- Email: [email protected]
Isolation and embryonic expression of avian ADAM 12 and ADAM 19
Gene Expression Patterns 5 (2004) 75–79 www.elsevier.com/locate/modgep
Isolation and embryonic expression of avian ADAM 12 and ADAM 19 Samara L. Lewisa, Peter G. Farliea,b, Donald F. Newgreena,* a
The Embryology Laboratory, The Murdoch Childrens Research Institute, Royal Children’s Hospital, Flemington Rd., Parkville 3052, Melbourne, Vic., Australia b Craniofacial Sciences Consortium, Murdoch Childrens Research Institute, Royal Children’s Hospital, Parkville, Melbourne, Vic., Australia Received 28 January 2004; received in revised form 10 June 2004; accepted 16 June 2004 Available online 2 September 2004
Abstract Members of the ADAM gene family encode large multi-domain proteins containing A Disintegrin And Metalloprotease domain. We have cloned quail orthologs of ADAM 12 and 19 using PCR-based screening and describe their expression patterns over the period E2.5 (Hamilton and Hamburger stage 14) to E5.0 (HH 25) using in situ hybridisation. Quail ADAM 12 is expressed in mesenchyme, cranially, in the tail and in the limb buds, and also in visceral mesenchyme. In the nervous system it is expressed in dorsal root ganglia and ventral roots. Quail ADAM 19 is expressed in cranial and dorsal root ganglia, sympathetic ganglia, ventral mixed nerves and in the allantois. Avian ADAM 12 and 19 genes exhibit similarities and differences in expression pattern compared to their murine orthologs, for example, expression of ADAM 12 in the nervous system, limb and tail bud in quail but not mouse. Interestingly, in mouse ADAM 19 is expressed in these locations. We have generated a sheep antibody to quail ADAM 19 and, in embryonic cells in vitro, found the protein at cell– cell junctions in many cell types. Some of these did have detectable ADAM 19 by in situ hybridisation but RT-PCR analysis confirmed the presence of low level ADAM 19 transcripts not detectable by in situ hybridisation. q 2004 Elsevier B.V. All rights reserved. Keywords: ADAM; Avian; Neural crest; Disintegrin; Metalloprotease
1. Results and discussion The ADAM (A Disintegrin And Metalloprotease domain) genes encode large trans-membrane proteins with extracellular metalloprotease, disintegrin- and cysteine-rich domains and a putative intracellular signalling domain. The meltrin sub-family consists of ADAM 12, 13, 19 and 33. ADAM 13 is characterised only in Xenopus, and is expressed in cranial neural crest cells migrating to the branchial arches, and in somitic mesoderm (Alfandari et al., 1997). ADAM 13 perturbation experiments disturb cranial neural crest cell migration. It is proposed that ADAM 13 interaction with fibronectin facilitates the migration of cranial neural crest cells in Xenopus (Alfandari et al., 2001; Gaultier et al., 2002). ADAM 12 (meltrin a) is expressed in mesenchyme that gives rise to skeletal muscle, bone and visceral organs in the embryonic day (E) 8.0 to E16.5 mouse (Kurisaki et al., 1998). ADAM 12 is implicated in myogenesis (Yagami-Hiromasa et al., 1995), and facilitates * Corresponding author. Tel.: þ61-3-8341-6301/6243; fax: þ 61-3-93481391. E-mail address: [email protected] (D.F. Newgreen). 1567-133X/$ - see front matter q 2004 Elsevier B.V. All rights reserved. doi:10.1016/j.modgep.2004.06.003
cell attachment through its cysteine-rich domain and binds the proteoglycan syndecan leading to cell spreading through a b1-integrin dependent mechanism (Iba et al., 2000; Thodeti et al., 2003). ADAM 19 (meltrin b) is expressed in cranial and dorsal root ganglia and in the ventral horns of the spinal cord and heart of the E8.0 to E16.5 mouse (Kurisaki et al., 1998). It cleaves the neurotrophin neuregulin in vivo, which is required for glial and heart development and synaptogenesis (Shirakabe et al., 2001). Mice lacking functional ADAM 19 demonstrate an essential role of ADAM 19 in heart development (Kurohara et al., 2004; Zhou et al., 2004). ADAM 33 has more recently been identified, is widely expressed in both mouse and human (Yoshinaka et al., 2002) and has been linked to asthma (Van Eerdewegh et al., 2002). Aves as models of early development have many technical advantages over other vertebrates, especially for studies of the neural crest. We have isolated orthologs of meltrin family members in Aves and describe here the cloning and expression of quail ADAM 12 and 19. We isolated an avian cDNA fragment homologous to a region conserved only amongst meltrin class ADAM genes
76
S.L. Lewis et al. / Gene Expression Patterns 5 (2004) 75–79
Fig. 1. (A) Pairwise amino acid percentage identity between meltrin family members and the unrelated ADAM 1. SpADAM is a sea urchin meltrin ADAM. (B) Pairwise amino acid percentage identity between quail and mouse domains of ADAM 12 and 19.
using degenerate RT-PCR. Using this fragment as a probe we screened an E3.0 whole quail cDNA library and isolated two full length ADAM genes, which we designated ADAM 12 and ADAM 19 (Genbank accessions AF456466 and AF456467) based on amino acid sequence identity. Quail ADAM 12 has 70% identity with both the mouse and human ADAM 12 proteins while quail ADAM 19 has 59 and 56% identity with the human and mouse proteins, respectively (Fig. 1A). Quail and mouse ADAM 12 protein identity increases to 90 and 92% in the metalloprotease- and cysteinerich domains, respectively and ADAM 19 protein identity between quail and mouse is 76 and 70% in the disintegrinand cysteine-rich domains, respectively (Fig. 1B). We used whole mount and section in situ hybridisation to examine the expression of these genes during early avian
development. ADAM 12 was observed in E3.0 (HH18) embryos in cranial mesenchyme in a region containing both mesoderm and neural crest derived mesenchyme cells (Fig. 2B). At this stage ADAM 12 was also expressed in the tail (Fig. 2B) and limb bud mesenchyme (Fig. 2C). In E5.0 (HH26) sagittal sections, expression of ADAM 12 was detected in cranial ganglia (Fig. 2E) and was detected in mesenchyme surrounding the dorsal aorta and other visceral mesenchyme including the pericardial cavity (Fig. 2D). Expression of ADAM 12 was also found in the dorsal root ganglia and in the ventral motor roots leading from the neural tube and in the mixed nerve (Fig. 2D and F). ADAM 19 was expressed at E2.5 (HH14) in cranial sensory ganglia and weakly, and transiently, in the heart (Fig. 3B). At E3.0 (HH18) ADAM 19 was detected in
Fig. 2. Expression of quail ADAM 12 detected by in situ hybridisation. (A) Sense control. (B) E3.0 whole mount showing expression in the cranial mesenchyme (black arrow) and tail bud (white arrow). (C) Magnification of the forelimb bud. (D) E5.0 sagittal section, with a magnification of the trunk in (F). Black arrows are dorsal root ganglia. (E) Facial region of E5.0 sagittal section showing expression in the trigeminal ganglia (white arrow), the eye is to the bottom right. Abbreviations: DA, dorsal aorta; NT, neural tube; VR, ventral roots; Scale bars are 1 mm (a, b, d) or 0.5 mm (c, e, f).
S.L. Lewis et al. / Gene Expression Patterns 5 (2004) 75–79
77
Fig. 3. Expression of quail ADAM 19 detected by in situ hybridisation. (A) Sense control. (B) E2.5 whole mount where expression is becoming evident in the cranial ganglia (black lines). Expression is also detected in the heart (white arrow). (C) E3.0 whole mount with expression in the cranial ganglia (IX–X is just becoming apparent) and allantois. (D) E5.0 sagittal section, with a magnification of the trunk in (F). (E) E5.0 transverse section with expression in the dorso-medial region of the dorsal root ganglion (arrow). Abbreviations: V, trigeminal ganglia; VII–VIII, facio-acoustic ganglia; IX– X, superior and jugular ganglia; AL, allantois; SG, sympathetic ganglia; vmn, ventral mixed nerve; black arrows, dorsal root ganglia; white asterisk, ventral horn. Scale bars are 1 mm (a, b, c, d) or 0.5 mm (e, f).
cranial ganglia and in the nascent allantois (Fig. 3C). At E5.0 (HH26) expression was detected in the dorsal root ganglia, where, in transverse sections, it was localised chiefly to the dorso-medial quadrant of the ganglia (Fig. 3E). At this stage, expression of ADAM 19 was also found in the sympathetic ganglia, the ventral mixed nerve and the ventral horns of the forming spinal cord (Fig. 3D and F). The embryonic expression patterns of avian ADAM 12 and 19 broadly correspond to that reported for their murine orthologs (Kurisaki et al., 1998). Expression of ADAM 12 in cranial and visceral mesenchyme was similar between the two species, as was expression of ADAM 19 in both cranial and dorsal root ganglia. However, there were also some differences. Expression of ADAM 12 in neural tissue has not been reported in the mouse (Kurisaki et al., 1998). In addition, expression in the limb and tail bud was described for ADAM 19 in the mouse (Kurisaki et al., 1998) but we found this with ADAM 12 in the quail. Since ADAM 19 has been described in less detail than ADAM 12 in the mouse, we performed in situ hybridisation of ADAM 19 in the mouse at E10.5, a stage morphologically equivalent to E3.0 to E4.0 in quail. This confirmed the reported pattern of ADAM 19 expression including presence in pre-cartilage mesenchyme condensations in the mouse limbs (data not shown). ADAM 19 could not be detected by northern blot of embryonic tissues, and could only be detected by RT-PCR
after Southern blotting indicating a very low level of expression. Despite this low expression level, it was widely expressed, being detected in all embryonic tissues examined (head, branchial arches, heart, trunk, limb bud at E3.0) and at all ages examined (E1.0, E1.5 and E3.5) (Fig. 4A). Thus, we detected expression in tissues and stages not revealed by in situ hybridisation. This suggests that ADAM 19 is actually widely expressed at a low level throughout the embryo, and in situ hybridisation detects only localised peaks of expression. To further examine the expression of ADAM 19 we raised a sheep polyclonal antibody against a poorly conserved region of the disintegrin domain. After affinity purification, the antibody detected two bands on a Western blot of approximately 100 and 80 kDa (Fig. 4B) corresponding to the precursor and processed forms of the protein, respectively. Additionally, we detected two smaller fragments at around 70 kDa which are likely to represent proteolytically cleaved products. This pattern is characteristic of ADAM 19 as described by Kang et al. (2002). To reveal sub-cellular localisation, we used the antibody for immunohistochemistry of avian embryonic cell cultures and found that the antibody labelled all cell types tested (neural tube and crest, somites, allantois, tail bud, limb bud, branchial arch), consistent with the RT-PCR result which showed widespread expression. In all cell types, ADAM 19
Fig. 4. (A) RT-PCR Southern for ADAM 19 showing widespread expression at early stages and across a range of tissues. Cytochrome B is used as a control for the starting amount of RNA at 20 and 15 cycles. Abbreviations: C, cranial; BA; branchial arch; H, heart; T, trunk; LB, limb bud. (B) ADAM 19 Western using affinity purified ADAM 19 antibody on E5.0 whole quail lysate shows characteristic bands representing the precursor (,100 kD) and processed (,80 kD) forms. Two weaker bands below these are characteristic of proteolytically cleaved products. Negative control is the secondary antibody only. Both are run in duplicate.
78
S.L. Lewis et al. / Gene Expression Patterns 5 (2004) 75–79
Fig. 5. Immunohistochemistry of ectodermal cells derived from the tailbud epithelium in vitro showing ADAM 19 co-localisation with circumferential F-actin (A –C) and E-cadherin (D –F). Scale bars are 10 mm.
immunoreactivity occurred in discrete cytoplasmic organelles and may have been associated with the Golgi apparatus or endoplasmic reticulum, as described for other ADAMs (Cao et al., 2002). In addition, in ectodermal-derived tissue from the tailbud, branchial arches and limb buds, ADAM 19 was localised to the cell – cell junctions where it co-localised with circumferential F-actin (Fig. 5A –C), E-cadherin (Fig. 5D – F) and b-catenin (not shown), all of which are involved in cell –cell adhesion. We did not observe co-localisation with focal contacts to extracellular matrix, revealed by paxillin antibody double labelling (not shown). In mesenchymal/fibroblast cells, ADAM 19 immunoreactivity was also seen at the cell edges but did not completely outline the cell as it did in epithelial cells. Dorsal root ganglion neurons were labelled by ADAM 19 antibody but specific sub-cellular localisation could not be visualised because of the spherical shape of the cell bodies. The calcium chelator EGTA dissociates calcium dependent cadherin mediated cell – cell contacts. Following treatment with EGTA for 15 min, the cell –cell contacts begin to retract as determined by b-catenin immunoreactivity which withdrew from the cell edges. Co-labelling for ADAM 19 showed that the two proteins remained co-distributed, with ADAM 19 also retracting from the cell –cell edges (data not shown). We failed to isolate an avian ADAM 13 in our screen despite the use of primers designed specifically for the purpose. ADAM 13 remains identified only in Xenopus. No orthologs of the other meltrin family members (ADAM 12, 19 or 33) have yet been identified in Xenopus. In any case, the isolation of avian ADAM 12 and 19 genes provides an opportunity to study the function of these multi-domain proteins in a tractable amniote, as well as allowing comparison with other developmental and in vitro models.
2. Materials and methods Fertile Japanese quail eggs (Coturnix coturnix japonica) (Lago Smallgoods, Melbourne, Australia) were incubated at 37 8C and staged according to Hamburger and Hamilton (1951) for chick embryos. Note that the morphological stage series (denoted HH) of quails is essentially identical to that of chicks, but the chronology of development, denoted by embryonic (E) day, is slightly more rapid. A quail cDNA fragment with homology to the meltrin class ADAMs was initially obtained by two rounds of degenerate PCR using E3.0 whole quail first-strand cDNA. For the first round of PCR the forward primer was 50 GCIAACTATGTIGAIAGTT30 and the reverse primers were 5 0 GCAATITCGGAGTGITCCAT3 0 and 50 GCCCIGTIGCIGCIGCCATG30 . For the second round, the same forward primer was used with a nested reverse primer, 50 ATTAGCTCIGCITTITGATG30 . A 177 nucleotide fragment was amplified, from both starting products, and used to screen an E3.0 whole quail cDNA library by filter hybridisation. Two full-length clones were obtained and sequenced. The first was a 4098 bp cDNA encoding a 923 amino acid protein and the second was a 5181 bp cDNA encoding a 900 amino acid protein. Both cDNAs contained all the characteristic domains of an ADAM and based on sequence identity were designated quail ADAM 12 and 19, respectively. Whole mount and section in situ hybridisation was performed by the methods of Henrique et al. (1995) and Dunwoodie et al. (1997), respectively. Antisense digoxigenin-labelled probes were prepared by in vitro transcription from plasmid templates as described by the manufacturer (Roche, Sydney, Australia). Plasmids used were the 30 858 bp (non-coding) of quail ADAM 19 cloned into pBluescript, the 30 573 bp (non-coding) of quail ADAM 12 cloned into pBluescript and a 1 kb fragment of mouse
S.L. Lewis et al. / Gene Expression Patterns 5 (2004) 75–79
ADAM 19 generated by RT-PCR from the primers 50 TTCATTACTGTGCTACCACC30 and 50 GTCACCAGGCTAGAAGG30 and cloned into pCRII TOPO. Expression RT-PCR of quail ADAM 19 was performed using the primers 50 CCAAGAGAATGTACGGAGGG30 and 50 ACTGCTGAAGAGCCTTCTGG30 generating a product which is predicted to span an intron. The PCR products were then transferred by Southern blotting to a nylon membrane, Hybond N þ (Amersham, Sydney, Australia) and probed with an end labelled oligonucleotide, 50 CTCCAGGAACTCTCTGCAGG30 . An 114 bp fragment of quail ADAM 19 was amplified by PCR using the primers 50 ACGTCCGTGTTCAACCAGTGCAACAGG30 and 5 0 ACGTGAATTCTTCCACATTTTCTCCCTCCG30 and cloned into pGEX2T to generate a GST-fusion protein. This fragment was chosen for its low level of conservation across the meltrin family to ensure that an ADAM 19 specific antibody was generated. The protein was purified using glutathione-sepharose beads (Amersham, Sydney, Australia) and sent to the Institute of Medical and Veterinary Science (Adelaide, Australia) for immunisation of a sheep. Immunoreactivity was tested by Western blot on purified protein. The pre-immune serum failed to detect the purified protein. The serum was affinity purified over an NHS-activated sepharose column (Amersham, Sydney, Australia) using the GST-ADAM fusion protein according to the manufacturer’s instructions. For Western blots the primary antibody was either unpurified serum diluted 1/1000, or affinity purified serum diluted 1/100 in PBS containing 1% Casein and 0.1% Tween 20. Secondary antibody was donkey anti-sheep HRP diluted 1/10 000 (Jackson Immunoresearch, West Grove, PA, USA). Bands were visualised by chemiluminescence ECL kit (Amersham, Sydney, Australia). Embryonic tissue was microdissected from E3.0 quail embryos using sharpened tungsten needles. These were cultured on bacteriological Petri dishes pre-coated with fibronectin (Roche, 20 mg/ml) with culture medium consisting of F12 supplemented with 3% non-heat inactivated fetal calf serum (Trace Biosciences, Australia), 20 mM glutamine (Sigma, St Louis, USA), 6 mg/ml penicillin (CSL, Melbourne, Australia) and 10 mg/ml streptomycin (CSL, Melbourne, Australia). After 2 – 5 days growth, embryonic cultures were fixed in 4% PFA in PBS for 5 –15 min, blocked in 1% BSA in PBS and processed for immunohistochemistry. Antibodies used were sheep antiquail ADAM 19 (affinity purified; 1/10), mouse anti-human E-cadherin (Signal Transduction Laboratories, Lexington, USA; 1/100) and mouse anti-human b-catenin (Signal Transduction Laboratories; 1/100). These were delivered in 1% BSA in PBS with 0.1% Triton X100, overnight at 4 8C. Second antibodies were administered similarly; these were Alexa 488 conjugated donkey anti-sheep (1/400) and Alexa 594 conjugated goat anti-mouse (1/1000) (Molecular Probes, Oregon, USA). Texas Red conjugated phalloidin (Molecular Probes; 1/100) was used to label F-actin.
79
Fluorescence microscopy was performed with an Olympus IX70 inverted microscope with FITC and Texas Red selective filters. Images were recorded using Spot RT camera and Spot Advanced software.
References Alfandari, D., Wolfsberg, T.G., White, J.M., DeSimone, D.W., 1997. ADAM 13: a novel ADAM expressed in somitic mesoderm and neural crest cells during Xenopus laevis development. Dev. Biol. (Orlando) 182, 314–330. Alfandari, D., Cousin, H., Gaultier, A., Smith, K., White, J.M., Darribere, T., DeSimone, D.W., 2001. Xenopus ADAM 13 is a metalloprotease required for cranial neural crest-cell migration. Curr. Biol. 11, 918–930. Cao, Y., Kang, Q., Zhao, Z., Zolkiewska, A., 2002. Intracellular processing of metalloprotease disintegrin ADAM12. J. Biol. Chem. 277, 26403–26411. Dunwoodie, S.L., Henrique, D., Harrison, S.M., Beddington, R.S., 1997. Mouse Dll3: a novel divergent Delta gene which may complement the function of other Delta homologues during early pattern formation in the mouse embryo. Development 124, 3065–3076. Gaultier, A., Cousin, H., Darribere, T., Alfandari, D., 2002. ADAM13 disintegrin and cysteine-rich domains bind to the second heparinbinding domain of fibronectin. J. Biol. Chem. 277, 23336–23344. Hamburger, V., Hamilton, H.L., 1951. A series of normal stages in the development of the chick. J. Morphol. 88, 49–92. Henrique, D., Adam, J., Myat, A., Chitnis, A., Lewis, J., Ish-Horowicz, D., 1995. Expression of a Delta homologue in prospective neurons in the chick. Nature 375, 787–790. Iba, K., Albrechtsen, R., Gilpin, B., Frohlich, C., Loechel, F., Zolkiewska, A., et al., 2000. The cysteine-rich domain of human ADAM 12 supports cell adhesion through syndecans and triggers signaling events that lead to beta1 integrin-dependent cell spreading. J. Cell Biol. 149, 1143–1156. Kang, T., Park, H.I., Suh, Y., Zhao, Y.G., Tschesche, H., Sang, Q.X., 2002. Autolytic processing at Glu586 – Ser587 within the cysteine-rich domain of human adamalysin 19/disintegrin-metalloproteinase 19 is necessary for its proteolytic activity. J. Biol. Chem. 277, 48514–48522. Kurisaki, T., Masuda, A., Osumi, N., Nabeshima, Y., Fujisawa-Sehara, A., 1998. Spatially- and temporally-restricted expression of meltrin alpha (ADAM12) and beta (ADAM19) in mouse embryo. Mech. Dev. 73, 211– 215. Kurohara, K., Komatsu, K., Kurisaki, T., Masuda, A., Irie, N., Asano, M., et al., 2004. Essential roles of Meltrin beta (ADAM19) in heart development. Dev. Biol. 267, 14–28. Shirakabe, K., Wakatsuki, S., Kurisaki, T., Fujisawa-Sehara, A., 2001. Roles of Meltrin beta/ADAM19 in the processing of neuregulin. J. Biol. Chem. 276, 9352–9358. Thodeti, C.K., Albrechtsen, R., Grauslund, M., Asmar, M., Larsson, C., Takada, Y., et al., 2003. ADAM12/syndecan-4 signaling promotes beta 1 integrin-dependent cell spreading through protein kinase Calpha and RhoA. J. Biol. Chem. 278, 9576–9584. Van Eerdewegh, P., Little, R.D., Dupuis, J., Del Mastro, R.G., Falls, K., Simon, J., et al., 2002. Association of the ADAM33 gene with asthma and bronchial hyperresponsiveness. Nature 418, 426 –430. Yagami-Hiromasa, T., Sato, T., Kurisaki, T., Kamijo, K., Nabeshima, Y., Fujisawa-Sehara, A., 1995. A metalloprotease-disintegrin participating in myoblast fusion. Nature 377, 652 –656. Yoshinaka, T., Nishii, K., Yamada, K., Sawada, H., Nishiwaki, E., Smith, K., et al., 2002. Identification and characterization of novel mouse and human ADAM33s with potential metalloprotease activity. Gene 282, 227– 236. Zhou, H.M., Weskamp, G., Chesneau, V., Sahin, U., Vortkamp, A., Horiuchi, K., et al., 2004. Essential role for ADAM19 in cardiovascular morphogenesis. Mol. Cell. Biol. 24, 96 –104.
Isolation and embryonic expression of avian ADAM 12 and ADAM 19 Samara L. Lewisa, Peter G. Farliea,b, Donald F. Newgreena,* a
The Embryology Laboratory, The Murdoch Childrens Research Institute, Royal Children’s Hospital, Flemington Rd., Parkville 3052, Melbourne, Vic., Australia b Craniofacial Sciences Consortium, Murdoch Childrens Research Institute, Royal Children’s Hospital, Parkville, Melbourne, Vic., Australia Received 28 January 2004; received in revised form 10 June 2004; accepted 16 June 2004 Available online 2 September 2004
Abstract Members of the ADAM gene family encode large multi-domain proteins containing A Disintegrin And Metalloprotease domain. We have cloned quail orthologs of ADAM 12 and 19 using PCR-based screening and describe their expression patterns over the period E2.5 (Hamilton and Hamburger stage 14) to E5.0 (HH 25) using in situ hybridisation. Quail ADAM 12 is expressed in mesenchyme, cranially, in the tail and in the limb buds, and also in visceral mesenchyme. In the nervous system it is expressed in dorsal root ganglia and ventral roots. Quail ADAM 19 is expressed in cranial and dorsal root ganglia, sympathetic ganglia, ventral mixed nerves and in the allantois. Avian ADAM 12 and 19 genes exhibit similarities and differences in expression pattern compared to their murine orthologs, for example, expression of ADAM 12 in the nervous system, limb and tail bud in quail but not mouse. Interestingly, in mouse ADAM 19 is expressed in these locations. We have generated a sheep antibody to quail ADAM 19 and, in embryonic cells in vitro, found the protein at cell– cell junctions in many cell types. Some of these did have detectable ADAM 19 by in situ hybridisation but RT-PCR analysis confirmed the presence of low level ADAM 19 transcripts not detectable by in situ hybridisation. q 2004 Elsevier B.V. All rights reserved. Keywords: ADAM; Avian; Neural crest; Disintegrin; Metalloprotease
1. Results and discussion The ADAM (A Disintegrin And Metalloprotease domain) genes encode large trans-membrane proteins with extracellular metalloprotease, disintegrin- and cysteine-rich domains and a putative intracellular signalling domain. The meltrin sub-family consists of ADAM 12, 13, 19 and 33. ADAM 13 is characterised only in Xenopus, and is expressed in cranial neural crest cells migrating to the branchial arches, and in somitic mesoderm (Alfandari et al., 1997). ADAM 13 perturbation experiments disturb cranial neural crest cell migration. It is proposed that ADAM 13 interaction with fibronectin facilitates the migration of cranial neural crest cells in Xenopus (Alfandari et al., 2001; Gaultier et al., 2002). ADAM 12 (meltrin a) is expressed in mesenchyme that gives rise to skeletal muscle, bone and visceral organs in the embryonic day (E) 8.0 to E16.5 mouse (Kurisaki et al., 1998). ADAM 12 is implicated in myogenesis (Yagami-Hiromasa et al., 1995), and facilitates * Corresponding author. Tel.: þ61-3-8341-6301/6243; fax: þ 61-3-93481391. E-mail address: [email protected] (D.F. Newgreen). 1567-133X/$ - see front matter q 2004 Elsevier B.V. All rights reserved. doi:10.1016/j.modgep.2004.06.003
cell attachment through its cysteine-rich domain and binds the proteoglycan syndecan leading to cell spreading through a b1-integrin dependent mechanism (Iba et al., 2000; Thodeti et al., 2003). ADAM 19 (meltrin b) is expressed in cranial and dorsal root ganglia and in the ventral horns of the spinal cord and heart of the E8.0 to E16.5 mouse (Kurisaki et al., 1998). It cleaves the neurotrophin neuregulin in vivo, which is required for glial and heart development and synaptogenesis (Shirakabe et al., 2001). Mice lacking functional ADAM 19 demonstrate an essential role of ADAM 19 in heart development (Kurohara et al., 2004; Zhou et al., 2004). ADAM 33 has more recently been identified, is widely expressed in both mouse and human (Yoshinaka et al., 2002) and has been linked to asthma (Van Eerdewegh et al., 2002). Aves as models of early development have many technical advantages over other vertebrates, especially for studies of the neural crest. We have isolated orthologs of meltrin family members in Aves and describe here the cloning and expression of quail ADAM 12 and 19. We isolated an avian cDNA fragment homologous to a region conserved only amongst meltrin class ADAM genes
76
S.L. Lewis et al. / Gene Expression Patterns 5 (2004) 75–79
Fig. 1. (A) Pairwise amino acid percentage identity between meltrin family members and the unrelated ADAM 1. SpADAM is a sea urchin meltrin ADAM. (B) Pairwise amino acid percentage identity between quail and mouse domains of ADAM 12 and 19.
using degenerate RT-PCR. Using this fragment as a probe we screened an E3.0 whole quail cDNA library and isolated two full length ADAM genes, which we designated ADAM 12 and ADAM 19 (Genbank accessions AF456466 and AF456467) based on amino acid sequence identity. Quail ADAM 12 has 70% identity with both the mouse and human ADAM 12 proteins while quail ADAM 19 has 59 and 56% identity with the human and mouse proteins, respectively (Fig. 1A). Quail and mouse ADAM 12 protein identity increases to 90 and 92% in the metalloprotease- and cysteinerich domains, respectively and ADAM 19 protein identity between quail and mouse is 76 and 70% in the disintegrinand cysteine-rich domains, respectively (Fig. 1B). We used whole mount and section in situ hybridisation to examine the expression of these genes during early avian
development. ADAM 12 was observed in E3.0 (HH18) embryos in cranial mesenchyme in a region containing both mesoderm and neural crest derived mesenchyme cells (Fig. 2B). At this stage ADAM 12 was also expressed in the tail (Fig. 2B) and limb bud mesenchyme (Fig. 2C). In E5.0 (HH26) sagittal sections, expression of ADAM 12 was detected in cranial ganglia (Fig. 2E) and was detected in mesenchyme surrounding the dorsal aorta and other visceral mesenchyme including the pericardial cavity (Fig. 2D). Expression of ADAM 12 was also found in the dorsal root ganglia and in the ventral motor roots leading from the neural tube and in the mixed nerve (Fig. 2D and F). ADAM 19 was expressed at E2.5 (HH14) in cranial sensory ganglia and weakly, and transiently, in the heart (Fig. 3B). At E3.0 (HH18) ADAM 19 was detected in
Fig. 2. Expression of quail ADAM 12 detected by in situ hybridisation. (A) Sense control. (B) E3.0 whole mount showing expression in the cranial mesenchyme (black arrow) and tail bud (white arrow). (C) Magnification of the forelimb bud. (D) E5.0 sagittal section, with a magnification of the trunk in (F). Black arrows are dorsal root ganglia. (E) Facial region of E5.0 sagittal section showing expression in the trigeminal ganglia (white arrow), the eye is to the bottom right. Abbreviations: DA, dorsal aorta; NT, neural tube; VR, ventral roots; Scale bars are 1 mm (a, b, d) or 0.5 mm (c, e, f).
S.L. Lewis et al. / Gene Expression Patterns 5 (2004) 75–79
77
Fig. 3. Expression of quail ADAM 19 detected by in situ hybridisation. (A) Sense control. (B) E2.5 whole mount where expression is becoming evident in the cranial ganglia (black lines). Expression is also detected in the heart (white arrow). (C) E3.0 whole mount with expression in the cranial ganglia (IX–X is just becoming apparent) and allantois. (D) E5.0 sagittal section, with a magnification of the trunk in (F). (E) E5.0 transverse section with expression in the dorso-medial region of the dorsal root ganglion (arrow). Abbreviations: V, trigeminal ganglia; VII–VIII, facio-acoustic ganglia; IX– X, superior and jugular ganglia; AL, allantois; SG, sympathetic ganglia; vmn, ventral mixed nerve; black arrows, dorsal root ganglia; white asterisk, ventral horn. Scale bars are 1 mm (a, b, c, d) or 0.5 mm (e, f).
cranial ganglia and in the nascent allantois (Fig. 3C). At E5.0 (HH26) expression was detected in the dorsal root ganglia, where, in transverse sections, it was localised chiefly to the dorso-medial quadrant of the ganglia (Fig. 3E). At this stage, expression of ADAM 19 was also found in the sympathetic ganglia, the ventral mixed nerve and the ventral horns of the forming spinal cord (Fig. 3D and F). The embryonic expression patterns of avian ADAM 12 and 19 broadly correspond to that reported for their murine orthologs (Kurisaki et al., 1998). Expression of ADAM 12 in cranial and visceral mesenchyme was similar between the two species, as was expression of ADAM 19 in both cranial and dorsal root ganglia. However, there were also some differences. Expression of ADAM 12 in neural tissue has not been reported in the mouse (Kurisaki et al., 1998). In addition, expression in the limb and tail bud was described for ADAM 19 in the mouse (Kurisaki et al., 1998) but we found this with ADAM 12 in the quail. Since ADAM 19 has been described in less detail than ADAM 12 in the mouse, we performed in situ hybridisation of ADAM 19 in the mouse at E10.5, a stage morphologically equivalent to E3.0 to E4.0 in quail. This confirmed the reported pattern of ADAM 19 expression including presence in pre-cartilage mesenchyme condensations in the mouse limbs (data not shown). ADAM 19 could not be detected by northern blot of embryonic tissues, and could only be detected by RT-PCR
after Southern blotting indicating a very low level of expression. Despite this low expression level, it was widely expressed, being detected in all embryonic tissues examined (head, branchial arches, heart, trunk, limb bud at E3.0) and at all ages examined (E1.0, E1.5 and E3.5) (Fig. 4A). Thus, we detected expression in tissues and stages not revealed by in situ hybridisation. This suggests that ADAM 19 is actually widely expressed at a low level throughout the embryo, and in situ hybridisation detects only localised peaks of expression. To further examine the expression of ADAM 19 we raised a sheep polyclonal antibody against a poorly conserved region of the disintegrin domain. After affinity purification, the antibody detected two bands on a Western blot of approximately 100 and 80 kDa (Fig. 4B) corresponding to the precursor and processed forms of the protein, respectively. Additionally, we detected two smaller fragments at around 70 kDa which are likely to represent proteolytically cleaved products. This pattern is characteristic of ADAM 19 as described by Kang et al. (2002). To reveal sub-cellular localisation, we used the antibody for immunohistochemistry of avian embryonic cell cultures and found that the antibody labelled all cell types tested (neural tube and crest, somites, allantois, tail bud, limb bud, branchial arch), consistent with the RT-PCR result which showed widespread expression. In all cell types, ADAM 19
Fig. 4. (A) RT-PCR Southern for ADAM 19 showing widespread expression at early stages and across a range of tissues. Cytochrome B is used as a control for the starting amount of RNA at 20 and 15 cycles. Abbreviations: C, cranial; BA; branchial arch; H, heart; T, trunk; LB, limb bud. (B) ADAM 19 Western using affinity purified ADAM 19 antibody on E5.0 whole quail lysate shows characteristic bands representing the precursor (,100 kD) and processed (,80 kD) forms. Two weaker bands below these are characteristic of proteolytically cleaved products. Negative control is the secondary antibody only. Both are run in duplicate.
78
S.L. Lewis et al. / Gene Expression Patterns 5 (2004) 75–79
Fig. 5. Immunohistochemistry of ectodermal cells derived from the tailbud epithelium in vitro showing ADAM 19 co-localisation with circumferential F-actin (A –C) and E-cadherin (D –F). Scale bars are 10 mm.
immunoreactivity occurred in discrete cytoplasmic organelles and may have been associated with the Golgi apparatus or endoplasmic reticulum, as described for other ADAMs (Cao et al., 2002). In addition, in ectodermal-derived tissue from the tailbud, branchial arches and limb buds, ADAM 19 was localised to the cell – cell junctions where it co-localised with circumferential F-actin (Fig. 5A –C), E-cadherin (Fig. 5D – F) and b-catenin (not shown), all of which are involved in cell –cell adhesion. We did not observe co-localisation with focal contacts to extracellular matrix, revealed by paxillin antibody double labelling (not shown). In mesenchymal/fibroblast cells, ADAM 19 immunoreactivity was also seen at the cell edges but did not completely outline the cell as it did in epithelial cells. Dorsal root ganglion neurons were labelled by ADAM 19 antibody but specific sub-cellular localisation could not be visualised because of the spherical shape of the cell bodies. The calcium chelator EGTA dissociates calcium dependent cadherin mediated cell – cell contacts. Following treatment with EGTA for 15 min, the cell –cell contacts begin to retract as determined by b-catenin immunoreactivity which withdrew from the cell edges. Co-labelling for ADAM 19 showed that the two proteins remained co-distributed, with ADAM 19 also retracting from the cell –cell edges (data not shown). We failed to isolate an avian ADAM 13 in our screen despite the use of primers designed specifically for the purpose. ADAM 13 remains identified only in Xenopus. No orthologs of the other meltrin family members (ADAM 12, 19 or 33) have yet been identified in Xenopus. In any case, the isolation of avian ADAM 12 and 19 genes provides an opportunity to study the function of these multi-domain proteins in a tractable amniote, as well as allowing comparison with other developmental and in vitro models.
2. Materials and methods Fertile Japanese quail eggs (Coturnix coturnix japonica) (Lago Smallgoods, Melbourne, Australia) were incubated at 37 8C and staged according to Hamburger and Hamilton (1951) for chick embryos. Note that the morphological stage series (denoted HH) of quails is essentially identical to that of chicks, but the chronology of development, denoted by embryonic (E) day, is slightly more rapid. A quail cDNA fragment with homology to the meltrin class ADAMs was initially obtained by two rounds of degenerate PCR using E3.0 whole quail first-strand cDNA. For the first round of PCR the forward primer was 50 GCIAACTATGTIGAIAGTT30 and the reverse primers were 5 0 GCAATITCGGAGTGITCCAT3 0 and 50 GCCCIGTIGCIGCIGCCATG30 . For the second round, the same forward primer was used with a nested reverse primer, 50 ATTAGCTCIGCITTITGATG30 . A 177 nucleotide fragment was amplified, from both starting products, and used to screen an E3.0 whole quail cDNA library by filter hybridisation. Two full-length clones were obtained and sequenced. The first was a 4098 bp cDNA encoding a 923 amino acid protein and the second was a 5181 bp cDNA encoding a 900 amino acid protein. Both cDNAs contained all the characteristic domains of an ADAM and based on sequence identity were designated quail ADAM 12 and 19, respectively. Whole mount and section in situ hybridisation was performed by the methods of Henrique et al. (1995) and Dunwoodie et al. (1997), respectively. Antisense digoxigenin-labelled probes were prepared by in vitro transcription from plasmid templates as described by the manufacturer (Roche, Sydney, Australia). Plasmids used were the 30 858 bp (non-coding) of quail ADAM 19 cloned into pBluescript, the 30 573 bp (non-coding) of quail ADAM 12 cloned into pBluescript and a 1 kb fragment of mouse
S.L. Lewis et al. / Gene Expression Patterns 5 (2004) 75–79
ADAM 19 generated by RT-PCR from the primers 50 TTCATTACTGTGCTACCACC30 and 50 GTCACCAGGCTAGAAGG30 and cloned into pCRII TOPO. Expression RT-PCR of quail ADAM 19 was performed using the primers 50 CCAAGAGAATGTACGGAGGG30 and 50 ACTGCTGAAGAGCCTTCTGG30 generating a product which is predicted to span an intron. The PCR products were then transferred by Southern blotting to a nylon membrane, Hybond N þ (Amersham, Sydney, Australia) and probed with an end labelled oligonucleotide, 50 CTCCAGGAACTCTCTGCAGG30 . An 114 bp fragment of quail ADAM 19 was amplified by PCR using the primers 50 ACGTCCGTGTTCAACCAGTGCAACAGG30 and 5 0 ACGTGAATTCTTCCACATTTTCTCCCTCCG30 and cloned into pGEX2T to generate a GST-fusion protein. This fragment was chosen for its low level of conservation across the meltrin family to ensure that an ADAM 19 specific antibody was generated. The protein was purified using glutathione-sepharose beads (Amersham, Sydney, Australia) and sent to the Institute of Medical and Veterinary Science (Adelaide, Australia) for immunisation of a sheep. Immunoreactivity was tested by Western blot on purified protein. The pre-immune serum failed to detect the purified protein. The serum was affinity purified over an NHS-activated sepharose column (Amersham, Sydney, Australia) using the GST-ADAM fusion protein according to the manufacturer’s instructions. For Western blots the primary antibody was either unpurified serum diluted 1/1000, or affinity purified serum diluted 1/100 in PBS containing 1% Casein and 0.1% Tween 20. Secondary antibody was donkey anti-sheep HRP diluted 1/10 000 (Jackson Immunoresearch, West Grove, PA, USA). Bands were visualised by chemiluminescence ECL kit (Amersham, Sydney, Australia). Embryonic tissue was microdissected from E3.0 quail embryos using sharpened tungsten needles. These were cultured on bacteriological Petri dishes pre-coated with fibronectin (Roche, 20 mg/ml) with culture medium consisting of F12 supplemented with 3% non-heat inactivated fetal calf serum (Trace Biosciences, Australia), 20 mM glutamine (Sigma, St Louis, USA), 6 mg/ml penicillin (CSL, Melbourne, Australia) and 10 mg/ml streptomycin (CSL, Melbourne, Australia). After 2 – 5 days growth, embryonic cultures were fixed in 4% PFA in PBS for 5 –15 min, blocked in 1% BSA in PBS and processed for immunohistochemistry. Antibodies used were sheep antiquail ADAM 19 (affinity purified; 1/10), mouse anti-human E-cadherin (Signal Transduction Laboratories, Lexington, USA; 1/100) and mouse anti-human b-catenin (Signal Transduction Laboratories; 1/100). These were delivered in 1% BSA in PBS with 0.1% Triton X100, overnight at 4 8C. Second antibodies were administered similarly; these were Alexa 488 conjugated donkey anti-sheep (1/400) and Alexa 594 conjugated goat anti-mouse (1/1000) (Molecular Probes, Oregon, USA). Texas Red conjugated phalloidin (Molecular Probes; 1/100) was used to label F-actin.
79
Fluorescence microscopy was performed with an Olympus IX70 inverted microscope with FITC and Texas Red selective filters. Images were recorded using Spot RT camera and Spot Advanced software.
References Alfandari, D., Wolfsberg, T.G., White, J.M., DeSimone, D.W., 1997. ADAM 13: a novel ADAM expressed in somitic mesoderm and neural crest cells during Xenopus laevis development. Dev. Biol. (Orlando) 182, 314–330. Alfandari, D., Cousin, H., Gaultier, A., Smith, K., White, J.M., Darribere, T., DeSimone, D.W., 2001. Xenopus ADAM 13 is a metalloprotease required for cranial neural crest-cell migration. Curr. Biol. 11, 918–930. Cao, Y., Kang, Q., Zhao, Z., Zolkiewska, A., 2002. Intracellular processing of metalloprotease disintegrin ADAM12. J. Biol. Chem. 277, 26403–26411. Dunwoodie, S.L., Henrique, D., Harrison, S.M., Beddington, R.S., 1997. Mouse Dll3: a novel divergent Delta gene which may complement the function of other Delta homologues during early pattern formation in the mouse embryo. Development 124, 3065–3076. Gaultier, A., Cousin, H., Darribere, T., Alfandari, D., 2002. ADAM13 disintegrin and cysteine-rich domains bind to the second heparinbinding domain of fibronectin. J. Biol. Chem. 277, 23336–23344. Hamburger, V., Hamilton, H.L., 1951. A series of normal stages in the development of the chick. J. Morphol. 88, 49–92. Henrique, D., Adam, J., Myat, A., Chitnis, A., Lewis, J., Ish-Horowicz, D., 1995. Expression of a Delta homologue in prospective neurons in the chick. Nature 375, 787–790. Iba, K., Albrechtsen, R., Gilpin, B., Frohlich, C., Loechel, F., Zolkiewska, A., et al., 2000. The cysteine-rich domain of human ADAM 12 supports cell adhesion through syndecans and triggers signaling events that lead to beta1 integrin-dependent cell spreading. J. Cell Biol. 149, 1143–1156. Kang, T., Park, H.I., Suh, Y., Zhao, Y.G., Tschesche, H., Sang, Q.X., 2002. Autolytic processing at Glu586 – Ser587 within the cysteine-rich domain of human adamalysin 19/disintegrin-metalloproteinase 19 is necessary for its proteolytic activity. J. Biol. Chem. 277, 48514–48522. Kurisaki, T., Masuda, A., Osumi, N., Nabeshima, Y., Fujisawa-Sehara, A., 1998. Spatially- and temporally-restricted expression of meltrin alpha (ADAM12) and beta (ADAM19) in mouse embryo. Mech. Dev. 73, 211– 215. Kurohara, K., Komatsu, K., Kurisaki, T., Masuda, A., Irie, N., Asano, M., et al., 2004. Essential roles of Meltrin beta (ADAM19) in heart development. Dev. Biol. 267, 14–28. Shirakabe, K., Wakatsuki, S., Kurisaki, T., Fujisawa-Sehara, A., 2001. Roles of Meltrin beta/ADAM19 in the processing of neuregulin. J. Biol. Chem. 276, 9352–9358. Thodeti, C.K., Albrechtsen, R., Grauslund, M., Asmar, M., Larsson, C., Takada, Y., et al., 2003. ADAM12/syndecan-4 signaling promotes beta 1 integrin-dependent cell spreading through protein kinase Calpha and RhoA. J. Biol. Chem. 278, 9576–9584. Van Eerdewegh, P., Little, R.D., Dupuis, J., Del Mastro, R.G., Falls, K., Simon, J., et al., 2002. Association of the ADAM33 gene with asthma and bronchial hyperresponsiveness. Nature 418, 426 –430. Yagami-Hiromasa, T., Sato, T., Kurisaki, T., Kamijo, K., Nabeshima, Y., Fujisawa-Sehara, A., 1995. A metalloprotease-disintegrin participating in myoblast fusion. Nature 377, 652 –656. Yoshinaka, T., Nishii, K., Yamada, K., Sawada, H., Nishiwaki, E., Smith, K., et al., 2002. Identification and characterization of novel mouse and human ADAM33s with potential metalloprotease activity. Gene 282, 227– 236. Zhou, H.M., Weskamp, G., Chesneau, V., Sahin, U., Vortkamp, A., Horiuchi, K., et al., 2004. Essential role for ADAM19 in cardiovascular morphogenesis. Mol. Cell. Biol. 24, 96 –104.