Isolation of a novel plasmid from Couchioplanes caeruleus and construction of two plasmid vectors for gene expression in Actinoplanes missouriensis

Plasmid 77 (2015) 32–38

Contents lists available at ScienceDirect

Plasmid j o u r n a l h o m e p a g e : w w w. e l s e v i e r. c o m / l o c a t e / y p l a s

Isolation of a novel plasmid from Couchioplanes caeruleus and construction of two plasmid vectors for gene expression in Actinoplanes missouriensis Moon-Sun Jang a,1, Azusa Fujita a,1, Satomi Ikawa b, Keitaro Hanawa b, Hideki Yamamura b, Tomohiko Tamura c, Masayuki Hayakawa b, Takeaki Tezuka a, Yasuo Ohnishi a,* a Department of Biotechnology, Graduate School of Agricultural and Life Sciences, The University of Tokyo, 1-1-1 Yayoi, Bunkyo-ku, Tokyo 113-8657, Japan b Division of Applied Biological Sciences, University of Yamanashi, 4-3-11 Takeda, Kofu, Yamanashi 400-8511, Japan c Biological Resource Center, National Institute of Technology and Evaluation (NBRC), 2-5-8 Kazusakamatari, Kisarazu, Chiba 292-0818, Japan

A R T I C L E

I N F O

Article history: Received 21 August 2014 Accepted 1 December 2014 Available online 8 December 2014 Communicated by Dr. W.F. Fricke Keywords: Actinoplanes missouriensis Couchioplanes caeruleus Rare actinomycetes Rolling-circle replication Plasmid Shuttle vector

A B S T R A C T

To date, no plasmid vector has been developed for the rare actinomycete Actinoplanes missouriensis. Moreover, no small circular plasmid has been reported to exist in the genus Actinoplanes. Here, a novel plasmid, designated pCAZ1, was isolated from Couchioplanes caeruleus subsp. azureus via screening for small circular plasmids in Actinoplanes (57 strains) and Couchioplanes (2 strains). Nucleotide sequencing revealed that pCAZ1 is a 5845-bp circular molecule with a G + C content of 67.5%. The pCAZ1 copy number was estimated at 30 per chromosome. pCAZ1 contains seven putative open reading frames, one of which encodes a protein containing three motifs conserved among plasmid-encoded replication proteins that are involved in the rolling-circle mechanism of replication. Detection of singlestranded DNA intermediates in C. caeruleus confirmed that pCAZ1 replicates by this mechanism. The ColE1 origin from pBluescript SK(+) and the oriT sequence with the apramycin resistance gene aac(3)IV from pIJ773 were inserted together into pCAZ1, to construct the Escherichia coli–A. missouriensis shuttle vectors, pCAM1 and pCAM2, in which the foreign DNA fragment was inserted into pCAZ1 in opposite directions. pCAM1 and pCAM2 were successfully transferred to A. missouriensis through the E. coli-mediated conjugative transfer system. The copy numbers of pCAM1 and pCAM2 in A. missouriensis were estimated to be one and four per chromosome, respectively. Thus, these vectors can be used as effective genetic tools for homologous and heterologous gene expression studies in A. missouriensis. © 2014 Elsevier Inc. All rights reserved.

1. Introduction

Abbreviations: dsDNA, double-stranded DNA; dso, double-strand origin; RCR, rolling-circle replication; ssDNA, single-stranded DNA; sso, single-strand origin. * Corresponding author. Department of Biotechnology, Graduate School of Agricultural and Life Sciences, University of Tokyo, 1-1-1 Yayoi, Bunkyoku, Tokyo 113-8657, Japan. Fax: +81 3 5841 8021. E-mail address: [email protected] (Y. Ohnishi). 1 These two authors equally contributed to this work. http://dx.doi.org/10.1016/j.plasmid.2014.12.001 0147-619X/© 2014 Elsevier Inc. All rights reserved.

Plasmids are extrachromosomal genetic elements with unique copy numbers in host organisms. Because plasmids can be introduced into new hosts by a variety of mechanisms, they are considered capable of mediating genetic exchanges among bacterial populations in natural habitats (Jain and Srivastava, 2013). Plasmids replicate in an autonomous and self-controlled manner using the replication machinery of the host in addition to proteins

M.-S. Jang et al./Plasmid 77 (2015) 32–38

encoded by their own DNA. Circular bacterial plasmids generally replicate by either theta-type replication, strand displacement replication, or rolling-circle replication (RCR) (del Solar et al., 1998). RCR is unidirectional and asymmetric because leading strand synthesis is uncoupled from lagging strand synthesis (del Solar et al., 1993; Khan, 2005). A relevant feature of RCR is that the synthesized leading plus strand remains covalently bound to the parental plus strand. In the current model, RCR is initiated by the plasmidencoded Rep protein, which binds to a region called the double-strand origin (dso) and introduces a site-specific nick into the plus strand. The 3′-hydroxyl end generated by the nick is used as a primer for synthesizing the new leading strand through a process involving host replication proteins such as DNA polymerase III, the single-stranded DNA (ssDNA)-binding protein SSB, and a helicase. Elongation of the leading strand continues until the replisome reaches the reconstituted dso and terminates by a DNA strand transfer reaction. Thus, leading strand replication generates a doublestranded DNA (dsDNA) constituted by the parental minus strand and the newly synthesized plus strand, as well as a ssDNA intermediate derived from the parental plus strand. The generation of ssDNA is the hallmark of RCR plasmids (te Riele et al., 1986). The parental plus strand is converted into dsDNA using host proteins that initiate DNA replication at the single-strand origin (sso). The sso is distant from the dso (Espinosa et al., 1995). Actinomycetes that differ from streptomycetes are called rare actinomycetes because of their low frequency of isolation from soil samples. Rare actinomycetes have attracted much attention as novel sources of pharmaceutically useful natural compounds and several methods for efficient isolation of these microbes have been developed (Couch, 1954; Hayakawa et al., 1991, 2000; Makkar and Cross, 1982; Palleroni, 1980). Some species of actinomycetes have complex morphological development making their cellular differentiation processes very interesting to study (Subramani and Aalbersberg, 2013; Tiwari and Gupta, 2013). However, to date, very few molecular biological studies have been conducted on rare actinomycetes, especially studies on their morphogenesis. Actinoplanes missouriensis, a rare actinomycete that lives in aquatic habitats and soil, has a rather complex lifecycle. In solid culture, A. missouriensis grows into a substrate mycelium and eventually forms round to globular sporangia on the substrate mycelium surface via a short sporangiophore of 4–5 μm. A sporangium contains a few hundred zoospores (shape, spherical to oval; diameter, 0.8–1.0 μm) with short flagella (Hayakawa et al., 1991; Uchida et al., 2011). Zoospores are released from a sporangium through dehiscence upon contact with water. However, pure water is not sufficient for the onset of dehiscence; therefore, some unknown substance(s) in soil extracts must be required. Once released, zoospores begin to swim immediately at astonishing speed using flagella. Chemotaxis allows a zoospore to move to a preferable environment using its chemotactic properties toward a wide variety of substances including aromatic compounds, sugars, and amino acids (Hayakawa et al., 1991). Finally, the zoospore stops swimming and germinates to form a substrate mycelium. These characteristics make A. missouriensis a suitable bacterium for studying morphogenesis and the regulatory

33

mechanisms involved in sensing and responding to environmental changes. The complete genomic sequence of A. missouriensis 431T (NBRC 102363T) was reported recently (Yamamura et al., 2012). While the linear plasmid pAM1 (approximately 100 kb) was identified in A. missouriensis DSM 43046T (Rose and Fetzner, 2006), no plasmids were found in A. missouriensis 431T (Yamamura et al., 2012). Genetic tools are indispensable for molecular biological studies on A. missouriensis, but to date, no plasmid vector has been developed for genetic analysis of this bacterium. Moreover, no small circular plasmid has been reported to exist in the genus Actinoplanes or in a closely related genus Couchioplanes, although two small circular plasmids, pMZ1 (9.9 kb) and pMR2 (11.0 kb), were found in Micromonospora zionensis NRRL5466 and Micromonospora rosaria NRRL3718, respectively (Oshida et al., 1986). Hence, the aim of the present study was to construct plasmid vectors for gene expression in A. missouriensis. For this purpose, we investigated 57 Actinoplanes and two Couchioplanes strains for the presence of small circular plasmids. We identified and characterized a novel RCR plasmid, pCAZ1, from Couchioplanes caeruleus subsp. azureus. Using pCAZ1, we generated the Escherichia coli–A. missouriensis shuttle vectors, pCAM1 and pCAM2, which were introduced successfully into A. missouriensis using an E. colimediated conjugative transfer system. 2. Materials and methods 2.1. Bacterial strains, plasmids and media The A. missouriensis 431T strain (NBRC 102363T) was obtained from the National Institute of Technology and Evaluation (NITE, http://www.nite.go.jp/index-e.html). A. missouriensis was grown in Maltose–Bennett’s agar (0.2% meat extract, 0.1% yeast extract, 0.2% NZ amine, 1% maltose monohydrate, pH 7.0) or HAT agar (0.1% sucrose, 0.01% casamino acids, 0.05% K2HPO4, 0.2% humic acid, 10 mL trace element solution, pH 7.5) at 30 °C for solid cultures, and grown in PYM medium (0.5% Bacto™ peptone, 0.3% yeast extract, 0.1% MgSO4•7H2O, pH 7.0) at 30 °C for liquid cultures. Agar media contained 2% agar. The trace element solution contained 0.004% ZnCl2, 0.02% FeCl3•6H2O, 0.001% CuCl2•2H2O, 0.001% MnCl2•4H2O, 0.001% Na2B4O7•10H2O, 0.001% (NH4)6 Mo7O24•4H2O. HAT agar was used for sporangia formation. GYMC medium (0.4% glucose, 0.4% yeast extract, 1% malt extract, 0.2% CaCO3, pH 7.2) was used for conjugation with E. coli ET12567 (pUZ8002). E. coli ET12567 (pUZ8002) and pIJ773 were obtained from the John Innes Centre (Norwich, UK). E. coli JM109 used as a routine cloning host was purchased from Takara Biochemicals. The pBluescript SK(+) vector was purchased from Merck. The media and growth conditions for E. coli were those described by Maniatis et al. (1982). Apramycin (50 μg/mL), spectinomycin (50 μg/mL) and ampicillin (50 μg/mL) were added when necessary. 2.2. Search for small circular plasmids Supplementary Table S1 shows the details of the 57 Actinoplanes and two Couchioplanes strains obtained from

34

M.-S. Jang et al./Plasmid 77 (2015) 32–38

NITE. The strains were cultured in 5 mL of Bennett’s medium (0.1% beef extract, 0.1% yeast extract, 0.2% NZ amine, 1% glucose, pH 7.3) at 30 °C for 5–7 days. Mycelia were collected by centrifugation and frozen for storage. After storage, mycelia were washed twice with 0.3 M sucrose and DNA was extracted from them using a GenElute™ Plasmid Miniprep kit (Sigma-Aldrich) according to the manufacturer’s instructions. DNA samples were analyzed by electrophoresis on 0.8% agarose gels.

2.3. Isolation of pCAZ1 C. caeruleus subsp. azureus was cultured in 100 mL of Glucose–Bennett’s broth (0.2% meat extract, 0.1% yeast extract, 0.2% NZ amine, 1% glucose, pH 7.0) at 30 °C for 5 days. Mycelia were collected by centrifugation and suspended in 7 mL of solution I (0.3 M sucrose, 25 mM TrisHCl pH 8.0, 25 mM EDTA, 5 mg/mL lysozyme, 1 μg/mL RNase A) followed by incubation at 37 °C for 30 min. Next, 14 mL of solution II (0.2 M NaOH, 1% SDS) was added and the mixture was incubated at 50 °C for 30 min and then on ice for 10 min. Then, 10.5 mL of solution III (3 M potassium acetate) was added and the mixture was incubated on ice for 10 min. After addition of 1 mL of chloroform, the mixture was vigorously shaken by a vortex mixer and centrifuged at 15,000 rpm for 30 min. The supernatant containing the plasmid DNA was transferred to a fresh tube. Next, the plasmid DNA was purified twice using a CsCl2 density gradient centrifugation method as follows. DNAs in the supernatant were precipitated by isopropanol and resuspended in 2.6 mL TE (10 mM Tris, 1 mM EDTA, pH 8.0) containing 2.3 g of CsCl2 and 1.5 mg of ethidium bromide. The DNA solution was ultracentrifuged at 300,000 × g for 6 h (Optima™ TLX, Beckman Coulter), after which the plasmid DNA band visualized with ultraviolet light was extracted using a syringe. Ethidium bromide was removed from the DNA solution with CsCl2 saturated isopropanol. The plasmid DNA obtained was precipitated with ethanol and resuspended in a small amount of TE.

2.4. pCAZ1 nucleotide sequence The nucleotide sequence of pCAZ1 was determined by shotgun sequencing (Takara Biochemicals). The sequence has been deposited in the DNA Data Bank of Japan (DDBJ) under accession number AB981620.

2.5. Construction of pCAM1 and pCAM2 The 1.4-kb EcoRI–PstI fragment containing the apramycin resistant gene aac(3)IV and the origin of transfer (oriT) was obtained from pIJ773 and cloned into the EcoRI and PstI sites of pBluescript SK(+), resulting in pBlueaacAp. The ampicillin resistance gene (bla) was removed from pBlueaacAp by digestion with the blunt-ended cutters DraI and SspI followed by self-ligation, resulting in pBlueaac. pBlueaac and pCAZ1 were digested with SacII and ligated to each other resulting in pCAM1 and pCAM2, which contain the foreign DNA fragment in opposite orientations.

2.6. ssDNA detection C. caeruleus subsp. azureus was cultured in 200 mL of Glucose–Bennett’s medium at 30 °C for 6 days. The mycelia collected were suspended in 6 mL of solution I and incubated at 37 °C for 1 h. After addition of 0.1 mL of 20% SDS solution, the mixture was gently shaken and treated with pH neutral phenol–chloroform. The total DNA obtained was digested with S1 nuclease at 37 °C for 15 min. After separation by 0.8% agarose gel electrophoresis, the DNA molecules were transferred to a nylon membrane under nondenaturing conditions and analyzed by Southern blotting. The cazA DNA probe was PCR amplified using couchioplanes-F (5′-GTTCATCTGCGCTGCTCTGC-3′) and couchioplanes-R (5′-AGGCCCGCTTGATCGGGTT-3′) primers with pCAZ1 as the template, and labeled with [α-32P]dCTP (PerkinElmer) using a BcaBEST™ Labeling kit (Takara Biochemicals). 2.7. Plasmid copy number measurements A 1-kb fragment within the coding sequence of rpoB, which encodes the RNA polymerase β subunit, was PCR amplified using RNApol-F (5′-GGAATTCGCCGTACGTCGAGC GCTTAC-3′) and RNApol-R-1000 (5′-CCGAAGCTTCGCGGA CCTGGTTCTGGATG-3′) primers with A. missouriensis chromosomal DNA as the template. The amplified DNA was digested with EcoRI and HindIII and cloned into the EcoRI and HindIII sites of pCAM1, resulting in pCAM1-rpoB. pCAM1rpoB was introduced into E. coli ET12567 (pUZ8002), and then into A. missouriensis by conjugative transfer. Total DNA was extracted from A. missouriensis harboring pCAM1rpoB or pCAM2, and C. caeruleus subsp. azureus as follows. A. missouriensis transconjugants were cultivated in 200 mL of PYM at 30 °C for 3 days. C. caeruleus subsp. azureus was cultivated in 200 mL of Glucose–Bennett’s medium at 30 °C for 6 days. The mycelia were collected by centrifugation and suspended in 10 mL of TE containing 10% sucrose, 5 mg/mL lysozyme and 1 μg/mL RNase A. After incubation at 37 °C for 30 min, 1.2 mL of 20% SDS solution was added and the mixture was gently shaken and incubated at 60 °C for 10 min. Next, 4 mL of 5 M sodium chloride (NaCl), 2 mL of 5% cetyltrimethylammonium bromide and 10 mL of chloroform were added and the mixture was shaken in a rotator for over 1 h, followed by centrifugation. The supernatant was transferred to a fresh tube and the DNA molecules were precipitated with ethanol. The DNA pellet was suspended in 0.5 mL of TE, and 1 μL of 1 mg/mL of RNase A was added. After incubation at 37 °C for 30 min, the DNA solution was treated with pH neutral phenol–chloroform. Total DNA from the A. missouriensis transconjugants and C. caeruleus subsp. azureus was digested with NsbI and SacII, respectively. After separation by 1% agarose gel electrophoresis, the DNA molecules were transferred onto a nylon membrane under denaturing conditions and analyzed by Southern blotting. The rpoB probe was amplified using RNApol-F and RNApolR-500 (5′-CGGATCGGGATGACCTTGAC-3′) primers with pCAM1-rpoB as the template and then 32P-labeled using the same method described above for the cazA probe. The intensities of the DNA bands detected were quantified using QuantityOne software (Bio-Rad).

M.-S. Jang et al./Plasmid 77 (2015) 32–38

2.8. Intergeneric conjugation between E. coli and A. missouriensis

35

A SacII cazG

3. Results and discussion 3.1. Screening for small circular plasmids in Actinoplanes and Couchioplanes A small circular plasmid that replicates in A. missouriensis was required for the development of a host–vector system for A. missouriensis. Therefore, we searched 57 Actinoplanes and two Couchioplanes strains for small circular plasmids, as described in Section 2, Materials and methods. Note that the genus Couchioplanes is phylogenetically very close to Actinoplanes (Tamura et al., 1994). We found that C. caeruleus subsp. azureus harbored a plasmid of about 6 kb in length. We named this plasmid pCAZ1. Because the method used for detecting and isolating plasmids was not optimized for each strain, there is a possibility that some of the other strains tested herein may also have a plasmid. Furthermore, it is likely that low-copy-number plasmids were not detected by our method. pCAZ1 is not a low-copy-number plasmid in C. caeruleus subsp. azureus because its copy number was estimated to be 30 per chromosome (see below).

cazA cazF

pCAZ1

cazE

5,845 bp

cazD

cazB cazC

Ec Ec oR H oR I in V C dII la I I

B

ColE1 ori SacII

aac(3)IV oriT SacII

pCAM1

cazG

9,083 bp

cazA

cazF cazE cazD

cazB cazC

Cl a Hi I nd Ec III o Ec R V oR I

A donor E. coli ET12567 (pUZ8002) strain harboring pCAM1, pCAM1-rpoB, or pCAM2 was precultured in 2 mL of Luria–Bertani broth (LB) at 37 °C overnight. Then, 0.1 mL of the preculture was inoculated into 10 mL of LB medium (in a 50-mL tube) and incubated with shaking at 37 °C for 2.5–3 h. The cells were collected by centrifugation (3500 rpm, 5 min), washed twice with cold 0.75% NaCl, and resuspended in 1 mL of cold 0.75% NaCl. The A. missouriensis recipient strain was cultivated in 100 mL PYM at 30 °C for 1.5 days. The mycelia were collected by centrifugation (3500 rpm, 5 min), resuspended in 5 mL of cold 0.75% NaCl and partially fragmented with a sonicator (Heat SystemsUltrasonics Inc., model W-375) equipped with a tapered microtip (five times, 50% duty cycle, output of 3). The sonicated mycelia were collected by centrifugation at 3500 rpm for 5 min at room temperature and resuspended in 1 mL of cold 0.75% NaCl. For conjugation, 200 μL of the E. coli donor strain and 200 μL of A. missouriensis recipient strain were mixed and spread onto GYMC agar medium. After 18– 24 h, the plate was overlaid with 1 mL of filtered dH2O containing 50 μg/mL spectinomycin (A. missouriensis is intrinsically resistant to spectinomycin) and 50 μg/mL apramycin. After 5–10 days, colonies of transconjugants were formed; these were picked up with sterilized toothpicks and inoculated onto agar medium containing spectinomycin and apramycin.

ColE1 ori

aac(3)IV oriT SacII cazA

SacII

pCAM2

cazG

9,083 bp

cazF cazE cazD

cazB cazC

Fig. 1. Schematic representation of plasmids. (A) pCAZ1 was isolated from C. caeruleus subsp. azureus. (B) pCAM1 and pCAM2 were constructed in this study.

3.2. Nucleotide sequencing of pCAZ1 isolated from Couchioplanes caeruleus subsp. azureus We isolated and purified a large amount of pCAZ1 from C. caeruleus subsp. azureus and determined its complete nucleotide sequence. pCAZ1 comprises a 5845-bp circular molecule with a G + C content of 67.5%. Frame Plot analysis (Ishikawa and Hotta, 1999) predicted seven open reading

frames (cazA to cazG) in pCAZ1 (Fig. 1A and Table 1). However, genes encoding antibiotic or heavy metal resistance proteins were not found, indicating that pCAZ1 is a cryptic plasmid. Although we found no genes encoding proteins that share >30% sequence identity with replication proteins (Rep), CazC

36

M.-S. Jang et al./Plasmid 77 (2015) 32–38

Table 1 Open reading frames in pCAZ1. ORF ID

Size (aa)

BLAST best hit

Organism

Identity (%)

CazA CazB CazC CazD CazE CazF CazG

252 133 516 112 67 142 260

Hypothetical protein Chromosome partitioning protein Hypothetical protein Hypothetical protein No hit Hypothetical protein Transcriptional regulator

Actinoplanes globisporus Salinispora pacifica Streptomyces sp. x4 Salinispora arenicola CNS-205

57 70 52 56

Salinispora pacifica Nocardia farcinica IFM 10152

67 62

shares 25% sequence identity with a putative Rep of pXAG82 isolated from Xanthomonas axonopodis (Kim et al., 2006). In fact, CazC contains three sequence motifs conserved among Reps of RCR plasmids (Fig. 2). Furthermore, seven repeats of TACTGAH (H: T, A, or C) and an inverted repeat were found in the intergenic region between cazA and cazB (Fig. 3). The repeat sequences are likely to be the bind sites where the Rep protein binds, while the inverted repeat appears to be the nick site where the Rep protein introduces a nick to initiate the replication process (Moscoso et al., 1995). Therefore, this region appears to be the dso of pCAZ1. Taken together, these results suggested that pCAZ1 is a RCR plasmid. The sso, where host proteins initiate conversion of the parental plus strand ssDNA into dsDNA, could not be predicted, because sso regions are not conserved among RCR plasmids (Khan, 2005).

motif I

motif II

pCAZ1 209- MVTLTYPG 260- APHFHLLMV pUB110 125- FLTLTVKN 105- NQHMHVLVC pAP1 181- MLTLTGRH 240- MVHSHVLII pIJ101 63- LVTFTARH 149- HPHIHAIVL

motif III 337- VAVYFTKHGS 246- YAKYPVKDTD 315- IGNYVSKMQT 226- LAEYLAKTQD

Fig. 2. Alignment of sequence motifs I, II, and III of CazC with those of other RCR plasmids (pUB110, pAP1, and pIJ101). Residues conserved among all the proteins are highlighted. pUB110, pAP1, and pIJ101 were isolated from Staphylococcus aureus, Arcanobacterium pyogenes, and Streptomyces lividans, respectively (Billington et al., 1998; Kieser et al., 1982; Lacey and Chopra, 1974). pUB110, pAP1, and pIJ101 belong to the Rep_1 family (Lorenzo-Díaz et al., 2014). The two conserved His residues in motif II are required for metal-binding, while the Tyr residue in motif III is involved in nucleophilic attack on plasmid DNA during replication initiation (del Solar et al., 1998).

3.3. Detection of single-stranded replication intermediates of pCAZ1 In the process of RCR plasmid replication, ssDNA is generated as a replication intermediate. To confirm that pCAZ1 replicates by the RCR mechanism, we tried to detect ssDNA in pCAZ1 in C. caeruleus subsp. azureus. Total DNA was extracted from C. caeruleus subsp. azureus under nondenaturing conditions and analyzed by Southern hybridization using a 32P-labeled cazA probe capable of detecting pCAZ1 DNA. Signals derived from ssDNA from pCAZ1 were clearly detected in the sample that had not been treated with S1 nuclease (Fig. 4). When the DNA samples were treated with S1 nuclease, which digests only ssDNA, the signals were greatly reduced (Fig. 4). Note that dsDNA from pCAZ1 was not detected in this experiment because the DNA was not denatured. From this result and that of the in silico analysis described above, we concluded that pCAZ1 is a RCR plasmid. 3.4. Construction of pCAM1 and pCAM2 We constructed two E. coli–A. missouriensis shuttle vectors, pCAM1 and pCAM2, as described in Section 2, Materials and methods (Fig. 1B). These 9-kb vectors contain the apramycin resistance gene aac(3)IV, the origin of transfer oriT, the ColE1 origin of replication, and pCAZ1. In pCAM1 and pCAM2, the foreign DNA fragment containing aac(3)IV, oriT, and the ColE1 origin was inserted into pCAZ1 in opposite directions. Both plasmids have a series of EcoRI, EcoRV, HindIII and ClaI sites at a position where a foreign DNA fragment can be inserted for gene cloning (Fig. 1B). pCAM1 and pCAM2 were successfully introduced into A. missouriensis by E. coli-mediated conjugative transfer. We obtained two

TGAACAGCAGGGCGCCTCGACACCGGCTGTGTGCCAGGTCAAGGCGCATCTACTGATCTACTGATTTACT GATTTGTTTAGTCGATGAGGGTCGACCCGGAGGCCTGGCGTTCGCGCTCGGCGGCCTTGTGGGTTGACCT GGACGTGAGCCCTCTCCCTCGGCTATCAGTATATCAGCATATACTGATATACTGAAGTACTGACTTACTG ATCCTTTCGGAGATCATCCAAGATCAGCTTGGTGAGGACCTCGTCGGAGAGCACCCGGCCTACCAGTGCG TTCAGCGCCTCTTGTTTGGTGACCCGGGCACGGCCGAGCCGGACTGCCGCCTCGGCGAGCCAGGCCTGGA AGTCCCGGTTGCGGGCCGGGCTCAGGTCGAGGGTGGTCCGGACCGGCTTGGCCAGCGGAGCCTCA Fig. 3. Nucleotide sequence of the dso-containing intergenic region between cazA and cazB. cazA and cazB stop codons are underlined and double underlined, respectively. Predicted bind sequences are indicated by boxes. An inverted repeat containing the probable nick site is indicated by arrows.

M.-S. Jang et al./Plasmid 77 (2015) 32–38

EtBr M

0

32P

20 50

0

20 50 S1 [U]

(kb)

37

tion of the putative Rep-encoding cazC and/or other gene(s) required for pCAZ1 replication. 3.5. Determination of pCAM1 and pCAM2 copy numbers

23.1 9.4 6.6 4.4 -

0.5 0.3 -

Fig. 4. Detection of the ssDNA generated during pCAZ1 replication. Total DNA from C. caeruleus subsp. azureus (with or without S1 nuclease digestion; S1 nuclease [unit] added to a sample is shown above the panels) was analyzed by Southern blotting using a 32P-labeled cazA probe. Signals derived from pCAZ1 ssDNA were clearly detected when the sample had not been treated with S1 nuclease (which digests ssDNA). pCAZ1 dsDNA was not detected because the DNA was not denatured in this experiment. Bands that migrated to high molecular-weight positions (>23.1 kb) should be derived from chromosomal DNA. Bands that migrated to low molecularweight positions (<0.3 kb) should be derived from RNA. Lane M: DNA size markers.

to seven transconjugants carrying either of the plasmids, when approximately 7 × 107 colony-forming units of fragmented mycelia were used. Therefore, the frequency of conjugative transfer was estimated to be approximately 10−7. We confirmed that pCAM1 extracted from the A. missouriensis transconjugant was identical to the original pCAM1 using agarose gel electrophoresis of the SacIIdigested plasmid DNA (data not shown). We were unable to introduce a cazG-deleted derivative of pCAM1 into A. missouriensis, indicating that cazG is essential for pCAZ1 replication (data not shown). CazG is a transcriptional regulator homolog. Therefore, CazG may be essential for transcrip-

A

EtBr M 1 2

A 1-kb DNA fragment within rpoB, which encodes the RNA polymerase β subunit and is present at a single copy per chromosome, was PCR amplified and ligated to the EcoRI and HindIII sites of pCAM1, resulting in pCAM1-rpoB. pCAM1 and pCAM1-rpoB were introduced into A. missouriensis, and the total DNA content of each transconjugant was extracted. Total DNA was digested with NsbI, and the rpoBcontaining DNA fragments derived from both the chromosomal DNA and pCAM1-rpoB were detected by Southern hybridization using a 32P-labeled rpoB probe (Fig. 5A). The results showed that the signal intensities of the rpoB-containing fragments from the chromosomal DNA and pCAM1-rpoB were almost identical. From this, we concluded that the copy number of pCAM1-rpoB was 1 per chromosome in A. missouriensis under the conditions used in this experiment. The copy numbers of pCAM1 and pCAM2 in A. missouriensis and pCAZ1 in C. caeruleus subsp. azureus were determined using the single-copy plasmid pCAM1-rpoB as a standard. Total DNA was extracted from the three A. missouriensis transconjugants harboring pCAM1, pCAM1rpoB, or pCAM2 as well as from C. caeruleus subsp. azureus. Equal amounts of total DNA from these samples were digested with NsbI (for the A. missouriensis transconjugants) or SacII (for C. caeruleus subsp. azureus), and the cazAcontaining DNA fragments derived from pCAM1, pCAM1rpoB, pCAM2 and pCAZ1 were detected by Southern hybridization using a 32P-labeled cazA probe (Fig. 5B). The signal intensities quantified from pCAM1, pCAM2, and pCAZ1 relative to the signal intensity of pCAM1-rpoB were 1.0, 4.1, and 32, respectively. From this result, we concluded that the copy numbers of pCAM1 and pCAM2 in A. missouriensis and pCAZ1 in C. caeruleus subsp. azureus were 1, 4, and 30 per

B

32P

3

5

4

EtBr 6 7

32P

8

9 10 11 12

(kb) 23.19.4 6.6 -4.4

-plasmid DNA -chromosomal DNA

Fig. 5. Plasmid copy number determination. (A) Total DNA was extracted from A. missouriensis harboring pCAM1 or pCAM1-rpoB. DNAs digested with NsbI were analyzed by Southern blotting using a 32P-labeled rpoB probe. A signal derived from plasmid DNA was not detected in the sample containing total DNA from A. missouriensis harboring pCAM1 (negative control). The signal intensity quantified for plasmid DNA relative to that of chromosomal DNA was 1.1. Lanes 1 and 3, pCAM1; lanes 2 and 4, pCAM1-rpoB; lane M, DNA size markers. (B) Total DNA was extracted from three A. missouriensis strains harboring pCAM1, pCAM1-rpoB, or pCAM2, and from C. caeruleus subsp. azureus. Total DNA extracted from A. missouriensis and C. caeruleus subsp. azureus was digested with NsbI and SacII, respectively, and analyzed by Southern blotting using a 32P-labeled cazA probe. The signal intensities quantified for pCAM1, pCAM2, and pCAZ1 relative to that of pCAM1-rpoB were 1.0, 4.1, and 32, respectively. Lanes 5 and 9, pCAM1-rpoB; lanes 6 and 10, pCAM1; lanes 7 and 11, pCAZ1; lanes 8 and 12, pCAM2. Note that pCAZ1 is visible as a band in lane 7 after ethidium bromide (EtBr) staining.

38

M.-S. Jang et al./Plasmid 77 (2015) 32–38

chromosome, respectively, under the conditions used. The copy number difference observed between pCAM1 and pCAM2 was unexpected because they have the same size and gene content; the only difference between them is the orientation of the inserted DNA fragment in pCAZ1. We speculate that this difference affected gene expression in the region derived from pCAZ1, resulting in the change of copy number observed. Additionally, the number of copies of pCAM1 and pCAM2 in A. missouriensis was much lower than the number of copies of pCAZ1 in the original host (C. caeruleus subsp. azureus). Copy number control of pCAZ1 (or its derivatives) may differ between C. caeruleus subsp. azureus and A. missouriensis. Alternatively, the lower copy number observed may be caused by insertion of the foreign DNA fragment into pCAZ1, which increased the size of the plasmid and possibly decreased its stability in vivo. 4. Conclusions C. caeruleus subsp. azureus harbors pCAZ1, a circular RCR plasmid of 5845-bp. The pCAZ1 copy number is 30 per chromosome. CazC seems to be the Rep of pCAZ1. To the best of our knowledge, pCAZ1 is the first plasmid isolated from the genus Couchioplanes. Using pCAZ1, two E. coli–A. missouriensis shuttle vectors, pCAM1 and pCAM2, were constructed. The copy numbers of pCAM1 and pCAM2 in A. missouriensis are 1 and 4 per chromosome, respectively. These shuttle vectors have the potential to be useful tools for homologous and heterologous gene expression studies in A. missouriensis. As far as we are aware, this is the first report of plasmid vectors that can replicate in A. missouriensis. Acknowledgments We are very grateful to the late Prof. Sueharu Horinouchi for his supervision at the beginning of this work. This project was supported in part by the Funding Program for Next Generation World-Leading Researchers from the Bureau of Science, Technology, and Innovation Policy, Cabinet Office, Government of Japan (GS006 to Y.O.), and Japan Society for the Promotion of Science (JSPS) Grants-in-Aid for Scientific Research (A) (26252010 to Y.O.) and Young Scientists (B) (25850046 to T.T.). Appendix: Supplementary Material Supplementary data to this article can be found online at doi:10.1016/j.plasmid.2014.12.001. References Billington, S.J., Jost, B.H., Songer, J.G., 1998. The Arcanobacterium (Actinomyces) pyogenes plasmid pAP1 is a member of the pIJ101/ pJV1 family of rolling circle replication plasmids. J. Bacteriol. 180, 3233–3236.

Couch, J.N., 1954. The genus Actinoplanes and its relatives. Trans. N. Y. Acad. Sci. 16, 315–318. del Solar, G., Moscoso, M., Espinosa, M., 1993. Rolling circle-replicating plasmids from gram-positive and gram-negative bacteria: a wall falls. Mol. Microbiol. 8, 789–796. del Solar, G., Giraldo, R., Ruiz-Echevarría, M.J., Espinosa, M., Díaz-Orejas, R., 1998. Replication and control of circular bacterial plasmids. Microbiol. Mol. Biol. Rev. 62, 434–464. Espinosa, M., del Solar, G., Rojo, F., Alonso, J.C., 1995. Plasmid rolling circle replication and its control. FEMS Microbiol. Lett. 130, 111–120. Hayakawa, M., Tamura, T., Nonomura, H., 1991. Selective isolation of Actinoplanes and Dactylosporangium from soil by using γ-collidine as the chemoattractant. J. Ferment. Bioeng. 72, 426–432. Hayakawa, M., Otoguro, M., Takeuchi, T., Yamazaki, T., Iimura, Y., 2000. Application of a method incorporating differential centrifugation for selective isolation of motile actinomycetes in soil and plant litter. Antonie Van Leeuwenhoek 78, 171–185. Ishikawa, J., Hotta, K., 1999. FramePlot: a new implementation of the frame analysis for predicting protein-coding regions in bacterial DNA with a high G + C content. FEMS Microbiol. Lett. 174, 251–253. Jain, A., Srivastava, P., 2013. Broad host range plasmids. FEMS Microbiol. Lett. 348, 87–96. Khan, S.A., 2005. Plasmid rolling-circle replication: highlights of two decades of research. Plasmid 53, 126–136. Kieser, T., Hopwood, D.A., Wright, H.M., Thompson, C.J., 1982. pIJ101, a multi-copy broad host-range Streptomyces plasmid: functional analysis and development of DNA cloning vectors. Mol. Gen. Genet. 185, 223–228. Kim, J.G., Choi, S., Oh, J., Moon, J.S., Hwang, I., 2006. Comparative analysis of three indigenous plasmids from Xanthomonas axonopodis pv. glycines. Plasmid 56, 79–87. Lacey, R.W., Chopra, I., 1974. Genetic studies of a multi-resistant strain of Staphylococcus aureus. J. Med. Microbiol 7, 285–297. Lorenzo-Díaz, F., Fernández-López, C., Garcillán-Barcia, M.P., Espinosa, M., 2014. Bringing them together: plasmid pMV158 rolling circle replication and conjugation under an evolutionary perspective. Plasmid 74, 15–31. Makkar, N.S., Cross, T., 1982. Actinoplanetes in soil and on plant litter from freshwater habitats. J. Appl. Bacteriol. 52, 209–218. Maniatis, T., Fritsch, E.F., Sambrook, J., 1982. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. Moscoso, M., del Solar, G., Espinosa, M., 1995. In vitro recognition of the replication origin of pLS1 and of plasmids of the pLS1 family by the RepB initiator protein. J. Bacteriol. 177, 7041–7049. Oshida, T., Takeda, K., Yamaguchi, T., Ohshima, S., Ito, Y., 1986. Isolation and characterization of plasmids from Micromonospora zionensis and Micromonospora rosaria. Plasmid 16, 74–76. Palleroni, N.J., 1980. A chemotactic method for the isolation of Actinoplanaceae. Arch. Microbiol. 128, 53–55. Rose, K., Fetzner, S., 2006. Identification of linear plasmid pAM1 in the flavonoid degrading strain Actinoplanes missouriensis(T) (DSM 43046). Plasmid 55, 249–254. Subramani, R., Aalbersberg, W., 2013. Culturable rare Actinomycetes: diversity, isolation and marine natural product discovery. Appl. Microbiol. Biotechnol. 97, 9291–9321. te Riele, H., Michel, B., Ehrlich, S.D., 1986. Single-stranded plasmid DNA in Bacillus subtilis and Staphylococcus aureus. Proc. Natl. Acad. Sci. U.S.A. 83, 2541–2545. Tamura, T., Nakagaito, Y., Nishii, T., Hasegawa, T., Stackebrandt, E., Yokota, A., 1994. A new genus of the order Actinomycetales, Couchioplanes gen. nov., with descriptions of Couchioplanes caeruleus (Horan and Brodsky 1986) comb. nov. and Couchioplanes caeruleus subsp. azureus subsp. nov. Int. J. Syst. Bacteriol. 44, 193–203. Tiwari, K., Gupta, R.K., 2013. Diversity and isolation of rare actinomycetes: an overview. Crit. Rev. Microbiol 39, 256–294. Uchida, K., Jang, M.S., Ohnishi, Y., Horinouchi, S., Hayakawa, M., Fujita, N., et al., 2011. Characterization of Actinoplanes missouriensis spore flagella. Appl. Environ. Microbiol. 77, 2559–2562. Yamamura, H., Ohnishi, Y., Ishikawa, J., Ichikawa, N., Ikeda, H., Sekine, M., et al., 2012. Complete genome sequence of the motile actinomycete Actinoplanes missouriensis 431(T) (=NBRC 102363(T)). Stand. Genomic Sci 7, 294–303.