- Email: [email protected]
JNK signaling pathway is required for bFGF-mediated surface cadherin downregulation on HUVEC
E XP E RI ME N TA L CE LL RE S EA RCH 3 14 ( 20 0 8 ) 4 2 1 –42 9
a v a i l a b l e a t w w w. s c i e n c e d i r e c t . c o m
w w w. e l s e v i e r. c o m / l o c a t e / y e x c r
Research Article
JNK signaling pathway is required for bFGF-mediated surface cadherin downregulation on HUVEC Jen-Chine Wua , Horng-Chin Yanb , Wei-Teing Chenb , Wei-Hwa Chend , Chia-Jen Wanga , Ying-Chih Chib , Woei-Yau Kaoc,⁎ a
Graduate Institute of Life Science, National Defense Medical Center, Taipei, Taiwan Division of Pulmonary and Critical Care Medicine, Tri-Service General Hospital, Taipei, Taiwan c Division of Hematology-Oncology, Department of Medicine, Tri-Service General Hospital, Taipei, Taiwan d Department of Obstetrics and Gynecology, Tri-Service General Hospital, Taipei, Taiwan b
ARTICLE INFORMATION
ABS T R AC T
Article Chronology:
Angiogenesis, the process of new blood vessel formation, is important in wound healing,
Received 22 January 2007
inflammation, tumorigenesis and metastases. During this process, it is a critical step of the
Revised version received
loosening of cellular interactions between endothelial cells, which are dependent on the
23 September 2007
architecture of adherens junction constructed by homophilic interactions of cell surface
Accepted 2 October 2007
cadherins. Several studies suggested that the dynamic changes of cadherins are necessary
Available online 6 October 2007
during angiogenesis. However, the mechanism of cadherins regulation on endothelial cells requires further delineation. Here, we showed that basic fibroblast growth factor (bFGF), a
Keywords:
pivotal pro-angiogenic factor, can downregulate typical cadherins (E-, N-, P- and VE-cadherin)
Angiogenesis
expression on the surface of human umbilical vein endothelial cells (HUVECs) via FGF receptor
Endothelial cells
1 (FGFR1) signaling. The bFGF-mediated surface cadherin downregulation was significantly
bFGF
reversed only when the HUVECs were treated with JNK inhibitor (SP600125), but not ERK
Cadherin
(PD98059) or p38 inhibitor (SB203580). Infecting HUVECs with a dominant negative H-Ras
JNK
mutant (RasS17N) interferes bFGF-mediated cadherin downregulation, and the result suggests that bFGF attenuates surface cadherin expression on HUVECs via FGFR1 and intracellular RasJNK signaling. However, after growth factors withdrawal, FGFR1 blockade or JNK inhibition for 16 h, cadherins were re-expressed on cell surface of HUVECs. But the mRNA or total protein of cadherins had no significant change, suggesting that the effect of bFGF on cadherin expression may work through a post-translational control. Our data first suggest that JNK participates in bFGF-mediated surface cadherin downregulation. Loss of surface cadherins may affect the cell– cell interaction between endothelial cells and facilitate angiogenesis. © 2007 Elsevier Inc. All rights reserved.
Introduction Angiogenesis, the formation of new capillaries from preexisting blood vessels, plays a critical role in embryogenesis, inflammation, wound healing, tumorigenesis and metastasis. The ultrastructural changes in the endothelium during angio-
genesis include basement membrane breakdown, loosening of cell–cell and cell–matrix interaction, migration, proliferation and differentiation. Following proangiogenic stimulation, the dynamic cell–cell and cell–matrix interactions produce rapid changes in cell shape and vascular architecture. Changes in cell–cell and cell–matrix adhesions are critical responses and
⁎ Corresponding author. E-mail address: [email protected] (W.-Y. Kao). 0014-4827/$ – see front matter © 2007 Elsevier Inc. All rights reserved. doi:10.1016/j.yexcr.2007.10.002
422
E XP ER I ME NT A L C EL L RE S EA R CH 3 14 ( 20 0 8 ) 4 2 1 –42 9
contribute to endothelial cell motility and cytoskeletal reorganization [1–3]. However, it is not fully understood how cell–cell and cell–matrix interactions are disrupted by proangiogenic factors during angiogenesis. The cell adhesion molecules (CAMs) mediate most cell–cell interaction and modulate cell motility by affecting adhesion strength, cytoskeletal organization, contractility and cell shape [4]. The cadherin family of CAMs is important in cell adhesion, morphogenesis, cytoskeletal organization, cell sorting and migration [5]. The classical cadherins, including epithelial (E)-, neural (N)-, placental (P)- and vascular endothelial (VE)-cadherin, are single-span transmembrane proteins and contribute to calcium-dependent cell–cell adhesion through homophilic interaction [6,7]. Simultaneously, the intracellular domain of cadherin binds coherent partners such as α-catenin, β-catenin, plakoglobin (γ-catenin) and vinculin and links to actin filament network [8]. The architecture of the cadherin–catenin–actin complex forms the adherens junction and maintains the blood vessel integrity. For example, the embryos of VE-cadherin knockout mouse exhibit severely impaired assembly of vascular structures [9,10]. In vitro studies have demonstrated that VE-cadherin participates in endothelial cell adhesion, capillary tube formation, leukocyte extravasation and tumor angiogenesis [11–16]. These observations suggested that VE-cadherin is required for angiogenesis and the maintenance of capillary tubular architecture. On the other way, the strength of the cadherin-mediated cell–cell interaction is reduced in certain special situations. Downregulation of N-cadherin has been shown to stimulate the migration of human arterial smooth muscle cells [17]. VEcadherin is eliminated from the surface of endothelial cells during bFGF-induced angiogenesis [18,19]. In addition, during VEGF-stimulated capillary tube formation of confluent human umbilical vein endothelial cells (HUVECs), VE-cadherin and βcatenin are rapidly lost from the cell–cell contacts during the initial phase of angiogenesis and reconstituted later [20]. These observations suggest that the destruction of cadherin-mediated adherens junctions on endothelial cell surface may be necessary in the initial step of angiogenesis [21]. In the present study, we demonstrate that bFGF is a powerful mediator to downregulate the typical cadherin expression on the surface of HUVECs. Our data also demonstrate that bFGF attenuates surface cadherin expression by interacting with FGFR1, which leads to the activation of intracellular Ras and JNK signaling pathways. However, there are no significant changes in the levels of cadherin mRNA or total protein, suggesting that bFGF may regulate surface expression and cellular localization of cadherins through a post-translational control. In summary, our results suggest that bFGF-induced JNK activation may mediate endothelial cells mobilization by attenuating surface cadherins expression; this mechanism may play an important role in angiogenesis.
Materials and methods Reagents and antibodies Cell culture reagents were purchased from Invitrogen (Carlsbad, CA, USA). Fetal bovine serum (FBS) was obtained from
Hyclone (Logan, UT, USA). PD98059, SB203580 and SP600125 were obtained from Sigma (St. Louis, MO, USA) and SU5402 from Calbiochem (Darmstadt, Germany). The following antibodies against the cadherin extracellular domain were used in flow cytometric analysis: E-cadherin (67A4), N-cadherin (H-63) and P-cadherin (N-19) were obtained from Santa Cruz Biotechnology (Santa Cruz, CA, USA) and VE-cadherin from R&D Systems (Minneapolis, MN, USA). The antibodies against cytoplasmic domain of cadherins were used in Western blot: E-cadherin (4A2C7), N-cadherin (3B9) and P-cadherin (12H6) were obtained from Zymed Laboratories; VE-cadherin (F-8) was from Santa Cruz Biotechnology. Anti-β-actin antibody was obtained from Sigma. All secondary antibodies were purchased from Santa Cruz Biotechnology. Unless otherwise stated in the text, all other chemicals were purchased from Sigma and were of the highest grade available.
Cell culture Primary cultures of HUVECs were isolated from fresh human umbilical cord veins and maintained in EGM2 BulletKit (Cambrex, East Rutherford, NJ, USA) containing 2% FBS, bFGF, VEGF, insulin-like growth factor-1 (IGF-1), epithelial growth factor (EGF), hydrocortisone and heparin. In some situation, HUVECs were cultured in M199 basal medium containing penicillin/ streptomycin and supplemented with 20% FBS. HUVECs were attached on 2% gelatin-coated dish and detached by incubating with 0.5% Trypsin/5.37 mM EDTA for 1 min at room temperature. Only passages four to six of the HUVECs were used for experiments in this study. Rhabdomyosarcoma TE671 was used to generate lentivirus and maintained in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% FBS and 1% penicillin/streptomycin. All cells were incubated at 37 °C in a humidified incubator with 5% CO2.
Flow cytometric analysis of surface cadherin expression After cultured in different conditions, HUVECs were harvested by incubating in 5.3 mM EDTA (pH 7.4) for 10 min at 37 °C and then resuspended at 5 × 105 cells/ml phenol red-free RPMI 1640 medium for 10 min on ice. Cells were incubated with primary monoclonal antibody for 60 min on ice, washed twice with PBS/1% bovine serum albumin (BSA) and then detected with a FITC- or PE-labeled secondary anti-mouse (E-, N- and VEcadherin) or anti-goat antibody (P-cadherin) for 15 min on ice. The stained cells were washed twice and fixed in 2% formaldehyde–PBS solution. Fluorescence of cells was detected using a FACSCalibur immunocytometry system (BD Biosciences, Palo Alto, CA, USA).
Semiquantitative and quantitative real-time RT-PCR analysis of cadherin and catenin mRNA levels Total RNA of HUVECs was obtained by the TRIzol reagent standard procedure (Invitrogen) and reverse transcribed using the SuperScript™ III First-Strand Synthesis System (Invitrogen) in the presence of 2.5 μg/ml oligo dT. The first-strand cDNA was quantified by spectrophotometry at OD 260 nm and amplified with the respective primers for an optimal number of PCR cycles. The sequence of primers modified for using in
E XP E RI ME N TA L CE LL RE S EA RCH 3 14 ( 20 0 8 ) 4 2 1 –42 9
PCR amplification of cadherin, catenin and GAPDH [22] is 5′TCCATTTCTTGGTCTACGCC and 5′-CACCTTCAGCCATCCTGTTT for E-cadherin; 5′-GTGCCATTAGCCAAGGGAATTCAGC and 5′GCGTTCCTGTTCCACTCATAGGAGG for N-cadherin; 5′-GACCAACGAGGCCCCTTTTGTGCTG and 5′-GTGGTGGGAGGGCTTCCATTGTCCA for P-cadherin; 5′-AACTTCCCCTTCTTCACCC and 5′-AAAGGCTGCTGGAAAATG for VE-cadherin; 5′-CAGAGGGAGCATGACTTCGG and 5′-CTACAGCAGCCACCAACTCT for α2-catenin; 5′-AAGGTCTGAGGAGCAGCTTC and 5′-TGGACCATAACTGCAGCCTT for β1-catenin; 5′-ATGGAGGTGATGAACCTGATGG and 5′-CCTGACACACCAGAGCACAT for γ-catenin; 5′-CCAGCCGAGCCACATCGCTC and 5′-ATGAGCCCCAGCCTTCTCCAT for GAPDH. After being fully denatured at 94 °C for 3 min, the PCR mixtures were followed by denaturing at 94 °C for 30 s, annealing at 60 °C for E-, N-, P- and VE-cadherin for 30 s and at 50 °C for α-, β-, γ-catenin and GAPDH for 30 s and polymerizing at 72 °C for 1 min. Finally, a full extension at 72 °C for 10 min was performed. The samples were loaded at equal volumes onto 2% agarose gels and visualized with ethidium bromide. The levels of cadherins mRNA were also quantified by quantitative real-time PCR, which was performed as manufacturer's instructions of iQ™ SYBR green supermix (Bio-Rad, CA, USA). After optimizing PCR condition, the expression levels of cadherin mRNA were presented as the cycle of threshold (Ct) value and normalized to GAPDH. All data were performed in triplicate and showed as means ± SD.
Recombinant lentiviral vector construction, lentivirus production and infection To generate the lentiviral vector carrying the dominant negative H-RasS17N, the full length of human H-RasS17N was amplified by PCR using the primers (5′-TAATACGACTCACTATAGGG and 5′-AGAAGGCACAGTCGAGGCT) from plasmid pcDNA3.1+/CMV-H-RasS17N [23] (kindly provided by Professor S.Y. Jiang, Department of Medical Education and Research, Buddhist Tzu Chi General Hospital, Taipei, Taiwan, ROC) and cloned by pGEM-T Easy Vector Systems (Promega, Madison, WI, USA). The EcoRI fragment of H-RasS17N/pGEMT was subsequently cloned in frame into pTY-EF (kindly provided by Professor H.K. Sytwu, Department of Microbiology and Immunology, National Defense Medical Center, Taipei, Taiwan, ROC) to generate a lentiviral transducing vector containing the EF1α promoter, named pTY-EF-HRasS17N . A green fluorescence protein (GFP) expression vector pTY-EF-GFP was used to estimate reference titers [24]. Lentiviral vectors were produced by using a transient cotransfection system modified from the method of L.J. Chang and A.K. Zaiss [24]. Briefly, 7 × 105 TE671 cells were transfected with 1.8 μg of the packaging plasmid pHP-dl-N/ A, 0.3 μg of the G glycoprotein of vesicular stomatitis virus (VSV-G) envelope plasmid pHEF-VSVG, 0.2 μg of the human immunodeficiency virus-1 (HIV-1) Tat expression plasmid pCEP4-Tat and 1 μg of the transducing plasmid pTY-EFHRasS17N or pTY-EF-GFP (pHP-dl-N/A, pHEF-VSVG and pCEP4-Tat were the kind gifts of H.K. Sytwu). Three harvests of conditioned medium containing recombinant lentivirus which is carrying H-RasS17N (LtRasS17N) or GFP (LtGFP) were collected at 48–72 h later and concentrated by ultracentrifugation at 4 °C.
423
To assess the relative titers of LtRasS17N, about 1 × 105 HUVECs were seeded into each well of gelatin-coated six-well plate with 3 ml of EGM2 medium containing 4 μg/ml polybrene (Sigma). The cells were infected with serial dilutions of LtGFP for 72 h, and the GFP-positive cells were counted using a FACSCalibur immunocytometry system (BD Biosciences). Transduction units per milliliter (TUs/ml) were calculated as (1 × 105) × (percentage of GFP-positive cells) / (the volume of virus added). TUs of LtGFP were used to optimize the condition of LtRasS17N infection.
Western blot analysis Following different treatment, HUVECs were washed twice with ice-cold PBS and lysed in lysis buffer (50 mM HEPES, 150 mM NaCl, 0.1 mM EDTA, 1 mM CaCl2, 1 mM MgCl2, 1% Triton X-100, 0.1% SDS, 0.5% deoxycholate, 100 mM NaF, 3 mM Na3VO4 and protease inhibitor), solubilized by ultrasonic cell disruptor (Misonix) on ice and centrifuged at 13,000×g for 5 min at 4 °C. The protein concentration of samples was quantified by BCA protein assay kit (PIERCE). After heated for 7 min at 95 °C with 5× SDS–PAGE sampling buffer, proteins were electrophoresed on 12% SDS–PAGE gels. Following the transference onto a PVDF membrane, proteins were immunoblotted with antibodies against E-, N-, P-, VE-cadherin and β-actin, respectively. The immunoblotted proteins were then incubated with a secondary Ab conjugated to horseradish peroxidase (HRP) and visualized by the LumiGLO chemiluminescent peroxidase substrate (KPL).
Results bFGF inhibits surface cadherin expression on HUVECs Although adherens junction maintains endothelial cells integrity by increasing cell–cell adhesion [1], the breakdown of adherens junction is required to initiate angiogenesis [18–20]. The decrease of cadherin expression by proangiogenic factors was investigated by comparing the surface expression of classic cadherins on primary HUVECs maintained in EGM2 medium (a commercial growth factorsenriched medium, containing bFGF, VEGF, IGF-1 and EGF) with resting HUVECs, cultured in 20% FBS/M199 medium without any growth factors administration for 48 h. The amounts of cadherins presented on cell surface were detected by flow cytometric method, using monoclonal antibodies against the extracellular domain of each cadherin. The data showed that E-, N-, P- and VE-cadherin were all significantly reduced on HUVECs cultured in EGM2 compared with that cultured in 20% FBS/M199 (Figs. 1A, B). The result indicates that some components in EGM2 cause the decrease of surface cadherin expression on HUVECs. However, both bFGF and VEGF are crucial factors in promoting angiogenesis [25]. To test whether bFGF or VEGF can downregulate surface cadherin expression directly, we analyzed the surface cadherins on HUVECs cultured in 20% FBS/M199 supplemented with bFGF (10–50 μg/ml) or
424
E XP ER I ME NT A L C EL L RE S EA R CH 3 14 ( 20 0 8 ) 4 2 1 –42 9
Fig. 1 – Basic FGF, but not VEGF, downregulates surface cadherin expression on HUVECs. (A) Flow cytometric analysis of surface cadherin expression on HUVECs cultured in EGM2 (black line) or 20% FBS/M199 (gray filled) for 48 h. (B) The expression of surface cadherins is quantified as mean and shown as fold± SD compared with EGM2. HUVECs used in all experiments were collected at least from four different umbilical cords. (C) After cultured in 20% FBS/M199 only (black) or with 25 μg/ml bFGF (white) or 100 μg/ml VEGF (gray) for 48 h, the surface cadherin expressions of HUVECs were examined by flow cytometric analyses.
VEGF (10–100 μg/ml) for 48 h. Fig. 1C shows that bFGF is potent to decrease the surface expression of cadherins on resting HUVECs, whereas VEGF is no effect. This finding suggests that bFGF is one of the major regulators to disrupt surface cadherins on HUVECs.
FGFR1, Ras and JNK activation contribute to bFGF signaling FGFR1 is the major bFGF receptor on endothelial cells and mediates many biological effects by activating several intracellular signaling pathways [25–27]. The molecular mechanism
Fig. 2 – Blockade of FGFR1 kinase and JNK significantly reduces bFGF-mediated surface cadherin downregulation on HUVECs. (A) HUVECs were cultured in EGM2 only (EGM2; gray filled) or containing 4.2 μM SU5402 (SU), 20 μM PD98059 (PD), 20 μM SP600125 (SP) or 20 μM SB203580 (SB) for 48 h (black line), and the surface cadherins were assayed by flow cytometric analysis. (B) The quantitative data are represented as fold± SD compared with EGM2. HUVECs used in all experiments were collected from four different umbilical cords. (C) After 24 h of incubation, the surface cadherins were examined by flow cytometry and quantified as fold± SD compared with EGM2. HUVECs used in all experiments were collected from three different umbilical cords.
E XP E RI ME N TA L CE LL RE S EA RCH 3 14 ( 20 0 8 ) 4 2 1 –42 9
425
Fig. 3 – Dominant negative Ras abrogates bFGF-mediated cadherin downregulation on HUVECs. (A) Flow cytometric analysis of surface cadherins expression on LtGFP-infected (thin line) or LtRasS17N-infected (gray filled) HUVECs. (B) The quantitative data are represented as fold compared with LtGFP-infected HUVECs.
for bFGF-mediated cadherin downregulation on HUVECs was investigated by treating EGM2-cultured HUVECs with several specific inhibitors. SU5402, an intracellular tyrosine kinase inhibitor of FGFR1, was added to EGM2-cultured HUVECs for 48 h. E-, N-, P- and VE-cadherin expressions on the surface of HUVECs were significantly elevated after addition of SU5402 (SU; 8.4 μM) compared with DMSO (Figs. 2A, B). This result indicates that FGFR1 is the principal receptor for bFGFmediated cadherin downregulation. However, bFGF–FGFR1 interaction also activates intracellular small GTPase Ras, phosphoinositide 3-kinase (PI3K) and phospholipase C-γ (PLC-γ) and mediates endothelial cell proliferation, differentiation and migration [25–27]. Recent reports have also suggested that the Ras-MAPK signaling pathway is important in regulating endothelial cells migration during bFGF-induced angiogenesis [28,29]. To further investigate the participation of MAPK signaling in bFGF-mediated surface cadherin downregulation, we treated EGM2-cultured HUVECs with the ERK inhibitor PD98059 (PD) or the JNK inhibitor SP600125 (SP) or the p38 inhibitor SB203580 (SB) for 48 h. The surface cadherin expression was significantly elevated on HUVECs treated with 10–20 μM SP600125; however, neither PD98059 (1–100 μM) nor SB203580 (1–100 μM) administration affected surface cadherin expression (Figs. 2A, B). Fig. 2C shows that the level of cadherin restoration was similar in HUVECs cultured in growth factors withdrawal (20% FBS), FGFR1 blockade (SU) or JNK inhibition (SP) for 24 h. Besides, we also silenced JNK activity in HUVECs with a JNK1 or JNK2 siRNA, respectively. The expression of the studied four cadherins was also increased on surface of EGM2cultured HUVECs (data not shown). These suggest that FGFR1JNK signaling may be crucial in the mediation of dynamic regulation of cadherins on HUVECs by bFGF. The small GTPase Ras is a proximal upstream activator of JNK; Ras can also be activated through bFGF–FGFR1 signaling in endothelial cells [29,30]. To investigate whether Ras participates in bFGF-mediated cadherin downregulation, we generated a lentiviral vector carrying a dominant negative RasS17N mutant (LtRasS17N) or GFP (LtGFP). HUVECs were infected with
virus, and the surface expression of cadherins was determined by flow cytometry after three passages. The data show that cadherin expression on the surface of LtRasS17N-infected HUVECs was significantly higher than that on the surface of LtGFP-infected cells (Figs. 3A, B). However, expression levels of cadherins in LtRasS17N-infected HUVECs were not as high as that in growth factor withdrawal condition. A possible reason may be that endogenous Ras is able to mediate bFGF signaling in the LtRasS17N-infected HUVECs.
bFGF downregulates surface cadherins without affecting mRNA or total proteins We also examined the kinetics of surface cadherin expression on HUVECs. After various treatments for 16 h, including cultured in growth factor withdrawal condition (20% FBS), FGFR1 kinase blockade (SU) or JNK inhibition (SP), the percentage of high fluorescence intensity (HFI) was significantly increased, as compared with EGM2-cultured HUVECs (EGM2) (Fig. 4). To verify whether bFGF reduces surface cadherin expression by attenuating mRNA levels of cadherins, we measured the mRNA levels of cadherins, cadherin-associated catenins and GAPDH using RT-PCR methods [22]. As shown in Fig. 5A, there was no significant difference between the EGM2, 20% FBS/M199, EGM2/SU or EGM2/SP conditions. These data were confirmed by quantitative RT-PCR (Fig. 5B). We also measured the total amount of cadherins by Western blot analysis. However, there was no significant change in the total amount protein after EGM2, 20% FBS, SU or SP treatment (Fig. 6). According to these results, we suggest that bFGF mediates cadherin downregulation on surface of HUVECs without any changes of total mRNA or proteins of cadherins.
Discussion Adherens junction, constructed by cadherins, cadherin-associated catenins and cytoskeletal actin network, is an important
426
E XP ER I ME NT A L C EL L RE S EA R CH 3 14 ( 20 0 8 ) 4 2 1 –42 9
Fig. 4 – Time course of surface cadherin restoration by growth factor withdrawal, FGFR1 kinase blockade or JNK inhibition. In brief, HUVECs were washed by medium and cultured in EGM2 (EGM2), 20% FBS/M199 (20% FBS), EGM2 containing 4.2 μM SU5402 (SU) or 20 μM SP600125 (SP). Cells were harvested at 8, 16 and 24 h and analyzed the surface cadherins by flow cytometry. The percentage of high fluorescence intensity (HFI) was quantified and shown. HUVECs used in all experiments were collected from three different umbilical cords.
cell–cell interaction complex on endothelium [8]. All the typical cadherins (E-, N-, P- and VE-cadherin) are expressed on endothelium [31]. N-cadherin mediates the heterophilic interaction of endothelial cells with mural cells (including pericytes and vascular smooth muscle cells), which is necessary for the maturation and stabilization of the vasculature [32,33]. Through homotypic cell–cell interaction, VE-cadherin plays important roles in maintaining capillary tubular architecture during embryonic endocardial development, adult vasculogenesis and angiogenesis [11–13,32]. These results indicate that intercellular junctions, including cell–cell and cell–ECM interaction, mediate ‘stabilization’ signals and maintain the integrity of endothelial cells during resting state. However, it is necessary for intercellular junctions to become partially disorganized to allow migration and proliferation of endothelial cells during the formation of new vessels [18,21,34]. Recent studies have showed that VE-cadherin is removed from the endothelium surface during bFGF-induced angiogenesis [18,21]. Fibroblasts-derived growth factors can modulate the expression and regulation of VE-cadherin on human endothe-
lial cells [14]. Moreover, VE-cadherin and β-catenin are rapidly lost from cell–cell contacts between endothelial cells during the initial stage of angiogenesis [20]. Our data also showed that bFGF can attenuate the surface expression of E-, N-, P- and VEcadherin on HUVECs, suggesting that the disorganization of adherens junction may be required in the initial stage of angiogenesis. This process must be tightly controlled by proangiogenic factors, such as bFGF, to avoid uncontrolled proliferation or apoptosis of endothelial cells. Several investigators reported their findings about the effect of bFGF or VEGF on cadherin regulation using different experimental conditions and got different results [56,57]. It is very difficult to address which model is more appropriate to mimic vascular biology in vivo. Trivier et al. demonstrated that the morphological features of HUVECs cultured in EGM2 showed a “proliferating stage” feature, but cells grown in EGM2 devoid of bFGF and VEGF displayed a “senescence stage” feature [55]. Zhang and Issekutz defined “resting stage” as HUVECs cultured in 20% heat-inactivated human AB serum/ RPMI 1640 without any growth factor. They also demonstrated
E XP E RI ME N TA L CE LL RE S EA RCH 3 14 ( 20 0 8 ) 4 2 1 –42 9
427
Fig. 5 – Comparison of the cadherins, catenins and GAPDH mRNA levels in HUVECs. (A) In brief, HUVECs were washed by medium and cultured in EGM2 (EGM2), 20% FBS/M199 (20% FBS), EGM2 containing 4.2 μM SU5402 (SU) or 20 μM SP600125 (SP). After 12 h of incubation, cells were harvested for RNA extraction and cDNA generation. The cDNA was amplified for optimal cycles by specific primers for E-, N-, P-, VE-cadherin, GAPDH, α-, β- and γ-catenin. (B) Real-time RT-PCR for expression levels of cadherins and GAPDH mRNA in HUVECs. The cDNA collected in panel A was examined for the amount of cadherins and GAPDH mRNA by quantitative real-time PCR. HUVECs used in all experiments were collected from three different umbilical cords.
that bFGF has no effect on VE-cadherin expression in HUVECs [56]. Prandini et al. demonstrated that bFGF activates VEcadherin promoter but they did not delineate the culture condition [57]. It is possible that bFGF might have opposite functions on proliferating and resting endothelial cells. Our experimental results also suggest that bFGF has an ability to eliminate surface cadherins on the surface of endothelial cells in the experimental condition mimicking proliferating stage of HUVECs. By triggering protease production, cell–cell adhesion disturbance and integrin modulation during the initial phase of angiogenesis, bFGF promotes endothelial cells proliferation and migration. It also plays a role in vessel morphogenesis and maturation in the later phase of angiogenesis [21,35]. Disrupting the FGFR1 in mouse embryos showed that FGFR1 is required for the development and maintenance of the vasculature [36,37]. The interaction of bFGF–FGFR1 leads to FGFR1 dimerization and autophosphorylation within the intracellular domain of FGFR1. Autophosphorylation of FGFR1 can activate intracellular PI3K, PLC-γ and Ras signaling in endothelial cells [30,38]. Following Ras activation and the consequent continuous phosphorylation, MAPKs including ERK, JNK and p38 MAP kinase are activated, and then they turn on certain transcription factors, which mediate angiogenesisrelated genes expression [28]. Recent studies suggested that Ras activation is required for bFGF- or VEGF-mediated endothelial cell motility. An activated RasV12 mutant induces PI3K, ERK and JNK activation in primary endothelial cells [29]. Moreover, they concluded that ERK maintains endothelial cell survival and proliferation; JNK promotes proliferation and migration whereas p38 induces endothelial cell differentiation
[29,39]. Constitutively overexpressed oncogenic H-Ras in ECV304 endothelial cells increases cell motility through RasSEK1-JNK pathway [40]. Based on these reports and our results, we consider that bFGF could downregulate surface cadherins via FGFR1-Ras-JNK signaling to promote endothelial cells migration in the early stage of angiogenesis. Other adhesion molecules, such as integrins, also serve as regulators in maintaining cell–ECM interaction in endothelium and are reported to be regulated during bFGF-induced angiogenesis [41–44].
Fig. 6 – Analysis of total protein levels of cadherins and β-actin in HUVECs. In brief, HUVECs were washed by medium and cultured in EGM2 (EGM2), 20% FBS/M199 (20% FBS), EGM2 containing 4.2 μM SU5402 (SU) or 20 μM SP600125 (SP). After 24 h of incubation, cells were harvested for protein collection. The amount of cadherins and β-actin was measured by Western blot analysis.
428
E XP ER I ME NT A L C EL L RE S EA R CH 3 14 ( 20 0 8 ) 4 2 1 –42 9
Interestingly, recent evidence has demonstrated that active Ras could enhance endothelial cell migratory ability by attenuating α3β1 integrin expression [44]. These observations raise a possibility that bFGF may activate Ras-JNK signaling to mediate the destruction of cell–cell and cell–ECM interaction at the same time, resulting in promoting endothelial cells migration. Our data show that bFGF attenuates surface cadherin expression on HUVECs. However, the mRNA or total protein levels of cadherins did not show significant difference. These results indicated that bFGF does not directly affect the transcription and translation of cadherins. In the literature, the surface cadherins have been shown to exist in a dynamic state with cytosolic cadherins. The steady state of cadherins is limited by recycling processes, including endocytosis, exocytosis and degradation [32,45]. For example, the endocytosis of VE-cadherin can be inhibited by p120CTN binding [45,46]. The phosphorylation levels of VE-cadherin and βcatenin also affect the anchorage of VE-cadherin–catenins– actin, resulting in VE-cadherin internalization [47–50]. In addition, some specific lytic enzymes may act on cleavage of the cadherin cytoplasmic tail or the extracellular domain [51– 54]. Thus, a complex mechanism has been postulated to regulate the surface expression of cadherins and cadherin– catenins–actin structure. Our results only suggest the basic mechanism that bFGF modulates surface cadherin expression by intracellular Ras-JNK signaling. Further work is required to clarify how JNK mediates surface/intercellular cadherin turnover.
Acknowledgments This study was supported in part by grants from National Science Council (NSC93-2314-B-016-027), Tri-Service General Hospital (TSGH-C94-25) and C.Y. Foundation for advancement of Education, Sciences, and Medicine, Taipei, Republic of China.
REFERENCES
[1] C.M. Nelson, C.S. Chen, VE-cadherin simultaneously stimulates and inhibits cell proliferation by altering cytoskeletal structure and tension, J. Cell Sci. 116 (2003) 3571–3581. [2] D. Vestweber, Molecular mechanisms that control endothelial cell contacts, J. Pathol. 190 (2000) 281–291. [3] S.M. Dudek, J.G. Garcia, Cytoskeletal regulation of pulmonary vascular permeability, J. Appl. Physiol. 91 (2001) 1487–1500. [4] R.L. Juliano, Signal transduction by cell adhesion receptors and the cytoskeleton: functions of integrins, cadherins, selectins, and immunoglobulin-superfamily members, Annu. Rev. Pharmacol. Toxicol. 42 (2002) 283–323. [5] G. Christofori, H. Semb, The role of the cell-adhesion molecule E-cadherin as a tumour-suppressor gene, Trends Biochem. Sci. 24 (1999) 73–76. [6] S.T. Suzuki, Structural and functional diversity of cadherin superfamily: are new members of cadherin superfamily involved in signal transduction pathway? Cell Biochem. 61 (1996) 531–542. [7] S.T. Suzuki, Protocadherins and diversity of the cadherin superfamily, J. Cell Sci. 109 (Pt 11) (1996) 2609–2611.
[8] B.D. Angst, C. Marcozzi, A.I. Magee, The cadherin superfamily: diversity in form and function, J. Cell Sci. 114 (2001) 629–641. [9] P. Carmeliet, M.G. Lampugnani, L. Moons, F. Breviario, V. Compernolle, F. Bono, G. Balconi, R. Spagnuolo, B. Oostuyse, M. Dewerchin, A. Zanetti, A. Angellilo, V. Mattot, D. Nuyens, E. Lutgens, F. Clotman, M.C. de Ruiter, A. Gittenberger-de Groot, R. Poelmann, F. Lupu, J.M. Herbert, D. Collen, E. Dejana, Targeted deficiency or cytosolic truncation of the VE-cadherin gene in mice impairs VEGF-mediated endothelial survival and angiogenesis, Cell 98 (1999) 147–157. [10] D. Vittet, T. Buchou, A. Schweitzer, E. Dejana, P. Huber, Targeted null-mutation in the vascular endothelial-cadherin gene impairs the organization of vascular-like structures in embryoid bodies, Proc. Natl. Acad. Sci. U. S. A. 94 (1997) 6273–6278. [11] T.L. Bach, C. Barsigian, D.G. Chalupowicz, D. Busler, C.H. Yaen, D.S. Grant, J. Martinez, VE-Cadherin mediates endothelial cell capillary tube formation in fibrin and collagen gels, Exp. Cell Res. 238 (1998) 324–334. [12] J.H. Distler, A. Hirth, M. Kurowska-Stolarska, R.E. Gay, S. Gay, O. Distler, Angiogenic and angiostatic factors in the molecular control of angiogenesis, Q. J. Nucl. Med. 47 (2003) 149–161. [13] D. Vestweber, Regulation of endothelial cell contacts during leukocyte extravasation, Curr. Opin. Cell Biol. 14 (2002) 587–593. [14] T.A. Martin, K. Harding, W.G. Jiang, Matrix-bound fibroblasts regulate angiogenesis by modulation of VE-cadherin, Eur. J. Clin. Invest. 31 (2001) 931–938. [15] M. Corada, L. Zanetta, F. Orsenigo, F. Breviario, M.G. Lampugnani, S. Bernasconi, F. Liao, D.J. Hicklin, P. Bohlen, E. Dejana, A monoclonal antibody to vascular endothelial-cadherin inhibits tumor angiogenesis without side effects on endothelial permeability, Blood 100 (2002) 905–911. [16] F. Liao, J.F. Doody, J. Overholser, B. Finnerty, R. Bassi, Y. Wu, E. Dejana, P. Kussie, P. Bohlen, D.J. Hicklin, Selective targeting of angiogenic tumor vasculature by vascular endothelial-cadherin antibody inhibits tumor growth without affecting vascular permeability, Cancer Res. 62 (2002) 2567–2575. [17] R. Blindt, A.K. Bosserhoff, J. Dammers, N. Krott, L. Demircan, R. Hoffmann, P. Hanrath, C. Weber, F. Vogt, Downregulation of N-cadherin in the neointima stimulates migration of smooth muscle cells by RhoA deactivation, Cardiovasc. Res. 62 (2004) 212–222. [18] P.A. Underwood, P.A. Bean, J.R. Gamble, Rate of endothelial expansion is controlled by cell:cell adhesion, Int. J. Biochem. Cell Biol. 34 (2002) 55–69. [19] T. Halama, M. Groger, M. Pillinger, G. Staffler, E. Prager, H. Stockinger, W. Holnthoner, S. Lechleitner, K. Wolff, P. Petzelbauer, Platelet endothelial cell adhesion molecule-1 and vascular endothelial cadherin cooperatively regulate fibroblast growth factor-induced modulations of adherens junction functions, J. Invest. Dermatol. 116 (2001) 110–117. [20] T.J. Wright, L. Leach, P.E. Shaw, P. Jones, Dynamics of vascular endothelial-cadherin and beta-catenin localization by vascular endothelial growth factor-induced angiogenesis in human umbilical vein cells, Exp. Cell Res. 280 (2002) 159–168. [21] M. Presta, P. Dell'Era, S. Mitola, E. Moroni, R. Ronca, M. Rusnati, Fibroblast growth factor/fibroblast growth factor receptor system in angiogenesis, Cytokine Growth Factor Rev. 16 (2005) 159–178. [22] C.T. Tai, W.C. Lin, W.C. Chang, T.H. Chiu, G.T. Chen, Classical cadherin and catenin expression in normal myometrial tissues and uterine leiomyomas, Mol. Reprod. Dev. 64 (2003) 172–178. [23] F.M. Tsai, R.Y. Shyu, S.Y. Jiang, RIG1 inhibits the Ras/mitogen-activated protein kinase pathway by suppressing the activation of Ras, Cell. Signal. 18 (2006) 349–358.
E XP E RI ME N TA L CE LL RE S EA RCH 3 14 ( 20 0 8 ) 4 2 1 –42 9
[24] L.J. Chang, A.K. Zaiss, Lentiviral vectors. Preparation and use, Methods Mol. Med. 69 (2002) 303–318. [25] S.V. Lutsenko, S.M. Kiselev, S.E. Severin, Molecular mechanisms of tumor angiogenesis, Biochemistry (Mosc) 68 (2003) 286–300. [26] M. Goldfarb, Signaling by fibroblast growth factors: the inside story, Sci. STKE 2001 (2001) PE37. [27] R. Munoz-Chapuli, A.R. Quesada, M. Angel Medina, Angiogenesis and signal transduction in endothelial cells, Cell Mol. Life Sci. 61 (2004) 2224–2243. [28] M. Tsang, I.B. Dawid, Promotion and attenuation of FGF signaling through the Ras-MAPK pathway, Sci. STKE 2004 (2004) pe17. [29] K.N. Meadows, P. Bryant, P.A. Vincent, K.M. Pumiglia, Activated Ras induces a proangiogenic phenotype in primary endothelial cells, Oncogene 23 (2004) 192–200. [30] M.J. Cross, L. Claesson-Welsh, FGF and VEGF function in angiogenesis: signalling pathways, biological responses and therapeutic inhibition, Trends Pharmacol. Sci. 22 (2001) 201–207. [31] E. Dejana, M. Corada, M.G. Lampugnani, Endothelial cell-to-cell junctions, FASEB J. 9 (1995) 910–918. [32] U. Cavallaro, S. Liebner, E. Dejana, Endothelial cadherins and tumor angiogenesis, Exp. Cell Res. 312 (2006) 659–667. [33] H. Gerhardt, C. Betsholtz, Endothelial–pericyte interactions in angiogenesis, Cell Tissue Res. 314 (2003) 15–23. [34] E. Dejana, Endothelial cell–cell junctions: happy together, Nat. Rev. Mol. Cell Biol. 5 (2004) 261–270. [35] M.A. Nugent, R.V. Iozzo, Fibroblast growth factor-2, Int J. Biochem. Cell Biol. 32 (2000) 115–120. [36] C.X. Deng, A. Wynshaw-Boris, M.M. Shen, C. Daugherty, D.M. Ornitz, P. Leder, Murine FGFR-1 is required for early postimplantation growth and axial organization, Genes Dev. 8 (1994) 3045–3057. [37] S.H. Lee, D.J. Schloss, J.L. Swain, Maintenance of vascular integrity in the embryo requires signaling through the fibroblast growth factor receptor, J. Biol. Chem. 275 (2000) 33679–33687. [38] P. Auguste, S. Javerzat, A. Bikfalvi, Regulation of vascular development by fibroblast growth factors, Cell Tissue Res. 314 (2003) 157–166. [39] T. Matsumoto, I. Turesson, M. Book, P. Gerwins, L. Claesson-Welsh, p38 MAP kinase negatively regulates endothelial cell survival, proliferation, and differentiation in FGF-2-stimulated angiogenesis, J. Cell Biol. 156 (2002) 149–160. [40] E.Y. Shin, S.Y. Kim, E.G. Kim, c-Jun N-terminal kinase is involved in motility of endothelial cell, Exp. Mol. Med. 33 (2001) 276–283. [41] G. Collo, M.S. Pepper, Endothelial cell integrin alpha5beta1 expression is modulated by cytokines and during migration in vitro, J. Cell Sci. 112 (Pt 4) (1999) 569–578. [42] S. Klein, F.G. Giancotti, M. Presta, S.M. Albelda, C.A. Buck, D.B. Rifkin, Basic fibroblast growth factor modulates integrin expression in microvascular endothelial cells, Mol. Biol. Cell 4 (1993) 973–982. [43] N.T. Sepp, L.J. Li, K.H. Lee, E.J. Brown, S.W. Caughman, T.J. Lawley, R.A. Swerlick, Basic fibroblast growth factor increases expression of the alpha v beta 3 integrin complex on human microvascular endothelial cells, J. Invest. Dermatol. 103 (1994) 295–299. [44] E.Y. Shin, J.Y. Lee, M.K. Park, G.B. Jeong, E.G. Kim, S.Y. Kim, H-Ras is a negative regulator of alpha3beta1 integrin
[45]
[46]
[47]
[48]
[49]
[50]
[51]
[52]
[53]
[54]
[55]
[56]
[57]
429
expression in ECV304 endothelial cells, Biochem. Biophys. Res. Commun. 257 (1999) 95–99. A.P. Kowalczyk, A.B. Reynolds, Protecting your tail: regulation of cadherin degradation by p120-catenin, Curr. Opin. Cell Biol. 16 (2004) 522–527. K. Xiao, J. Garner, K.M. Buckley, P.A. Vincent, C.M. Chiasson, E. Dejana, V. Faundez, A.P. Kowalczyk, p120-Catenin regulates clathrin-dependent endocytosis of VE-cadherin, Mol. Biol. Cell 16 (2005) 5141–5151. M.D. Potter, S. Barbero, D.A. Cheresh, Tyrosine phosphorylation of VE-cadherin prevents binding of p120- and beta-catenin and maintains the cellular mesenchymal state, J. Biol. Chem. 280 (2005) 31906–31912. M.T. Lin, M.L. Yen, C.Y. Lin, M.L. Kuo, Inhibition of vascular endothelial growth factor-induced angiogenesis by resveratrol through interruption of Src-dependent vascular endothelial cadherin tyrosine phosphorylation, Mol. Pharmacol. 64 (2003) 1029–1036. N. Lambeng, Y. Wallez, C. Rampon, F. Cand, G. Christe, D. Gulino-Debrac, I. Vilgrain, P. Huber, Vascular endothelial-cadherin tyrosine phosphorylation in angiogenic and quiescent adult tissues, Circ. Res. 96 (2005) 384–391. A.H. Huber, W.I. Weis, The structure of the beta-catenin/E-cadherin complex and the molecular basis of diverse ligand recognition by beta-catenin, Cell 105 (2001) 391–402. Y. Ichikawa, T. Ishikawa, N. Momiyama, M. Kamiyama, H. Sakurada, R. Matsuyama, S. Hasegawa, T. Chishima, Y. Hamaguchi, S. Fujii, S. Saito, K. Kubota, S. Hasegawa, H. Ike, S. Oki, H. Shimada, Matrilysin (MMP-7) degrades VE-cadherin and accelerates accumulation of beta-catenin in the nucleus of human umbilical vein endothelial cells, Oncol. Rep. 15 (2006) 311–315. B. Hermant, S. Bibert, E. Concord, B. Dublet, M. Weidenhaupt, T. Vernet, D. Gulino-Debrac, Identification of proteases involved in the proteolysis of vascular endothelium cadherin during neutrophil transmigration, J. Biol. Chem. 278 (2003) 14002–14012. T. Hirao, D. Nanba, M. Tanaka, H. Ishiguro, Y. Kinugasa, Y. Doki, M. Yano, N. Matsuura, M. Monden, S. Higashiyama, Overexpression of ADAM9 enhances growth factor-mediated recycling of E-cadherin in human colon cancer cell line HT29 cells, Exp. Cell Res. 312 (2006) 331–339. P. Marambaud, J. Shioi, G. Serban, A. Georgakopoulos, S. Sarner, V. Nagy, L. Baki, P. Wen, S. Efthimiopoulos, Z. Shao, T. Wisniewski, N.K. Robakis, A presenilin-1/gamma-secretase cleavage releases the E-cadherin intracellular domain and regulates disassembly of adherens junctions, EMBO J. 21 (2002) 1948–1956. E. Trivier, D.J. Kurz, Y. Hong, H.L. Huang, J.D. Erusalimsky, Differential regulation of telomerase in endothelial cells by fibroblast growth factor-2 and vascular endothelial growth factor-A, association with replicative life span, Ann. N.Y. Acad. Sci. 1019 (2004) 111–115. H. Zhang, A.C. Issekutz, Down-modulation of monocyte transendothelial migration and endothelial adhesion molecule expression by fibroblast growth factor, reversal by the anti-angiogenic agent SU6668, Am. J. Pathol. 160 (2002) 2219–2230. M.H. Prandini, I. Dreher, S. Bouillot, S. Benkerri, T. Moll, P. Huber, The human VE-cadherin promoter is subjected to organ-specific regulation and is activated in tumour angiogenesis, Oncogene 24 (2005) 2992–3001.
a v a i l a b l e a t w w w. s c i e n c e d i r e c t . c o m
w w w. e l s e v i e r. c o m / l o c a t e / y e x c r
Research Article
JNK signaling pathway is required for bFGF-mediated surface cadherin downregulation on HUVEC Jen-Chine Wua , Horng-Chin Yanb , Wei-Teing Chenb , Wei-Hwa Chend , Chia-Jen Wanga , Ying-Chih Chib , Woei-Yau Kaoc,⁎ a
Graduate Institute of Life Science, National Defense Medical Center, Taipei, Taiwan Division of Pulmonary and Critical Care Medicine, Tri-Service General Hospital, Taipei, Taiwan c Division of Hematology-Oncology, Department of Medicine, Tri-Service General Hospital, Taipei, Taiwan d Department of Obstetrics and Gynecology, Tri-Service General Hospital, Taipei, Taiwan b
ARTICLE INFORMATION
ABS T R AC T
Article Chronology:
Angiogenesis, the process of new blood vessel formation, is important in wound healing,
Received 22 January 2007
inflammation, tumorigenesis and metastases. During this process, it is a critical step of the
Revised version received
loosening of cellular interactions between endothelial cells, which are dependent on the
23 September 2007
architecture of adherens junction constructed by homophilic interactions of cell surface
Accepted 2 October 2007
cadherins. Several studies suggested that the dynamic changes of cadherins are necessary
Available online 6 October 2007
during angiogenesis. However, the mechanism of cadherins regulation on endothelial cells requires further delineation. Here, we showed that basic fibroblast growth factor (bFGF), a
Keywords:
pivotal pro-angiogenic factor, can downregulate typical cadherins (E-, N-, P- and VE-cadherin)
Angiogenesis
expression on the surface of human umbilical vein endothelial cells (HUVECs) via FGF receptor
Endothelial cells
1 (FGFR1) signaling. The bFGF-mediated surface cadherin downregulation was significantly
bFGF
reversed only when the HUVECs were treated with JNK inhibitor (SP600125), but not ERK
Cadherin
(PD98059) or p38 inhibitor (SB203580). Infecting HUVECs with a dominant negative H-Ras
JNK
mutant (RasS17N) interferes bFGF-mediated cadherin downregulation, and the result suggests that bFGF attenuates surface cadherin expression on HUVECs via FGFR1 and intracellular RasJNK signaling. However, after growth factors withdrawal, FGFR1 blockade or JNK inhibition for 16 h, cadherins were re-expressed on cell surface of HUVECs. But the mRNA or total protein of cadherins had no significant change, suggesting that the effect of bFGF on cadherin expression may work through a post-translational control. Our data first suggest that JNK participates in bFGF-mediated surface cadherin downregulation. Loss of surface cadherins may affect the cell– cell interaction between endothelial cells and facilitate angiogenesis. © 2007 Elsevier Inc. All rights reserved.
Introduction Angiogenesis, the formation of new capillaries from preexisting blood vessels, plays a critical role in embryogenesis, inflammation, wound healing, tumorigenesis and metastasis. The ultrastructural changes in the endothelium during angio-
genesis include basement membrane breakdown, loosening of cell–cell and cell–matrix interaction, migration, proliferation and differentiation. Following proangiogenic stimulation, the dynamic cell–cell and cell–matrix interactions produce rapid changes in cell shape and vascular architecture. Changes in cell–cell and cell–matrix adhesions are critical responses and
⁎ Corresponding author. E-mail address: [email protected] (W.-Y. Kao). 0014-4827/$ – see front matter © 2007 Elsevier Inc. All rights reserved. doi:10.1016/j.yexcr.2007.10.002
422
E XP ER I ME NT A L C EL L RE S EA R CH 3 14 ( 20 0 8 ) 4 2 1 –42 9
contribute to endothelial cell motility and cytoskeletal reorganization [1–3]. However, it is not fully understood how cell–cell and cell–matrix interactions are disrupted by proangiogenic factors during angiogenesis. The cell adhesion molecules (CAMs) mediate most cell–cell interaction and modulate cell motility by affecting adhesion strength, cytoskeletal organization, contractility and cell shape [4]. The cadherin family of CAMs is important in cell adhesion, morphogenesis, cytoskeletal organization, cell sorting and migration [5]. The classical cadherins, including epithelial (E)-, neural (N)-, placental (P)- and vascular endothelial (VE)-cadherin, are single-span transmembrane proteins and contribute to calcium-dependent cell–cell adhesion through homophilic interaction [6,7]. Simultaneously, the intracellular domain of cadherin binds coherent partners such as α-catenin, β-catenin, plakoglobin (γ-catenin) and vinculin and links to actin filament network [8]. The architecture of the cadherin–catenin–actin complex forms the adherens junction and maintains the blood vessel integrity. For example, the embryos of VE-cadherin knockout mouse exhibit severely impaired assembly of vascular structures [9,10]. In vitro studies have demonstrated that VE-cadherin participates in endothelial cell adhesion, capillary tube formation, leukocyte extravasation and tumor angiogenesis [11–16]. These observations suggested that VE-cadherin is required for angiogenesis and the maintenance of capillary tubular architecture. On the other way, the strength of the cadherin-mediated cell–cell interaction is reduced in certain special situations. Downregulation of N-cadherin has been shown to stimulate the migration of human arterial smooth muscle cells [17]. VEcadherin is eliminated from the surface of endothelial cells during bFGF-induced angiogenesis [18,19]. In addition, during VEGF-stimulated capillary tube formation of confluent human umbilical vein endothelial cells (HUVECs), VE-cadherin and βcatenin are rapidly lost from the cell–cell contacts during the initial phase of angiogenesis and reconstituted later [20]. These observations suggest that the destruction of cadherin-mediated adherens junctions on endothelial cell surface may be necessary in the initial step of angiogenesis [21]. In the present study, we demonstrate that bFGF is a powerful mediator to downregulate the typical cadherin expression on the surface of HUVECs. Our data also demonstrate that bFGF attenuates surface cadherin expression by interacting with FGFR1, which leads to the activation of intracellular Ras and JNK signaling pathways. However, there are no significant changes in the levels of cadherin mRNA or total protein, suggesting that bFGF may regulate surface expression and cellular localization of cadherins through a post-translational control. In summary, our results suggest that bFGF-induced JNK activation may mediate endothelial cells mobilization by attenuating surface cadherins expression; this mechanism may play an important role in angiogenesis.
Materials and methods Reagents and antibodies Cell culture reagents were purchased from Invitrogen (Carlsbad, CA, USA). Fetal bovine serum (FBS) was obtained from
Hyclone (Logan, UT, USA). PD98059, SB203580 and SP600125 were obtained from Sigma (St. Louis, MO, USA) and SU5402 from Calbiochem (Darmstadt, Germany). The following antibodies against the cadherin extracellular domain were used in flow cytometric analysis: E-cadherin (67A4), N-cadherin (H-63) and P-cadherin (N-19) were obtained from Santa Cruz Biotechnology (Santa Cruz, CA, USA) and VE-cadherin from R&D Systems (Minneapolis, MN, USA). The antibodies against cytoplasmic domain of cadherins were used in Western blot: E-cadherin (4A2C7), N-cadherin (3B9) and P-cadherin (12H6) were obtained from Zymed Laboratories; VE-cadherin (F-8) was from Santa Cruz Biotechnology. Anti-β-actin antibody was obtained from Sigma. All secondary antibodies were purchased from Santa Cruz Biotechnology. Unless otherwise stated in the text, all other chemicals were purchased from Sigma and were of the highest grade available.
Cell culture Primary cultures of HUVECs were isolated from fresh human umbilical cord veins and maintained in EGM2 BulletKit (Cambrex, East Rutherford, NJ, USA) containing 2% FBS, bFGF, VEGF, insulin-like growth factor-1 (IGF-1), epithelial growth factor (EGF), hydrocortisone and heparin. In some situation, HUVECs were cultured in M199 basal medium containing penicillin/ streptomycin and supplemented with 20% FBS. HUVECs were attached on 2% gelatin-coated dish and detached by incubating with 0.5% Trypsin/5.37 mM EDTA for 1 min at room temperature. Only passages four to six of the HUVECs were used for experiments in this study. Rhabdomyosarcoma TE671 was used to generate lentivirus and maintained in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% FBS and 1% penicillin/streptomycin. All cells were incubated at 37 °C in a humidified incubator with 5% CO2.
Flow cytometric analysis of surface cadherin expression After cultured in different conditions, HUVECs were harvested by incubating in 5.3 mM EDTA (pH 7.4) for 10 min at 37 °C and then resuspended at 5 × 105 cells/ml phenol red-free RPMI 1640 medium for 10 min on ice. Cells were incubated with primary monoclonal antibody for 60 min on ice, washed twice with PBS/1% bovine serum albumin (BSA) and then detected with a FITC- or PE-labeled secondary anti-mouse (E-, N- and VEcadherin) or anti-goat antibody (P-cadherin) for 15 min on ice. The stained cells were washed twice and fixed in 2% formaldehyde–PBS solution. Fluorescence of cells was detected using a FACSCalibur immunocytometry system (BD Biosciences, Palo Alto, CA, USA).
Semiquantitative and quantitative real-time RT-PCR analysis of cadherin and catenin mRNA levels Total RNA of HUVECs was obtained by the TRIzol reagent standard procedure (Invitrogen) and reverse transcribed using the SuperScript™ III First-Strand Synthesis System (Invitrogen) in the presence of 2.5 μg/ml oligo dT. The first-strand cDNA was quantified by spectrophotometry at OD 260 nm and amplified with the respective primers for an optimal number of PCR cycles. The sequence of primers modified for using in
E XP E RI ME N TA L CE LL RE S EA RCH 3 14 ( 20 0 8 ) 4 2 1 –42 9
PCR amplification of cadherin, catenin and GAPDH [22] is 5′TCCATTTCTTGGTCTACGCC and 5′-CACCTTCAGCCATCCTGTTT for E-cadherin; 5′-GTGCCATTAGCCAAGGGAATTCAGC and 5′GCGTTCCTGTTCCACTCATAGGAGG for N-cadherin; 5′-GACCAACGAGGCCCCTTTTGTGCTG and 5′-GTGGTGGGAGGGCTTCCATTGTCCA for P-cadherin; 5′-AACTTCCCCTTCTTCACCC and 5′-AAAGGCTGCTGGAAAATG for VE-cadherin; 5′-CAGAGGGAGCATGACTTCGG and 5′-CTACAGCAGCCACCAACTCT for α2-catenin; 5′-AAGGTCTGAGGAGCAGCTTC and 5′-TGGACCATAACTGCAGCCTT for β1-catenin; 5′-ATGGAGGTGATGAACCTGATGG and 5′-CCTGACACACCAGAGCACAT for γ-catenin; 5′-CCAGCCGAGCCACATCGCTC and 5′-ATGAGCCCCAGCCTTCTCCAT for GAPDH. After being fully denatured at 94 °C for 3 min, the PCR mixtures were followed by denaturing at 94 °C for 30 s, annealing at 60 °C for E-, N-, P- and VE-cadherin for 30 s and at 50 °C for α-, β-, γ-catenin and GAPDH for 30 s and polymerizing at 72 °C for 1 min. Finally, a full extension at 72 °C for 10 min was performed. The samples were loaded at equal volumes onto 2% agarose gels and visualized with ethidium bromide. The levels of cadherins mRNA were also quantified by quantitative real-time PCR, which was performed as manufacturer's instructions of iQ™ SYBR green supermix (Bio-Rad, CA, USA). After optimizing PCR condition, the expression levels of cadherin mRNA were presented as the cycle of threshold (Ct) value and normalized to GAPDH. All data were performed in triplicate and showed as means ± SD.
Recombinant lentiviral vector construction, lentivirus production and infection To generate the lentiviral vector carrying the dominant negative H-RasS17N, the full length of human H-RasS17N was amplified by PCR using the primers (5′-TAATACGACTCACTATAGGG and 5′-AGAAGGCACAGTCGAGGCT) from plasmid pcDNA3.1+/CMV-H-RasS17N [23] (kindly provided by Professor S.Y. Jiang, Department of Medical Education and Research, Buddhist Tzu Chi General Hospital, Taipei, Taiwan, ROC) and cloned by pGEM-T Easy Vector Systems (Promega, Madison, WI, USA). The EcoRI fragment of H-RasS17N/pGEMT was subsequently cloned in frame into pTY-EF (kindly provided by Professor H.K. Sytwu, Department of Microbiology and Immunology, National Defense Medical Center, Taipei, Taiwan, ROC) to generate a lentiviral transducing vector containing the EF1α promoter, named pTY-EF-HRasS17N . A green fluorescence protein (GFP) expression vector pTY-EF-GFP was used to estimate reference titers [24]. Lentiviral vectors were produced by using a transient cotransfection system modified from the method of L.J. Chang and A.K. Zaiss [24]. Briefly, 7 × 105 TE671 cells were transfected with 1.8 μg of the packaging plasmid pHP-dl-N/ A, 0.3 μg of the G glycoprotein of vesicular stomatitis virus (VSV-G) envelope plasmid pHEF-VSVG, 0.2 μg of the human immunodeficiency virus-1 (HIV-1) Tat expression plasmid pCEP4-Tat and 1 μg of the transducing plasmid pTY-EFHRasS17N or pTY-EF-GFP (pHP-dl-N/A, pHEF-VSVG and pCEP4-Tat were the kind gifts of H.K. Sytwu). Three harvests of conditioned medium containing recombinant lentivirus which is carrying H-RasS17N (LtRasS17N) or GFP (LtGFP) were collected at 48–72 h later and concentrated by ultracentrifugation at 4 °C.
423
To assess the relative titers of LtRasS17N, about 1 × 105 HUVECs were seeded into each well of gelatin-coated six-well plate with 3 ml of EGM2 medium containing 4 μg/ml polybrene (Sigma). The cells were infected with serial dilutions of LtGFP for 72 h, and the GFP-positive cells were counted using a FACSCalibur immunocytometry system (BD Biosciences). Transduction units per milliliter (TUs/ml) were calculated as (1 × 105) × (percentage of GFP-positive cells) / (the volume of virus added). TUs of LtGFP were used to optimize the condition of LtRasS17N infection.
Western blot analysis Following different treatment, HUVECs were washed twice with ice-cold PBS and lysed in lysis buffer (50 mM HEPES, 150 mM NaCl, 0.1 mM EDTA, 1 mM CaCl2, 1 mM MgCl2, 1% Triton X-100, 0.1% SDS, 0.5% deoxycholate, 100 mM NaF, 3 mM Na3VO4 and protease inhibitor), solubilized by ultrasonic cell disruptor (Misonix) on ice and centrifuged at 13,000×g for 5 min at 4 °C. The protein concentration of samples was quantified by BCA protein assay kit (PIERCE). After heated for 7 min at 95 °C with 5× SDS–PAGE sampling buffer, proteins were electrophoresed on 12% SDS–PAGE gels. Following the transference onto a PVDF membrane, proteins were immunoblotted with antibodies against E-, N-, P-, VE-cadherin and β-actin, respectively. The immunoblotted proteins were then incubated with a secondary Ab conjugated to horseradish peroxidase (HRP) and visualized by the LumiGLO chemiluminescent peroxidase substrate (KPL).
Results bFGF inhibits surface cadherin expression on HUVECs Although adherens junction maintains endothelial cells integrity by increasing cell–cell adhesion [1], the breakdown of adherens junction is required to initiate angiogenesis [18–20]. The decrease of cadherin expression by proangiogenic factors was investigated by comparing the surface expression of classic cadherins on primary HUVECs maintained in EGM2 medium (a commercial growth factorsenriched medium, containing bFGF, VEGF, IGF-1 and EGF) with resting HUVECs, cultured in 20% FBS/M199 medium without any growth factors administration for 48 h. The amounts of cadherins presented on cell surface were detected by flow cytometric method, using monoclonal antibodies against the extracellular domain of each cadherin. The data showed that E-, N-, P- and VE-cadherin were all significantly reduced on HUVECs cultured in EGM2 compared with that cultured in 20% FBS/M199 (Figs. 1A, B). The result indicates that some components in EGM2 cause the decrease of surface cadherin expression on HUVECs. However, both bFGF and VEGF are crucial factors in promoting angiogenesis [25]. To test whether bFGF or VEGF can downregulate surface cadherin expression directly, we analyzed the surface cadherins on HUVECs cultured in 20% FBS/M199 supplemented with bFGF (10–50 μg/ml) or
424
E XP ER I ME NT A L C EL L RE S EA R CH 3 14 ( 20 0 8 ) 4 2 1 –42 9
Fig. 1 – Basic FGF, but not VEGF, downregulates surface cadherin expression on HUVECs. (A) Flow cytometric analysis of surface cadherin expression on HUVECs cultured in EGM2 (black line) or 20% FBS/M199 (gray filled) for 48 h. (B) The expression of surface cadherins is quantified as mean and shown as fold± SD compared with EGM2. HUVECs used in all experiments were collected at least from four different umbilical cords. (C) After cultured in 20% FBS/M199 only (black) or with 25 μg/ml bFGF (white) or 100 μg/ml VEGF (gray) for 48 h, the surface cadherin expressions of HUVECs were examined by flow cytometric analyses.
VEGF (10–100 μg/ml) for 48 h. Fig. 1C shows that bFGF is potent to decrease the surface expression of cadherins on resting HUVECs, whereas VEGF is no effect. This finding suggests that bFGF is one of the major regulators to disrupt surface cadherins on HUVECs.
FGFR1, Ras and JNK activation contribute to bFGF signaling FGFR1 is the major bFGF receptor on endothelial cells and mediates many biological effects by activating several intracellular signaling pathways [25–27]. The molecular mechanism
Fig. 2 – Blockade of FGFR1 kinase and JNK significantly reduces bFGF-mediated surface cadherin downregulation on HUVECs. (A) HUVECs were cultured in EGM2 only (EGM2; gray filled) or containing 4.2 μM SU5402 (SU), 20 μM PD98059 (PD), 20 μM SP600125 (SP) or 20 μM SB203580 (SB) for 48 h (black line), and the surface cadherins were assayed by flow cytometric analysis. (B) The quantitative data are represented as fold± SD compared with EGM2. HUVECs used in all experiments were collected from four different umbilical cords. (C) After 24 h of incubation, the surface cadherins were examined by flow cytometry and quantified as fold± SD compared with EGM2. HUVECs used in all experiments were collected from three different umbilical cords.
E XP E RI ME N TA L CE LL RE S EA RCH 3 14 ( 20 0 8 ) 4 2 1 –42 9
425
Fig. 3 – Dominant negative Ras abrogates bFGF-mediated cadherin downregulation on HUVECs. (A) Flow cytometric analysis of surface cadherins expression on LtGFP-infected (thin line) or LtRasS17N-infected (gray filled) HUVECs. (B) The quantitative data are represented as fold compared with LtGFP-infected HUVECs.
for bFGF-mediated cadherin downregulation on HUVECs was investigated by treating EGM2-cultured HUVECs with several specific inhibitors. SU5402, an intracellular tyrosine kinase inhibitor of FGFR1, was added to EGM2-cultured HUVECs for 48 h. E-, N-, P- and VE-cadherin expressions on the surface of HUVECs were significantly elevated after addition of SU5402 (SU; 8.4 μM) compared with DMSO (Figs. 2A, B). This result indicates that FGFR1 is the principal receptor for bFGFmediated cadherin downregulation. However, bFGF–FGFR1 interaction also activates intracellular small GTPase Ras, phosphoinositide 3-kinase (PI3K) and phospholipase C-γ (PLC-γ) and mediates endothelial cell proliferation, differentiation and migration [25–27]. Recent reports have also suggested that the Ras-MAPK signaling pathway is important in regulating endothelial cells migration during bFGF-induced angiogenesis [28,29]. To further investigate the participation of MAPK signaling in bFGF-mediated surface cadherin downregulation, we treated EGM2-cultured HUVECs with the ERK inhibitor PD98059 (PD) or the JNK inhibitor SP600125 (SP) or the p38 inhibitor SB203580 (SB) for 48 h. The surface cadherin expression was significantly elevated on HUVECs treated with 10–20 μM SP600125; however, neither PD98059 (1–100 μM) nor SB203580 (1–100 μM) administration affected surface cadherin expression (Figs. 2A, B). Fig. 2C shows that the level of cadherin restoration was similar in HUVECs cultured in growth factors withdrawal (20% FBS), FGFR1 blockade (SU) or JNK inhibition (SP) for 24 h. Besides, we also silenced JNK activity in HUVECs with a JNK1 or JNK2 siRNA, respectively. The expression of the studied four cadherins was also increased on surface of EGM2cultured HUVECs (data not shown). These suggest that FGFR1JNK signaling may be crucial in the mediation of dynamic regulation of cadherins on HUVECs by bFGF. The small GTPase Ras is a proximal upstream activator of JNK; Ras can also be activated through bFGF–FGFR1 signaling in endothelial cells [29,30]. To investigate whether Ras participates in bFGF-mediated cadherin downregulation, we generated a lentiviral vector carrying a dominant negative RasS17N mutant (LtRasS17N) or GFP (LtGFP). HUVECs were infected with
virus, and the surface expression of cadherins was determined by flow cytometry after three passages. The data show that cadherin expression on the surface of LtRasS17N-infected HUVECs was significantly higher than that on the surface of LtGFP-infected cells (Figs. 3A, B). However, expression levels of cadherins in LtRasS17N-infected HUVECs were not as high as that in growth factor withdrawal condition. A possible reason may be that endogenous Ras is able to mediate bFGF signaling in the LtRasS17N-infected HUVECs.
bFGF downregulates surface cadherins without affecting mRNA or total proteins We also examined the kinetics of surface cadherin expression on HUVECs. After various treatments for 16 h, including cultured in growth factor withdrawal condition (20% FBS), FGFR1 kinase blockade (SU) or JNK inhibition (SP), the percentage of high fluorescence intensity (HFI) was significantly increased, as compared with EGM2-cultured HUVECs (EGM2) (Fig. 4). To verify whether bFGF reduces surface cadherin expression by attenuating mRNA levels of cadherins, we measured the mRNA levels of cadherins, cadherin-associated catenins and GAPDH using RT-PCR methods [22]. As shown in Fig. 5A, there was no significant difference between the EGM2, 20% FBS/M199, EGM2/SU or EGM2/SP conditions. These data were confirmed by quantitative RT-PCR (Fig. 5B). We also measured the total amount of cadherins by Western blot analysis. However, there was no significant change in the total amount protein after EGM2, 20% FBS, SU or SP treatment (Fig. 6). According to these results, we suggest that bFGF mediates cadherin downregulation on surface of HUVECs without any changes of total mRNA or proteins of cadherins.
Discussion Adherens junction, constructed by cadherins, cadherin-associated catenins and cytoskeletal actin network, is an important
426
E XP ER I ME NT A L C EL L RE S EA R CH 3 14 ( 20 0 8 ) 4 2 1 –42 9
Fig. 4 – Time course of surface cadherin restoration by growth factor withdrawal, FGFR1 kinase blockade or JNK inhibition. In brief, HUVECs were washed by medium and cultured in EGM2 (EGM2), 20% FBS/M199 (20% FBS), EGM2 containing 4.2 μM SU5402 (SU) or 20 μM SP600125 (SP). Cells were harvested at 8, 16 and 24 h and analyzed the surface cadherins by flow cytometry. The percentage of high fluorescence intensity (HFI) was quantified and shown. HUVECs used in all experiments were collected from three different umbilical cords.
cell–cell interaction complex on endothelium [8]. All the typical cadherins (E-, N-, P- and VE-cadherin) are expressed on endothelium [31]. N-cadherin mediates the heterophilic interaction of endothelial cells with mural cells (including pericytes and vascular smooth muscle cells), which is necessary for the maturation and stabilization of the vasculature [32,33]. Through homotypic cell–cell interaction, VE-cadherin plays important roles in maintaining capillary tubular architecture during embryonic endocardial development, adult vasculogenesis and angiogenesis [11–13,32]. These results indicate that intercellular junctions, including cell–cell and cell–ECM interaction, mediate ‘stabilization’ signals and maintain the integrity of endothelial cells during resting state. However, it is necessary for intercellular junctions to become partially disorganized to allow migration and proliferation of endothelial cells during the formation of new vessels [18,21,34]. Recent studies have showed that VE-cadherin is removed from the endothelium surface during bFGF-induced angiogenesis [18,21]. Fibroblasts-derived growth factors can modulate the expression and regulation of VE-cadherin on human endothe-
lial cells [14]. Moreover, VE-cadherin and β-catenin are rapidly lost from cell–cell contacts between endothelial cells during the initial stage of angiogenesis [20]. Our data also showed that bFGF can attenuate the surface expression of E-, N-, P- and VEcadherin on HUVECs, suggesting that the disorganization of adherens junction may be required in the initial stage of angiogenesis. This process must be tightly controlled by proangiogenic factors, such as bFGF, to avoid uncontrolled proliferation or apoptosis of endothelial cells. Several investigators reported their findings about the effect of bFGF or VEGF on cadherin regulation using different experimental conditions and got different results [56,57]. It is very difficult to address which model is more appropriate to mimic vascular biology in vivo. Trivier et al. demonstrated that the morphological features of HUVECs cultured in EGM2 showed a “proliferating stage” feature, but cells grown in EGM2 devoid of bFGF and VEGF displayed a “senescence stage” feature [55]. Zhang and Issekutz defined “resting stage” as HUVECs cultured in 20% heat-inactivated human AB serum/ RPMI 1640 without any growth factor. They also demonstrated
E XP E RI ME N TA L CE LL RE S EA RCH 3 14 ( 20 0 8 ) 4 2 1 –42 9
427
Fig. 5 – Comparison of the cadherins, catenins and GAPDH mRNA levels in HUVECs. (A) In brief, HUVECs were washed by medium and cultured in EGM2 (EGM2), 20% FBS/M199 (20% FBS), EGM2 containing 4.2 μM SU5402 (SU) or 20 μM SP600125 (SP). After 12 h of incubation, cells were harvested for RNA extraction and cDNA generation. The cDNA was amplified for optimal cycles by specific primers for E-, N-, P-, VE-cadherin, GAPDH, α-, β- and γ-catenin. (B) Real-time RT-PCR for expression levels of cadherins and GAPDH mRNA in HUVECs. The cDNA collected in panel A was examined for the amount of cadherins and GAPDH mRNA by quantitative real-time PCR. HUVECs used in all experiments were collected from three different umbilical cords.
that bFGF has no effect on VE-cadherin expression in HUVECs [56]. Prandini et al. demonstrated that bFGF activates VEcadherin promoter but they did not delineate the culture condition [57]. It is possible that bFGF might have opposite functions on proliferating and resting endothelial cells. Our experimental results also suggest that bFGF has an ability to eliminate surface cadherins on the surface of endothelial cells in the experimental condition mimicking proliferating stage of HUVECs. By triggering protease production, cell–cell adhesion disturbance and integrin modulation during the initial phase of angiogenesis, bFGF promotes endothelial cells proliferation and migration. It also plays a role in vessel morphogenesis and maturation in the later phase of angiogenesis [21,35]. Disrupting the FGFR1 in mouse embryos showed that FGFR1 is required for the development and maintenance of the vasculature [36,37]. The interaction of bFGF–FGFR1 leads to FGFR1 dimerization and autophosphorylation within the intracellular domain of FGFR1. Autophosphorylation of FGFR1 can activate intracellular PI3K, PLC-γ and Ras signaling in endothelial cells [30,38]. Following Ras activation and the consequent continuous phosphorylation, MAPKs including ERK, JNK and p38 MAP kinase are activated, and then they turn on certain transcription factors, which mediate angiogenesisrelated genes expression [28]. Recent studies suggested that Ras activation is required for bFGF- or VEGF-mediated endothelial cell motility. An activated RasV12 mutant induces PI3K, ERK and JNK activation in primary endothelial cells [29]. Moreover, they concluded that ERK maintains endothelial cell survival and proliferation; JNK promotes proliferation and migration whereas p38 induces endothelial cell differentiation
[29,39]. Constitutively overexpressed oncogenic H-Ras in ECV304 endothelial cells increases cell motility through RasSEK1-JNK pathway [40]. Based on these reports and our results, we consider that bFGF could downregulate surface cadherins via FGFR1-Ras-JNK signaling to promote endothelial cells migration in the early stage of angiogenesis. Other adhesion molecules, such as integrins, also serve as regulators in maintaining cell–ECM interaction in endothelium and are reported to be regulated during bFGF-induced angiogenesis [41–44].
Fig. 6 – Analysis of total protein levels of cadherins and β-actin in HUVECs. In brief, HUVECs were washed by medium and cultured in EGM2 (EGM2), 20% FBS/M199 (20% FBS), EGM2 containing 4.2 μM SU5402 (SU) or 20 μM SP600125 (SP). After 24 h of incubation, cells were harvested for protein collection. The amount of cadherins and β-actin was measured by Western blot analysis.
428
E XP ER I ME NT A L C EL L RE S EA R CH 3 14 ( 20 0 8 ) 4 2 1 –42 9
Interestingly, recent evidence has demonstrated that active Ras could enhance endothelial cell migratory ability by attenuating α3β1 integrin expression [44]. These observations raise a possibility that bFGF may activate Ras-JNK signaling to mediate the destruction of cell–cell and cell–ECM interaction at the same time, resulting in promoting endothelial cells migration. Our data show that bFGF attenuates surface cadherin expression on HUVECs. However, the mRNA or total protein levels of cadherins did not show significant difference. These results indicated that bFGF does not directly affect the transcription and translation of cadherins. In the literature, the surface cadherins have been shown to exist in a dynamic state with cytosolic cadherins. The steady state of cadherins is limited by recycling processes, including endocytosis, exocytosis and degradation [32,45]. For example, the endocytosis of VE-cadherin can be inhibited by p120CTN binding [45,46]. The phosphorylation levels of VE-cadherin and βcatenin also affect the anchorage of VE-cadherin–catenins– actin, resulting in VE-cadherin internalization [47–50]. In addition, some specific lytic enzymes may act on cleavage of the cadherin cytoplasmic tail or the extracellular domain [51– 54]. Thus, a complex mechanism has been postulated to regulate the surface expression of cadherins and cadherin– catenins–actin structure. Our results only suggest the basic mechanism that bFGF modulates surface cadherin expression by intracellular Ras-JNK signaling. Further work is required to clarify how JNK mediates surface/intercellular cadherin turnover.
Acknowledgments This study was supported in part by grants from National Science Council (NSC93-2314-B-016-027), Tri-Service General Hospital (TSGH-C94-25) and C.Y. Foundation for advancement of Education, Sciences, and Medicine, Taipei, Republic of China.
REFERENCES
[1] C.M. Nelson, C.S. Chen, VE-cadherin simultaneously stimulates and inhibits cell proliferation by altering cytoskeletal structure and tension, J. Cell Sci. 116 (2003) 3571–3581. [2] D. Vestweber, Molecular mechanisms that control endothelial cell contacts, J. Pathol. 190 (2000) 281–291. [3] S.M. Dudek, J.G. Garcia, Cytoskeletal regulation of pulmonary vascular permeability, J. Appl. Physiol. 91 (2001) 1487–1500. [4] R.L. Juliano, Signal transduction by cell adhesion receptors and the cytoskeleton: functions of integrins, cadherins, selectins, and immunoglobulin-superfamily members, Annu. Rev. Pharmacol. Toxicol. 42 (2002) 283–323. [5] G. Christofori, H. Semb, The role of the cell-adhesion molecule E-cadherin as a tumour-suppressor gene, Trends Biochem. Sci. 24 (1999) 73–76. [6] S.T. Suzuki, Structural and functional diversity of cadherin superfamily: are new members of cadherin superfamily involved in signal transduction pathway? Cell Biochem. 61 (1996) 531–542. [7] S.T. Suzuki, Protocadherins and diversity of the cadherin superfamily, J. Cell Sci. 109 (Pt 11) (1996) 2609–2611.
[8] B.D. Angst, C. Marcozzi, A.I. Magee, The cadherin superfamily: diversity in form and function, J. Cell Sci. 114 (2001) 629–641. [9] P. Carmeliet, M.G. Lampugnani, L. Moons, F. Breviario, V. Compernolle, F. Bono, G. Balconi, R. Spagnuolo, B. Oostuyse, M. Dewerchin, A. Zanetti, A. Angellilo, V. Mattot, D. Nuyens, E. Lutgens, F. Clotman, M.C. de Ruiter, A. Gittenberger-de Groot, R. Poelmann, F. Lupu, J.M. Herbert, D. Collen, E. Dejana, Targeted deficiency or cytosolic truncation of the VE-cadherin gene in mice impairs VEGF-mediated endothelial survival and angiogenesis, Cell 98 (1999) 147–157. [10] D. Vittet, T. Buchou, A. Schweitzer, E. Dejana, P. Huber, Targeted null-mutation in the vascular endothelial-cadherin gene impairs the organization of vascular-like structures in embryoid bodies, Proc. Natl. Acad. Sci. U. S. A. 94 (1997) 6273–6278. [11] T.L. Bach, C. Barsigian, D.G. Chalupowicz, D. Busler, C.H. Yaen, D.S. Grant, J. Martinez, VE-Cadherin mediates endothelial cell capillary tube formation in fibrin and collagen gels, Exp. Cell Res. 238 (1998) 324–334. [12] J.H. Distler, A. Hirth, M. Kurowska-Stolarska, R.E. Gay, S. Gay, O. Distler, Angiogenic and angiostatic factors in the molecular control of angiogenesis, Q. J. Nucl. Med. 47 (2003) 149–161. [13] D. Vestweber, Regulation of endothelial cell contacts during leukocyte extravasation, Curr. Opin. Cell Biol. 14 (2002) 587–593. [14] T.A. Martin, K. Harding, W.G. Jiang, Matrix-bound fibroblasts regulate angiogenesis by modulation of VE-cadherin, Eur. J. Clin. Invest. 31 (2001) 931–938. [15] M. Corada, L. Zanetta, F. Orsenigo, F. Breviario, M.G. Lampugnani, S. Bernasconi, F. Liao, D.J. Hicklin, P. Bohlen, E. Dejana, A monoclonal antibody to vascular endothelial-cadherin inhibits tumor angiogenesis without side effects on endothelial permeability, Blood 100 (2002) 905–911. [16] F. Liao, J.F. Doody, J. Overholser, B. Finnerty, R. Bassi, Y. Wu, E. Dejana, P. Kussie, P. Bohlen, D.J. Hicklin, Selective targeting of angiogenic tumor vasculature by vascular endothelial-cadherin antibody inhibits tumor growth without affecting vascular permeability, Cancer Res. 62 (2002) 2567–2575. [17] R. Blindt, A.K. Bosserhoff, J. Dammers, N. Krott, L. Demircan, R. Hoffmann, P. Hanrath, C. Weber, F. Vogt, Downregulation of N-cadherin in the neointima stimulates migration of smooth muscle cells by RhoA deactivation, Cardiovasc. Res. 62 (2004) 212–222. [18] P.A. Underwood, P.A. Bean, J.R. Gamble, Rate of endothelial expansion is controlled by cell:cell adhesion, Int. J. Biochem. Cell Biol. 34 (2002) 55–69. [19] T. Halama, M. Groger, M. Pillinger, G. Staffler, E. Prager, H. Stockinger, W. Holnthoner, S. Lechleitner, K. Wolff, P. Petzelbauer, Platelet endothelial cell adhesion molecule-1 and vascular endothelial cadherin cooperatively regulate fibroblast growth factor-induced modulations of adherens junction functions, J. Invest. Dermatol. 116 (2001) 110–117. [20] T.J. Wright, L. Leach, P.E. Shaw, P. Jones, Dynamics of vascular endothelial-cadherin and beta-catenin localization by vascular endothelial growth factor-induced angiogenesis in human umbilical vein cells, Exp. Cell Res. 280 (2002) 159–168. [21] M. Presta, P. Dell'Era, S. Mitola, E. Moroni, R. Ronca, M. Rusnati, Fibroblast growth factor/fibroblast growth factor receptor system in angiogenesis, Cytokine Growth Factor Rev. 16 (2005) 159–178. [22] C.T. Tai, W.C. Lin, W.C. Chang, T.H. Chiu, G.T. Chen, Classical cadherin and catenin expression in normal myometrial tissues and uterine leiomyomas, Mol. Reprod. Dev. 64 (2003) 172–178. [23] F.M. Tsai, R.Y. Shyu, S.Y. Jiang, RIG1 inhibits the Ras/mitogen-activated protein kinase pathway by suppressing the activation of Ras, Cell. Signal. 18 (2006) 349–358.
E XP E RI ME N TA L CE LL RE S EA RCH 3 14 ( 20 0 8 ) 4 2 1 –42 9
[24] L.J. Chang, A.K. Zaiss, Lentiviral vectors. Preparation and use, Methods Mol. Med. 69 (2002) 303–318. [25] S.V. Lutsenko, S.M. Kiselev, S.E. Severin, Molecular mechanisms of tumor angiogenesis, Biochemistry (Mosc) 68 (2003) 286–300. [26] M. Goldfarb, Signaling by fibroblast growth factors: the inside story, Sci. STKE 2001 (2001) PE37. [27] R. Munoz-Chapuli, A.R. Quesada, M. Angel Medina, Angiogenesis and signal transduction in endothelial cells, Cell Mol. Life Sci. 61 (2004) 2224–2243. [28] M. Tsang, I.B. Dawid, Promotion and attenuation of FGF signaling through the Ras-MAPK pathway, Sci. STKE 2004 (2004) pe17. [29] K.N. Meadows, P. Bryant, P.A. Vincent, K.M. Pumiglia, Activated Ras induces a proangiogenic phenotype in primary endothelial cells, Oncogene 23 (2004) 192–200. [30] M.J. Cross, L. Claesson-Welsh, FGF and VEGF function in angiogenesis: signalling pathways, biological responses and therapeutic inhibition, Trends Pharmacol. Sci. 22 (2001) 201–207. [31] E. Dejana, M. Corada, M.G. Lampugnani, Endothelial cell-to-cell junctions, FASEB J. 9 (1995) 910–918. [32] U. Cavallaro, S. Liebner, E. Dejana, Endothelial cadherins and tumor angiogenesis, Exp. Cell Res. 312 (2006) 659–667. [33] H. Gerhardt, C. Betsholtz, Endothelial–pericyte interactions in angiogenesis, Cell Tissue Res. 314 (2003) 15–23. [34] E. Dejana, Endothelial cell–cell junctions: happy together, Nat. Rev. Mol. Cell Biol. 5 (2004) 261–270. [35] M.A. Nugent, R.V. Iozzo, Fibroblast growth factor-2, Int J. Biochem. Cell Biol. 32 (2000) 115–120. [36] C.X. Deng, A. Wynshaw-Boris, M.M. Shen, C. Daugherty, D.M. Ornitz, P. Leder, Murine FGFR-1 is required for early postimplantation growth and axial organization, Genes Dev. 8 (1994) 3045–3057. [37] S.H. Lee, D.J. Schloss, J.L. Swain, Maintenance of vascular integrity in the embryo requires signaling through the fibroblast growth factor receptor, J. Biol. Chem. 275 (2000) 33679–33687. [38] P. Auguste, S. Javerzat, A. Bikfalvi, Regulation of vascular development by fibroblast growth factors, Cell Tissue Res. 314 (2003) 157–166. [39] T. Matsumoto, I. Turesson, M. Book, P. Gerwins, L. Claesson-Welsh, p38 MAP kinase negatively regulates endothelial cell survival, proliferation, and differentiation in FGF-2-stimulated angiogenesis, J. Cell Biol. 156 (2002) 149–160. [40] E.Y. Shin, S.Y. Kim, E.G. Kim, c-Jun N-terminal kinase is involved in motility of endothelial cell, Exp. Mol. Med. 33 (2001) 276–283. [41] G. Collo, M.S. Pepper, Endothelial cell integrin alpha5beta1 expression is modulated by cytokines and during migration in vitro, J. Cell Sci. 112 (Pt 4) (1999) 569–578. [42] S. Klein, F.G. Giancotti, M. Presta, S.M. Albelda, C.A. Buck, D.B. Rifkin, Basic fibroblast growth factor modulates integrin expression in microvascular endothelial cells, Mol. Biol. Cell 4 (1993) 973–982. [43] N.T. Sepp, L.J. Li, K.H. Lee, E.J. Brown, S.W. Caughman, T.J. Lawley, R.A. Swerlick, Basic fibroblast growth factor increases expression of the alpha v beta 3 integrin complex on human microvascular endothelial cells, J. Invest. Dermatol. 103 (1994) 295–299. [44] E.Y. Shin, J.Y. Lee, M.K. Park, G.B. Jeong, E.G. Kim, S.Y. Kim, H-Ras is a negative regulator of alpha3beta1 integrin
[45]
[46]
[47]
[48]
[49]
[50]
[51]
[52]
[53]
[54]
[55]
[56]
[57]
429
expression in ECV304 endothelial cells, Biochem. Biophys. Res. Commun. 257 (1999) 95–99. A.P. Kowalczyk, A.B. Reynolds, Protecting your tail: regulation of cadherin degradation by p120-catenin, Curr. Opin. Cell Biol. 16 (2004) 522–527. K. Xiao, J. Garner, K.M. Buckley, P.A. Vincent, C.M. Chiasson, E. Dejana, V. Faundez, A.P. Kowalczyk, p120-Catenin regulates clathrin-dependent endocytosis of VE-cadherin, Mol. Biol. Cell 16 (2005) 5141–5151. M.D. Potter, S. Barbero, D.A. Cheresh, Tyrosine phosphorylation of VE-cadherin prevents binding of p120- and beta-catenin and maintains the cellular mesenchymal state, J. Biol. Chem. 280 (2005) 31906–31912. M.T. Lin, M.L. Yen, C.Y. Lin, M.L. Kuo, Inhibition of vascular endothelial growth factor-induced angiogenesis by resveratrol through interruption of Src-dependent vascular endothelial cadherin tyrosine phosphorylation, Mol. Pharmacol. 64 (2003) 1029–1036. N. Lambeng, Y. Wallez, C. Rampon, F. Cand, G. Christe, D. Gulino-Debrac, I. Vilgrain, P. Huber, Vascular endothelial-cadherin tyrosine phosphorylation in angiogenic and quiescent adult tissues, Circ. Res. 96 (2005) 384–391. A.H. Huber, W.I. Weis, The structure of the beta-catenin/E-cadherin complex and the molecular basis of diverse ligand recognition by beta-catenin, Cell 105 (2001) 391–402. Y. Ichikawa, T. Ishikawa, N. Momiyama, M. Kamiyama, H. Sakurada, R. Matsuyama, S. Hasegawa, T. Chishima, Y. Hamaguchi, S. Fujii, S. Saito, K. Kubota, S. Hasegawa, H. Ike, S. Oki, H. Shimada, Matrilysin (MMP-7) degrades VE-cadherin and accelerates accumulation of beta-catenin in the nucleus of human umbilical vein endothelial cells, Oncol. Rep. 15 (2006) 311–315. B. Hermant, S. Bibert, E. Concord, B. Dublet, M. Weidenhaupt, T. Vernet, D. Gulino-Debrac, Identification of proteases involved in the proteolysis of vascular endothelium cadherin during neutrophil transmigration, J. Biol. Chem. 278 (2003) 14002–14012. T. Hirao, D. Nanba, M. Tanaka, H. Ishiguro, Y. Kinugasa, Y. Doki, M. Yano, N. Matsuura, M. Monden, S. Higashiyama, Overexpression of ADAM9 enhances growth factor-mediated recycling of E-cadherin in human colon cancer cell line HT29 cells, Exp. Cell Res. 312 (2006) 331–339. P. Marambaud, J. Shioi, G. Serban, A. Georgakopoulos, S. Sarner, V. Nagy, L. Baki, P. Wen, S. Efthimiopoulos, Z. Shao, T. Wisniewski, N.K. Robakis, A presenilin-1/gamma-secretase cleavage releases the E-cadherin intracellular domain and regulates disassembly of adherens junctions, EMBO J. 21 (2002) 1948–1956. E. Trivier, D.J. Kurz, Y. Hong, H.L. Huang, J.D. Erusalimsky, Differential regulation of telomerase in endothelial cells by fibroblast growth factor-2 and vascular endothelial growth factor-A, association with replicative life span, Ann. N.Y. Acad. Sci. 1019 (2004) 111–115. H. Zhang, A.C. Issekutz, Down-modulation of monocyte transendothelial migration and endothelial adhesion molecule expression by fibroblast growth factor, reversal by the anti-angiogenic agent SU6668, Am. J. Pathol. 160 (2002) 2219–2230. M.H. Prandini, I. Dreher, S. Bouillot, S. Benkerri, T. Moll, P. Huber, The human VE-cadherin promoter is subjected to organ-specific regulation and is activated in tumour angiogenesis, Oncogene 24 (2005) 2992–3001.