryopreserved pulp tissues and those isolated from fresh pulp tissues. No statistical differences between the groups were observed through the time course proliferation assay. There were also no visible differences in cell viability, expression of MSC markers, and osteogenic and adipogenic differentiation between the 2 groups of DPSCs. Previously, it was shown that after long-term cryopreservation (2 years) of isolated DPSCs from extracted teeth, there was no change in differentiation capacity, expression of respective surface antigens, and produced woven bone tissue (24). Cryopreserved deciduous teeth stem cells can also maintain the stem cell property and multipotency (25, 26). Cryopreserved stem cells from apical papilla showed comparable biological and immunomodulatory functions with freshly isolated stem cells from apical papilla (27). Another study also showed that cryopreservation of deciduous dental pulp cannot affect the biological and immunologic properties of stem cells from human exfoliated deciduous teeth (14). This study illustrated that this approach is simple, economic, and user-friendly.
Conclusion In conclusion, these data support the feasibility of banking of cryopreserved dental pulp tissues obtained from endodontic treatment for isolation of DPSCs and their applications in regenerative medicine. Our preliminary research can facilitate the development of future current good tissue practice protocols for the clinical banking of DPSCs.
Acknowledgments The authors thank Manipal University and Sri Rajiv Gandhi College of Dental Sciences and Hospital, RGC Campus, Bangalore, India, for extending facilities to perform the present work. The authors deny any conflicts of interest related to this study.
6
Malekfar et al.
References 1. Bonnamain V, Thinard R, Sergent-Tanguy S, et al. Human dental pulp stem cells cultured in serum-free supplemented medium. Front Physiol 2013;4:357. 2. Gronthos S, Mankani M, Brahim J, et al. Postnatal human dental pulp stem cells (DPSCs) in vitro and in vivo. Proc Natl Acad Sci U S A 2000;25:13625–30. 3. Gronthos S, Brahim J, Li W, et al. Stem cell properties of human dental pulp stem cells. J Dent Res 2002;8:531–5. 4. Dominici M, Le Blanc K, Mueller I, et al. Minimal criteria for defining multipotent mesenchymal stromal cells. The International Society for Cellular Therapy position statement. Cytotherapy 2006;4:315–7. 5. Lei M, Li K, Li B, et al. Mesenchymal stem cell characteristics of dental pulp and periodontal ligament stem cells after in vivo transplantation. Biomaterials 2014; 24:6332–43. 6. Huang GT-J, Gronthos S, Shi S. Mesenchymal stem cells derived from dental tissues vs. those from other sources: their biology and role in regenerative medicine. J Dent Res 2009;9:792–806. 7. Kumar S, Chanda D, Ponnazhagan S. Therapeutic potential of genetically modified mesenchymal stem cells. Gene Ther 2008;10:711–5. 8. Prescott RS, Alsanea R, Fayad MI, et al. In vivo generation of dental pulp-like tissue by using dental pulp stem cells, a collagen scaffold, and dentin matrix protein 1 after subcutaneous transplantation in mice. J Endod 2008;4:421–6. 9. Zhao Y, Wang L, Jin Y, Shi S. Fas ligand regulates the immunomodulatory properties of dental pulp stem cells. J Dent Res 2012;10:948–54. 10. Alongi DJ, Yamaza T, Song Y, et al. Stem/progenitor cells from inflamed human dental pulp retain tissue regeneration potential. Regen Med 2010;5: 617–31. 11. Chen Y-K, Huang AH-C, Chan AW-S, et al. Human dental pulp stem cells derived from different cryopreservation methods of human dental pulp tissues of diseased teeth. J Oral Pathol Med Off Publ Int Assoc Oral Pathol Am Acad Oral Pathol 2011;10: 793–800. 12. Lee S-Y, Chiang P-C, Tsai Y-H, et al. Effects of cryopreservation of intact teeth on the isolated dental pulp stem cells. J Endod 2010;8:1336–40. 13. Gioventu S, Andriolo G, Bonino F, et al. A novel method for banking dental pulp stem cells. Transfus Apher Sci 2012;2:199–206. 14. Ma L, Makino Y, Yamaza H, et al. Cryopreserved dental pulp tissues of exfoliated deciduous teeth is a feasible stem cell resource for regenerative medicine. PLoS One 2012;12:e51777. 15. Pereira LO, Rubini MR, Silva JR, et al. Comparison of stem cell properties of cells isolated from normal and inflamed dental pulps. Int Endod J 2012;12:1080–90. 16. Areman EM, Sacher RA, Deeg HJ. Processing and storage of human bone marrow: a survey of current practices in North America. Bone Marrow Transplant 1990;3: 203–9. 17. Watt SM, Austin E, Armitage S. Cryopreservation of hematopoietic stem/progenitor cells for therapeutic use. Methods Mol Biol 2007;368:237–59. 18. Perry BC, Zhou D, Wu X, et al. Collection, cryopreservation, and characterization of human dental pulp-derived mesenchymal stem cells for banking and clinical use. Tissue Eng Part C Methods 2008;2:149–56. 19. Bohl KS, Shon J, Rutherford B, Mooney DJ. Role of synthetic extracellular matrix in development of engineered dental pulp. J Biomater Sci Polym Ed 1998; 7:749–64. 20. Attar A, Eslaminejad MB, Tavangar MS, et al. Dental pulp polyps contain stem cells comparable to the normal dental pulps. J Clin Exp Dent 2014;1:e53–9. 21. Kanafi MM, Pal R, Gupta PK. Phenotypic and functional comparison of optimum culture conditions for upscaling of dental pulp stem cells. Cell Biol Int 2013;2:126–36. 22. Lindemann D, Werle SB, Steffens D, et al. Effects of cryopreservation on the characteristics of dental pulp stem cells of intact deciduous teeth. Arch Oral Biol 2014;9:970–6. 23. Lin S-L, Chang W-J, Lin C-Y, et al. Static magnetic field increases survival rate of dental pulp stem cells during DMSO-free cryopreservation. Electromagn Biol Med 2014;23:1–7. 24. O’Grady SM, Cooper KE, Rae JL. Cyclic GMP regulation of a voltage-activated K channel in dissociated enterocytes. J Membr Biol 1991;2:159–67. 25. Lizier NF, Kerkis A, Gomes CM, et al. Scaling-up of dental pulp stem cells isolated from multiple niches. PLoS One 2012;6:e39885. 26. Kerkis I, Kerkis A, Dozortsev D, et al. Isolation and characterization of a population of immature dental pulp stem cells expressing OCT-4 and other embryonic stem cell markers. Cells Tissues Organs 2006;3–4:105–16. 27. Ding G, Wang W, Liu Y, et al. Effect of cryopreservation on biological and immunological properties of stem cells from apical papilla. J Cell Physiol 2010;2:415–22.
JOE — Volume -, Number -, - 2015
Isolation and Characterization of Human Dental Pulp Stem Cells from Cryopreserved Pulp Tissues Obtained from Teeth with Irreversible Pulpitis Azin Malekfar, BDS,* Kusum S. Valli, MDS,* Mohammad Mahboob Kanafi, PhD,† and Ramesh R. Bhonde, PhD† Abstract Introduction: Human dental pulp stem cells (DPSCs) are becoming an attractive target for therapeutic purposes because of their neural crest origin and propensity. Although DPSCs can be successfully cryopreserved, there are hardly any reports on cryopreservation of dental pulp tissues obtained from teeth diagnosed with symptomatic irreversible pulpitis during endodontic treatment and isolation and characterization of DPSCs from such cryopreserved pulp. The aim of this study was to cryopreserve the said pulp tissues to propagate and characterize isolated DPSCs. Methods: A medium consisting of 90% fetal bovine serum and 10% dimethyl sulfoxide was used for cryopreservation of pulp tissues. DPSCs were isolated from fresh and cryopreserved pulp tissues using an enzymatic method. Cell viability and proliferation were determined using the MTT [3-(4,5dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide] assay. DPSC migration and interaction were analyzed with the wound healing assay. Mesenchymal characteristics of DPSCs were verified by flow cytometric analysis of cell surface CD markers. The osteogenic and adipogenic potential of DPSCs was shown by von Kossa and oil red O staining methods, respectively, and the polymerase chain reaction method. Result: We found no significant difference in CD marker expression and osteogenic and adipogenic differentiation potential of DPSCs obtained from fresh and cryopreserved dental pulp tissue. Conclusions: Our study shows that dental pulp can be successfully cryopreserved without losing normal characteristics and differentiation potential of their DPSCs, thus making them suitable for dental banking and future therapeutic purposes. (J Endod 2015;-:1–6)
Key Words Cryopreservation, dental pulp, dental pulp stem cells, endodontics, mesenchymal stem cells, stem cell banking
D
ental pulp stem/progenitor cells originating from neural crests exist in the pulp tissue of teeth (1). In 2000, Dr Gronthos and colleagues identified stem cells in human dental tissues for the first time and reported isolation of postnatal human dental pulp stem cells (DPSCs) by enzymatic treatment (2). These DPSCs were found to be capable of differentiating into neural-like cells in vitro and were also capable of forming ectopic dentin and associated pulp tissue in vivo (3). Subsequent studies revealed that these newly identified cells are a clonogenic and rapidly proliferative population of mesenchymal stem cells (MSCs). By definition, MSCs have the ability to differentiate into osteoblasts, adipocytes, and chondrocytes; adhere to plastic tissue culture dishes; and express CD105, CD73, and CD90 but not CD45, CD34, CD14 or CD11b, CD79a or CD19, or HLA-DR surface molecules (4). All of these vital features of MSCs have been observed in DPSCs and confirmed through several characterization studies (5, 6). Dental pulp tissue is an attractive source of MSCs because it is a noncontroversial and readily accessible source. Because regeneration and maintenance are reliant on MSCs (7), these features of DPSCs bring to light their promise in the field of tissue engineering and regenerative medicine, in particular regenerative endodontics (revascularization/pulpal regeneration) (8). It is known that DPSCs possess immunomodulatory effects (9) and can be obtained from inflamed dental pulps as well. Alongi et al (10) showed that DPSCs isolated from inflamed pulps can express higher levels of MSC markers CD90 and CD105 in comparison with those from normal pulps. Because successful isolation of DPSCs has been limited to 5 days after tooth extraction, it is important to optimize their isolation and preservation (11). It is well documented that cryopreserved whole teeth can be used as a possible source of DPSCs (12, 13). In 1 of these related studies, scientists cryopreserved whole teeth after excavating microchannels into the tooth with laser piercing to allow the cryopreservative access to the dental pulp and preserve the cells. Their data showed that isolated DPSCs from these cryopreserved teeth exhibit MSC morphology, immunophenotype, viability, and a proliferation rate comparable with those of cells isolated from fresh, noncryopreserved teeth (13). In another study, instead of whole teeth cryopreservation, it has been shown that cryopreserved dental pulp tissues of deciduous teeth are also a feasible stem cell resource for isolation of dental stem cells from human exfoliated deciduous teeth (14). To develop DPSC banking, the primary step is to identify and select the best accessible sources of pulp tissue for isolation of DPSCs. Although isolation of DPSCs from teeth diagnosed with irreversible pulpitis is almost impractical immediately after endodontic therapy, it has been proven that the inflammatory process does not affect the
From the *Department of Conservative Dentistry and Endodontics, Sri Rajiv Gandhi College of Dental Sciences and Hospital; and †Manipal Institute of Regenerative Medicine, Manipal University, Bangalore, India. Address requests for reprints to Dr Ramesh R. Bhonde, Manipal Institute of Regenerative Medicine, Manipal University, Bangalore 560065, India. E-mail address: [email protected] 0099-2399/$ - see front matter Copyright ª 2015 American Association of Endodontists. http://dx.doi.org/10.1016/j.joen.2015.10.001
JOE — Volume -, Number -, - 2015
Cryopreservation of Dental Pulp for Banking
1
Basic Research—Biology properties of the DPSCs (15). Therefore, cryopreservation of pulp tissues from teeth with irreversible pulpitis and subsequent isolation of DPSCs from them would be an alternative with therapeutic value to overcome this issue. Hence, in the present study, we aimed to evaluate whether cryopreserved inflamed pulp tissues of permanent teeth with irreversible pulpitis are a retrievable and practical DPSC source? With this aim, we attempted to compare characterization of DPSCs isolated from cryopreserved and noncryopreserved (fresh) pulp tissues of permanent teeth with symptomatic irreversible pulpitis.
Materials and Methods Pulp tissues were obtained during root canal treatment of human permanent carious molar teeth of 15- to 30-year-old patients with symptomatic irreversible pulpitis at the Department of Conservative Dentistry and Endodontics, Sri Rajiv Gandhi College of Dental Sciences and Hospital, RGC Campus, Bangalore, India. Informed consent was obtained from donors, and the protocol was approved by the Institutional Ethical Committee of Sri Rajiv Gandhi College of Dental Sciences and Hospital.
Isolation of DPSCs DPSCs were isolated from cryopreserved (n = 10) and noncryopreserved (fresh) human dental pulp tissues (n = 10). Dental pulp tissues were washed 2 to 3 times with Dulbecco phosphate-buffered saline solution under the laminar flow chamber. Then, 2-mg/mL collagenase blends (Sigma-Aldrich, St Louis, MO) were added, and the tissues were minced to smaller pieces to increase the surface area for better enzyme action. Then, minced tissues were kept in the incubator (5% CO2, 37 C) for 1 hour. After incubation, the action of enzymes was neutralized by addition of the culture medium. The samples were then centrifuged at 400g for 5 minutes, and cell pellets were collected and plated in 24-well plates and kept in the incubator. Cultures were fed with fresh media every 48 hours. DPSCs were cultured in knockout Dulbecco modified Eagle medium (Gibco, Grand Island, NY) supplemented with 10% fetal bovine serum (Hyclone, Logan, UT), 5 mmol/L L-glutamine (Gibco), and 50 U/mL penicillin streptomycin (Gibco). Cryopreservation of Dental Pulp Tissues Dental pulp tissues were mixed with chilled cryopreserved medium (4 C) and kept overnight at 80 C. The cryopreserved medium consisted of 10% dimethyl sulfoxide (Sigma-Aldrich) and 90% fetal bovine serum (Hyclone). They were transferred into liquid nitrogen in a controlled cooling manner enabling a cooling rate of 1 C/min and stored. After 3 months of storage, the cryopreserved pulps were thawed out, and DPSCs were isolated using the previously mentioned method.
Growth Kinetic Study The growth kinetic study was performed by calculating population doubling (PD), cumulative population doubling (CPD), and population doubling time (TD). DPSCs were dissociated with 0.25% trypsin (Gibco) and counted using the trypan blue exclusion method on a Neubauer hemocytometer at the end of each passage once cells were about 90% confluent, and then they were replated for the subsequent passages. The PD and TD were determined by the following formulas, respectively: PD = LogNhLogNi/Log2 and TD = t*Log2/LogNhLogNi, where Ni = number of cells at seeding time, Nh = number of cells at harvesting time, and t = culture time (in hours), and CPD = PD of each passage + PD of previous passage. MTT Assay It was a 2-day protocol. On the first day, 7500 cells mixed with 100 mL growth media were seeded into each well of a 96-well plate and incubated overnight. The next day 20 mL of 5 mg/mL MTT [3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide] was added to each well, and cells were incubated for 3.5 hours at 37 C in the culture hood. Then, media was removed, and 150 mL MTT solvent was added. The plate was covered with tinfoil, and cells were agitated on an orbital shaker for 15 minutes. Absorbance was read at 590 nm with a reference filter of 620 nm. Wound Healing Assay The effects of cryopreservation of pulp on the migration of stem cells were examined via the wound healing assay. For this purpose, DPSCs were mechanically scratched with a sterile pipette tip in 6-well plastic dishes to remove a certain portion of cells. The migratory ability of the cells was assessed by counting the number of cells within the scratched wound at 0, 12, 24, 36, and 48 hours. Flow Cytometric Analysis Flow cytometry with DPSCs was performed to characterize these cells for a candidate set of MSC-specific surface markers. Cells were harvested and counted; then, 10 mL phycoerythrin/fluorescein isothiocyanate (PE/FITC) tagged antibodies were added into the appropriate number of cells. Samples were stained for 1 hour at 4 C and then washed with fluorescence-activated cell sorting (FACS) buffer for 5 minutes. To fix the cells, 4% paraformaldehyde was added to the pellet and resuspended. The following markers were used for immunostaining: CD166-PE, CD 105 FITC, CD73PE, CD90-PE, CD34-FITC, CD19-PE, CD45-PE, and HLA-DR-PE (Table 1). Data analysis was optimized against control cells incubated with specific isotypes immunoglobulin (Ig) G1-PE, IgG2aPE, and IgG1-FITC on FACS Calibur (BD Biosciences, Franklin Lakes, NJ). Cells were identified by light scatter for 10,000 gated events and analyzed using BD Cell Quest Pro software (BD Biosciences).
TABLE 1. The List of Conjugated Antibodies Used in the Study Antigen
Antibody
Dilution
Brand
Application
CD166 CD105 CD90 CD73 CD45 CD34 CD19 HLA DR
PE conjugated antihuman CD16 FITC conjugated antihuman CD105 PE conjugated antihuman CD90 PE conjugated antihuman CD73 PE conjugated antihuman CD45 FITC conjugated antihuman CD34 PE conjugated antihuman CD19 PE conjugated antihuman HLA-DR
1:20 1:20 1:20 1:20 1:20 1:20 1:20 1:20
BD Biosciences BD Biosciences BD Biosciences BD Biosciences BD Biosciences BD Biosciences BD Biosciences BD Biosciences
Immunophenotyping by flow cytometry Immunophenotyping by flow cytometry Immunophenotyping by flow cytometry Immunophenotyping by flow cytometry Immunophenotyping by flow cytometry Immunophenotyping by flow cytometry Immunophenotyping by flow cytometry Immunophenotyping by flow cytometry
FITC, fluorescein isothiocyanate; HLA-DR, human leukocyte antigen-DR; PE, phycoerythrin.
2
Malekfar et al.
JOE — Volume -, Number -, - 2015
Basic Research—Biology TABLE 2. Primer Sequence for Reverse-transcription Polymerase Chain Reaction Gene name OCN OPN PPARG AP2 GAPDH
50 -Sequence-30 Forward AGCAAAGGTGCAGCCTTTGT Reverse GCGCCTGGGTCTCTTCACT Forward GCCGACCAAGGAAAACTCACT Reverse GGCACAGGTGATGCCTAGGA Forward CAGTGTGAATTACAGCAAACC Reverse ACAGTGTATCAGTGAAGGAAT Forward GGTGGTGGAATGCGTCATG Reverse CAACGTCCCTTGGCTTATGC Forward CTCACTGGCATGGCCTTCCG Reverse ACCACCCTGTTGCTGTAGCC
Product size 63 71 100
was reversed transcribed, and polymerase chain reaction (PCR) amplification of target message RNA was performed using the Thermo Scientific PCR kit (Thermo Scientific, Waltham, MA). The amplified PCR product specificity was analyzed using 1.5% agarose gel. Densitometric quantification was performed from the image of the PCR product using ImageJ software (National Institutes of Health, Bethesda, MD), and normalized values (with glyceraldehyde-3-phosphate dehydrogenase [GAPDH] as the internal control) were plotted. The PCR oligonucleotide primers and annealing temperature are listed in Table 2.
71 95
Osteogenic Differentiation For osteogenic differentiation, DPSCs were seeded at 3000 cells/cm2 in 24-well plates and allowed to be at about 90% confluence. Then, cells were induced with an osteogenic differentiation kit per the manufacturer’s instructions (Lonza, Walkersiville, MD). Accumulation of calcium was assessed by von Kossa staining on the 21st day after induction. Adipogenic Differentiation The cultures were initiated at 3000 cells/cm2 in 24-well plates and allowed to reach 90% confluency. Thereafter, an adipogenic differentiation kit (Lonza) was used, and oil red O staining was conducted after 3 weeks to visualize lipid droplets. RNA Isolation and Reverse-transcription Polymerase Chain Reaction Total RNA was extracted from osteogenic and adipogenic differentiated DPSCs using the Qiagen RNeasy Mini Kit (Qiagen, Hilden, Germany) according to the protocol therein. About 1 mg total RNA
Statistical Analysis Results were presented as the mean of at least 10 sample replicates (n = 10) the standard error of the mean and experiments repeated in triplicates. Statistical comparisons were performed using the Student t test. A P value #.01 was considered significant.
Results Morphologic Analysis The culture protocol, as described previously, allowed reproducible isolation of DPSCs from both cryopreserved and noncryopreserved pulp tissues. Within 8 to 14 days after the isolation process, DPSCs appeared as adherent cells on the bottom of culture dishes. The isolation success rate was 60% and 80% for DPSCs from cryopreserved and noncryopreserved pulp tissue groups, respectively. The cell morphology of cultured DPSCs was confirmed using phase contrast microscopy. Homogenous DPSCs from both groups showed morphologic features similar to fibroblasts. Proliferation Rate A mean PD of 4.29 1.12 and 4.68 1.68 was calculated for DPSCs from cryopreserved and noncryopreserved pulp tissue groups, respectively, after 10 successive passages (Fig. 1A).
Figure 1. Quantitative analysis of proliferation of DPSCs. The graphs represent the results of (A) PD, (B) CPD, (C) TD, and (D) MTT assay.
JOE — Volume -, Number -, - 2015
Cryopreservation of Dental Pulp for Banking
3
Basic Research—Biology We also estimated the CPD of DPSCs at the end of 10 passages. The CPDs ranged between 45.21 3.65 for DPSCs from cryopreserved pulps and 47.69 5.32 for DPSCs from noncryopreserved pulps. The difference was not significant (Fig. 1B). After 10 passages, a mean TD of 49.71 3.82 hours and 46.54 7.69 hours was recorded for DPSCs from cryopreserved and noncryopreserved pulp tissue groups, respectively (Fig. 1C).
MTT Assay The cell viability assay with MTT indicated an almost similar proliferation rate for both DPSC groups isolated from cryopreserved and noncryopreserved pulp tissues as shown in Figure 1D. Statistical analysis also confirmed that there is not any significant difference between these 2 groups. Wound Healing Assay There was no significant difference in the number of migrated cells in the 2 DPSC groups that were isolated from cryopreserved and noncryopreserved pulp tissues (Fig. 2D). Flow Cytometric Profile All the surface markers tested were similarly expressed on DPSCs irrespective of the freezing mix used in the process of pulp tissues as a source of isolated cells. Both the populations of DPSCs were positive for
mesenchymal markers CD166, CD105, CD90, and CD73 and negative for CD45, CD34, CD19, and HLA-DR (Fig. 2A–C).
Multilineage Differentiation DPSCs from both groups were examined for their in vitro differentiation capacity along osteogenic and adipogenic lineages. DPSCs at passage 7 were used. No noticeable distinction in von Kossa and oil red O staining was observed between the 2 groups (Fig. 3A and B). Afterward, the osteoblast gene expression pattern for osteocalcin and osteopontin and the adipogenic gene expression pattern for adipocyte protein 2 and human peroxisome proliferator–activated receptor gamma in both groups of DPSCs were analyzed at the messenger RNA level. Similar to von Kossa and oil red O staining results, the conducted PCR did not show any differences in osteogenic and adipogenic potentials of these 2 groups (Fig. 4A and B).
Discussion Although the process involved in the isolation of MSCs is complicated, clinically appropriate processing for banking of the resources can provide immense advantages for cell therapy with a reduction of the number of recruitments essential for cell processing. Cryopreservation of stem cells has offered several services
Figure 2. Flow cytometric analyses. (A and B) Histograms and (C) graphs show that DPSCs isolated from both cryopreserved and noncryopreserved pulp tissues were immunonegative for CD45, CD34, CD19, and HLA-DR but expressed cell surface antigens CD166, CD105, CD90, and CD73. (D) Wound healing assay; comparison of the number of migrated DPSC in 2 different groups.
4
Malekfar et al.
JOE — Volume -, Number -, - 2015
Basic Research—Biology
Figure 3. DPSC differentiation. In vitro osteogenesis and adipogenesis evidenced by mineralized matrix deposition stained with (A) von Kossa stain and (B) oil red O stain, respectively, in obtained DPSCs from cryopreserved and noncryopreserved pulp tissues 3 weeks after induction.
such as long-term storage, adjusting a therapeutic cell dose, and reducing contamination for safety and quality in the clinical applications (14). This approach has been used widely and successfully in bone marrow transplantation and hematopoietic stem cells transplantation (16, 17). Therefore, cryopreserved storing and banking of MSC resources would be a variable, indispensable, and practical approach for stem cell–based therapy.
It is documented that DPSC isolation is possible for at least 120 hours after tooth extraction if teeth are stored at 4 C in a variety of collection/transport media, indicating that processing immediately after extraction may not be necessary for successful banking of DPSCs. Studies also showed that by the recovery of viable DPSCs after cryopreservation of intact teeth, minimal processing may be required for the banking of samples with no instant plans for expansion (18).
Figure 4. (A) Semiquantitative RT-PCR of osteoblast and adipoblast differentiation gene markers and (B) densitometric quantification of the image of the PCR product using ImageJ software.
JOE — Volume -, Number -, - 2015
Cryopreservation of Dental Pulp for Banking
5
Basic Research—Biology At the end of each endodontic treatment, obtained pulp tissues can be considered as a valuable starting source for the isolation of DPSCs besides those from extracted teeth. It is documented that seeded pulp cells on polyglycolic acid are able to form a tissue analogous to the indigenous pulp (19). These findings afford new prospects on the possibility of generating pulp and dentin in pulpless canals that are referred for regenerative endodontics. In the present study, we assessed the possibility of isolation of DPSCs from 3-month cryopreserved pulp tissues obtained from endodontic treatment and compared the characteristics of isolated cells with those of DPSCs from noncryopreserved pulp tissues. DPSCs with fibroblastic morphology as previously described were isolated from both groups; the media used in the study was knockout DMEM as reported earlier (20, 21). The successful isolation rate of DPSCs was considered altered with a significant reduction in the cryopreserved group, an incident that was observed in other studies (22). This phenomenon may be caused by the resisting damage caused by ice crystals during the freezing procedure (23). Nevertheless, further investigation on freezing optimization may improve the successful isolation rate of DPSCs from cryopreserved pulp tissues because in a study that applied a novel programmable freezer coupled to a magnetic field for cryopreservation, the isolation rate of DPSCs from magnetically cryopreserved teeth improved to 73% (12). However, there was no significant difference in morphology between cells isolated from cryopreserved pulp tissues and those isolated from fresh pulp tissues. No statistical differences between the groups were observed through the time course proliferation assay. There were also no visible differences in cell viability, expression of MSC markers, and osteogenic and adipogenic differentiation between the 2 groups of DPSCs. Previously, it was shown that after long-term cryopreservation (2 years) of isolated DPSCs from extracted teeth, there was no change in differentiation capacity, expression of respective surface antigens, and produced woven bone tissue (24). Cryopreserved deciduous teeth stem cells can also maintain the stem cell property and multipotency (25, 26). Cryopreserved stem cells from apical papilla showed comparable biological and immunomodulatory functions with freshly isolated stem cells from apical papilla (27). Another study also showed that cryopreservation of deciduous dental pulp cannot affect the biological and immunologic properties of stem cells from human exfoliated deciduous teeth (14). This study illustrated that this approach is simple, economic, and user-friendly.
Conclusion In conclusion, these data support the feasibility of banking of cryopreserved dental pulp tissues obtained from endodontic treatment for isolation of DPSCs and their applications in regenerative medicine. Our preliminary research can facilitate the development of future current good tissue practice protocols for the clinical banking of DPSCs.
Acknowledgments The authors thank Manipal University and Sri Rajiv Gandhi College of Dental Sciences and Hospital, RGC Campus, Bangalore, India, for extending facilities to perform the present work. The authors deny any conflicts of interest related to this study.
6
Malekfar et al.
References 1. Bonnamain V, Thinard R, Sergent-Tanguy S, et al. Human dental pulp stem cells cultured in serum-free supplemented medium. Front Physiol 2013;4:357. 2. Gronthos S, Mankani M, Brahim J, et al. Postnatal human dental pulp stem cells (DPSCs) in vitro and in vivo. Proc Natl Acad Sci U S A 2000;25:13625–30. 3. Gronthos S, Brahim J, Li W, et al. Stem cell properties of human dental pulp stem cells. J Dent Res 2002;8:531–5. 4. Dominici M, Le Blanc K, Mueller I, et al. Minimal criteria for defining multipotent mesenchymal stromal cells. The International Society for Cellular Therapy position statement. Cytotherapy 2006;4:315–7. 5. Lei M, Li K, Li B, et al. Mesenchymal stem cell characteristics of dental pulp and periodontal ligament stem cells after in vivo transplantation. Biomaterials 2014; 24:6332–43. 6. Huang GT-J, Gronthos S, Shi S. Mesenchymal stem cells derived from dental tissues vs. those from other sources: their biology and role in regenerative medicine. J Dent Res 2009;9:792–806. 7. Kumar S, Chanda D, Ponnazhagan S. Therapeutic potential of genetically modified mesenchymal stem cells. Gene Ther 2008;10:711–5. 8. Prescott RS, Alsanea R, Fayad MI, et al. In vivo generation of dental pulp-like tissue by using dental pulp stem cells, a collagen scaffold, and dentin matrix protein 1 after subcutaneous transplantation in mice. J Endod 2008;4:421–6. 9. Zhao Y, Wang L, Jin Y, Shi S. Fas ligand regulates the immunomodulatory properties of dental pulp stem cells. J Dent Res 2012;10:948–54. 10. Alongi DJ, Yamaza T, Song Y, et al. Stem/progenitor cells from inflamed human dental pulp retain tissue regeneration potential. Regen Med 2010;5: 617–31. 11. Chen Y-K, Huang AH-C, Chan AW-S, et al. Human dental pulp stem cells derived from different cryopreservation methods of human dental pulp tissues of diseased teeth. J Oral Pathol Med Off Publ Int Assoc Oral Pathol Am Acad Oral Pathol 2011;10: 793–800. 12. Lee S-Y, Chiang P-C, Tsai Y-H, et al. Effects of cryopreservation of intact teeth on the isolated dental pulp stem cells. J Endod 2010;8:1336–40. 13. Gioventu S, Andriolo G, Bonino F, et al. A novel method for banking dental pulp stem cells. Transfus Apher Sci 2012;2:199–206. 14. Ma L, Makino Y, Yamaza H, et al. Cryopreserved dental pulp tissues of exfoliated deciduous teeth is a feasible stem cell resource for regenerative medicine. PLoS One 2012;12:e51777. 15. Pereira LO, Rubini MR, Silva JR, et al. Comparison of stem cell properties of cells isolated from normal and inflamed dental pulps. Int Endod J 2012;12:1080–90. 16. Areman EM, Sacher RA, Deeg HJ. Processing and storage of human bone marrow: a survey of current practices in North America. Bone Marrow Transplant 1990;3: 203–9. 17. Watt SM, Austin E, Armitage S. Cryopreservation of hematopoietic stem/progenitor cells for therapeutic use. Methods Mol Biol 2007;368:237–59. 18. Perry BC, Zhou D, Wu X, et al. Collection, cryopreservation, and characterization of human dental pulp-derived mesenchymal stem cells for banking and clinical use. Tissue Eng Part C Methods 2008;2:149–56. 19. Bohl KS, Shon J, Rutherford B, Mooney DJ. Role of synthetic extracellular matrix in development of engineered dental pulp. J Biomater Sci Polym Ed 1998; 7:749–64. 20. Attar A, Eslaminejad MB, Tavangar MS, et al. Dental pulp polyps contain stem cells comparable to the normal dental pulps. J Clin Exp Dent 2014;1:e53–9. 21. Kanafi MM, Pal R, Gupta PK. Phenotypic and functional comparison of optimum culture conditions for upscaling of dental pulp stem cells. Cell Biol Int 2013;2:126–36. 22. Lindemann D, Werle SB, Steffens D, et al. Effects of cryopreservation on the characteristics of dental pulp stem cells of intact deciduous teeth. Arch Oral Biol 2014;9:970–6. 23. Lin S-L, Chang W-J, Lin C-Y, et al. Static magnetic field increases survival rate of dental pulp stem cells during DMSO-free cryopreservation. Electromagn Biol Med 2014;23:1–7. 24. O’Grady SM, Cooper KE, Rae JL. Cyclic GMP regulation of a voltage-activated K channel in dissociated enterocytes. J Membr Biol 1991;2:159–67. 25. Lizier NF, Kerkis A, Gomes CM, et al. Scaling-up of dental pulp stem cells isolated from multiple niches. PLoS One 2012;6:e39885. 26. Kerkis I, Kerkis A, Dozortsev D, et al. Isolation and characterization of a population of immature dental pulp stem cells expressing OCT-4 and other embryonic stem cell markers. Cells Tissues Organs 2006;3–4:105–16. 27. Ding G, Wang W, Liu Y, et al. Effect of cryopreservation on biological and immunological properties of stem cells from apical papilla. J Cell Physiol 2010;2:415–22.
JOE — Volume -, Number -, - 2015