Isolation and properties of cDNA clones encoding SRF, a transcription factor that binds to the c-fos serum response element

Cell, Vol. 55, 989-1003,

December

23, 1988,

Copyright

0 1988 by Cell Press

Isolation and Properties of cDNA Clones Encoding SRF, a Transcription Factor That Binds to the c-fos Serum Response Element Christine Norman;‘ Mike Runswick,’ Roy Pollock:t and Richard Treisman’t Laboratory of Molecular Biology MRC Centre Hills Road Cambridge CB2 2QH, England t Imperial Cancer Research Fund I? 0. Box 123 Lincoln’s Inn Fields London WCPA 3PX, England ??

The serum response element (SRE) is a sequence required for transient transcriptional activation of genes in response to growth factors. We have isolated cDNA clones encoding serum response factor (SRF), a ubiquitous nuclear protein that binds to the SRE. The SRF gene is highly conserved through evolution, and in cultured cells its transcription is itself transiently increased following serum stimulation. A cDNA clone of SRF expressed in vitro generates protein that forms complexes indistinguishable from those formed with HeLa cell SRF, as judged by DNA binding specificity and the ability to promote SRE-dependent in vitro transcription. SRF binds DNA as a dimer, and the DNA binding/dimerizaGon domain of the protein exhibits striking homology b two yeast regulatory proteins. Introduction When susceptible cells are stimulated with growth factors or mitogens, expression of a large number of genes is stimulated without the need for prior protein synthesis (see Almendral et al., 1988, and references cited therein). The proto-oncogene c-fos (Curran et al., 1983; for review see Curran, 1988) is one member of this cellular “immediate-early” gene family. Stimulation of fibroblasts with serum or purified growth factors increases the rate of c-fos transcription by up to 50-fold within 5 min of stimulation; however, this activation is transient and transcription rates return to prestimulation levels within 30 min (Greenberg and Ziff, 1984). This results in the transient accumulation of large amounts of unstable c-fos mRNA and protein (Greenberg and Ziff, 1984; Kruijer et al., 1984; Mijller et al., 1984). Gene transfer studies have shown that serum-inducible transcriptional activation of the c-fos gene is dependent on the serum response element (SRE), a short sequence of dyad symmetry that is located 300 base pairs (bp) to the 5’side of the site of transcription initiation (Treisman, 1985, 1986; Gilman et al., 1986; Greenberg et al., 1987). The SRE is required for induction of c-fos transcription by activators of protein kinase C (Fisch et al., 1987; Gilman, 1988; Buscher et al., 1988), EGF (Fisch et al., 1987), PDGF (Gilman, 1988; Buscher et al., 1988), and insulin (Stump0 et

al., 1988). SRE sequences are also found in the promoters of other cellular immediate-early genes, such as those encoding cytoskeletal actins (Mohun et al., 1987; Greenberg et al., 1987) and two potential DNA binding proteins (Chavrier et al., 1988). The SRE was initially identified as the binding site for a ubiquitous nuclear protein, termed serum response factor (SRF; Treisman, 1986). Photoactivated protein-DNA cross-linking studies identified a 67 kd polypeptide present in nuclear extracts that has the sequence specificity of SRF, and DNA-affinity purified HeLa cell SRF preparations are predominantly composed of a 67 kd polypeptide (Treisman, 1987). SRE binding proteins purified by other groups are also M, 62-67 kd polypeptides and probably also represent SRF (Prywes and Roeder, 1987; Schroter et al., 1987). The SRE is not involved in the induction of c-fos transcription by elevation of intracellular cyclic AMP or calcium levels (Fisch et al., 1987; Gilman, 1988; Sheng et al., 1988; Buscher et al., 1988); these stimuli possibly act via other transcriptional regulatory elements located elsewhere in the c-fos promoter (Gilman et al., 1986; Fisch et al., 1987; Hayes et al., 1987; Piette and Yaniv, 1987). For several reasons, the precise role of SRF in seruminduced activation of transcription has remained unclear. First, although SRF binding in vitro does appear to correlate with SRE activity in vivo (Treisman, 1986,1987; Greenberg et al., 1987; Fisch et al., 1987; Gilman, 1988), such correlation does not provide direct evidence that SRF mediates the regulation. Second, in addition to its function as an inducible promoter element, the SRE also has a basal constitutive activity associated with it that is also eliminated by mutations that block SRF binding (Mohun et al., 1987; Treisman, 1987). Third, a number of musclespecific genes, including those encoding the cardiac and skeletal muscle actins, contain the SRE-related element CC(A/QGG (the “CArG box”; Minty and Kedes, 1986). Recent studies have shown that the CC(A/l)GGG and the SRE are functionally interchangeable, and the CC(A/T)eGG element binds SRF in vitro, albeit weakly (Taylor et al., submitted). Fourth, when extracts of stimulated cells are compared with those from nonstimulated cells, no change in SRE-SRF interactions is detectable in many cell types (Treisman, 1986; Gilman et al., 1986; Prywes and Roeder, 1986), although in EGF-stimulated A431 cells, an increase in binding activity has been reported (Prywes and Roeder, 1966). To allow the examination of the properties of SRF in more detail, we have isolated cDNA clones encoding the protein. This paper describes the structure of these clones and the properties of SRF produced in vitro from SRF cRNA. Results Isolation of SRF cDNA Clones SRF was purified from HeLa cells by preparative scale affinity chromatography as previously described (Treisman, 1987), fragmented by cyanogen bromide cleavage, and

Cell 990

Table Peptide

1.

Sequences

Obtained

from

Cyanogen

Bromide

Fragments

of HeLa

SRF

Sequence

Oligonucleotides

CB13

YPSPOAV

-

CB20

AVlGQQAGSSSNLTELQVVNLxxAP

CAGGCCATCCAGGTGCATCAGGCCCCCCAGCAGGC GTAATTGGACAACAAGC G C G G C A C T T

CB22

PGGAVAQGVPVQAIQVHQAPQQASP

The sequences obtained from cyanogen bromide fragments dures The probes used for initial screening of the library

ATTCAAGTACATCAAGC C G G C A C T

(192) G

(96) G

of HeLa SRF are shown; for details of three misassignments, see Experimental are shown with the degree of redundancy of the pool probes in parentheses.

the resulting peptides recovered and subjected to microscale protein sequence analysis. The partial SRF amino acid sequence data was used to generate two degenerate sets of oligonucleotide probes and a “guessmer” oligonucleotide probe, shown in Table 1. Screening of a human placental cDNA library identified a phage X8.2.2, that hybridizes to all three probes. DNA sequence analysis using the oligonucleotide pools as primers confirmed that the protein sequence adjoining the priming site in the clones matches the determined polypeptide sequence adjoining the probes in SRF protein (compare Table 1 with Figure 2). The insert from h8.2.2 was used to isolate additional clones from the library (Figure 1). One of these, h2.9, was confirmed as SRF by the following functional criteria: in vitro translation of this cDNA gives rise to DNA binding activity specific for the c-fos SRE; complexes formed between this polypeptide and the SRE are recognized by a mouse polyclonal anti-SRF antibody (data not shown; see below). The SRF cDNAs fall into two classes, representing mRNAs that differ in the lengh of the 3’ untranslated region (see Figure 1). We were unsuccessful in recovering complete clones (as judged from the lengths of SRF mRNAs) from this library or from a HepG2 cDNA library. The HepG2 SRF cDNA clone lHl0 represents the 3’ end of the longer mRNA (Figure 1); however, the majority of cDNAs from the HepG2 library have 5’ endpoints clustered in the region just 5’to the end of clone X2.9, probably owing to the high GC content of this DNA (see below). To localize the 5’ end of SRF mRNAs, we performed a primer extension experiment using a primer derived from the 5’ end of clone X2.9 (see Figure 2); this showed that the 5’ end of HeLa cell SRF mRNA is located approximately 650 nucleotides upstream of the 5’ end of clone h2.9 (data not shown). We used this primer to prepare a primed cDNA library from serum-stimulated HeLa cell mRNA; the longest recovered cDNA, h451.25, is shown in Figure 1, and the endpoints of several colinear extended primer clones are shown in Figure 2. Sequence Analysis of SRF cDNAs The cDNA clones 12.9, hHl0, hH454.9, and h451.25 were sequenced by the chain termination method. Apart from a sequence polymorphism in the 3’ untranslated region observed between clones hH10 and X2.9, no sequence

Proce-

differences were noted between overlapping regions of different cDNAs. The deduced complete sequence of SRF cDNA is shown in Figure 2. The longest SRF mRNA is predicted to contain a long GC-rich 5’ untranslated region. Stop codons are present in two reading frames in this region, the third reading frame remaining open until 40 codons into the main predicted reading frame, but lacking an initiation codon. The first ATG is at nucleotide 293 but is followed by an in-frame termination codon at position 326; a second ATG follows in the same frame at nucleotide 359. Previous studies predict that initiation will occur at the second ATG (Kozak, 1986). The principal open reading frame encodes a polypeptide of predicted M, 51,593. The 3’ untranslated regions are of lengths 769 nucleotides (short form) and 2318 nucleotides (long form). Both polyadenylation sites are preceded by polyadenylation signals (Proudfoot and Brownlee, 1976), that used for the short form mRNA containing one base mismatched to the consensus sequence. The 3’untranslated region does not score highly on protein coding prediction analysis and contains no apparent open reading frames. Overall, the GC content of the mRNA is 60.8%; however, at the 5’ end of the mRNAs the GC content is higher, with the 5’ untranslated region containing 79% GC. The SRF Gene Is Itself Regulated by Serum To ascertain the size of the SRF mRNAs, we fractionated total HeLa cell RNA on denaturing gels and probed transfers using the insert from clone X8.2.2. HeLa cells contain two SRF mRNAs of estimated lengths 4500 nucleotides and 2900 nucleotides (Figure 3A, lane 1). It is likely that other cell types contain the same two species of mRNA, since the cDNA clones recovered from placenta and HepGP cells also represent these two types. Since the SRF gene product is implicated in growth factor-regulated transcription, we examined the transcription of the SRF gene following serum stimulation. Although SRF RNAs are readily detectable in cells deprived of serum for 48 hr serum readdition results in an approximately 5-fold increase in SRF RNA abundance (Figure 3A, lanes l-l 0). This increase does not require protein synthesis, and induction in the presence of protein synthesis inhibitors such as cycloheximide results in a modest superinduction of SRF RNA (Figure 3A, compare lanes 5-7 with lanes

Characterization 991

mRNAs

of SRF

4.5kb _

AAAA

Figure 1. SRF cDNA mRNA Structures

Clones

and

Deduced

The structures of the two SRF mRNAs are shown at the top, with the open reading frame shown as an open box and the uncertainty at the 5’ end of the mRNA indicated by a dash. Below are shown the cDNAs discussed in the text. A number of cDNAs recovered from the HepGP libarary that span the main body of the messages are not shown. The primer used for generation of 1451.25 is shown as a bar.

a-10). Early during the induction, an additional pair of transcripts about 10 kb in length is detectable (Figure 3A, lanes 2-4). These RNAs probably represent unspliced precursors of the SRF mRNAs for two reasons: first, they are detected at a stringency at WI ,ich no non-SRF bands are visible in Southern transfer hybridizations; second, the size of the SRF transcription unit is also 10 kb (R. Pollock, unpublished data). These results indicate that the SRF gene is itself transcriptionally regulated by serum factors and is a member of the cellular immediate-early gene family. Conservation of the SRF Gene To examine the degree of conservation of the SRF gene, we washed Southern transfer hybridizations at various degrees of stringency. Analysis of human, monkey, mouse, frog, fly, and yeast (S. cerevisiae) DNA is shown in Figure 36. In this experiment, we used a probe consisting of the 5’half of clone h2.9, since probes containing the 5’ 500 nucleotides of the cDNA gave very high backgrounds of nonspecific hybridization owing to their high GC content. At high stringency (0.1x SSC, SO%), three EcoRl fragments are visible with human, monkey, and mouse DNA (Figure 36, lanes 1, 3, and 5). Analysis of genomic DNA clones of human SRF reveals that the detected fragments are contiguous in the genome and represent fragments of a single copy SRF gene (R. Pollock, unpublished data). At reduced stringency (2x SSC, SO%), SRF-related sequences are detectable in fly and frog DNA, but not in yeast (Figure 36, lanes 2, 4, and 6). Under these relaxed conditions, a number of weakly hybridizing human DNA fragments are visible, partially obscured by background (Figure 38, lane 5). Studies with shorter probes indicate that these bands do indeed represent potential SRF-related sequences (R. Pollock, unpublished data; see Discussion). Expression of SRF by In Vitro Translation To verify the predicted reading frame encoding SRF, we carried out in vitro translation experiments. A “full-length” SRF cDNA clone was reconstructed from clones x451.25, hH454.9, and 12.9 and placed 3’ to a bacteriophage T7

promoter. Translation of cRNA synthesized in vitro from this plasmid in a reticulocyte cell free translation system is shown in Figure 4A, lane 2. A polypeptide of M, ~62,000 was visible upon long fluorographic exposure. We reasoned that the inefficient translation might be due to the long GC-rich untranslated region and therefore examined the expression of SRF from templates truncated to position 185 or 350. Both of these templates direct the synthesis of the 62 kd polypeptide, confirming that the initiator codon in these messages must indeed be that at nucleotide 359 (Figure 4A, compare lanes l-3). Although these templates allow a substantial increase in SRF synthesis in vitro, we further increased SRF expression by use of plasmid pT7AATG, in which the SRF 5’ untranslated sequences are replaced by those of the human f3-globin gene. Transcripts from this plasmid direct the synthesis of 50- to lOO-fold more SRF than the intact SRF cRNA (Figure 4A, compare lane 4 with lane 1). To verify the position of the termination codon, we translated 3’ truncated SRF cRNAs, which confirmed that, as predicted, translation termination must occur between nucleotides 1655 (Xmnl) and 1970 (Hincll) (data not shown). The in vitro translation products from the various plasmids were tested for their ability to bind to the SRE in the experiment shown in Figure 48. The amount of SRE binding activity increased in proportion ot the amount of 62 kd polypeptide generated in the translation reactions (Figure 48, lanes l-4) and forms a complex of similar mobility to that formed between the same SRE probe and purified HeLa cell SRF (Figure 48, compare lanes l-4 and H). In addition, we confirmed that both cloned SRF and HeLa SRF form complexes that are recognized by a polyclonal antiserum raised against affinity purified HeLa SRF (Figure 48, lanes 5-8; G. Evan and R. Treisman, unpublished data). of SRF Produced In Vitro Binding Specificity The binding specificity of both crude and purified SRF has been extensively evaluated in binding assays by competition studies using SREs of widely different affinity (Mohun et al., 1987; Treisman, 1987). To test whether the SRF specified by the cDNA clones exhibits a similar sequence

Cell 992

Characterization 993

A

of SRF

SERUM

I 0

,

+ CHX

B

Eksc

1530456090120’60

23.1 *

9.42

L-

6.56 *

1c

4.36 )

28s

18s

.

123456789x) Figure

3. SRF Gene

Expression

123456 and Evolutionary

123456

Conservation

(A) Regulation of the gene by serum growth factors. The hybridization probe in these experiments was the 18.2.2 insert. HeLa cells were serum starved for 48 hr, restimulated with serum, and SRF mRNA analyzed at various times thereafter by gel electrophoresis. The positions of 28s and 18s ribosomal RNA are indicated. The two principal SRF mRNAs and their putative precursor are indicated by M and P respectively. (6) Conservation of the SRF gene. The hybridization probe in these experiments was the C-terminal half of the SRF coding region, nucleotides 802-1970. DNA (IO ng) from monkey (CVl cells; lane l), Drosophila (Schneider cells; lane 2) mouse (3T8 cells; lane 3) Xenopus (XLKE cells; lane 4) human (HeLa cells; lane 5) and yeast (S. cerevisiae; lane 8) was digested with EcoRl and fractionated by gel electrophoresis. SRF fragments were detected by hybridization after transfer to nitrocellulose. Washing conditions are indicated above the figure, and molecular weight markers are to the left.

specificity, we produced SRF in vitro from the high efficiency pT7AATG template, formed complexes with a cloned c-fosH SRE, and performed binding competition assays, shown in Figure 5. In vitro synthesized SRF recognizes the variant sites in the order ACT.L 9 ACT.D > F0S.D (see Mohun et al., 1987; Treisman, 1987). Site B ACT.R ACT.L’, to which binding of SRF cannot be detected in vitro or in vivo (Treisman, 1987) does not compete detectably for binding. In addition, a fragment of the Xenopus cardiac actin gene, which contains an SRE-related CC(A/T)eGG sequence and which can bind pure SRF with a low affinity (Taylor et al., submitted), also has a low affinity for SRF sythesized in vitro (Figure 5, lanes 21-24). We conclude that the binding specificity of cloned SRF is identical to that of the native HeLa cell protein. SRF Synthesized In Vitro Activates Transcription We previously reported that the SRE acts as a constitutive as well as an inducible promoter element (Mohun et al., 1987). As a first step towards reconstructing serum regulated transcription in vitro, we set up an in vitro transcription system in which this constitutive effect of the SRE can be reproduced. Two templates, based on the plasmids

Figure

2. Deduced

Sequences

of SRF cDNA

pA48CAT and pA48FOS (Mohun et al., 1987) are used in each reaction. These templates contain a Xenopus laevis cytoskeletal gene TATA box and 48 bp of 5’ flanking sequence fused to the c-fosH or CAT transcription units, respectively. In each reaction, the FOS template is left unchanged and is used as a reference template, while the CAT template is varied by insertion of various SRE sequences at the Sside of the TATA box. A primer extension assay, in which transcripts of each template generate extension products of different lengths, is used to monitor the levels of correctly initiated transcript. Figure 5A shows the results obtained using a HeLa cell system in which endogenous SRF protein is present. Addition of a high affinity SRE to the A48CAT template causes a marked increase in transcript yield relative to the reference transcript, while addition of the mutated SRE ACT.C has no effect (Figure 8A, lanes l-3). When variant SREs derived from the actin SRE are used, the degree of transcriptional stimulation varies according to binding affinity (data not shown; Norman and Treisman, 1988). Affinity chromatography of the appropriate extract fraction on ACTL (SRE) Sepharose allows the specific removal of SRF, but not other proteins, from the extract (Treisman,

and Protein

The complete SRF cDNA sequence, deduced from cDNA clones 12.9. M51.25, A454.9, and 1H9, is shown, with endpoints of cDNA clones indicated by arrows. The B’endpoints of three other primer extended cDNAs analyzed are indicated by arrowheads. The three peptides obtained by sequence analysis of purified SRF are underlined. Homology to the consensus optimal translation initiation site is underlined, as are the two poly(A) addition signals. Clone lHl0 lacks a G at nucleotide 3352. The GenSank accession number for this sequence is J03181.

Cell 994

A.

6. CGMPLEX

SDS GEL

Hl

0 1234~

GELS

234H

56

78

1-14 Figure 4. Production Reticulocyte Lysate

of SRF

by In Vitro

Translation

m the

Rabbrt

(A) Effect of 5’ untranslated sequences on expression. Lanes 1-3. translation of SRF cRNA containing different lengths of 5’untranslated sequence; 2 fd were analyzed in each lane. Lane 1, 358 nucleotides (pG3.5); lane 2, 174 nucleotides (pG3.3); lane 3, 8 nucleotides (pG3.1); lane 4. SRF cRNA from pT7AATG. in which the 6-globin Suntranslated region replaces that of SRF. Lane 0, no added template. Lane M. 14Cmethylated markers of indicated M,. (6) Complexes formed by SRF produced in vitro. Lanes 1 and 4, analysis of complex yield from translation reactions in part (A); lane numbers correspond. One microliter was analyzed per lane, using the ACT.L (high affimty SRE) binding probe. Lane H. purified SRF from HeLa cells. Lanes 5-6. reaction of SRF with antibody raised agamst purified SRF. Lanes 5 and 6. 1 ul of SRF produced rn vitro from pT7hATG template; lanes 7 and 6. HeLa cell SRF. Lanes 5 and 7, plus 1 ul of preimmune serum; lanes 6 and 8. plus 1 ul of 1:iO diluted anti-SRF serum. Free probe (F) and complex (C) are indicated.

1987). The basal level of in vitro transcription is unaffected by SRF depletion; however, in depleted extracts, neither intact nor mutant SREs affect transcription (Figure 6A, lanes 4-6). Addition of purified HeLa cell SRF restores SRE-dependent in vitro transcription, demonstrating that SRF is a positively acting transcription factor (Figure 6A, lanes 7-10). We next tested whether SRF synthesized in vitro is active in this system. Aliquots of reticulocyte lysate were either mock-incubated or programmed with pT7AATG cRNA, then added to SRF-containing and SRF-depleted in vitro transcription reactions. Addition of mock-incubated lysate has no effect on transcription either in the intact or SRF-depleted in vitro transcription reaction (Figure 66, lanes l-4). In contrast, when lysate programmed with SRF cRNA is added, SRE-dependent in vitro transcription is restored to normal levels (Figure 6B, compare lanes 5 and 6 with lanes 1 and 2). The amount of in vitro synthesized SRF protein required for maximal in vitro transcription levels is commensurate with the amount required to saturate binding to the SRE (data not shown). These results show that, at least in the constitutive in vitro transcription assay, functional SRF is produced in vitro.

Characterization of the SRF DNA Binding Region To delineate the sequences required for SRF to bind DNA, we constructed a set of deleted cDNA derivatives, each linked in-frame to the human S-globin gene Yuntranslated region and initiation codon and placed to the 3’side of a T7 promoter. After translation in vitro, the SRF deletion derivatives were incubated with an SRE probe in the presence of a 104-fold excess of pUC12 competitor DNA, and complex formation was analyzed by gel electrophoresis. The results are shown in Figure 7A. Truncation at the C-terminal side showed that an SRF fragment containing residues 82-264 exhibits virtually normal binding; further truncation to position 245 substantially reduces binding affinity (Figure 7A, compare lanes 1 and 2). Further deletions that truncate the protein to residue 222 have little effect, but removal of a further eight amino acids essentially abolishes specific binding (Figure 7A, lanes 3-6; see also Figure 8B). Truncation at the N terminus showed that an SRF fragment comprising residues 82-508 exhibits normal binding. Further truncation to generate a fragment comprising residues 133-508 has no effect on binding; removal of nine more N-terminal amino acids, however, generates a polypeptide containing amino acids 142-508 that fails to show specific binding under our assay conditions (Figure 7A, lanes 7-15). To test whether the short segment of SRF with borders defined by the deletion analysis was sufficient for DNA binding, we synthesized a short polypeptide containing SRF amino acids 133-222. This fragment retains the ability to bind specifically to the SRE, albeit with reduced affinity (Figure 7A, lanes 16 and 17). These experiments do not address the question of whether SRF binds DNA as a multimer. To test whether this is the case, long and short forms of SRF, both of which retain DNA binding activity, were translated either separately or simultaneously; after binding to an SRE probe, complexes were analyzed by gel electrophoresis. In this assay, heterodimers or higher multimers will migrate with mobility intermediate between that of the long and short forms alone (Hope and Struhl, 1987). Mixing of long and short forms of the protein after separate translation in vitro generates two forms of SRF-SRE complex, as would be expected if the protein existed as a monomer or stable multimer in solution (Figure 78, lanes l-3). In contrast, simultaneous translation of long and short forms generates a third complex of intermediate mobility in addition to the complexes characteristic of the separate SRF derivatives (Figure 78, compare lanes 3 and 4). The mobility of the intermediate complex is dependent on the sizes of the SRF derivatives used (data not shown). These data demonstrate that SRF exists in solution and binds DNA as a multimer, most probably a dimer. We adapted this dimerization assay to locate the region of the protein involved. In this “dimerization interference” assay, a large excess cRNA encoding the deletion mutant under test is cotranslated with a small quantity of cRNA encoding an SRF “indicator” polypeptide, which shows normal dimerization and binding capability. If the deletion under test is capable of forming stable dimers with the indicator derivative, virtually no indicator homodimer is

Characterization 995

of SRF

ACT.D

PCT.L

COMPETITOR:

ACT.L*

FOLD

‘-52o1odI_52o1odI-52o1odI-

EXCESS:

FCSD

ACT.R

Box1

‘-

‘-

Figure 5. Binding In Vitro

9tO1112

5676

13141516

17 18820

of SRF Produced

Complexes were formed between SRF produced by translation of pT7DATG template (1 ml) and a probe containing the c-fosu SRE in the presence of variant SRE competitors ACT.L’ (lanes l-4) ACT.L (lanes 5-8) ACT.D (lanes 9-W) FOSD (lanes 13-16) ACT.R (lanes 17-20), and BOX1 (lanes 21-24). Each set of lanes shows complex yield in the presence of no competitor (lanes I, 5, 9, 13, 17, and 21) or B-fold (lanes 2, 6, IO, 14, 18, and 22) 20fold (lanes 3. 7, 11, 15, 19, and 23) and lOO-fold (lanes 4, 8, 12, 16, 20, and 24) competitor excess. Free probe (F) and complex (C) are indicated.

Y

1234

Specificity

21222324

B.

A.

EXTRACT:

EXTRACT:

I

PURE SPF:

SRF-

SRF+

-

-

I +

r-r-

SRF+ -r

LYSATE:

++

SRF-

S&F+

sRF+ r--%

L* L

L* L

L* L

L* L

I-ACAT

A.CAT SRE:

SRE:

I

-

,. ,’

+ _.

. AFOS

+:;

M Figure

123

6. In Vitro Transcription

456 Assay

789

to

12

34

56

78

M

for SRF

Reactions contained two templates containing the X. laevis y-actin TATA box fused either to the c-fosn (A.FOS) or the CAT (A.CAT) transcription units. Primer extension products specific to the A.FOS and ACAT templates are indicated by arrows. (A) Activity of purified HeLa cell SRF. Extracts either contained SRF (lanes l-3) or were depleted of SRF (lanes 4-10). Purified HeLa cell SRF was added to reactions in lanes 7-10: lanes 7-9 contained 1 ul, and lane 10, 3 ul. The ACAT template was varied by the addition of the following SRE sequences: lanes 1, 4, 7, and 10, ACT.L (high affinity); lanes 2, 5, and 8, ACT.L’ (nonbinding mutant); lanes 3, 6, and 9, no SRE. (6) Transcription activity of SRF produced in vitro. Extracts contained endogenous SRF (lanes 1 and 2) or were depleted of SRF (lanes 3-8). All reactions contained 3 ul of reticulocyte lysate, either mock incubated (lanes 1-4) or programmed with SRF cRNA from pT7BWG (lanes 5 and 6, 1 ul; lanes 7 and 8, and 2 ~1). Templates were A.FOS (reference; lanes l-8) and ACAT, carrying the high affinity ACT.L SRE (lanes 1, 3, 5, and 7) or the nonbinding derivative ACT.C (lanes 2, 4, 6, and 8).

formed; in contrast, a test derivative that cannot form stable dimers will not interfere with the formation of indicator homodimers. The application of this assay to SRF N-terminal truncations in shown in Figure 8A. SRF derivatives encoding residues l-508, 122-508, and 133-508 all prevent formation of appreciable levels of indicator homodimer (SRF polypeptide 82-264; Figure 8A lanes 2-4). In addition, two further nonbinding SRF truncations encoding residues 142-508 and 188-508 behave similarly, indicating that these derivatives retain the capacity to form stable dimers. However, truncations encoding residues

177-508, 180-508, and 190-508 all fail to prevent formation of the indicator homodimer (Figure 8A, lanes 8-10) indicating that a region essential for dimerization lies to the C-terminal side of position 168. Figure 8B shows a similar experiment using SRF C-terminal truncations, with a small amount of intact SRF used as indicator. In this case, the results are more complex. Truncations that lower binding affinity but do not abolish binding altogether generally show no reduction in dimerization capability (Figure 88, lanes 1-4; note that derivative 82-234 exhibits reduced capability). However, truncation to position 214,

Cell 996

123456 Figure

7. DNA Binding

by SRF Derviatives

(A) Mapping the SRF DNA binding region. SRF derivatives were produced in vitro by translation of the appropriate template, and 1 ul of each was tested for its ability to bind the ACTL SRE probe. The extent of SRF sequence in each mutant is indicated above the figure. Lanes 1-6, C-terminal truncations; lanes 7-15, N-terminal truncations; and lanes 16 and 17, minimal DNA binding fragments. (B) SRF binds as a dimer. “Long” (SRF residues 82-508) and “short” (SRF residues 82-245) forms of SRF were translated separately or together and tested for complex formation with a c-fos” SRE probe. Lane 1, 1 ul of long form; lane 2. 1 ul of short form; lane 3, 0.5 ul of each form mixed after translation; and lane 4, 1 pl of each form translated together. The positions of long/long homodimers, long/short heterodimers, and short/short homodimers are indicated by LL, LS, and SS, respectively, and free probe by F.

which causes a further marked drop in binding affinity (see Figure 7 lanes 4 and 5) prevents formation of stable heterodimers with the test gene (Figure 86, compare lanes 4 and 5). Taken together, these results indicate that residues 168-222 are required for formation of stable SRF dimers. Discussion Isolation of SRF CDNA Clones In this paper, we describe the isolation and properties in vitro of cDNA clones encoding serum response factor (SRF), a ubiquitous nuclear protein that binds to the serum response element (SRE), a dyad symmetry element that mediates transient transcriptional activation of a number of genes by growth factors. The cDNA clones are identified as encoding SRF since they encode a polypeptide that: contains peptides found in native HeLa cell SRF preparations; cross-reacts with antibodies raised against purified SRF; binds to DNA with the same sequence specificity as SRF; and activates SRE-dependent transcription in vitro. The SRF gene is highly conserved through evolution, and it appears that other SRF-related genes are present in the genome. The SRF protein coding region encodes a polypeptide of predicted molecular mass 51,593. Comparison of the predicted SRF DNA and protein sequence with the sequence databases revealed no significant alignments of SRF with known proteins, apart from a region of homology, discussed below, between the DNA binding region and part of the yeast MCMl (FUN80) and ARG80 (ARGRI)

genes (Dubois et al., 1987a, 1987b; Passmore et al., 1988). Overall, the protein is rich in serine (64/508 residues), threonine (59/508), proline (37/508), and glutamine (28/ 508). Proline, serine, and threonine are also abundant in short-lived proteins such as Fos and ElA (“PEST” proteins; reviewed by Rechtsteiner et al., 1987). However, we do not yet know whether SRF falls into this category. The SRF sequences N-terminal to the DNA binding region (Figure 9A; residues l-140) are very rich in glycine and alanine (34 and 24 residues, respectively), while the region to the C-terminal side of the DNA binding region (residues 223-508) is especially rich in serine and threonine (47 and 36 residues out of 286). The SRF produced by translation of SRF cRNA in vitro is of apparent M, ~62,000, in contrast to the 67,000 estimated for SRF purifed from HeLa cells (Treisman, 1987). Although molecular mass estimates for SRFvary between 62 kd and 67 kd, we feel it is likely that the discrepancy arises from differences in modification of SRF produced in vitro compared with native SRF; in contrast to SRF produced in vitro, HeLa cell SRF migrates as a diffuse band in SDS gels. A number of eukaryotic transcription factors are known to be phosphorylated and/or glycosylated in vivo (e.g., Montminy and Bilezikjian, 1987; Sorger et al., 1987; Jackson and Tjian, 1988). Recent data indicate that SRF is a phosphoprotein (R. Prywes, personal communication; D. Hancock, G. Evan, and R. Treisman unpublished data). There are three principal regions of significant charged character SRF (Figure 9A). A positively charged stretch, residues 130-170, is associated with DNA binding (see be-

Characterization 997

of SRF

A SHORT

Figure 8. SRF Sequences Dimer Formation l-264

1234

Required for Stable

Complex formation was assayed by gel electrophoresis. (A) N-terminal truncabons. Indicator SRF CANA. encoding SRF residues 82-264 was cotranslated in the presence of excess cRNA encoding various N-terminal truncations as Indicated above the figure. Lane 1. Indicator RNA alone; lanes 2-9, N-terminal truncations plus indicator: lane 1Q indicator plus excess TMV RNA. The band of low intensity II-I lane 5 represents the low affinity 82-2641142-508 heterodimer. (B) C-terminal truncabons. lndlcator SRF cRNA encoding residues l-508 was cotranslated with cRNA encoding the various C-terminal truncations indicated above the Figure.

56789Xl

low; Figure 8). This is flanked by two negatively charged regions, located at residues 80-91 and 242-260, respectively (Figure 9A). A number of studies have led to Ihe view that regions of negative charge, particularly amphipathic helices, are important for the activation function of some transcription factors (Hope and Struhl, 1986; Ma and Ptashne, 1987a, 1987b: Hope et al., 1988). Given the large proportion of serine and threonine residues in SRF, it is conceivable that its properties as a transcription activator are modulated by modifications, such as phosphorylation, at these sites. Since a number of studies have impticated protein kinases in the transient activation of c-fos transcription (for review, see Curran, 1988), we examined the SRF sequence for potential sites for phosphorylation (reviewed by Cohen, 1988). The negatively charged region at residues 80-91, EGDSESGEEEEL, resembles a creatine kinase type II recognition site; two potential recognition sites for kinase A are located at residues 159 (RRYT) and 166 (KRKT), within the DNA binding region (see below). The DNA Binding Region We generated SRF derivatives by in vitro translation of cloned templates and tested for DNA binding by gel electrophoresis. These experiments showed that a short polypeptide containing SRF amino acids 133-222 is sufficient for dimerization and DNA binding; however, the presence of further amino acids at the C-terminal side of this region is required for maximal binding affinity in vitro. The DNA binding/dimerization region does not appear obviously related to previously established DNA binding structures such as the “helix-turn-helix” (reviewed by Pabo and Sauer, 1984) and “zinc finger” (reviewed by Klug and Rhodes, 1987) motifs. At the N-terminal side of the region are two positively charged segments, with helical character: in the center is a hydrophobic region, VLLLVA, and at the C-terminal end is a relatively uncharged region of potential sheet. The sequence between the first and sec-

12345678 ond peaks of sheet, VASETGHV, is closely related to that between the third and fourth, ITSETGKA. DNA binding is abolished by C-terminal deletions that encroach on the putative sheet region, and this reduction correlates with a reduced ability to dimerize. Sheet regions have been previously shown to facilitate dimerization of other DNA binding proteins by stacking interactions (e.g., Anderson et al., 1981). Since the left end of the DNA binding region is strongly, positively charged, it is probable that this region interacts directly with DNA; indeed, truncations of the protein that remove this positively charged region abolish DNA binding but not the capacity to dimerize. The sequences in the dimerization region do not appear related to the recently noted “leucine zipper” motif (Landschulz et al., 1988). A number of DNA binding proteins from yeast have been shown to bind DNA with closely related if not ident& cal sequence specificity to DNA binding proteins from mammalian cells (Vogt et al., 1987; Struhl, 1987; Sorger et al., 1987; Wiederrecht et al., 1987; Harshmann et al., 1988; Jones et al., 1988). The SRE, and the related CArG element (Minty and Kedes, 1986; Taylor et al., submitted), both resemble the binding site for PRTF/GRM, arS. cerevisiae protein involved in cell-type-specific gene expression (Bender and Sprague, 1987; Keleher et al., 1988; Passmore et al., 1988). Recent work suggests that PRTFl GRM is identical to the product of the MCMl gene, which is required for minichromosome maintenance (Passmore et al., 1988; Keleher et al., 1988) and that MCMl and PRTF can indeed bind to SRE sequences (B.-K. Tye, personal communication; G. Ammerer, personal communication). Comparison of the SRF sequence with those of MCMl (Passmore et al., 1988) and the related protein ARGBO, (Dubois et al., 1987b; Passmore et al., 1988), shows that the SRF DNA bindingldimerization domain is closely related to the 80-amino-acid sequence conserved between the two yeast proteins (Figure 9B; Passmore et al., 1988). All three proteins are identical at 41 out of the 80

Cell 998

A. 22&_224

133

BINDING

222

166

DIMERISATION

a-kmGE+ l-lYDFo+ PHoBlCllY s

I

I

I

b I

I

I8

I

B.

I

I

I

I

I

I

I

I

I

I

I

I

I

I 500

400

300

5 130

avsgakpqkkTrgRvKIkmeFIdNKlRRytTFSKRKtGIMKKAYELStLTGTQVLLLVaSETGhVYTFaTrKLqPmiTsetGKaLIQtCLNsPDsPpr~D

I II

SRF

I

//I//l I II I I I I II II I I I /IIlIIIII/ III I I I I I I II I II II tktkdssdtsTvtRRKqpIryIENKTRRHVTFSKRrHGIMKKAYELSVLTGaniLLLilansGLVYTFtTPKLEPvVredEGKsLIrACiNAsDtPdatD I I I IIIIII III II I II II II II I I/IIIiIIIIIIIl IIIIIII IIIIIII III I eeqtptnngqqkeRRKIeIkFIENKTRRHVTFSKRKHGIMfELSVLTGTQVLLLVvSETGLVYTFsTPKfEPiVTqqEGrnLIQACLNAPDdeeede

ARG8067 MCMl

I 200

100

II

II

II

IIIIII

IIIIII

III

II/II//III

Ill

/III

I I

I

I

I

III

III

I

i

II

----------t--RrKi-i-fIeNKtRRhvTFSKRkhGIMyELSvLTGtqvLLLV-SetGlVYTF-TpKleP-vt--eGk-LIqaClNapD-p---d Figure

9. Structural

Features

of SRF

(A) Charge and hydrophobicity plots for the entire SRF coding region are shown relative to the locations of the SRF DNA binding region and sequences required for stable dimer formatron. (6) Homology between SRF and the yeast proteins MCMl (PRTFIGRM) and ARGBO (ARGRI). Data on the latter two proteins are from Passmore et al. (1988). The three sequences are aligned, with identities indicated. Residues identical between all three proteins are shown in capitals, those identical in two out of three by lower case letters. Below, similarities are summarized with residues identical between all three proteins in capital letters, and between two proteins in lower case letters.

positions, and SRF and MCMl are most closely related (SRWMCMl, 55/80; SRF/ARG80, 44180; MCMVARG80, 55/80). We note that the region of homology does not include the C-terminal segment of SRF that apparently increases SRF-SRE affinity; this might reflect a less stringent requirement for specific DNA binding of the yeast proteins. We presume that our cross-hybridization studies failed to detect this similarity owing to its relatively short length and bias at codon third positions (G or C in SRF; A or T in MCMl; Passmore et al., 1988). Although the primary protein sequence is relatively poorly conserved at the C-terminal side of the homologous region, both yeast proteins and SRF give similar structure predictions (positive charge-hydrophobic-sheet) to those of SRF (R. Treisman, unpublished data). SRF is not related to the yeast proteins outside the DNA binding domain, suggesting that the DNA binding region has been conserved as a unit in proteins of different function. It was previously reported that an increase in DNA binding activity specific to the c-fos 5’ activating element occurs upon EGF stimulation of A431 cells (see above; Prywes and Roeder, 1986). In many other cell types, however, the amount of SRE binding activity remains unchanged upon growth factor stimulation (Treisman, 1986; Gilman et al., 1986; Greenberg et al., 1987). This has led to the suggestion that there exists a non-binding or lowaffinity form of SRF that undergoes modification to generate a high affinity form. Our results show that SRF synthesized in the rabbit reticulocyte lysate binds DNA both specifically and efficiently, suggesting that if modification is necessary for SRE binding, it must occur in vitro. We

are currently investigating whether SRF is modified in the lysate and testing the binding activity of SRF produced in bacteria. We note that the two potential kinase A sites fall within the SRF DNA binding region and that the reticulocyte lysate will phosphorylate at kinase A recognition sequences (Curran et al., 1987). Regulation of SRF Gene Expression The SRF gene is transcribed to generate two mRNAs of lengths 4.5 kb and 2.9 kb, which differ in the lengths of their 3’ untranslated regions. When serum-starved HeLa cells are restimulated with serum, the transcription of the SRF gene is transiently induced, leading to an increase in SRF mRNA level of 5- to lo-fold. The putative unspliced precursors of the SRF mRNAs are abundant at 15 min. and are detectable up to 30 min after stimulation. New protein synthesis is not required for induction of SRF gene transcription, and serum stimulation in the presence of the protein synthesis inhibitor cycloheximide results in a slight superinduction of SRF mRNA. The SRF gene can thus be classified as a member of the cellular “immediateearly” gene family (see Lau and Nathans, 1985; Almendral et al., 1988) many of which encode transcriptional regulatory proteins. At present we do not know what role the induction of SRF gene transcription plays in the response to serum factors. During our experiments to synthesize SRF in vitro by translation of SRF cRNA, we found that the SRF mRNA 5’ untranslated region severely inhibits translation in the reticulotcyte lysate. It will be interesting to examine whether translation of SRF message is also regulated following serum stimulation. It remains possible that

Characterization 999

of SRF

0

Figure 10. Possible Function In Vivo

UNSTIMULATED CELLS

GR0Ml-l FACTOR STIMULATION

?

Roles

for

SRF

in SRE

See text for discussion. SRF is represented as an oval, and other factors as squares; the transcription level is indicated by arrows.

I

activation of transcription or translation of SRF mRNA may contribute to the increase in SRE binding activity that occurs following EGF stimulation of A431 cells (Prywes and Roeder, 1986). SRF Can Function as a Constitutive Transcription Activator Although the SRE is a sequence element associated with growth factor-inducible transcription, it also functions as a constitutive promoter element (Mohun et al., 1987). We exploited this to develop an in vitro assay for SRE basal activity, in which the strength of synthetic promoters comprising an SRE linked to a TATA box correlates with the affinity of the SRE for SRF. However, the relationship of this constitutive activity and the serum-inducible function of the SRE remain unclear (see below). Removal of SRF from the in vitro transcription extracts by SRE DNA affinity chromatography has no effect on basal transcription levels but abolishes stimulation of transcription by the SRE. Readdition of SRF, either purified from HeLa cells or produced in vitro by translation of SRF cRNA, restores SREdependent, in vitro transcription. These results provide direct evidence that SRF can be a positively acting transcription factor; moreover, any modifications necessary for activation of transcription must occur in the reticulocyte lysate. It does remain possible that SRF acts by complementing an endogenous transcription factor; however, in view of the correlation of SRE activity in vitro with SRF DNA binding, we consider this unlikely. We are currently using the in vitro system to map regions of SRF required for transcription activation. In addition, the establishment of conditions for efficient SRE-dependent in vitro transcription should be helpful in the development of in vitro systems that mimic the transcriptional response to growth factors. The Role of SRF in Serum Activated Transcription What is the role of SRF in the function of the SRE in vivo? Since SRF functions in vitro as a constitutive transcrip-

tional activator, and SRE binding activity is recoverable from many cell types in the absence of growth factor stimulation, it is reasonable to suppose that in many cell types SRF can bind the SRE and act constitutively, prior to growth factor stimulation (Figure 10). It remains possible that SRF requires modification to bind DNA, and Figure 10 also illustrates a situation in which unmodified SRF remains unbound. Three kinds of roles for SRF in transcription following growth factor stimulation can be envisaged. In the first and most simple view, SRF is responsible for both basal and growth factor-induced SRE activity; modulation of SRE activity would occur by covalent modification of either SRF itself or other components of the transcription machinery with which it interacts. This model would be similar to that proposed for regulation of transcription by yeast heat shock transcription factor (Sorger and Pelham, 1988; Sorger et al., 1987). In the second view, growth factor stimulation would cause SRF either to interact with a positively acting accessory protein, which might recognize SRF itself or recognize an SRF-SRE complex, or alternatively, release from SRF a negative regulatory factor that inhibits SRF function in unstimulated cells. These models are reminiscent of the way in which the SRFrelated yeast transcription factor PRTFlGRM acts in combination with cell-type-specific proteins al or a2 to generate positively or negatively acting complexes (Bender and Sprague, 1987; Kronstad et al., 1987; Keleher et al., 1988; Sauer et al., 1988). In the third model, SRF mediates constitutive transcription while a different protein altogether, which shares partial or complete sequence specificity with SRF, is involved in the inducible transcription. It has become abundantly clear that eukaryotic gene regulatory elements are frequently recognized by more than one different protein (Dorn et al., 1987; Santoro et al., 1988; Scheidereit et al., 1987); we are therefore attempting to isolate other SRF-related genes. At present, it is difficult to distinguish between these various models. Several groups have shown that point mutations that prevent SRF binding in vitro also block

Cell 1000

transcription

induction

1987; Greenberg 1988; Stump0 thetic

SRE

larly

to the

also ments vitro

merely

function. response Taylor

activity, in vitro

to serum SRF

SRF is involved activation ponents

provide

site

All these Since

(ACTR)

mutations

these

activation no direct

test

experiwith

of sites

appear

activate

transcription

factors

should

(Norman The

enable

in growth

of the transcription

and

availability

its interaction

to bind

Treisman,

in 1988;

of cDNA

us to test directly

factor-mediated

in

of SRF

a number

and to investigate

Experimental

simi-

yet efficiently

et al., submitted).

encoding

1987).

transcription they

syn-

stimulation

affinity

transcription.

In addition,

SRF weakly

a low

(Treisman,

1987; Gilman,

a high affinity

to serum

(Treisman, correlate

binding

et al.,

In addition,

while

constitutive

of agents

Fisch

responds

c-fos SRE, poorly

affect

1987;

et al., 1988). (ACTL)

responds

by a variety

et al.,

clones whether

The furthest extended clone, x451.25, was sequenced completely No differences ansing from alternate splicing patterns were detected in 16 primer extension clones analyzed.

Sequence

Analysis DNA sequences were determined by the primed synthesis method (Bankier et al., 1987), after the preparation of libraries of random sonicated DNA fragments inserted into m13mp8. All clones were sequenced on both DNA strands to a redundancy of 7- to lo-fold. Difficult regcons were sequenced with inosine or azaguanosine mixes substituted for the guanosine mix. Sequence compilation and analysis was done using the Staden or lntelligenetics programs.

DNA and RNA Analysis DNA and RNA preparation, ration, and hybridization tis et al., 1982).

electrophoresis were by standard

and transfer, probe prepatechniques (see e.g., Mania-

transcriptional with other

com-

apparatus.

Procedures

SRF Preparation and Sequencing SRF was purified from 10” HeLa cells as previously

described (Treisman, 1987). Protein (-0.5 nmol) was recovered by addition of freshly made trichloracetic acid to 15% w/v followed by centrifugation. After solution in 70% v/v formic acid, SRF was digested with CNBr for 4 hr, diluted with 10 vof of H,O), and the solvent was removed by lyophilization. After solution in 20 pl of 0.1% trifluoroacelic acid, the fragments were separated by reversed phase HPLC on a Brownlee Cl8 microbore column (2 mm x 30 mm) using an Applied Biosystems 130A microbore apparatus. The peptides were eluted using a gradient of 0%-80% acetonitrile in 0.1% trifluoroacetic acid and recovered by lyophilization. Sequences were determined using a modified Applied Biosystems model 470A gas-phase sequenator with on-line HPLC detection. Sequences obtained are shown in Table 1. Note that the SRF DNA sequence predicts CB13 05 as H, CB20 P25 as H. and CB22 G8 as Q. The cDNA sequence was confirmed by analysis of genomic SRF clones (data not shown). Isolation of cDNA Clones A human Sgtll placental cDNA library (Clontech; lo6 plaques) was screened by hybridization with oligonucleotide probes as follows. Phage growth and preparation of triplicate plaque lifts was done by standard techniques (e.g., see Maniatis et al., 1982). Lifts were presoaked for 1 hr at the appropriate temperature in 6x SSTE (SSTE is 0.15 M NaCI, IO mM Tris-HCI [pH 7.81. 1 mM EDTA), 0.1% SDS, 2 mM Na4P207, 5 mM KH2P04, 100 pg/ml of tRNA, and 10x Denhardt’s solution; hybridization was in the same solution containing 2 pmollml of oligonucleotide. Hybridization (Lathe, 1985) was at 65OC (CB20 guessmer), 43°C (CB20 pool), and 41°C (CB22 pool). Filters wre rinsed in 6x SSTE, 0.1% SDS at room temperature twice for 10 min followed by two washes in the same buffer at the hybridization temperature. Library screening with nick-translated restriction fragment probes was done as above but with 2x SSTE, and final hybridization/washing was at 80°C in 0.1 x SSTE. 0.1% SDS. A librarv of HeoGP cell cDNA clones in latl0 was screened with the insert from 12.9. Synthesis and Cloning of Primer Extended cDNA For cloning of primer extended cDNA, the oligonucleotide primer 5’-CATACCGATCTCCATCTCGCTCAGGCTCCGCTTCA-3 (24 pmol) was annealed lo 40 pg of polyadenylated HeLa cell RNA (from cells stimulated with 15% serum and 10 pglml of cycloheximide) and extended in 10 mM Tris-HCI (pH 8.5). 50 mM NaOAc, 8 mM MgCIP, 0.5 mM each dNTP, 20 U/ml of RNAasin, and 50 U of reverse transcriptase for 30 min at 3PC. After recovery, the cDNA was rendered doublestranded bv the RNAase H method as oreviouslv described (Watson and Jackson, 1985), followed by EcoRl methylation, end repair,‘and addition of EcoRl linkers. After size fractionation on a 1% agarose gel, cDNA was ligated to hgtl0 arms (Stratagene), packaged as described by the manufacturer, and screened using the insert of 1454.9 as probe.

Plasmid Constructions All phage inserts

were subcloned

DNA maniDulations

into pUC12 prior to analysis.

Plasmid

and DreDaration were bv standard methods.

A compiete SRF coding ‘region was recbnstructed from RI-Not1 (i;451.25), Notl-Bglll (x454.9), Bglll-RI (12.9). To assay proteins encoded by SRF cDNA, segments of the cDNA were inserted into pGEM1. Plasmid pG3.5 contains SRF nucleotides l-3450; plasmid pG3.3 contains SRF nucleotides 185-3450, assembled as PII-Ps1l (x454.9), PSI-RI (12.9); plasmid pG3.1 contains SRF nucleo0des 351 (octamer Xhol linkerat Taql site) to 3450. All are oriented for transcription by T7 RNA polymerase and were linearized at the BstEll site (nucleotide 2879). Plasmids for translation of SRF fragments were based on pT7bA6Sal, a derivative of pGEM2 in which the fi-globin insert of pSP6H!3A6 (Krainer et al , 1984) is inserted between the polylinker Hindlll and Pstl sites, with a Sall linker inserted at the P-globin initiation codon to create the sequence CCATGGGTCGACCATGG. Transcripts synthesized from this plasmid by T7 RNA polymerase contain the nucleotides GGAGACCGGAAGCUUGCUU followed by the @globin 5’ untranslated region and AUG. Plasmid PT~AATG comprises SRF nucleo0des 359 (ATG) lo 1970 (Hincll) inserted between the Ncol and Hincll sites of pT7PSal. An oligonucleotide adaptor was used lo allow the precise joining of SRF sequences to the p-globin ATG codon. Plasmid T7A2.9 contains SRF nucleotides 602-1970, from phage 12.9, inserted between the Salll and Hincll sites of pT7bA6Sal via an Xho linker; the sequence at the S’joint is CCATGGGTCTCGAGGAATTCGGG SRF. This plasmid encodes MGLEEFG-SRF82 to 508. Plasmids for mapping the SRF DNA binding region were generated from pT7A2.9 by standard techniques. 5’ deletions are denoted pT7AXXX, where XXX presents the 5’ nucleotide of SRF sequence: pT7A648 encodes MGLE-SRF97 to 508. pT7A678 encodes MGLEV-SRF108 to 508. pT78696 encodes MGLE-SRF113 to 508. pT7A723 encodes MGLE-SRF112 to 508. pT7A737 encodes MSR-SRF127 to 508 (linker sequence CCATGT CGAGG). pT7A755 encodes MSR-SRF133 to 508 (linker sequence CC&TGT CGAGG). pT7A780 encodes MGLE-SRF142 to 508. pT7A860 encodes MSR-SRF168 to 508. pT7A873 encodes MGLE-SRF172 lo 508. pT7A897 encodes MGLE-SRF180 to 508. pT7A926 encodes MGLEEFG-SRF190 to 508 (from h1.8; linker as T7A2.9). 3’ deletions were constructed by exonuclease treatment from the Bglll site (SRF nucleotide 1090) and addition of a Bglll linker, CAGATCTG, and are denoted pT7AYYY11090, where YYY is the 3 nucleotide of SRF at the 5’ side of the deletion. Below, the coding potential is given for RNA generated from templates linearized with Bglll, assuming that transcription and translation continue to the absolute end of the fragment: pT7AlO57/1090 encodes MGLEETG-SRF82 to 234. pT781024/1090 encodes MGLEETG-SAF82 lo 222-R. pT7A1001/1090 encodes MGLEETG-SRF82 10 214-TE.

Characterization 1001

of SRF

pT7A99111090 encodes MGLEETGSRF82 to 211-01. pT7A97811090 encodes MGLEETG-SRF82 to 208~QI. pT7A95211090 encodes MGLEETGSRF82 to to 198~QI. Other C-terminal truncations were produced by linearization of the template plasmid at appropriate restriction sites. To test the minimal SRF region sufficient for specific DNA binding, 5’ and 3’ truncations were recombined: pT7A723-1024/1090 encodes MGSE-SRF122 to 222-R. pT7A755-102411090 encodes MSRSRFl33 to 222-R. Plasmid pA48CAT and its SRE-containing derivatives were as previously described (Mohun et al., 1987; Treisman, 1987). Plasmid pA48FOS and its derivatives are as described (Treisman, 1987) but with all c-fosH sequences between the end of exon 1 (Hincll) and the polylinker Hincll site deleted. These plasmids contain Xenopus type 5 cytoskeletal actin sequences from -48 joined to the appropriate transcription unit at position +21. The synthetic 28 bp SRE oligonucleotides are inserted into the EcoRl site in the linker sequence GAATTCGAGCTCCCC attached to position -48 of the actin promoter. Synthesis of cRNA and Translation of SRF In Vitro Transcription with T7 polymerase in the presence of m7GpppG was performed as described (Melton et al., 1984) and synthesis was quantitated by 32P incorporation. In vitro translation using the rabbit reticulocyte lysate (a gift from Tim Hunt) was done according to the manufacturers’ instructions, with 10 ng/ml of template RNA (Jackson and Hunt, 1983). For dimerization interference assays, the indicator and test cRNAs were used to 1 @ml and 10 ng/ml, respectively. Yields of SRF derivatives were checked by SDS-PAGE. Aliquots of 1 nl were used for binding assays, 2 nl for SDS-PAGE, and 3 PI for in vitro transcription. DNA Binding Assays DNA binding was assayed by gel electrophoresis as previously described (Treisman, 1988). With SRF synthesized in vitro, binding was on ice for 15 min and binding reactions included 5 mglml of BSA. Antibody reactions were done with preformed SRF-SRE complexes by the addition of an appropriate amount of polyclonal mouse anti-SRF antiserum (raised against purified HeLa cell SRF; G. Evan and R. Treisman, unpublished data) to the reaction and further incubation for 15 min before electrophoresis. Binding competition assays were done using plasmid competitors as previously described, except for pBOX1, which is a pUCl2 subclone carrying the X. laevis cardiac actin gene CCArGG box 1 (Mohun et al., 1987) which contains the SRE-related sequence AGCTACCAAATAAGGGCAGG. For dimerization interference assays, binding reactions contained 1 ng of probe to ensure substantial excess. In Vitro Transcription Assay Transcription reactions (20 ~1) contained 5 ul of DNA cellulose flowthrough fraction (5-10 mglml; dialyzed into buffer DO.1) and 3 ~1 of Biorex 70 flowthrough fraction (7 mglml) prepared as previously described (Treisman, 1987) 2 ~1 of buffer D0.1, 1 mM MgCI?, 5 mM spermidine, 0.5 mM each ribonucleoside triphosphate, 1 mM creatine phosphate, and 4% PEG8000. Supercoiled plasmids pA48CAT and pA48FOS, or their derivatives containing SRE oligonucleotides inserted 5’ to the TATA box (Mohun et al., 1987; Treisman, 1987). were used as templates as indicated in the figure legends. Transcription was allowed to proceed for 30 min at 30% and the reaction was terminated by dilution into 200 ul of TE followed by phenol extraction. The oligonucleotides S-GCGTTGAAGCCCGAGAACATC-3’ and B’GTTCTTTACGATGCCATT-B’were used as primers for detection of A48FOS and A48CAT transcripts by primer extension assay (conditions as described above); correctly initiated transcripts generate extension products of lengths 184 and 137 nucleotides, respectively. Depletion of SRF was as described (Treisman, 1987). Purified SRF was diluted with 4 vol of DO.1 with 5 mglml of BSA for addition into transcription reactions; in these experiments, an equal volume of diluent alone was added to reactions lacking SRF Acknowledgments We are indebted to Peter Whiteside (Department of Microbiology, Surrey University) and CellTech for bulk growth of HeLa cells, without

which this work would not have been possible. We thank Gustav Ammerer and Bik-Kwoon Tye for communication of unpublished data on PRTF and MCMl. respectively, and we are grateful to Dr. Bik-Kwoon Tye and her colleagues at Cornell for generously sending us a copy of their work on MCMI and ARG80 prior to publication. We thank Caroline McGuigan for technical assistance and Tim Hunt, Tim Mohun, James Scott, Terry Smith, Kathleen Weston, and Tim Wilson for translation lessons, advice on screening and XLKE cells, the HepG2 LgtlO cDNA library, oligonucleotide synthesis,, help with sequencing, and HeLa cell RNA, respectively. We thank Gerard Evan, Tim Hunt, Nit Jones, Aaron Klug, Frank Lee, Hugh Pelham, and John Walker for helpful discussions and encouragement. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “‘advertisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact, Received

September

12, 1988.

References Almendral. J. M., Sommer, D., Macdonald-Bravo, H., Burckhardt, J., Perera, J., and Bravo, R. (1988). Complexity of the Early Genetic Response to growth factors in mouse fibroblasts. Mol. Cell. Biol. 8, 2140-2148. Anderson, W. F.. Ohlendorf, D. H., Takeda. Y., and Matthews, B. W. (1981). Structure of cro repressor from bacteriophage )i and its interaction with DNA. Nature 290, 754-758. Baldwin, A., and Sharp, P A. (1988). Two factors, NF-KB and HZTFI, interact with a single regulatory sequence in the class I MHC promoter. Proc. Natl. Acad. Sci. USA 85, 723-727. Bankier, A. T., Weston, K. M., and Barrell, B. G. (1987). Random cloning and sequencing by the Ml3/dideoxynucleotide chain termination method. Meth. Enzymol. 755, 51-93. Bender, A., and Sprague, Jr., G. F. (1987). MATal protein, a yeast transcription activator, binds synergistically with a second protein to a set of cell-type-specific genes. Cell 50, 881-891. Buscher, M., Rahmsdorf, H.-J., Litfin, M., Karin, M., and Herrlich, l? (1988). Activation of the c-fos gene by UV and phorbol ester: different signal pathways converge to the same enhancer element. Oncogene, in press. Chavrier, P, Zerial. M, Lemaire. P., Almendral. J., Bravo, R., and Charnay, P (1988). A gene encoding a protein with zinc fingers activated during the GO/G1 transition in cultured cells. EMBO J. 7, 29-35. Cohen, P (1988). Protein phosphorylation R. Sot. Lond. (Biol.) 234, 115-144. . Curran, T. (1988). The Oncogene and T. Curran, eds. (Amsterdam:

and hormone

Handbook, Elsevier).

action.

Proc.

E. P Reddy, A. M. Skalka,

Curran, T., MacConnell, W. P, van Straaten, F., and Verma, I. M. (1983). Structure of the FBJ murine osteosarcoma virus genome: molecular cloning of its associated helper virus and the cellular homolog of the c-fos gene from mouse and human cells, Mol. and Cell. Biol. 3, 914-921. Curran, T.. Gordon, M. B., Rubino, K. L., and Sambucetti, L. C. (1987). Isolation and characterisation of the c-fos(rat) cDNA and analysis of posttranslational modification in vitro. Oncogene 2, 79-84. Dorn, A., Bollekens, J., Staub, A., Benoist. C.. and Mathrs, D. (1987). A multiplicity of CCAAT box-binding proteins. Cell 50, 883-872. Dubois, E., Bercy, J., Descamps, F., and Messenguy, F. (1987a). Characterization of two new genes essential for vegetative growth of Saccharomyces cerevisiae: nucleotide sequence determination and chromosome mapping. Gene 55, 285-275. Dubois, E., Bercy, J., and Messenguy, F. (1987b). Characterization of two genes, ARGRI and ARGRIII, required for specific regulation of the arginine metabolism in yeast. Mol. Gen. Genet. 207, 142-148. Fisch, T. M., Prywes, R.. and Roeder, R. G. (1987). c-fos sequences required for basal expression and induction by EGF, TPA and Ca2+ ionophore. Mol. Cell. Biol. 7, 3490-3502. Gilman,

M. 2. (1988). The c-fos serum

response

element

responds

to

Cdl 1002

protein kinase C-dependent and -independent clic AMI? Genes Dev. 2. 394-402.

signals

but not to cy-

Gilman, M. Z., Wilson, R. N., and Weinberg, Ft. A. (1988). Multiple protein binding sites in the 5’ flanking region regulate c-fos expression, Mol. Cell. Biol. 6, 4305-4314. Greenberg, M. E., and Ziff, E. B. (1984). Stimulation of 3T3 cells induces transcription of the c-fos proto-oncogene. Nature 377, 433-438. Greenberg, M. E., Hermanowski, A. L., and Ziff, E. B. (1988). Effect of protein synthesis inhibitors on growth factor activation of c-fos, c-myc and actin gene transcription. Mol. Cell. Biol. 6, 1050-1057. Greenberg, M. E.. Siegfried, Z., and Ziff, E. B. (1987). Mutation of the c-fos dyad symmetry element inhibits inducibility in vivo and the nuclear regulatory factor binding in vitro. Mol. Cell. Biol. 7, 1217-1225.

Maniatls, T, Fnsch, E. F., and Sambrook, J. (1982). Molecular Cloning. A Laboratory Manual (Cold Spring Harbor, New York: Cold Spring Harbor Laboratory). Melton, D. A., Krieg, P A., Rebagliati, M. R., Maniatis, T. P., Zinn, K.. and Green, M. R. (1984). Efficient in vitro synthesis of biologically active RNA and RNA hybridization probes from plasmids containing a bacteriophage SP6 promoter. Nucl. Acids Res. 72, 7035-7056. Minty, A.. and Kedes, L. J. (1986). Upstream cardiac actin gene that modulate its transcription ence of an evolutionarily conserved regulatory 6, 2125-2136

regions of the human cn muscle cells: presmotif. Mol. Cell. Biol.

Mohun, T., Garrett, N., and Treisman, R. (1987). Xenopus cytoskeietal actin and human c-fos gene promoters share a conserved proteinbinding site. EMBO J. 6, 687-673.

Harshmann, K. D., Moye-Rowley, W. S., and Parker, C. S. (1988). Transcriptional activation by the SV40 AP-1 recognition element in yeast is mediated by a factor similar to AP-I that is distinct from GCN4. Cell 53, 321-330.

Montminy, M. R., and Bilezikjian, M. (1987). Binding of a nuclear protein to the CAMP response element of the somatostatin gene. Nature 328, 175-178.

Hayes, T. E., Kitchen, A. M., and Cochran, B. H. (1987). Inducible binding of a factor to the c-fos regulatory region. Proc. Natl. Acad. Sci. USA 84, 1272-1278.

Miiller, R., Bravo, R., Burckhardt, J., and Curran, T. (1984). InductIon of c-fos gene and protein by growth factors precedes activation of c-myc. Nature 372, 716-720.

Hope, I. A., and Struhl, K. (1988). Functional dissection of a eukaryotic transcription activator protein, GCN4 of yeast. Cell 46, 885-894.

eleBiol.

Hope, I. A., and Struhl. K. (1987). GCN4, a eukaryotic transcriptional activator protein, binds as a dimer to target DNA. EMBO J. 6, 2781-2784.

Norman, C., and Treisman. R. (1988). Analysis of serum response ment (SRE) function in vitro. Cold Spring Harbor Symp. Quant. 53, in press. Pabo, C., and Sauer, R. (1984). Biochem. 53. 293-321.

Rev.

Hope, I. A.. Mahadevan, S., and Struhl, K. (1988). Structural tional analysis of the short acidic transcriptional activating yeast GCN4 protein. Nature 333, 835-840.

Passmore, S., Maine, G. T.. Elble, R.. Christ, C., and Tye, B. K. (1988). A Saccharomyces cerevisiae protein involved in plasmid maintenance is necessary for mating of MATa cells. J. Mol. Biol.. in press.

and funcregion of

Protein-DNA

recognition.

Annu.

Jackson, Ft. J., and Hunt, R. T. (1983). Preparation and use of nuclease treated rabbit reticulocyte lysates for translation of eukaryotic mRNA. Meth. Enzymol. 96, 50-74.

Piette, J., and Yaniv, M. (1987). Two different factors bind to the a domain of the polyomavirus enhancer, one of which also interacts with the SV40 and c-fos enhancers. EMBO J. 7; 1331-1337.

Jackson, S. P., and Tjian, R. (1988). 0-glycosylation of eukaryotic scription factors: implications for mechanisms of transcriptional lation. Cell 55, 125-133.

Proudfoot, N. J., and Brownlee, G. (1978). 3’ noncoding region quences in eukaryotic messenger RNA. Nature 263, 211-214.

tranregu-

Jones, R. H., Moreno, S., Nurse, F?, and Jones, N. C. (1988). Expression of the SV40 promoter in fission yeast: identification and characterization of an AP-l-like factor. Cell 53. 859-887.

Prywes, R., and Roeder, R. G. (1986). the c-fos enhancer. Cell 47, 777-784.

Inducible

binding

Prywes, R., and Roeder, R. G. (1987). Purification hancer binding protein. Mol Cell. Biol. 7, 3482-3489.

of a factor

of the c-fos

seto en-

Keleher, C. A., Gouette, C., and Johnson, A. D. (1988). The yeast celltype-specific repressor a2 acts cooperatively with a non-cell-typespecific protein. Cell 53, 927-936.

Rauscher, F. J.. Ill, Sambucetti, L. C., Curran, T., Distal, R. J., and Speigelman, B. M. (1988). Common DNA binding site for Fos protein complexes and transcription factor AP-I. Cell 52, 471-480.

Klug, A., and Rhodes, D. (1987). “Zinc fingers”: for nucleic acid recognition. Trends Biochem.

Rechtsteiner, intracellular

a novel motif involved Sci. 72, 464-469.

M., Rogers, S.. and Rote, K. (1987). Protein structure stability. Trends Biochem. Sci. 72, 390-394.

and

Kozak, M. (1986). Point mutations define a sequence flanking the AUG initiator codon that modulates translation by eukaryotic ribosomes. Cell 44, 283-292.

Santoro, C., Mermod, N.. Andrews, l? C., and Tjian, R. (1988). A family of CCAAT-box-binding proteins active in transcription and DNA replication: Cloning and expression of multiple cDNAs. Nature 334, 218-224.

Krainer, A. R., Maniatis, T., Ruskin, B.. and Green, M. R. (1984). Normal and mutant human b-globin pre-mRNAs are faithfully and efficiently spliced in vitro. Cell 36, 993-1005.

Sauer, R. T., Smith, D. L., and Johnson, A. D. (1988). Flexibility of the yeast a2 repressor enables it to occupy the ends of its operator, leaving the center free. Genes Dev. 2, 807-816.

Kronstad, J. W., Holly, J. A., and MacKay, V. L. (1987). A yeast operator overlaps an upstream activation site. Cell 50, 389-377.

Scheidereit, C., Heguy, A., and Roeder, R. G. (1987). Identification and purification of a human lymphoid-specific octamer binding protein (OTF-2) that activates transcription of an immunoglobulin gene promoter in vitro. Cell 57, 783-793.

Kruijer, W., Cooper, J. A., Hunter, T., and Verman, I. M. (1984). Plateletderived growth factor induces rapid but transient expression of the c-fos gene and protein. Nature 312, 7ll-716. Landschulz. W. H., Johnson, I? F., and McKnight. S. L. (1988). The leutine zipper: a hypothetical structure common to a new class of DNA binding proteins. Science 240, 1759-1784. Lathe, amino

R. (1985). Synthetic oligonucleotide probes acid sequence data. J. Mol. Biol. 183, l-12.

Lau, L. F., and Nathans, D. (1985). Identification pressed during the GO/G1 transition of cultured 4, 3145-3151.

deduced

from

of a set of genes axmouse cells. EMBO J.

Lau, L. F., and Nathans. D. (1987). Expression of a set of growth-related immediate early genes in BALB/c 3T3 cells: coordinate regulation with c-fos, or c-myc. Proc. Natl. Acad. Sci. USA 84, 1182-1188. Ma, J., and Ptashne, M. (1987a). Deletion analysis of GAL4 defines transcription activating segments. Cell 48, 847-853. Ma, J., and Ptashne, Cell 57, 113-119.

M. (1987b). A new class of transcription

two

activators.

Schroter, H., Shaw, P., and Nordheim, A. (1987). Purification of intercalator-released ps7, a polypeptide that interacts specifically wtth the c-fos serum response element. Nucl. Acids Res. 75, 10145-10158. Sheng, M., Dougan, S. T., McFadden, (1988). Calcium and growth factor induced tiOnal activation require different upstream Cell. Viol. 8, 2787-2796.

G., and Greenberg, M. E. pathways of c-fos transcnpregulatory sequences. Mol.

Sorger, P K., and Pelham, H. R. 6. (1988). Yeast heat shock factor an essential DNA-binding protein that exhibits temperature-dependent phosphorylation. Cell 54, 855-864.

IS

Sorger, P. K.. Lewis, M. J., and Pelham, H. R. 8. (1987). Heat shock factor is regulated differently in yeast and HeLa cells. Nature 329, 81-84. Struhl, K. (1987). The DNA-binding domains of the jun oncoprotein and the yeast GCN4 transcription activator proteins are functionally homologous. Cell 50, 841-846. StUmpO,

D., Stewart,

T. N., Gilman,

M. Z., and Blackshear,

P J. (1988).

Characterization 1003

of SRF

Identification of c-fos sequences involved in induction phorbol esters. J. Biol. Chem. 263, 1611-1616.

by insulin

and

Treisman, R. (1985). Transient accumulation of c-fos RNA following serum stimulation requires a conserved 5’ element and c-fos 3’ sequences. Cell 42, 889-902. Treisman, Ft. (1986). Identification of a protein-binding ates transcription response of the c-fos gene to serum 567-574. Treisman, R. H. (1987). Identification that binds the c-fos serum response

site that medifactors. Cell 46,

and purification of a polypeptide element. EMBO J. 6, 27il-2717.

Van Straaten. F., van Beveren, C., Curran, T., and Verma, I. M. (1983). Complete sequence of a human c-one gene: deduced amino-acid sequence of the human c-fos gene protein. Proc. Natl. Acad. Sci. USA 80, 3183-3187. Vogt, P K., SOS, T. J., and Doolittle, R. (1987). Homology between the DNA-binding domain of the GCN4 regulatory protein of yeast and the carboxyl terminal region of a protein coded for by the oncogene v-jun. Proc. Natl. Acad. Sci. USA 84, 3316-3319. Watson, C.. and Jackson, J. (1985). An alternative procedure for synthesising double stranded cDNA for cloning in phage and plasmid vectors. In DNA Cloning, A Practical Approach. Vol. 1, D. Glover, ed. (IRL Press: Oxford), pp. 79-88. Wiederrecht, G., Shuey, D. J., Kibbe, W. A., and Parker, The Saccharomyces and Drosophila heat shock proteins in size and DNA binding properties. Cell 48, 507-515.

C. S. (1987). are identical