Isolation and functional characterization of SUCROSE SYNTHASE 1 and SUCROSE TRANSPORTER 2 promoters from ramie (Boehmeria nivea L. Gaudich)

Accepted Manuscript Isolation and functional characterization of SUCROSE SYNTHASE 1 and SUCROSE TRANSPORTER 2 promoters from ramie (Boehmeria nivea L. Gaudich)

Pingan Guo, Yancheng Zheng, Yanyan He, Lijun Liu, Bo Wang, Dingxiang Peng PII: DOI: Reference:

S0378-1119(18)31129-6 https://doi.org/10.1016/j.gene.2018.10.081 GENE 43337

To appear in:

Gene

Received date: Revised date: Accepted date:

6 July 2018 12 October 2018 28 October 2018

Please cite this article as: Pingan Guo, Yancheng Zheng, Yanyan He, Lijun Liu, Bo Wang, Dingxiang Peng , Isolation and functional characterization of SUCROSE SYNTHASE 1 and SUCROSE TRANSPORTER 2 promoters from ramie (Boehmeria nivea L. Gaudich). Gene (2018), https://doi.org/10.1016/j.gene.2018.10.081

This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

ACCEPTED MANUSCRIPT

Title Isolation and functional characterization of SUCROSE SYNTHASE 1 and SUCROSE TRANSPORTER 2 promoters from ramie (Boehmeria nivea L. Gaudich) Authors

PT

Pingan Guo1

RI

Yancheng Zheng1

SC

Yanyan He2 Lijun Liu1

NU

Bo Wang1*

MA

[email protected] Dingxiang Peng1*

MOA Key Laboratory of Crop Ecophysiology and Farming System in the Middle Reaches of the

PT E

1

D

[email protected]

Yangtze River, College of Plant Science and Technology, Huazhong Agricultural University, #1

2

Institute of Vegetables and Flowers, Chinese Academy of Agricultural Sciences, Beijing 100081,

China. *

AC

87287136.

CE

Shizishan Street, Hongshan District, Wuhan 430070, Hubei Province, China, Tel/fax: +86 27

Corresponding author

ACCEPTED MANUSCRIPT

Abstract Sucrose synthase and sucrose transporter are involved in sucrose metabolism and partitioning of photosynthetic products, respectively. In this study, we cloned SUCROSE SYNTHASE 1 and SUCROSE TRANSPORTER 2 genes from ramie. Real-time quantitative PCR revealed that BnSUS1 and BnSUT2 were widely expressed in the analyzed tissues. Subsequently, the two promoters of BnSUS1 and

PT

BnSUT2 were isolated and truncated. The two promoters and their truncated fragments were fused GUS to transform into Arabidopsis. GUS staining showed that BnSUS1pro-1690 and BnSUS1pro-1420

RI

had vascular specificity in cotyledons and mature leaves while BnSUT2pro-2239, BnSUT2pro-1681,

SC

BnSUT2pro-1199 and BnSUT2pro-618 had a constitutive function in seedlings and mature organs. Notably, the activity of BnSUT2pro-2239 and its fragments (except that of BnSUT2pro-231) are strongly

NU

induced by mechanical wounding. Moreover, BnSUS1pro-1051 and BnSUS1pro-485 are sensitive to CuSO4 treatment while BnSUT2pro-2239 and BnSUT2pro-1681 are sensitive to PEG and ABA

MA

treatments, respectively. Our findings will provide the foundation for deciphering the functions of BnSUS1 and BnSUT2, and also expand the promoter library to provide more options for plant genetic engineering.

D

Keywords

1.

Introduction

PT E

Ramie; SUCROSE SYNTHASE 1; SUCROSE TRANSPORTER 2; Promoter

CE

Sucrose synthase (SUS; EC 2.4.1.13) is an important cytoplasmic enzyme in the plant cells and plays a pivotal role in sugar metabolism (Koch, 2004). As previously demonstrated, SUS is a reversible

AC

enzyme that catalyzes the cleavage of sucrose (Geigenberger and Stitt, 1993) and, UDP-glucose and fructose are its catalytic products (Wei et al., 2015). UDP-glucose is a substrate of cellulose synthase and used to produce cellulose for cell wall biosynthesis (Amor et al., 1995; Salnikov et al., 2001). Researches on SUS genes have been carried out in several plants, especially cotton (Ruan et al., 2001). Cotton fiber cell initiation and elongation are significantly repressed due to suppressing expression of SUS (Ruan and Furbank, 2003). In addition, overexpression of GhSUSA1 contributes to an effective improvement in cotton fiber quality and yield due to increased cell wall thickening during secondary wall formation (Jiang et al., 2012). Similar studies on poplar (Coleman et al., 2009; Wei et al., 2015) and switchgrass (Poovaiah et al., 2015) also suggest that SUS is indispensable in cellulose synthesis

ACCEPTED MANUSCRIPT and cell wall formation. Promoter functional analysis can provide an auxiliary view for functional analysis of the corresponding gene. Promoters of SUS genes have been studied in several plants, such as maize (Russell, 1990), rice (Shi et al., 1994) and citrus (Singer et al., 2011), where they drive GUS expression predominantly in the vasculature. Moreover, four AtSUS promoters were investigated in Arabidopsis thaliana, of which AtSUS1pro has vascular specificity (Bieniawska et al., 2007).

PT

In higher plants, photosynthetic assimilation products are mainly transported in the form of sucrose. Sucrose transporters (SUTs) play an important role in this process and mediate carbon

RI

partitioning (Kühn and Grof, 2010). Genes encoding SUTs have been studied in some plants. A previous study on potato confirms that StSUT1 is essential for the loading and unloading of

SC

assimilation products in the phloem and that repression of StSUT1 expression severely affects the plant growth and development (Riesmeier et al., 1994). Antisense repression of NtSUT1 provided an

NU

evidence for an essential role in sucrose export from tobacco leaves (Bürkle et al., 1998). In Arabidopsis, the AtSUC2 promoter has phloem specificity (Truernit and Sauer, 1995), supporting a role

MA

of AtSUC2 in phloem loading and unloading. Further detailed work reveals the necessary role of AtSUC2 in phloem loading (Srivastava et al., 2008). Another sucrose transporter from Arabidopsis

D

named AtSUC3 or AtSUT2 was also studied. Unlike AtSUC2, the AtSUC3 protein localized to some

PT E

non-photosynthetic cells or tissues and may play a role in sucrose import to sink tissues and in particular, its expression strongly responds to external damage induction (Meyer et al., 2004). In addition, studies on PmSUT2 (Barth et al., 2003), LeSUT1 and LeSUT2 (Hackel et al., 2006), and

CE

PtaSUT4 (Payyavula et al., 2011) from Plantago major, Lycopersicon esculentum and Populus tremula×alba, respectively, also demonstrated the important role of SUT in sucrose transport and

AC

photo-assimilate partitioning.

Ramie is a bast fiber plant that mainly grows in southern China and is also known as "Chinese grass". Its bast fibers are usually used as a textile raw material. The thickened cell wall of these specialized cells mainly provides the specialized properties of bast fiber (Fig. S1). The higher the cellulose content, the better the fiber quality. Although sucrose sythase plays an important role in cellulose synthesis, according to best of our knowledge, no research has been reported on SUS genes of ramie. Ramie is a perennial herb with complex underground part which includes rhizomes and radish roots with fine roots. Its nutrients are mainly stored within the radish roots, providing a reserve for new growth following harvest. As the previous studies stated, sucrose transporters play an indispensable

ACCEPTED MANUSCRIPT role in the transport and mediation of photosynthetic products, but unfortunately, to date, no studies related SUT genes of ramie have been reported. Furthermore, studies on tissue-specific promoters have been reported in many species, but few have been reported in ramie (Huang et al., 2016; Guo et al., 2018). The excavation of tissue-specific promoters, especially phloem-specific promoters, is important for molecular breeding in ramie. In the present study, we cloned and investigated the expression

PT

patterns of BnSUS1 and BnSUT2 in different tissues of ramie. The promoter regions of the two genes were also isolated and their functions were analyzed in detail in Arabidopsis. These efforts will provide

Materials and methods

SC

2.

RI

useful information for the functional analysis of BnSUS1 and BnSUT2.

2.1. DNA extraction, exon-intron structure and phylogenetic analysis

NU

The genomic DNA was extracted from fresh ramie leaves with Omega Plant Genomic DNA Extraction Kit (OMEGA bio-tec, CA, USA) and used as the template to isolate the genomic sequences of BnSUS1

MA

and BnSUT2. The exon-intron structures were drawn by using the tool: Gene Structure Display Server 2.0 (Hu et al., 2015). The multiple alignments of amino acid sequences were performed via MAFFT

D

algorithm (Katoh et al., 2017). Phylogenetic trees were constructed in MEGA 6.0 software under

PT E

default settings by using the Maximum Likelihood method with 1000 bootstrap replications (Tamura et al., 2013).

2.2. cDNA synthesis and real-time quantitative PCR

CE

Total RNA was extracted from six tissues or organs (leaves without main vein, vein, bark, wood, pith and root) of ramie with the RNAprep Pure Plant Kit (Tiangen Biotech, Beijing, China). TransScript II

AC

First-Strand cDNA Synthesis SuperMix kit (TransGen Biotech, Beijing, China) was used for cDNA synthesis. Real-time quantitative PCR was conducted with iTaq Universal SYBR Green Supermix (Bio-Rad, Hercules, CA, USA) on a Bio-Rad iQ5 Real-Time PCR System (Bio-Rad, CA, USA). The ramie Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as the endogenous control. The relative transcriptional level was calculated as described previously (Livak and Schmittgen, 2001). One-way ANOVA was used for data analysis. The primers used are listed in Tab. 1. 2.3. Isolation and analysis of the promoters The two promoters were isolated according to Universal Fast Walking (UFW), a method for cloning

ACCEPTED MANUSCRIPT flanking sequences established by Myrick and Gelbart (Myrick and Gelbart, 2002). The detailed UFW procedure has been described in Tab. S1. The primers involved are listed in Tab. 2. The promoter sequences were analyzed in detail by using the PLACE, an online tool for detecting cis-acting elements (Higo et al., 1999). 2.4. Construction of promoters-GUS and series of 5’-deletion segments-GUS constructs

PT

The promoter was truncated based on the distribution density of cis-acting elements in the promoter region. Full-length promoter and a series 5’-deletion fragments were introduced into the pBI121 (Fig.

RI

S2) to replace CaMV 35s promoter by using ClonExpress II One Step Cloning Kit (Vazyme Biotech,

SC

Nanjing, China) according to the manufacturer’s instructions. All primers used for sequences amplification and homologous recombination are shown in Tab. S2.

NU

2.5. Arabidopsis transformation and positive transgenic lines screening The constructed recombinant plasmids were transformed into Agrobacterium tumefaciens strain

MA

GV3101 via electroporation. The wild-type Arabidopsis thaliana were used for genetic transformation via floral dip method (Zhang et al., 2006). Kanamycin-resistant seedlings were screened from

D

transformed seeds and planted into the greenhouse to produce T2 generation. The T3 generation

PT E

transgenic lines were used for the follow-up experiments. 2.6. Histochemical GUS staining

Seedlings and mature organs or tissues of each transgenic Arabidopsis thaliana line were harvested and

CE

immersed in X-gluc (Amresco, USA) reaction buffer for histochemical GUS staining (Jefferson et al., 1987). After incubation at 37 °C for 12 h in dark, all samples were decolorized with 70% ethanol

AC

following 90% ethanol. GUS staining sites were captured by stereo fluorescence microscope (SZX16, Olympus, Japan).

2.7. Treatments and GUS fluorometric assays Transgenic Arabidopsis lines carrying promoters and their truncated fragment constructs were used for stress experiments and three independent transgenic lines (genetically unique) were selected for each constructs. T3 generation resistant seeds of each line were surface sterilized and grown on 1/2 MS medium. Ten days later, the seedlings were transferred into the petri dish with filter paper attached and treated with either dH2O (control), 5% sucrose (m/v), 10 µM IAA, 200 µM CuSO4, 20% PEG6000,

ACCEPTED MANUSCRIPT 100 µM ABA or 10 µM GA3 for 6 hours at 22 °C under white fluorescent light. Three parallel experiments were performed for each treatment of all selected lines. Approximately 100 mg of each sample was collected and immersed in liquid nitrogen immediately. For mechanical wounding treatment, the leaves attached with plants were damaged and kept in the incubator at 80% relative humidity for 10 minutes. The experiment was repeated three times independently. Approximately

PT

100mg injured leaves were detached for each repetition. The leaves that had not been damaged were used as controls. All samples were stored at -80°C for further analysis. GUS was extracted from stored

RI

samples with GUS extraction buffer (50 mM potassium phosphate buffer at pH 7.0, 10 mM EDTA, 0.1 % sodium laurylsarcosine, 0.1 % Triton X-100 and 10 mM β-mercaptoethanol). Protein concentration was

SC

confirmed via Bradford method (Bradford, 1976). The fluorogenic reaction was performed as described by Jefferson (Jefferson et al., 1987) using 4-MUG (4-methyl-umbelliferyl-glucuronide) (Sigma-Aldrich,

NU

USA) as a substrate. Fluorescence was measured at excitation and emission wavelengths of 365 and 455 nm, respectively, by using the multifunctional microplate reader (EnSpire, PerkinElmer, USA).

MA

Student's t-test was used to determine significant differences between treatment groups and respective controls. Results

D

3.

PT E

3.1. Cloning and expression analysis of BnSUS1 and BnSUT2 in ramie The full-length cDNA sequences of BnSUS1 and BnSUT2 were obtained from transcriptome database

CE

(data not shown). Phylogenetic analysis revealed that BnSUS1 was close to AtSUS1 and AtSUS4 (Fig. 1a), while BnSUT2 was close to AtSUC3 (Fig. 1b) in genetic evolution. The exon-intron structures

AC

were constructed and shown in Fig. 1c. Both genes have multiple introns and exons (Fig. 1c). The DNA sequences of BnSUS1 and BnSUT2 have been submitted to NCBI with accession numbers: MH253892 and MH253893. To explore the expression patterns of BnSUS1 and BnSUT2, we assessed their relative expression levels in six different tissues or organs (Leaf without main vein, vein, bark, pith, wood and root) of ramie by quantitative real-time PCR (qRT-PCR) (Fig. 2). The results showed that the expression of both genes could be detected in six tissues or organs. The relative expression level of BnSUS1 is highest in leaves and lowest in wood (Fig. 2A), while the relative expression level of BnSUT2 decreased from leaf to root (Fig. 2B).

ACCEPTED MANUSCRIPT

3.2. Isolation and cis-acting elements prediction of BnSUS1 and BnSUT2 promoters The UFW method was used for isolating promoters in this study. The polymorphic amplification electrophoresis results of UFW were produced under different polymerase chain reaction (PCR) conditions (Fig. S3a, S3b, lane 1, 2, 3 and 4). Subsequently, all PCR products were cloned and sequenced. Finally, a 1690-bp BnSUS1 promoter region (BnSUS1pro) and a 2239-bp BnSUT2 promoter

PT

region (BnSUT2pro) were isolated from ramie. The PLACE web tool was utilized to detect the cis-acting elements of BnSUS1pro and BnSUT2pro. All of the detected cis-acting elements and their

RI

detail information are listed in Tab. S3 (BnSUS1pro) and Tab. S4 (BnSUT2pro). Some of elements were

SC

selected and drawn into Fig. 3 according to their location in the promoter region. For BnSUS1pro, TATA-BOX (Grace et al., 2004) was found at -340 and -189 which played essential role for RNA

NU

polymerase recognition and transcription initiation; CAAT-BOX (Shirsat et al., 1989) was liable for tissue-specific activity and found at multiple locations (Tab. S3). An element (named

MA

POLLEN1LELAT52) (Bate and Twell, 1998) responsible for pollen specific activation was located at -1520, -1516, -1372, -995, -762, -672, -668, -658, -652, -443, -236 and -227 (Tab. S3). Two elements, ACGTABOX (required for sugar-repression) (Toyofuku et al., 1998) and TATCCAOSAMY

D

(mediating sucrose regulation related gene expression) (Chen et al., 2006) related sugar were found at

PT E

-207 and -165, respectively. In addition, ROOTMOTIFTAPOX1, a root specificity element, was also identified at multiple locations (Tab. S3). Similarly, the detailed information of all predicted cis-acting

CE

elements of BnSUT2pro is listed in Tab. S4. Serial 5’-deletion fragments of the two promoters were produced according to the distribution density of the predicted cis-acting elements (Fig. 3a and Fig. 3b)

AC

and named BnSUS1pro-1690, BnSUS1pro-1420, BnSUS1pro-1051, BnSUS1pro-485; BnSUT2pro-2239, BnSUT2pro-1681, BnSUT2pro-1199, BnSUT2pro-618, BnSUT2pro-231, respectively (Fig. 3). 3.3. GUS staining in different transgenic Arabidopsis lines To investigate the function of two promoters, the full-length promoters and 5’-deletion fragments were fused GUS and transformed into Arabidopsis. Histochemical staining was used to detect GUS expression in Arabidopsis seedlings and mature organs. The GUS expression sites were detected in cotyledons, hypocotyls and radicles of 1-day-old seedlings containing the BnSUS1pro-1690 or BnSUS1pro-1420 construct, while GUS staining was not detected in 1-day-old seedlings containing the BnSUS1pro-1051 or BnSUS1pro-485 construct (Fig. 4).

ACCEPTED MANUSCRIPT Meanwhile, GUS expression was strongly observed in the vasculature of leaves of seedlings carrying BnSUS1pro-1690 or BnSUS1pro-1420 construct regardless of 4-day-old, 7-day-old or 10-day-old (Fig. 4A, A1). GUS staining could be detected in roots of all seedlings carrying the BnSUS1pro-1690 or its truncated fragments construct at 4-day-old, 7-day-old and 10-day-old developmental stages (Fig. 4). Unlike BnSUS1pro, the BnSUT2pro exhibited strong constitutive functions. Strong expression of GUS

PT

was detected in all parts of the seedlings carrying BnSUT2pro-2239, BnSUT2pro-1681, BnSUT2pro-1199 or BnSUT2pro-618 construct at different developmental stages (Fig. 4B, B1, B2 and B3). Moreover,

RI

GUS staining was not detected in seedlings carrying BnSUT2pro-231 construct in all developmental stages (Fig. 4B4).

SC

GUS expression patterns were also investigated in mature organs of transgenic Arabidopsis lines. GUS staining could be detected in flower, silique, vein and stem of Arabidopsis lines carrying

NU

BnSUS1pro-1690 or BnSUS1pro-1420 construct (Fig. 5A and A1). However, no GUS expression was detected in rosette leaves, cauline leaves and stems in Arabidopsis lines carrying BnSUS1pro-1051 or

MA

BnSUS1pro-485 construct, whereas GUS expression was found in the stamens (Fig. 5A2 and A3). Similar to the seedling stage, BnSUT2pro also showed a constitutive function in mature organs of

D

Arabidopsis. Strong GUS activity was detected in flowers, rosette leaves, cauline leaves and stems of

PT E

the transgenic lines carrying BnSUT2pro-2239, BnSUT2pro-1681, BnSUT2pro-1199 or BnSUT2pro-618 construct, and GUS expression was also detected in siliques but the activity was weak (Fig.5B, B1, B2 and B3). In particular, GUS activity was not exhibited in all tested organs of transgenic lines carrying

CE

BnSUT2pro-231 construct (Fig. 5B4).

AC

3.4. Mechanical wounding enhanced GUS expression Performing the GUS staining on the mature organs of transgenic Arabidopsis carrying BnSUT2pro-2239 constructs, we found that the GUS expression was more intense in areas that were injured, such as leaf incisions (Fig. 5B, B1, B2 and B3). To determine whether or not BnSUT2pro and its 5’-truncated fragments respond to external damage, we performed mechanical wounding treatment on Arabidopsis leaves carrying BnSUT2pro-2239 or 5’-truncated fragments constructs. Subsequently, we performed GUS staining and quantitative detection of GUS activity on treated leaves. The results showed that the GUS expression on the damaged side in the leaf of Arabidopsis carrying BnSUT2pro-2239, BnSUT2pro-1681, BnSUT2pro-1199 or BnSUT2pro-618 construct was significantly higher than the

ACCEPTED MANUSCRIPT undamaged side (Fig. 6). Meanwhile, GUS staining was not observed in leaves carrying BnSUT2pro-231 construct (Fig. 6). The quantitative results of GUS activity also revealed that GUS activity in the damaged leaves was extremely higher than undamaged leaves (p<0.01 or p<0.001) (Fig. 6). 3.5. Quantification of GUS activity in different transgenic Arabidopsis lines under different stresses

PT

To investigate the effect of abiotic stresses on the promoter activity, we selected three independent transgenic Arabidopsis lines for each promoter fragment and measured the GUS fluorescence intensity

RI

of those lines under different stresses. GUS fluorescence assay showed that sucrose treatment had little

SC

effect on the activity of BnSUS1pro-1690 and its truncated fragments except for one of the lines carrying BnSUS1pro-1051 construct: BnSUS1pro-1051-1 (Fig. 7a). CuSO4 treatment had little effect on the GUS

NU

activity of all Arabidopsis lines carrying BnSUS1pro-1690 or BnSUS1pro-1420 construct, but significantly enhanced the GUS activity of all lines carrying BnSUS1pro-1051 or BnSUS1pro-485

MA

construct (p<0.05 or p<0.01) (Fig. 7b). There was no significant change in GUS activity in Arabidopsis lines carrying BnSUS1pro-1690, BnSUS1pro-1051 or BnSUS1pro-485 construct under ABA treatment, whereas the GUS activity of the two lines (BnSUS1pro-1420-2 and BnSUS1pro-1420-6)

D

carrying BnSUS1pro-1420 construct was significantly inhibited (Fig. 7c). Although IAA treatment

PT E

enhanced the GUS activity of the Arabidopsis seedlings carrying BnSUS1pro-1690 construct, only BnSUS1pro-1690-8 was significantly different compared to the control (Fig. 7d). IAA treatment

CE

significantly inhibited the GUS activity of BnSUS1 pro-1420-2, while the GUS activity of BnSUS1pro-1420-3 and BnSUS1pro-1420-6 was not significantly different from the control (Fig. 7d). In

AC

addition, GUS activity was not affected under IAA treatment in all lines carrying BnSUS1pro-1051 or BnSUS1pro-485 construct (Fig. 7d). Sucrose treatment had no significant effect on the GUS activity of the Arabidopsis lines carrying BnSUT2pro-2239 or its truncated fragments construct, except that of BnSUT2pro-618-7 (Fig. 8a). PEG treatment significantly enhanced the GUS activity of three Arabidopsis seedlings lines carrying BnSUT2pro-2239 construct was greatly induced (p<0.01 or p<0.001), but had little effect on Arabidopsis

seedlings

lines

carrying

BnSUT2pro-1681,

BnSUT2pro-1199,

BnSUT2pro-618

or

BnSUT2pro-231 construct (Fig. 8b). GUS activity of Arabidopsis seedlings lines carrying BnSUT2pro-2239, BnSUT2pro-1199 or BnSUT2pro-231 construct was not sensitive to ABA treatment

ACCEPTED MANUSCRIPT (Fig. 8c). However, the GUS activity of three Arabidopsis lines carrying BnSUT2pro-1681 constructs was significantly enhanced under ABA treatment (Fig. 8c). Moreover, there was no significant change in the GUS activity of all Arabidopsis lines after 6 hours of GA3 treatment (Fig. 8d). 4.

Discussion

Sucrose synthase is widely believed to play an important role in plant sucrose metabolism (Martin et al.,

PT

1993; Zrenner et al., 1995; Craig et al., 1999; Etxeberria and Gonzalez, 2003) and has potential effects in cellulose synthesis (Amor et al., 1995; Salnikov et al., 2001; Ruan and Furbank, 2003). The

RI

foregoing statements have fully demonstrated the importance of SUS for cellulose synthesis and

SC

secondary cell wall formation. In present study, we cloned one sucrose synthase gene (BnSUS1) of ramie and isolated its promoter region. Real-time quantitative PCR revealed that BnSUS1 was widely

NU

expressed in various tissues (Fig. 2), which is consistent with the findings of SUS1 in Arabidopsis (Baud et al., 2004; Bieniawska et al., 2007), barley (Barrero-Sicilia et al., 2011), populus (An et al.,

MA

2014) and citrus (Islam et al., 2014). GUS staining in transgenic Arabidopsis clearly confirmed that BnSUS1pro-1690 and BnSUS1pro-1420 have vasculature specificity in cotyledons (Fig. 4A, A1) and mature leaves (Fig. 5A, A1). This expression pattern was also reported for AtSUS1 in Arabidopsis

D

(Bieniawska et al., 2007). Meanwhile, GUS staining of seedlings carrying BnSUS1pro-1051 or

PT E

BnSUS1pro-485 construct occurred only in the roots (Fig. 4A2, A3), which indicates that the region determined the vasculature specificity function of BnSUS1pro is localized at -1051 to -1690. In addition,

CE

predicted root-specific elements (ROOTMOTIFTAPOX1) (Elmayan and Tepfer, 1995) are localized at multiple regions of BnSUS1pro-1690 (Tab. S3), which are responsible for root specificity of

AC

BnSUS1pro-1690 and its truncated fragments (Fig. 4A, A1, A2 and A3). Sucrose is considered as a regulatory factor in modulating expression level of sucrose synthase (Koch, 1996) and sucrose feeding also affects the relative expression level of AtSUS1 in Arabidopsis (Baud et al., 2004). However, in this study, GUS activity was hardly affected by sucrose in Arabidopsis seedlings carrying BnSUS1pro-1690 or its truncated fragments construct (Fig. 7a). Thus, we speculate that there are two possible reasons: the function displayed by the promoter is not completely consistent with the expression pattern of the corresponding gene or the function of SUS1 varies among species. CuSO4 treatment was taken into consideration in this study based on the presence of copper-responsive elements in the prediction of the BnSUS1pro cis-acting elements (Tab. S3). No previous studies have

ACCEPTED MANUSCRIPT been reported on the effect of CuSO4 or copper ions on sucrose synthase. Our findings revealed that the activity of BnSUS1pro-1051 and BnSUS1pro -485 could be stimulated by CuSO4 while BnSUS1pro-1690 and BnSUS1pro-1420 were not sensitive to CuSO4 (Fig. 7b). The copper-responsive element has been proven to be critical motif necessary to respond to copper deficiency (Quinn and Merchant, 1995; Quinn et al., 2002). Although, it was predicted at position -1574, -1565 and -939 of BnSUS1pro, the

PT

activity of BnSUS1pro-1690 and BnSUS1pro-1420 were not activated under dH2O treatment (control) (Fig. 7b), indicating that these motifs do not appear to function in the plants tested. Meanwhile, the

RI

activities of BnSUS1pro-1051 and BnSUS1pro-485 are significantly activated by CuSO4. Therefore, we speculate that there is unidentified copper-activated response elements located in the region -485 to 0

SC

and the copper-inhibited response elements located in the region -1690 to -1051. Further analysis is required to specifically identify the CuSO4 responsive elements in the BnSUS1pro.

NU

In higher plants, sucrose transporters play an important role in regulating the partition of photosynthesis assimilation products (Kühn and Grof, 2010). In this study, a ramie sucrose transporter

MA

gene (BnSUT2) was first identified and its promoter region was isolated. SUT2 gene is a specific presence in the SUT gene family, whether in monocotyledon (Weschke et al., 2000; Aoki et al., 2003)

D

or dicotyledonous plants (Barker et al., 2000; Barth et al., 2003; Meyer et al., 2004). The function of

PT E

the SUT2 protein varies among different species. For instance, LeSUT2 is speculated to act as the sucrose sensor in sieve elements of tomato (Barker et al., 2000); HvSUT2 not only mediates sucrose transport but may also have a general housekeeping role in barley (Weschke et al., 2000); OsSUT2 is

CE

inferred to be involved in sucrose transport during early development of caryopsis in rice (Aoki et al., 2003); AtSUC3 is suggested to play a role in the sucrose import into sink tissues in Arabidopsis (Meyer

AC

et al., 2004). Quantitative real-time PCR exhibited that BnSUT2 was widely expressed in various tissues (Fig. 2B) and GUS staining revealed that BnSUT2pro-2239 has constitutive functions (Fig. 4B; Fig. 5B). This suggests that BnSUT2 may be similar to HvSUT2, acting as a general housekeeping gene. Although the phylogenetic analysis showed that BnSUT2 was closely related to AtSUC3 (Fig. 1b), their functions are not consistent, especially for the promoter (Meyer et al., 2004). The TATA-box is generally believed to be the core element of the eukaryotic promoter located approximately -30 bp upstream of the transcription initiation (Wiley et al., 1992). However, the prediction of cis-acting elements showed that the TATA-box of BnSUT2pro was located at -334 (Tab. S4). This suggests that there is an approximately 300 bp 5'-untranslated region existed upstream of the

ACCEPTED MANUSCRIPT initial codon. In addition, GUS staining was invisible in Arabidopsis seedlings and mature organs carrying BnSUT2pro-231 construct (Fig. 4B4 and Fig. 5B4), indicating that BnSUT2pro-231 did not possess promoter activity. W-box was first identified in tobacco and involved in wound-induced expression (Nishiuchi et al., 2004). GUS expression was extremely induced under mechanical wounding

treatment

in

Arabidopsis

leaves

carrying

BnSUT2pro-2239,

BnSUT2pro-1681,

PT

BnSUT2pro-1199 or BnSUT2pro-618 construct (Fig. 6), while W-box motif was predicted at five locations (-1706, -942, -824, -678 and -550) in BnSUT2pro (Tab. S4). Therefore, the presence of W-box

suggested

that

RI

might be the main cause of the strong response of BnSUT2pro to mechanical wounding and also BnSUT2pro-2239, BnSUT2pro-1681, BnSUT2pro-1199 and

BnSUT2pro-618 are

SC

wounding-inducible promoters. In addition, it is puzzling that when the damage occurs, the constitutive function of BnSUT2pro seems to be weakened or disappeared (Fig. 6). We speculate that although

NU

BnSUT2pro has both constitutive and wound-induced functions, these two functions do not work at the same time. When the injury occurs, BnSUT2pro mainly exhibits wound-induced function. SUT proteins

MA

not only play an important role in the distribution of assimilation products but also involve cellular metabolism and defense responses (Ibraheem et al., 2008). In this study, GUS expression was strongly

D

induced by mechanical wounding in Arabidopsis carrying BnSUT2pro, indicating that the strongly

PT E

induced expression of BnSUT2 is involved in plant response to external damage resistance. Similar results have also been reported in previous studies (Truernit et al., 1996; Sakr et al., 1997; Fotopoulos et al., 2003; Meyer et al., 2004), suggest that up-regulated expression of SUTs in injured or infected

CE

tissues can increase the content of carbohydrate and provide energy assurance for increased metabolic activity in these tissues (Meyer et al., 2004; Ibraheem et al., 2008).

AC

PYRIMIDINEBOX (Morita et al., 1998) and GAREAT (Ogawa et al., 2003) are cis-elements associated with sugar repression and GA-responsive, respectively, and although predicted in BnSUT2pro (Tab. S4), most transgenic Arabidopsis lines carrying BnSUT2pro-2239 or its truncated fragments construct are not sensitive to sucrose and GA3 treatments (Fig. 8a, d), indicating the two elements may not perform their functions. PEG treatment significantly increased GUS activity on Arabidopsis seedlings carrying BnSUT2pro-2239 construct but showed little effect on the seedlings carrying BnSUT2pro-1681, BnSUT2pro-1199, BnSUT2pro-618 or BnSUT2pro-231 construct (Fig. 8b). Those results suggest that there may be cis-acting elements associated with drought-responsive located in the region of -2239 to -1681. ABA treatment induced GUS expression in Arabidopsis seedlings carrying

ACCEPTED MANUSCRIPT BnSUT2pro-1681 construct but had no significant effect on the seedlings carrying rest of the truncated constructs (Fig. 8c), which indicated that the region (-1681 to -1199) is essential for ABA-induced expression. Although, the ABA-responsive element (Young et al., 1997) is located at -2071 of BnSUT2pro,it does not appear to function or plays a negative regulatory role. In addition, GUS activity analysis showed that the function of BnSUT2pro-2239 appeared to be inhibited (Fig. 8) compared to its

PT

truncated fragments, but the GUS staining results did not differ significantly among these promoters (Fig. 4 and Fig. 5). Therefore, the presence or absence of repressors in the region of -2239 to -1681

5.

RI

requires further experimental validation. Conclusions

SC

Taken together, the BnSUS1pro has vascular tissue specificity and CuSO4 treatment strongly stimulates the activity of BnSUS1pro-1051 and BnSUS1pro-485. The BnSUT2pro is a constitutive

NU

promoter and BnSUT2pro-618 is the shortest region to ensure its constitutive function. In addition, the activity of BnSUT2pro is strongly induced by mechanical wounding and, PEG and ABA treatment also

MA

affect the activity of BnSUT2pro. Our work will provide useful information on functional analysis of BnSUS1 and BnSUT2 for future research and enrich the plant promoter library to provide more options

PT E

Author contribution statement

D

for plant genetic engineering.

D.P. and P.G. designed the research project. P.G. performed the research and wrote the paper. P.G. and

CE

Y.Z. performed Arabidopsis genetic transformation and GUS fluorometric assays. P.G. and Y.H.

AC

isolated the regions of the two promoters. B.W. and L.L. provided experimental materials and revised manuscript. All authors read and approved the manuscript. Acknowledgments

This study was supported by National Natural Science Foundation of China (31671736). Conflict of Interest: The authors declare that they have no conflict of interest. References Amor, Y., Haigler, C.H., Johnson, S., Wainscott, M. and Delmer, D.P., 1995. A membrane-associated form of sucrose synthase and its potential role in synthesis of cellulose and callose in plants.

ACCEPTED MANUSCRIPT Proceedings of the National Academy of Sciences 92, 9353-9357. An, X., Chen, Z., Wang, J., Ye, M., Ji, L., Wang, J., Liao, W. and Ma, H., 2014. Identification and characterization of the Populus sucrose synthase gene family. Gene 539, 58. Aoki, N., Hirose, T., Scofield, G.N., Whitfeld, P.R. and Furbank, R.T., 2003. The sucrose transporter gene family in rice. Plant & Cell Physiology 44, 223. Barker, L., Kühn, C., Weise, A., Schulz, A., Gebhardt, C., Hirner, B., Hellmann, H., Schulze, W., Ward, J.M. and Frommer, W.B., 2000. SUT2, a putative sucrose sensor in sieve elements. The Plant Cell 12, 1153-1164. Barrero-Sicilia, C., Hernando-Amado, S., González-Melendi, P. and Carbonero, P., 2011. Structure,

PT

expression profile and subcellular localisation of four different sucrose synthase genes from barley. Planta 234, 391-403.

RI

Barth, I., Meyer, S. and Sauer, N., 2003. PmSUC3: characterization of a SUT2/SUC3-type sucrose transporter from Plantago major. The Plant Cell 15, 1375-1385.

SC

Bate, N. and Twell, D., 1998. Functional architecture of a late pollen promoter: pollen-specific transcription is developmentally regulated by multiple stage-specific and co-dependent activator elements. Plant molecular biology 37, 859-869.

NU

Baud, S., Vaultier, M.N. and Rochat, C., 2004. Structure and expression profile of the sucrose synthase multigene family in Arabidopsis. Journal of Experimental Botany 55, 397-409. Bieniawska, Z., Paul Barratt, D., Garlick, A.P., Thole, V., Kruger, N.J., Martin, C., Zrenner, R. and Smith,

MA

A.M., 2007. Analysis of the sucrose synthase gene family in Arabidopsis. The Plant Journal 49, 810-828.

Bradford, M.M., 1976. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Analytical Biochemistry 72, 248-254.

D

Bürkle, L., Hibberd, J.M., Quick, W.P., Kühn, C., Hirner, B. and Frommer, W.B., 1998. The H+-sucrose cotransporter NtSUT1 is essential for sugar export from tobacco leaves. Plant Physiology 118,

PT E

59-68.

Chen, P.-W., Chiang, C.-M., Tseng, T.-H. and Yu, S.-M., 2006. Interaction between rice MYBGA and the gibberellin response element controls tissue-specific sugar sensitivity of α-amylase genes. The Plant Cell 18, 2326-2340.

CE

Coleman, H.D., Yan, J. and Mansfield, S.D., 2009. Sucrose synthase affects carbon partitioning to increase cellulose production and altered cell wall ultrastructure. Proceedings of the National Academy of Sciences 106, 13118-13123.

AC

Craig, J., Barratt, P., Tatge, H., Déjardin, A., Handley, L., Gardner, C.D., Barber, L., Wang, T., Hedley, C. and Martin, C., 1999. Mutations at therug4locus alter the carbon and nitrogen metabolism of pea plants through an effect on sucrose synthase. Plant Journal 17, 353-362. Elmayan, T. and Tepfer, M., 1995. Evaluation in tobacco of the organ specificity and strength of the rolD promoter, domain A of the 35S promoter and the 35S2 promoter. Transgenic Research 4, 388-396. Etxeberria, E. and Gonzalez, P., 2003. Evidence for a tonoplast-associated form of sucrose synthase and its potential involvement in sucrose mobilization from the vacuole. Journal of Experimental Botany 54, 1407-1414. Fotopoulos, V., Gilbert, M.J., Pittman, J.K., Marvier, A.C., Buchanan, A.J., Sauer, N., Hall, J.L. and Williams, L.E., 2003. The Monosaccharide Transporter Gene, AtSTP4, and the Cell-Wall Invertase, Atβfruct1, Are Induced in Arabidopsis during Infection with the Fungal Biotroph

ACCEPTED MANUSCRIPT Erysiphe cichoracearum. Plant Physiology 132, 821-829. Geigenberger, P. and Stitt, M., 1993. Sucrose synthase catalyses a readily reversible reaction in vivo in developing potato tubers and other plant tissues. Planta 189, 329-339. Grace, M.L., Chandrasekharan, M.B., Hall, T.C. and Crowe, A.J., 2004. Sequence and spacing of TATA box elements are critical for accurate initiation from the β-phaseolin promoter. Journal of Biological Chemistry 279, 8102-8110. Guo, P., Zheng, Y., Peng, D., Liu, L., Dai, L., Chen, C. and Wang, B., 2018. Identification and expression characterization of the Phloem Protein 2 (PP2) genes in ramie (Boehmeria nivea L. Gaudich). Sci Rep 8, 10734.

PT

Hackel, A., Schauer, N., Carrari, F., Fernie, A.R., Grimm, B. and Kühn, C., 2006. Sucrose transporter LeSUT1 and LeSUT2 inhibition affects tomato fruit development in different ways. The Plant

RI

Journal 45, 180-192.

Higo, K., Ugawa, Y., Iwamoto, M. and Korenaga, T., 1999. Plant cis-acting regulatory DNA elements

SC

(PLACE) database: 1999. Nucleic acids research 27, 297-300.

Hu, B., Jin, J., Guo, A.Y., Zhang, H., Luo, J. and Gao, G., 2015. GSDS 2.0: an upgraded gene feature visualization server. Bioinformatics 31, 1296.

NU

Huang, C., Zhou, J., Jie, Y., Xing, H., Zhong, Y., She, W., Wei, G., Yu, W. and Ma, Y., 2016. A ramie (Boehmeria nivea) bZIP transcription factor BnbZIP3 positively regulates drought, salinity and heavy metal tolerance. Molecular Breeding 36, 1-15.

MA

Ibraheem, O., Hove, R.M. and Bradley, G., 2008. Sucrose assimilation and the role of sucrose transporters in plant wound response. African Journal of Biotechnology 7. Islam, M.Z., Hu, X.M., Jin, L.F., Liu, Y.Z. and Peng, S.A., 2014. Genome-wide identification and expression profile analysis of citrus sucrose synthase genes: investigation of possible roles in

D

the regulation of sugar accumulation. Plos One 9, e113623. Jefferson, R.A., Kavanagh, T.A. and Bevan, M.W., 1987. GUS fusions: beta-glucuronidase as a sensitive

PT E

and versatile gene fusion marker in higher plants. The EMBO journal 6, 3901. Jiang, Y., Guo, W., Zhu, H., Ruan, Y.L. and Zhang, T., 2012. Overexpression of GhSusA1 increases plant biomass and improves cotton fiber yield and quality. Plant biotechnology journal 10, 301-312. Katoh, K., Rozewicki, J. and Yamada, K.D., 2017. MAFFT online service: multiple sequence alignment,

CE

interactive sequence choice and visualization. Briefings in Bioinformatics. Koch, K., 2004. Sucrose metabolism: regulatory mechanisms and pivotal roles in sugar sensing and plant development. Current Opinion in Plant Biology 7, 235-246.

AC

Koch, K.E., 1996. Carbohydrate-modulated gene expression in plants. Annual Review of Plant Biology 47, 509-540.

Kühn, C. and Grof, C.P., 2010. Sucrose transporters of higher plants. Current opinion in plant biology 13, 287-297.

Livak, K.J. and Schmittgen, T.D., 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2

-ΔΔCT

method. methods 25, 402-408.

Martin, T., Frommer, W.B., Salanoubat, M. and Willmitzer, L., 1993. Expression of an Arabidopsis sucrose synthase gene indicates a role in metabolization of sucrose both during phloem loading and in sink organs. Plant Journal 4, 367-377. Meyer, S., Lauterbach, C., Niedermeier, M., Barth, I., Sjolund, R.D. and Sauer, N., 2004. Wounding enhances expression of AtSUC3, a sucrose transporter from Arabidopsis sieve elements and sink tissues. Plant Physiology 134, 684-93.

ACCEPTED MANUSCRIPT Morita, A., Umemura, T., Kuroyanagi, M., Futsuhara, Y., Perata, P. and Yamaguchi, J., 1998. Functional dissection of a sugar-repressed alpha-amylase gene (RAmy1 A) promoter in rice embryos. Febs Letters 423, 81–85. Myrick, K.V. and Gelbart, W.M., 2002. Universal Fast Walking for direct and versatile determination of flanking sequence. Gene 284, 125. Nishiuchi, T., Shinshi, H. and Suzuki, K., 2004. Rapid and Transient Activation of Transcription of the ERF3 Gene by Wounding in Tobacco Leaves POSSIBLE INVOLVEMENT OF NtWRKYs AND AUTOREPRESSION. Journal of Biological Chemistry 279, 55355-55361. Ogawa, M., Hanada, A., Yamauchi, Y., Kuwahara, A., Kamiya, Y. and Yamaguchi, S., 2003. Gibberellin

PT

Biosynthesis and Response during Arabidopsis Seed Germination. Plant Cell 15, 1591-1604. Payyavula, R.S., Tay, K.H., Tsai, C.J. and Harding, S.A., 2011. The sucrose transporter family in Populus:

RI

the importance of a tonoplast PtaSUT4 to biomass and carbon partitioning. The Plant Journal 65, 757-770.

SC

Poovaiah, C.R., Mazarei, M., Decker, S.R., Turner, G.B., Sykes, R.W., Davis, M.F. and Stewart, C.N., 2015. Transgenic switchgrass (Panicum virgatum L.) biomass is increased by overexpression of switchgrass sucrose synthase (PvSUS1). Biotechnology journal 10, 552-563.

NU

Quinn, J.M., Eriksson, M., Moseley, J.L. and Merchant, S.S., 2002. Oxygen Deficiency Responsive Gene Expression inChlamydomonas reinhardtii through a Copper-Sensing SignalTransduction Pathway. Plant Physiology 128, 463-471.

MA

Quinn, J.M. and Merchant, S., 1995. Two copper-responsive elements associated with the Chlamydomonas Cyc6 gene function as targets for transcriptional activators. Plant Cell 7, 623-628.

Riesmeier, J.W., Willmitzer, L. and Frommer, W.B., 1994. Evidence for an essential role of the sucrose

D

transporter in phloem loading and assimilate partitioning. The EMBO Journal 13, 1. Ruan, Y.-L., Llewellyn, D.J. and Furbank, R.T., 2001. The control of single-celled cotton fiber elongation

PT E

by developmentally reversible gating of plasmodesmata and coordinated expression of sucrose and K+ transporters and expansin. The Plant Cell 13, 47-60. Ruan, Y.L. and Furbank, R.T., 2003. Suppression of sucrose synthase gene expression represses cotton fiber cell initiation, elongation, and seed development. Plant Cell 15, 952-64.

CE

Russell, D., 1990. Maize Sucrose Synthase-1 Promoter Directs Phloem Cell-Specific Expression of Gus Gene in Transgenic Tobacco Plants. Proceedings of the National Academy of Sciences of the United States of America 87, 4144-8.

AC

Sakr, S., Noubahni, M., Bourbouloux, A., Riesmeier, J., Frommer, W.B., Sauer, N. and Delrot, S., 1997. Cutting, ageing and expression of plant membrane transporters. Biochimica Et Biophysica Acta 1330, 207-16. Salnikov, V.V., Grimson, M.J., Delmer, D.P. and Haigler, C.H., 2001. Sucrose synthase localizes to cellulose synthesis sites in tracheary elements. Phytochemistry 57, 823-833. Shi, Y., Wang, M., Powell, K., Van Damme, E., Hilder, V., Gatehouse, A., Boulter, D. and Gatehouse, J., 1994. Use of the rice sucrose synthase-1 promoter to direct phloem-specific expression of β-glucuronidase and snowdrop lectin genes in transgenic tobacco plants. Journal of Experimental Botany 45, 623-631. Shirsat, A., Wilford, N., Croy, R. and Boulter, D., 1989. Sequences responsible for the tissue specific promoter activity of a pea legumin gene in tobacco. Molecular and General Genetics MGG 215, 326-331.

ACCEPTED MANUSCRIPT Singer, S.D., Hily, J.M. and Cox, K.D., 2011. The sucrose synthase-1 promoter from Citrus sinensis directs expression of the β-glucuronidase reporter gene in phloem tissue and in response to wounding in transgenic plants. Planta 234, 623-637. Srivastava, A.C., Ganesan, S., Ismail, I.O. and Ayre, B.G., 2008. Functional Characterization of the Arabidopsis AtSUC2 Sucrose/H⁺ Symporter by Tissue-Specific Complementation Reveals an Essential Role in Phloem Loading But Not in Long-Distance Transport. Plant Physiology 148, 200-11. Tamura, K., Stecher, G., Peterson, D., Filipski, A. and Kumar, S., 2013. MEGA6: molecular evolutionary genetics analysis version 6.0. Molecular biology and evolution 30, 2725-2729.

PT

Toyofuku, K., Umemura, T.-a. and Yamaguchi, J., 1998. Promoter elements required for sugar-repression of the RAmy3D gene for α-amylase in rice. FEBS letters 428, 275-280.

RI

Truernit, E. and Sauer, N., 1995. The promoter of the Arabidopsis thaliana SUC2 sucrose-H+ symporter gene directs expression of beta-glucuronidase to the phloem: Evidence for phloem loading

SC

and unloading by SUC2. Planta 196, 564-70.

Truernit, E., Schmid, J., Epple, P., Illig, J. and Sauer, N., 1996. The sink-specific and stress-regulated Arabidopsis STP4 gene: enhanced expression of a gene encoding a monosaccharide

NU

transporter by wounding, elicitors, and pathogen challenge. The Plant Cell 8, 2169-2182. Wei, Z., Qu, Z., Zhang, L., Zhao, S., Bi, Z., Ji, X., Wang, X. and Wei, H., 2015. Overexpression of Poplar Xylem Sucrose Synthase in Tobacco Leads to a Thickened Cell Wall and Increased Height. Plos

MA

One 10, e0120669.

Weschke, W., Panitz, R., Sauer, N., Wang, Q., Neubohn, B., Weber, H. and Wobus, U., 2000. Sucrose transport into barley seeds: molecular characterization of two transporters and implications for seed development and starch accumulation. Plant Journal 21, 455-467.

D

Wiley, S.R., Kraus, R.J. and Mertz, J.E., 1992. Functional binding of the "TATA" box binding component of transcription factor TFIID to the -30 region of TATA-less promoters. Proceedings of the

PT E

National Academy of Sciences of the United States of America 89, 5814-5818. Young, K.S., Hwa‐Jee, C. and Thomas, T.L., 1997. Isolation of a novel class of bZIP transcription factors that interact with ABA-responsive and embryo-specification elements in the Dc3 promoter using a modified yeast one-hybrid system. Plant Journal 11, 1237-1251.

CE

Zhang, X., Henriques, R., Lin, S.S., Niu, Q.W. and Chua, N.H., 2006. Agrobacterium-mediated transformation of Arabidopsis thaliana using the floral dip method. Nat Protoc 1, 641-6. Zrenner, R., Salanoubat, M., Willmitzer, L. and Sonnewald, U., 1995. Evidence of the crucial role of

AC

sucrose synthase for sink strength using transgenic potato plants (Solanum tuberosum L.). Plant Journal 7, 97-107.

ACCEPTED MANUSCRIPT Tables and figures Tables Tab. 1. The gene-specific primers of BnSUS1 and BnSUT2 for cloning and qRT-PCR Sequence (5’-3’)

Name

ATGGGTGAGCGTGTCCTGA

BnSUS1

TCACTCGTCCACAGCAAGA ATGGCGGGACGGAACGACT

BnSUT2

PT

TTAGCCAAAGTGGAAACCGG AGCTCAACGGCCAATTCAGG

qBnSUS1

TGGTACGGGTCGATGTGGAA

RI

CCAATGTGTCAGCGAATGGG

qBnSUT2

GCGAAAACAACCAGGGAAGC

SC

TGGAAGAATCGGTAGGTTGG

GAPDH

GACGCCAAAAACAGTGACAG

NU

Tab. 2. The primers of UFW to isolate two promoter regions Sequence (5’-3’)

Name

GTCCAAGAGAAGCCGGATCA

pBnSUS1-2

ACCATGAAACACAACCATNNNNNNNNNN

pBnSUS1-3

GAGAGTGGCCAAATAGTCCTCG

pBnSUT2-1

MA

pBnSUS1-1

pBnSUT2-2

TGGTTGTCATTCATCTCTNNNNNNNNNN

pBnSUS1-4

ACCTTTCCTTTGTAGCAGTGAAC

D

GTCGTAGTTGTCGTTTGTTCCAG

pBnSUT2-4

PT E

pBnSUT2-3

AC

CE

* “N” represents any nucleotide (A, T, C or G).

GGTCGTCGTTTTCCGTTTTTTC CGCAGCTGTCGTTTTTACCTAG

ACCEPTED MANUSCRIPT Figure legends Fig. 1. Phylogenetic tree and exon-intron structure of BnSUS1 and BnSUT2. (a) Phylogenetic relationship between BnSUS1 and six homologous proteins of Arabipdosis. (b) Phylogenetic relationship between BnSUT2 and five homologous proteins of Arabipdosis. (c) The exon-intron structure of BnSUS1 and BnSUT2. The initiation codon (ATG) was marked on the left side of part c.

PT

Fig. 2. Quantification real-time PCR results of BnSUS1 and BnSUT2 in different tissues. (A) Relative transcription level of BnSUS1 in six different tissues or organs. (B) Relative transcription level

RI

of BnSUT2 in six different tissues or organs. The data were presented as the mean ± SE of three separate measurements. (C) Sampling of the three tissues section (Pith, Wood and Bark). Le, Leaf; Ve,

SC

Vein; Ba, Bark Pi, Pith; Wo, Wood; Ro, Root. Different lower case letters showed the significant difference among six tissues or organs (p<0.05). Bar=1 cm.

NU

Fig. 3. Schematic diagram of cis-acting elements and truncated fragments in the promoter region. (a) Schematic diagram of truncated BnSUS1pro-1690 fused GUS constructs and distribution of

MA

cis-acting elements. (b) Schematic diagram of truncated BnSUT2pro-2239 fused GUS constructs and distribution of cis-acting elements. The initiation codon was defined as +1. Different elements were

D

indicated by different color patches. The numbers on the left indicated the length of 5’-truncated

PT E

fragments.

Fig. 4. GUS staining in different developmental stages (1-day, 4-day, 7-day and 10-day after germination) of wild-type and transgenic Arabidopsis seedlings. CK- indicated wild-type; CK+

indicated

CE

indicated transgenic Arabidopsis seedlings carrying CaMV 35S promoter construct; A, A1, A2 and A3 transgenic

Arabidopsis

seedlings

carrying

BnSUS1pro-1690,

BnSUS1pro-1420,

AC

BnSUS1pro-1051 and BnSUS1pro-485 constructs, respectively; B, B1, B2 and B3 indicated transgenic Arabidopsis seedlings carrying BnSUT2pro-2239, BnSUT2pro-1681, BnSUT2pro-1199, BnSUT2pro-618 and BnSUT2pro-231 constructs, respectively; Bar=100 µm, 200 µm, 500 µm and 1 mm for 1 DAY, 4 DAY, 7 DAY and 10 DAY, respectively. Fig. 5.

GUS staining in different mature organs or tissues of wild-type and transgenic

Arabidopsis. CK- indicated wild-type; CK+ indicated transgenic Arabidopsis carrying CaMV 35S promoter construct; A, A1, A2 and A3 indicated transgenic Arabidopsis carrying BnSUS1pro-1690, BnSUS1pro-1420, BnSUS1pro-1051 and BnSUS1pro-485 constructs, respectively; B, B1, B2 and B3 indicated transgenic Arabidopsis carrying BnSUT2pro-2239, BnSUT2pro-1681, BnSUT2pro-1199,

ACCEPTED MANUSCRIPT BnSUT2pro-618 and BnSUT2pro-231 constructs, respectively; Fl, Flower; St, Stem; Si, Silique; Rl, Rosette leaf; Cl, Cauline leaf. Bar=1 mm. Fig. 6.

GUS staining and fluorescence activity detection in wounded mature leaves of

Arabidopsis carrying BnSUT2pro-2239 and its truncated fragments. CK represented unwounded leaves. MW represented mechanical wounding. The data were presented as the mean ± SE of three

PT

separate measurements. * indicated p<0.05, ** indicated p<0.01 and *** indicated p<0.001. Bar=1 mm.

GUS activity of transgenic Arabidopsis seedlings carrying BnSUS1pro-1690 and its

RI

Fig. 7.

truncated fragments construct under different stresses. The control indicated treatment with dH2O.

SC

a, b, c, and d denoted GUS activity of Arabidopsis seedlings carrying BnSUS1pro-1690, BnSUS1pro-1420, BnSUS1pro-1051 or BnSUS1pro-485 construct under Sucrose, CuSO4, ABA or IAA

NU

treatments, respectively. The data were presented as the mean ± SE of three separate measurements for each independent line. * indicated p<0.05 and ** indicated p<0.01. GUS activity of transgenic Arabidopsis seedlings carrying BnSUT2pro-2239 and its

MA

Fig. 8.

truncated fragments construct under different stresses. The control indicated treatment with dH2O.

D

a, b, c, and d denoted GUS activity of Arabidopsis seedlings carrying BnSUT2pro-2239,

PT E

BnSUT2pro-1681, BnSUT2pro-1199, BnSUT2pro-618 or BnSUT2pro-231 construct under Sucrose, PEG, ABA or GA3 treatments, respectively. The data were presented as the mean ± SE of three separate

AC

p<0.001.

CE

measurements for each independent line. * indicated p<0.05, ** indicated p<0.01 and *** indicated

ACCEPTED MANUSCRIPT Abbreviation SUS, sucrose synthase; SUT, sucrose transporter; UFW, Universal Fast Walking; GUS, beta-glucuronidase; PCR, polymerase chain reaction; qRT-PCR, quantitative real-time PCR,

AC

CE

PT E

D

MA

NU

SC

RI

PT

1/2 MS, 1/2 Murashige and Skoog medium.

ACCEPTED MANUSCRIPT Highlights

PT RI SC NU MA D PT E

 

CE



The sucrose synthase 1 (SUS1) and sucrose transporter 2 (SUT2) genes were firstly investigated in ramie. Isolating the promoters of BnSUS1 and BnSUT2 genes by Universal Fast Walking for the first time The functions of the two promoters were analyzed in detail in Arabidopsis. BnSUS1pro with vascular tissue specificity and BnSUT2pro with strong response to wounding have potential applications in plant genetic engineering.

AC



Figure 1

Figure 2

Figure 3

Figure 4

Figure 5

Figure 6

Figure 7

Figure 8