Label-free photoelectrochemical aptasensing of diclofenac based on gold nanoparticles and graphene-doped CdS

Accepted Manuscript Title: Label-free photoelectrochemical aptasensing of diclofenac based on gold nanoparticles and graphene-doped CdS Authors: Otieno Kevin Okoth, Kai Yan, Jun Feng, Jingdong Zhang PII: DOI: Reference:

S0925-4005(17)31991-3 https://doi.org/10.1016/j.snb.2017.10.089 SNB 23393

To appear in:

Sensors and Actuators B

Received date: Revised date: Accepted date:

23-7-2017 15-10-2017 16-10-2017

Please cite this article as: Otieno Kevin Okoth, Kai Yan, Jun Feng, Jingdong Zhang, Label-free photoelectrochemical aptasensing of diclofenac based on gold nanoparticles and graphene-doped CdS, Sensors and Actuators B: Chemical https://doi.org/10.1016/j.snb.2017.10.089 This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

Label-free photoelectrochemical aptasensing of diclofenac based on gold nanoparticles and graphene-doped CdS Otieno Kevin Okoth, Kai Yan, Jun Feng, Jingdong Zhang*

Key laboratory of Material Chemistry for Energy Conversion and Storage (Ministry of Education), School of Chemistry and Chemical Engineering, Huazhong University of Science and Technology, Luoyu Road 1037, Wuhan 430074, P.R. China

*

Corresponding author. Tel: +86-27-87543032. Fax: +86-27-87543632. E-mail address:

[email protected] (J. Zhang).

GraphicalAbstract

1

Research Highlights 

A PEC aptasensor for DCF is constructed with gold nanoparticles and GR-CdS.



Gold nanoparticles enhance photocurrent of GR-CdS by surface plasmon resonance.



Gold nanoparticles improve immobilization of aptamer on electrode surface.



The developed aptasensor shows high sensitivity and selectivity for DCF detection.

Abstract Gold nanoparticles (Au NPs) and graphene-doped CdS (GR-CdS) were employed to fabricate a photoelectrochemical (PEC) aptasensor for detection of diclofenac (DCF). It was observed that GR-CdS modified electrode exhibited a high and stable photocurrent response upon visible light illumination, due to the excellent electrical and optical property of GR as well as the high absorption efficiency of CdS in the visible region. While Au NPs were incorporated with GR-CdS, a further increase in photocurrent response was observed owing to surface plasmon resonance. Moreover, the Au NPs were advantageous to immobilize the SH-terminated aptamer used as a biorecognition element. Upon interaction of DCF with the immobilized aptamer, the DCF molecules were captured by the aptasensor. When the sensor was illuminated with visible light, an enhanced PEC current response to DCF was realized due to the oxidation of the captured DCF by the photogenerated holes. Under the optimized conditions, the sensor showed a PEC response linear to DCF concentration in the range of 1 to 150 nM, with a detection limit (3S/N) of 0.78 nM. Thus, a highly selective and sensitive PEC sensor for the determination of DCF was provided. Keywords:

Photoelectrochemical

Aptasensor;

nanoparticles

2

Diclofenac;

Graphene;

CdS;

Gold

1. Introduction Photoelectrochemical (PEC) sensors have recently attracted considerable research interests due to their advantages of high sensitivity, simple instrument, easy miniaturization and low cost [1,2]. In the construction of PEC sensors, the sensitivity could be generally improved by promoting the performance of photocatalysts. Nevertheless, PEC sensing is based on photocatalytic reactions which are usually not specific to analytes. To overcome this problem, much effort has been paid to improve the selectivity of PEC sensors by introduction of various recognition elements such as molecular imprinted polymers, enzymes, antibodies and aptamers [3-6]. Among them, aptamers, well-known antibody mimetics possessing high recognition ability to specific targets, have been intensively utilized to construct highly selective PEC aptasensors for a wide range of analytes including inorganic ions, proteins, cells, antibiotics and organic compounds [7-12]. A number of semiconductors have been explored to develop photocatalysts that can respond to visible light due to the abundance of solar spectrum in the universe. Amongst these, CdS has been widely due to its desirable band gap of 2.4 eV, as well as high absorption coefficient in the solar spectrum [13]. However, practical application of CdS is still restricted due to the low photocatalytic efficiency of CdS, caused by the fast recombination of photogenerated charge carriers. In addition, CdS has been reported to undergo photocorrosion under strong illumination [14]. Great effort has been devoted to curbing the recombination of photogenerated holes and electrons through coupling with other semiconductors with matched energy levels such as TiO2 [4], MoS2 [14], and g-C3N4 [15]. Besides, carbon nanostructures such as carbon nanotubes and graphene have also been successfully incorporated into CdS hybrids. Graphene (G) is a “zero band gap” semiconductor, composed of sp2-hybridized carbon atoms in an extended honeycomb-like network. Owing to its outstanding physicochemical properties, graphene has been widely applied in preparation of 3

semiconductor nanohybrids. It can accept and efficiently transfer photogenerated electrons from a semiconductor upon irradiation due to excellent electrical conductivity, leading to reduced recombination of holes and electrons, and prolonged lifetime for charge carriers. Consequently, the photocatalytic activities of the nanocomposites are greatly improved. To date, a number of composites consisting of graphene and CdS have been prepared and used in a vast range of applications such as photocatalytic degradation of pollutant [16], hydrogen evolution [17], and photoelectrochemical sensors [18,19]. Due to its good stability, biocompartibility, ease of surface functionalization and excellent catalytic performance, gold nanostructures have been widely applied in fabrication of electroanalytical sensors [20-22]. Upon irradiation of Au nanostructure based photoactive species, collective oscillations of electrons result in the conduction band, a phenomenon called the localized surface plasmon resonance (LSPR) [23,24]. Due to the surface resonance plasmons, there is enhanced separation of photogenerated electron-hole pairs, and increased rate in formation of photogenerated charges. Furthermore, gold nanoparticles are more favourable for plasmon sensitization when compared to organic dyes, since they have greater extinction coefficients in the visible region [25]. For instance, coupling of Au nanostructures with CdS has resulted in enhanced photocatalytic hydrogen evolution [26] as well as improved PEC sensing performance [27]. These have been attributed to enhanced formation rate of electron/hole pairs and reduced recombination of photogenerated charges on CdS, thus used in this experiment. Nonsteroidal anti-inflammatory drugs refer to a group of drugs commonly prescribed due to their analgesic, anti-inflammatory and antipyretic effects. Amongst them is diclofenac that has been widely employed as an analgesic after surgery or injuries in acute and chronic inflammation, as well as in the treatment of rheumatic problems [28,29]. Unfortunately, extended use or overuse of DCF could result in life threatening heart or circulation problems 4

such as heart attack and stroke [30]. In addition, prolonged exposure to DCF in the environment has been suggested to induce renal lesions and alterations of the gills of fish, thus negatively impact the health of aquatic organisms [31]. Therefore, the development of a simple, highly selective and inexpensive method for determination of diclofenac in environmental, pharmaceutical and biological samples is very vital. To date, a number of electroanalytical techniques have been proposed for determination of DCF. For instance, spinel structured MgFe2O4 nanoparticles were used to simultaneously determine DCF and morphine in serum and urine samples [32]. Simultaneous analysis of DCF with other drugs such as indomethacin [33], paracetamol [34] and codeine [35] has been successfully demonstrated. Other strategies based on electrochemical [36] and impedimetric [37] aptamer sensing have also been explored for DCF sensing. It is still a challenge to develop highly sensitive and selective aptasensors for DCF detection. Herein, we describe a novel PEC strategy for the determination of DCF using an aptamer sensor. GR-CdS used as the photoactive material was prepared by a simple hydrothermal method. Such a composite offered advantages of remarkable visible light absorption ability of CdS and excellent electrons transfer properties of graphene. While Au NPs were deposited onto GR-CdS, a substantially enhanced photocurrent response attributed to surface plasmon resonance was realized, thus improving the sensitivity of the PEC sensing protocol. DCF aptamers as recognition elements were immobilized onto the modified electrode through the Au-SH interaction. After specific interaction between the aptamer and DCF, an increase in photocurrent response was observed. This proposed strategy exhibited high sensitivity, excellent selectivity and good stability.

2. Experimental

5

2.1. Materials and reagents Cadnium acetate [Cd(Ac)2] was purchased from Qiangsheng Chemical Co., Ltd. (Jiangsu, China). Diclofenac sodium was obtained from Sigma Aldrich Chemicals Reagent Co., USA. Poly (diallyldimethylammonium chloride) (PDDA, MW 100000-200000, 20% wt. in water) was purchased from Aldrich (St. Louis, USA). Paracetamol (PCT), Mercaptoacetic acid (MPA), thioacetamide, graphite powder, NaBH4 and hydrogen peroxide were obtained from Sinopharm Chemical Reagent Co., Ltd. (Shanghai, China). Diclofenac sodium drugs were supplied by Huaxin Pharmaceutical Co., Ltd. (Sichuan, China) and EASEHEAL Pharmaceutical Co. Ltd. (Nanjing, China). All other chemicals and reagents were of analytical grade and used without further purification. Thiol-functionalized DCF aptamer used

in

this

study

had

the

following

sequence:

[5´-SH-(CH2)6-

TCTAACGTGAATGATAGACCTGGCTTGGGTGGTGGGCGACTGACTGGCGGTGCA ACGTTAACTTATTCGACCATA-3´] and it was synthesized by Shanghai Sangon Biotech Co. Ltd. (Shanghai, China). Phosphate buffer solution (0.01 M PBS) at pH 8.0 was used for preparation of aptamer solution while double distilled water was used throughout the experiment. 2.2. Apparatus The crystalline phases and the composition of the materials were analyzed in the 2θ range from 5-80 degrees by X-ray diffraction (XRD, Bruker Instruments, Germany) with Cu Kα radiation. Scanning electron microscopy was performed on Quanta 200 field emission (FE-SEM) (FEI, The Netherlands) electron microscope to characterize the morphology of the as-synthesized nanomaterials. The optical properties of the samples were analyzed by UV absorption spectroscopy using a TU-1900 UV-visible spectrometer (Beijing Purkinje General Instrument Company, China) while the fourier transform infrared (FTIR) spectra were

6

generated from an Equinox 55 FTIR spectrophotometer (Bruker Co., Germany). The photoluminescence (PL) spectra were obtained from RF-5310PC fluorometer (Shimadzu, Japan) at an excitation wavelength of 220 nm. CHI830C electrochemical workstation (Shanghai Chenhua Instrument Company, China) was used to conduct all the PEC experiments. Electrochemical impedance spectroscopy (EIS) was carried out with a CHI660A electrochemical workstation (Shanghai Chenhua Instrument Company, China) at an open circuit in the frequency range from 100 mHz to 100 kHz, applied potential was 0.2 V. HPLC measurements were undertaken on an Agilent (USA) 1100 module system with a C18 column. The mobile phase used for HPLC experiment consisted of acetonitrile: 1% acetic acid (in water) in the ratio 60:40 (v/v). An injection volume of 50 µL was used while the flow rate was maintained at 1 mL min-1. The column effluents were monitored at an absorption wavelength of 275 nm. UV-Vis detector was employed in detection of effluents. All measurements were performed at room temperature. 2.3. Material synthesis GO was synthesized according to modified Hummers’ method as presented in an earlier report [38]. GR-CdS was prepared by first dispersing 5 mg of GO into 50 mL of water followed by 1 h sonication. 50 µL of PDDA was then added and the mixture stirred for 30 min. Subsequently, 0.1333g of Cd(Ac)2 and 100 µL MPA were added and further stirred for 30 min. The pH of the mixture was adjusted to 10 with NaOH solution upon which it was vigorously stirred under nitrogen atmosphere. Afterwards, 0.3 g thiourea was added to the mixture, stirred for 5 min then the resultant mixture heated in a teflon lined steel autoclave at 180 oC for 12 h. After cooling to room temperature, the product was washed several times in succession with water and ethanol then finally dried at 50 oC. Meanwhile, in the preparation of cysteamine stabilized Au NPs, the glassware used in the experiment were first soaked in aqua-regia (HCl/HNO3 in ratio 3:1) for 1 h, then thoroughly rinsed with distilled water and 7

dried in an oven. In the actual synthesis, 2.58 mL of 22 mM HAuCl4 was added to a beaker and then adjusted to 40 mL with distilled water. Subsequently, 400 µL of 213 mM cysteamine was injected into the mixture and stirred at room temperature for 20 min, followed by addition of 2 mL of freshly prepared 10 mM NaBH4 solution under vigorous stirring. The mixture turned wine-red indicating the formation of Au NPs and was further stirred at room temperature for 30 min. The obtained Au NPs were kept in a refrigerator at 4 o

C for further use.

2.4. Fabrication of PEC sensor Prior to fabrication, the FTO conducting glass was cut into small rectangular pieces (0.8 cm  1.2 cm). They were then cleaned by sequentially sonication in acetone, ethanol and 2 M NaOH for 30 min. The obtained FTO substrates were rinsed with plenty of deionized water and dried under a stream of nitrogen gas. FTO with an exposed geometric area of 0.096 cm2 was coated with 10 μL of 2 g L-1 GR-CdS suspension and dried in an oven for 2 h with the resultant electrode designated GR-CdS. Subsequently, 12 µL of cysteamine stabilized Au NPs were added onto the modified FTO and the solvent evaporated under IR irradiation. The resultant electrode surface was then coated with 10 µL of 1 µM aptamer solution and incubated at 4 oC for 12 hours. After adequately washing with distilled water, the fabricated aptamer sensor was dried under nitrogen gas and used for further studies. The prepared aptamer/Au-GR-CdS electrode was incubated with 10 µL of DCF solution at 30 oC for 90 min. Photoelectrochemical detection was then carried out in a three-electrode cell containing 0.1 M Na2SO4 solution with the fabricated electrode as the working electrode, platinum wire as the auxiliary electrode and a saturated calomel electrode (SCE) as the reference electrode. In this experiment, A CEL-S500R3 xenon lamp (Aulight Co. Ltd., China) (λ > 420 nm) was

8

utilized as the excitation source while the electrochemical workstation was operated at a bias potential of 0.2 V.

3. Results and discussion 3.1. Characterization of materials The X-ray diffraction (XRD) studies were performed to elucidate the crystal phases of GO and GR-CdS. As shown in Fig. 1A, the XRD pattern of GO exhibits a sharp peak at 11.3o, which is ascribed to the (001) reflection. For the XRD pattern of GR-CdS nanocomposite, a number of peaks located at 2θ values of 26.5, 30.7, 44.0, 52.1, 64.0 and 70.6 could be indexed to (111), (200), (220), (311), (400) and (331) crystal planes, respectively. These patterns correspond to the cubic CdS phase with lattice constant a = 5.8110 Å (JCPDS No. 01-080-0019). Since no GO peak is observed in GR-CdS, it shows that GO is reduced in the hydrothermal synthesis. Besides, the diffraction peaks of GR expected at 26o is not obvious possibly due to the overlap with the CdS characteristic peak (111) observed at 26.5o. On the other hand, the FTIR spectrum (Fig. S1) of GR-CdS also confirms the reduction of GO and formation of CdS in the hydrothermal process [39,40]. The SEM observation (Fig. 1B) indicates that a large number of CdS nanoparticles are uniformly grown on the surface of graphene. Such interfacial contact would be beneficial for the PEC activity of CdS. However, as depicted in Fig. 1C, no obvious change in morphology is observed upon the deposition of Au NPs on GR-CdS. This can be attributed to the very tiny nature of Au NPs. In order to confirm the loading of Au NPs, the EDS mapping image was recorded. As shown in Fig. 1D, it clearly displays the uniform distribution of Au on the modified electrode surface. Furthermore, XPS was performed to further investigate the

9

composition of the synthesized materials (Fig. S2). The results confirm the successful reduction and subsequent deposition of Au NPs on the composite [41]. 3.2. Optical properties and photocurrent responses The optical properties of GR-CdS and Au NPs were verified from the results of UVvisible absorption spectroscopy. As shown in Fig. 2A, GR-CdS nanocomposite exhibits a characteristic absorption peak at 260 nm and another broad absorption peak around 490 nm which can be attributed to GR and CdS, respectively. The result confirms that CdS absorbs light in the visible region while incorporation of GR can widen the range of light absorption. Meanwhile, cysteamine-stabilized Au NPs prepared by reduction of HAuCl4 using NaBH4 shows a broad absorption peak at around 530 nm. This absorption peak is seen to largely overlap with the PL emission spectrum of CdS (inset of Fig. 2 A) which is very important for the excitation of SPR of the Au NPs [42]. The photocurrent responses of Au, GR-CdS and Au/GR-CdS modified FTO electrodes were investigated in 0.1 M Na2SO4 at a bias potential of +0.2 V under visible light irradiation. As depicted in Fig. 2B, negligible photocurrent response is observed on Aumodified FTO electrode under visible light illumination. When GR-CdS-modified FTO is employed for measurement, a high photocurrent response is observed due to the appropriate band-gap of CdS that matches well with the solar spectrum. In addition, the incorporation of GR in the composite helps to reduce the fast recombination of the photogenerated electronhole pairs associated with CdS by increasing the transfer rate of the photogenerated electrons to the electrode. While Au NPs are assembled on GR-CdS modified electrode, an obviously enhanced PEC response is observed. This is ascribed to the plasmon-excited hot electrons from Au NPs that are transferred to the conduction band of CdS. Moreover, in such a nanocomposite, Au with very high electron transfer ability further increases the transfer rate

10

of photogenerated electrons, and thus effectively minimizing the recombination of photogenerated charges. Further studies based on photoluminescence (PL) were performed to reveal the effect of addition of Au on the photo-activity of GR-CdS. The PL spectrum of Au/GR-CdS is slightly lower when compared to that of GR-CdS (Fig. S3). It is attributed to the fact that the photogenerated electrons from CdS can easily be captured by the Au NPs, resulting in effective separation of photogenerated electrons and holes. Additionally, the decrease in intensity for Au/GR-CdS spectrum can be attributed to the SPR absorption effect, since the absorption peaks of Au NPs and CdS overlap [27]. Therefore, the combination of GR-CdS with Au NPs could offer a favorable platform for conducting PEC analysis. Moreover, we found that the photocurrent response of Au/GR-CdS modified FTO electrode showed an obvious dependence on the amount of Au NPs. As can be seen in Fig. 2C, when the amount of Au NPs increases to 12 µL, increase in photocurrent intensity is observed, ascribed to the enhanced SPR effect. However, when the amount of Au NPs is further increased, the photocurrent response gradually decreases, due to the thicker films on the FTO which blocks the transfer of the photogenerated electrons, hence acting as surface recombination centers. Therefore, the optimal volume of 12 µL of Au NPs was adopted to attain the highest sensitivity. 3.3. Construction of PEC aptamer sensor for DCF determination The stepwise assembly of DCF aptasensor is illustrated in Fig. 3A. The success of the fabrication process of DCF aptamer sensor was verified by EIS analysis using [Fe(CN)6]3-/4as redox probe (Fig. S4). According to the semicircle diameter at higher frequencies in the Nyquist plot of EIS, the charge transfer resistance (Ret) for each fabrication step was evaluated. The results indicate that the Ret for bare ITO is reduced by GR-CdS and Au NPs. However, after immobilization of the aptamer, an obvious increase in Ret is noted. This can

11

be attributed to the enhanced steric hindrance arising from the assembled aptamers which obstructs the electron transfer, in effect restricting the redox electrochemical reaction of [Fe(CN)6]3-/4-. In addition, the phosphate backbone of the aptamer develops more negative charges on the electrode surface, hence increases repulsion towards the negatively charged redox probe [43]. After the incubation and subsequent capture of DCF, the Ret is further increased. This can be explained by the formation of DCF-aptamer conjugates at the electrode surface which blocks the electron transfer between electrode and [Fe(CN)6]3-/4species, confirming the successful construction of DCF aptamer sensor. Meanwhile, PEC studies were conducted using various modified electrodes at a bias potential of +0.2 V in 0.1 M Na2SO4. As shown in Fig. 3B, no photocurrent response is observed for bare FTO, meaning low visible light activity of FTO. Upon modification of the FTO with GR-CdS composite, a dramatic increase in photocurrent intensity is realized. This can be ascribed to the presence of photoactive material, especially CdS that has strong absorption of light in the visible region. Besides, GR with excellent electrical conductivities enhances the transfer of the photogenerated electrons curbing charge recombination. Upon drop-casting Au NPs onto GR-CdS modified electrode, further increase in photocurrent response is noted. As aforementioned, this is the result of the surface plasmon resonance of Au NPs as well as the increased transfer of the photogenerated electrons. As a matter of fact, the plasmon resonance increases the energy transfer from Au surface to CdS, effectively promoting the enhanced generation holes and electrons under visible light irradiation. However, on immobilizing DCF aptamer on Au/GR-CdS, a significant decline in photoresponse is observed, indicating that the assembled aptamers block the transfer of electrons due to the enhanced steric hindrance. After the aptamer/Au/GR-CdS sensor is incubated in DCF solution, the photocurrent response is observed to increase significantly, confirming the capture of DCF by the aptamer. 12

On the other hand, in order to investigate the influence of Au NPs on the immobilization process of the aptamer, two different immobilization techniques were employed. In the first experiment, physical adsorption of the aptamer onto the surface of GRCdS was undertaken through π-π bonding interaction between the aptamer and the conjugated ring in graphene. The second experiment involved the immobilization of the aptamer on Au/GR-CdS via the formation of bond between SH- group in the thiol-terminated aptamer and Au NPs. As shown in Fig. 4A, decline in photocurrent response associated with steric hindrance upon immobilization of the aptamer is observed in both experiments. However, the decline is more pronounced in the presence of Au NPs. This method has been suggested to be more effective to immobile a large amount of aptamer molecules since it makes use of the strong interaction between the thiol group (-SH) and the gold surface to form strong covalent bonds [44]. In comparison, the smaller change in photocurrent response in the absence of Au NPs means that fewer aptamer molecules are immobilized by physical adsorption. Moreover, some of the adsorbed aptamers could be lost in the washing step due to the weak nature of ππ bonding. Furthermore, the effect of Au NPs on the response of aptasensor toward DCF was studied. To achieve this, the PEC responses of fabricated aptasensors with (aptamer-Au/GRCdS) and without Au NPs (aptamer/GR-CdS) before and after incubation with DCF solution were recorded. As can be seen in Fig. 4B, it is once again clear that the change in the PEC response for DCF on aptamer-Au/GR-CdS is much higher than that on aptamer/GR-CdS. This can be explained by the greater amounts of aptamer molecules that are immobilized in the presence of Au NPs which then capture more DCF molecules to participate the PEC process. Therefore, in this work, the Au NPs play two major roles. On one hand, Au NPs contribute to the enhanced photocurrent response of GR-CdS under visible light irradiation. While on the other hand, Au NPs provide a platform for effective immobilization of the thiolterminated aptamer through the formation of S-Au bonds between the Au NPs and SH-

13

aptamer. On the basis of above results, Au/GR-CdS offered a better strategy for fabricating a more sensitive aptasensor and was thus adopted in this experiment. 3.4. PEC aptasensing of DCF Since PEC response corresponds to the magnitude of interaction between an aptamer and its target, PEC aptasensor could be employed in quantitative analysis of DCF. In this case, the change in PEC response obtained from photocurrent intensity before and after incubation with DCF was plotted against concentration as shown in Fig. 5A. As can be seen, PEC photoresponse increases with increase in concentration of DCF. This can be attributed to more DCF captured by the aptamers at high DCF concentration; hence more photogenerated holes are consumed. Consequently, higher numbers of photogenerated electrons are registered at the electrode at higher DCF concentration. PEC response is found to linearly increase with increase in DCF concentration in the range of 1 to 150 nM (Fig. 5B.) The equation of the calibration curve is expresses PI/µA = 0.00432 C/nM + 0.061 (correlation coefficient R2= 0.9977). Meanwhile, we measured the blank signal eight times and obtained the standard deviation of the blank (SDblank) of 0.00112. The limit of detection (LOD) calculated as (3SDblank)/slope [45] is 0.78 nM, which shows that the proposed PEC sensor has ultrahigh sensitivity. Additionally, when the results from this experiment are compared with those obtained from earlier reported works as shown in Table 1, this work provides the lowest LOD so far obtained for analysis of DCF. In such a sensor, photogenerated electrons are transferred from the valency band (VB) to the conduction band (CB) of the CdS semiconductor while positively charged holes move to the VB when visible light irradiation is applied. Meanwhile, graphene plays the roles of electron acceptor and transporter to efficiently reduce the recombination of the photogenerated charges. Moreover, Au NPs deposited on GR-CdS contributes to the effective 14

immobilization of the thiol-terminated aptamer. While the aptamers are immobilized on Au/GR-CdS, a low PEC response is recorded. However, after incubation in DCF solution, the aptamers capture DCF molecules, then the DCF are oxidized by the photogenerated holes, leading to abundance of photogenerated electron. Consequently, more electrons reach the electrode, leading to enhanced photocurrent response. Different from some electrochemical or PEC sensors that are labeled with redox probe [46], enzyme [3] or enzyme mimetics [47] to provide or amplify current responses, the present sensor is label-free since the Au/GR-CdS electrode under visible light illumination can generate high PEC current as responsive signal. In order to investigate the selectivity of the proposed sensor, DCF was determined in the presence of dopamine (DOP), ascorbic acid (AA), Paracetamol (PCT) and glucose (GLC). From the results shown in Fig. 6, there is no obvious change in photocurrent response in the presence of interferences. Therefore, the proposed sensor exhibited satisfactory selectivity. On the other hand, the reproducibility of the aptamer sensor was also evaluated from the responses of five independently prepared electrodes. The relative standard deviation (RSD) obtained is 2.92%, suggesting good reproducibility. Moreover, to gain insights into the stability of the proposed aptasensor, the photocurrent response of the fabricated electrode was determined after 3 weeks storage at 4 oC. The photocurrent intensity is found to reduce to 94.3%, indicating that the proposed sensor has a good stability. To evaluate the feasibility of the proposed sensor for practical application, standard addition method was adopted in analysis of lake water. The results obtained in Table 2 suggest that the recovery values are between 102.64 and 107.64 %, which are acceptable for application. Furthermore, the applicability of the proposed method in real sample analysis was investigated by direct assay of DCF in pharmaceuticals using PEC technique and compared to results from HPLC measurements. In this study, tablets or capsules of DCF were finely ground into fine powder using a mortar and a pestle. Subsequently, measured amounts 15

of the powders were separately transferred into 100-mL beakers containing 50 mL distilled water and sonicated for 10 min to enhance dissolution. The resultant solutions were then filtered and used for quantitative analysis. As evident from Table 3, the results from PEC analysis compare well with those from HPLC, thus the proposed sensor can be practically applied in real samples.

4. Conclusions In summary, fabrication of a novel PEC aptamer sensor for ultra-sensitive and selective determination of DCF based on Au/GR-CdS has been demonstrated. Endowed with great visible light absorption, CdS was incorporated into a composite with graphene that possessed excellent electron transfer properties resulting in enhanced photocurrent response. In addition, the photoactivity of GR-CdS was greatly improved by the addition of an appropriate amount of Au NPs, attributed to surface plasmon resonance. The obtained Au/GR-CdS modified electrode was used to immobilize DCF aptamer through self-assembly of the thiol terminated aptamer onto Au NPs. Sensitive and selective determination of DCF was then performed, achieving a very low detection limit of 0.78 nM. Arising from merits of great stability and high sensitivity of Au/GR-CdS, and the excellent selectivity attributed to the DCF binding aptamer, the proposed sensor showed great promise when employed in determination of DCF in pharmaceutical and environmental samples.

16

Acknowledgements This work was supported by the National Natural Science Foundation of China (Grant No. 61571198). We also thank the Analytical and Testing Center of HUST for the use of SEM, XPS and XRD instruments.

Appendix A. Supporting information Supplementary data associated with this article can be found in the online version at

17

References [1] X. Zhang, Y. Guo, M. Liu, S. Zhang, Photoelectrochemically active species and photoelectrochemical biosensors, RSC Adv. 3 (2013) 2846-2857. [2] Z. Yue, F. Lisdat, W.J. Parak, S.G. Hickey, L. Tu, N. Sabir, D. Dorfs, N.C. Bigall, Quantum-Dot-Based Photoelectrochemical Sensors for Chemical and Biological Detection, ACS Appl. Mater. Inter. 5 (2013) 2800-2814. [3] Y.-J. Li, M.-J. Ma, J.-J. Zhu, Dual-Signal Amplification Strategy for Ultrasensitive Photoelectrochemical Immunosensing of α-Fetoprotein, Anal. Chem. 84 (2012) 10492-10499. [4] W.-W. Zhao, Z.-Y. Ma, D.-Y. Yan, J.-J. Xu, H.-Y. Chen, In Situ Enzymatic Ascorbic Acid Production as Electron Donor for CdS Quantum Dots Equipped TiO2 Nanotubes: A General and Efficient Approach for New Photoelectrochemical Immunoassay, Anal. Chem. 84 (2012) 10518-10521. [5] J. Gong, T. Fang, D. Peng, A. Li, L. Zhang, A highly sensitive photoelectrochemical detection of perfluorooctanic acid with molecularly imprined polymer-functionalized nanoarchitectured hybrid of AgI–BiOI composite, Biosens. Bioelectron. 73 (2015) 256-263. [6] K. Yan, Y. Liu, Y. Yang, J. Zhang, A Cathodic “Signal-off” Photoelectrochemical Aptasensor for Ultrasensitive and Selective Detection of Oxytetracycline, Anal. Chem. 87 (2015) 12215-12220. [7] M. Zhao, G.-C. Fan, J.-J. Chen, J.-J. Shi, J.-J. Zhu, Highly Sensitive and Selective Photoelectrochemical Biosensor for Hg2+ Detection Based on Dual Signal Amplification by Exciton Energy Transfer Coupled with Sensitization Effect, Anal. Chem. 87 (2015) 1234012347. [8] Y. Zang, J. Lei, Q. Hao, H. Ju, "Signal-On" Photoelectrochemical Sensing Strategy Based on Target-Dependent Aptamer Conformational Conversion for Selective Detection of Lead(II) Ion, ACS Appl. Mater. Inter. 6 (2014) 15991-15997. [9] G.-L. Wang, J.-X. Shu, Y.-M. Dong, X.-M. Wu, W.-W. Zhao, J.-J. Xu, H.-Y. Chen, Using G-Quadruplex/Hemin To "Switch-On" the Cathodic Photocurrent of p-Type PbS Quantum Dots: Toward a Versatile Platform for Photoelectrochemical Aptasensing, Anal. Chem. 87 (2015) 2892-2900. [10] F. Liu, Y. Zhang, J. Yu, S. Wang, S. Ge, X. Song, Application of ZnO/graphene and S6 aptamers for sensitive photoelectrochemical detection of SK-BR-3 breast cancer cells based on a disposable indium tin oxide device, Biosens. Bioelectron. 51 (2014) 413-420.

18

[11] O.K. Okoth, K. Yan, Y. Liu, J. Zhang, Graphene-doped Bi2S3 nanorods as visible-light photoelectrochemical aptasensing platform for sulfadimethoxine detection, Biosens. Bioelectron. 86 (2016) 636-642. [12] Y. Liu, K. Yan, O.K. Okoth, J. Zhang, A label-free photoelectrochemical aptasensor based on nitrogen-doped graphene quantum dots for chloramphenicol determination, Biosens. Bioelectron. 74 (2015) 1016-1021. [13] Q. Li, X. Li, S. Wageh, A.A. Al-Ghamdi, J. Yu, CdS/Graphene Nanocomposite Photocatalysts, Adv. Energy Mater. 5 (2015). [14] Y. Zang, J. Lei, Q. Hao, H. Ju, CdS/MoS2 heterojunction-based photoelectrochemical DNA biosensor via enhanced chemiluminescence excitation, Biosens. Bioelectron. 77 (2016) 557-564. [15] Y. Liu, K. Yan, J. Zhang, Graphitic Carbon Nitride Sensitized with CdS Quantum Dots for Visible-Light-Driven Photoelectrochemical Aptasensing of Tetracycline, ACS Appl. Mater. Inter. 8 (2016) 28255-28264. [16] R. Bera, S. Kundu, A. Patra, 2D Hybrid Nanostructure of Reduced Graphene Oxide-CdS Nanosheet for Enhanced Photocatalysis, ACS Appl. Mater. Inter. 7 (2015) 13251-13259. [17] S. Rengaraj, V. Mani, P. Kavanagh, J. Rusling, D. Leech, A membrane-less enzymatic fuel cell with layer-by-layer assembly of redox polymer and enzyme over graphite electrodes, Chem. Commun. 47 (2011) 11861-11863. [18] L. Shangguan, W. Zhu, Y. Xue, S. Liu, Construction of photoelectrochemical thrombin aptasensor via assembling multilayer of graphene-CdS nanocomposites, Biosens. Bioelectron. 64 (2015) 611-617. [19]

Y.

Zhu,

K.

Yan,

Y.

Liu,

J.

Zhang,

Photovoltammetric

behavior

and

photoelectrochemical determination of p-phenylenediamine on CdS quantum dots and graphene hybrid film, Anal. Chim. Acta 884 (2015) 29-36. [20] Y. Luo, J. Xu, Y. Li, H. Gao, J. Guo, F. Shen, C. Sun, A novel colorimetric aptasensor using cysteamine-stabilized gold nanoparticles as probe for rapid and specific detection of tetracycline in raw milk, Food Control 54 (2015) 7-15. [21] Y.-C. Zhu, N. Zhang, Y.-F. Ruan, W.-W. Zhao, J.-J. Xu, H.-Y. Chen, Alkaline Phosphatase Tagged Antibodies on Gold Nanoparticles/TiO2 Nanotubes Electrode: A Plasmonic Strategy for Label-Free and Amplified Photoelectrochemical Immunoassay, Anal. Chem. 88 (2016) 5626-5630. [22] M. Yang, X. Chen, T.-J. Jiang, Z. Guo, J.-H. Liu, X.-J. Huang, Electrochemical Detection of Trace Arsenic(III) by Nanocomposite of Nanorod-Like alpha-MnO2 Decorated 19

with similar to 5 nm Au Nanoparticles: Considering the Change of Arsenic Speciation, Anal. Chem. 88 (2016) 9720-9728. [23] Y. Qiao, J. Li, H. Li, H. Fang, D. Fan, W. Wang, A label-free photoelectrochemical aptasensor for bisphenol A based on surface plasmon resonance of gold nanoparticlesensitized ZnO nanopencils, Biosens. Bioelectron. 86 (2016) 315-320. [24] Q. Wu, Y. Sun, P. Ma, D. Zhang, S. Li, X. Wang, D. Song, Gold nanostar-enhanced surface plasmon resonance biosensor based on carboxyl-functionalized graphene oxide, Anal. Chim. Acta 913 (2016) 137-144. [25] J. Li, W. Tu, H. Li, M. Han, Y. Lan, Z. Dai, J. Bao, In Situ-Generated Nano-Gold Plasmon-Enhanced Photoelectrochemical Aptasensing Based on Carboxylated PeryleneFunctionalized Graphene, Anal. Chem. 86 (2014) 1306-1312. [26] G. Yu, X. Wang, J. Cao, S. Wu, W. Yan, G. Liu, Plasmonic Au nanoparticles embedding enhances the activity and stability of CdS for photocatalytic hydrogen evolution, Chem. Commun. 52 (2016) 2394-2397. [27] I. Ibrahim, H.N. Lim, O.K. Abou-Zied, N.M. Huang, P. Estrela, A. Pandikumar, Cadmium Sulfide Nanoparticles Decorated with Au Quantum Dots as Ultrasensitive Photoelectrochemical Sensor for Selective Detection of Copper(II) Ions, J. Phys. Chem. C 120 (2016) 22202-22214. [28] R.N. Goyal, S. Chatterjee, A.R.S. Rana, The effect of modifying an edge-plane pyrolytic graphite electrode with single-wall carbon nanotubes on its use for sensing diclofenac, Carbon 48 (2010) 4136-4144. [29] A. Mokhtari, H. Karimi-Maleh, A.A. Ensafi, H. Beitollahi, Application of modified multiwall carbon nanotubes paste electrode for simultaneous voltammetric determination of morphine and diclofenac in biological and pharmaceutical samples, Sensor Actuat. B: Chem. 169 (2012) 96-105. [30] R.N. Goyal, S. Chatterjee, B. Agrawal, Electrochemical investigations of diclofenac at edge plane pyrolytic graphite electrode and its determination in human urine, Sens. Actuators B: Chem. 145 (2010) 743-748. [31] M. Arvand, T.M. Gholizadeh, M.A. Zanjanchi, MWCNTs/Cu(OH)2 nanoparticles/IL nanocomposite modified glassy carbon electrode as a voltammetric sensor for determination of the non-steroidal anti-inflammatory drug diclofenac, Mater. Sci. Eng. C 32 (2012) 16821689.

20

[32] F. Basiri, M. Taei, Application of spinel-structured MgFe2O4 nanoparticles for simultaneous electrochemical determination diclofenac and morphine, Microchimica Acta 184 (2017) 155-162. [33] K. Sarhangzadeh, A.A. Khatami, M. Jabbari, S. Bahari, Simultaneous determination of diclofenac and indomethacin using a sensitive electrochemical sensor based on multiwalled carbon nanotube and ionic liquid nanocomposite, J. Appl. Electrochem. 43 (2013) 1217-1224. [34] O.K. Okoth, K. Yan, L. Liu, J. Zhang, Simultaneous Electrochemical Determination of Paracetamol

and

Diclofenac

Based

on

Poly(diallyldimethylammonium

chloride)

Functionalized Graphene, Electroanalysis 28 (2016) 76-82. [35] D.T. Gimenes, R.R. Cunha, M.M. Araujo de Carvalho Ribeiro, P.F. Pereira, R.A. Abarza Munoz, E.M. Richter, Two new electrochemical methods for fast and simultaneous determination of codeine and diclofenac, Talanta 116 (2013) 1026-1032. [36] L. Kashefi-Kheyrabadi, M.A. Mehrgardi, Design and construction of a label free aptasensor for electrochemical detection of sodium diclofenac, Biosens. Bioelectron. 33 (2012) 184-189. [37] H. Derikvand, M. Roushani, A.R. Abbasi, Z. Derikvand, A. Azadbakht, Design of folding-based impedimetric aptasensor for determination of the nonsteroidal antiinflammatory drug, Anal. Biochem. 513 (2016) 77-86. [38] J. Borowiec, R. Wang, L. Zhu, J. Zhang, Synthesis of nitrogen-doped graphene nanosheets decorated with gold nanoparticles as an improved sensor for electrochemical determination of chloramphenicol, Electrochim. Acta 99 (2013) 138-144. [39] Q. Shen, X. Shi, M. Fan, L. Han, L. Wang, Q. Fan, Highly sensitive photoelectrochemical

cysteine

sensor

based

on

reduced

graphene

oxide/CdS:Mn

nanocomposites, J. Electroanal. Chem. 759 (2015) 61-66. [40] X. Zhao, S. Zhou, Q. Shen, L.-P. Jiang, J.-J. Zhu, Fabrication of glutathione photoelectrochemical biosensor using graphene-CdS nanocomposites, Analyst 137 (2012) 3697-3703. [41] X. Zhang, F. Xu, B. Zhao, X. Ji, Y. Yao, D. Wu, Z. Gao, K. Jiang, Synthesis of CdS quantum dots decorated graphene nanosheets and non-enzymatic photoelectrochemical detection of glucose, Electrochim. Acta 133 (2014) 615-622. [42] W.-W. Zhao, J. Wang, J.-J. Xu, H.-Y. Chen, Energy transfer between CdS quantum dots and Au nanoparticles in photoelectrochemical detection, Chem. Commun. 47 (2011) 1099010992.

21

[43] O.K. Okoth, K. Yan, J. Zhang, Mo-doped BiVO4 and graphene nanocomposites with enhanced photoelectrochemical performance for aptasensing of streptomycin, Carbon 120 (2017) 194-202. [44] S.G. Meirinho, L.G. Dias, A.M. Peres, L.R. Rodrigues, Voltammetric aptasensors for protein disease biomarkers detection: A review, Biotechnol. Adv. 34 (2016) 941-953. [45] N.B. Messaoud, M.E. Ghica, C. Dridi, M.B. Ali, C.M.A. Brett, Electrochemical sensor based on multiwalled carbon nanotube and gold nanoparticle modified electrode for the sensitive detection of bisphenol A, Sens. Actuators B: Chem. 253 (2017) 513-522. [46] T.T.K. Nguyen, T.T. Vu, G. Anquetin, H.V. Tran, S. Reisberg, V. Noël, G. Mattana, Q.V. Nguyen, T. Dai Lam, M.C. Pham, B. Piro, Enzyme-less electrochemical displacement heterogeneous immunosensor for diclofenac detection, Biosens. Bioelectron. 97 (2017) 246252. [47] G.-L. Wang, K.-L. Liu, J.-X. Shu, T.-T. Gu, X.-M. Wu, Y.-M. Dong, Z.-J. Li, A novel photoelectrochemical sensor based on photocathode of PbS quantum dots utilizing catalase mimetics

of

bio-bar-coded

platinum

nanoparticles/G-quadruplex/hemin

for

signal

amplification, Biosens. Bioelectron. 69 (2015) 106-112. [48] A. Afkhami, A. Bahiraei, T. Madrakian, Gold nanoparticle/multi-walled carbon nanotube modified glassy carbon electrode as a sensitive voltammetric sensor for the determination of diclofenac sodium, Mater. Sci. Eng. C 59 (2016) 168-176. [49] M.C. Oliveira, E.H. Bindewald, L.H. Marcolino, Jr., M.F. Bergamini, Potentiometric determination of Diclofenac using an ion-selective electrode prepared from polypyrrole films, J. Electroanal. Chem. 732 (2014) 11-16. [50] M. Arvand, M. Hassannezhad, Square wave voltammetric determination of uric acid and diclofenac on multi-walled carbon nanotubes decorated with magnetic core-shell Fe3O4@SiO2 nanoparticles as an enhanced sensing interface, Ionics 21 (2015) 3245-3256.

22

Biographies

Otieno Kevin Okoth received his PhD degree from Huazhong University of Science and Technology, P.R. China in 2017. His research interests include electrochemical sensors, environmental chemistry and chemically modified electrodes.

Kai Yan is currently a Ph.D. Student in School of Chemistry and Chemical Engineering, Huazhong University of Science and Technology, P.R. China. His research interests include electrochemical sensors and biosensors.

Jun Feng is currently a master student in School of Chemistry and Chemical Engineering, Huazhong University of Science and Technology, P.R. China. His research interests include photoelectrocatalysis and environmental chemistry.

Jingdong Zhang is a professor in School of Chemistry and Chemical Engineering, Huazhong University of Science and Technology, P.R. China. He received his PhD degree from Hunan University, P.R. China in 2000. His research interests include bioelectrochemistry, electrochemical sensors, nanomaterials and photoelectrochemistry

23

Figure captions Fig. 1. (A) XRD patterns of GO and GR-CdS. SEM of (B) GR-CdS and (C) Au/GR-CdS. (D) EDS mapping result of Au on Au/GR-CdS. Fig. 2. (A) UV- absorption spectra of (a) GR-CdS and (b) Au. Inset is the PL spectrum of GR-CdS. (B) Photocurrent responses of (a) Au (b) GR-CdS and (c) Au/GR-CdS modified FTO electrodes in 0.1 M Na2SO4 at a bias potential of 0.2 V. (C) Influence of Au NPs amount on the photocurrent response of Au/GR-CdS modified electrodes in 0.1 M Na2SO4 at a bias potential of 0.2 V. Fig. 3. (A) Schematic illustration on the fabrication process of DCF PEC aptasensor. (B) Photocurrent responses of different electrodes: (a) bare FTO, (b) GR-CdS, (c) Au/GR-CdS (d) aptamer-Au/GR-CdS, and (e) DCF-aptamer-Au/GR-CdS in 0.1 M Na2SO4 at an applied potential of 0.2 V. Fig. 4. (A) Comparison of PEC responses of GR-CdS (I) and Au/GR-CdS (II) (a) before and (b) after immobilization of DCF aptamer. (B) Comparison of PEC responses of aptamer-GRCdS (I) and aptamer-Au/GR-CdS (II) modified electrodes (a) before and (b) after incubation with 100 nM DCF solution. Fig. 5. (A) Photocurrent responses of the aptasensor to (a-f) 1, 10, 20, 50, 100 and 150 nM DCF. (B) Corresponding calibration curve for DCF by the aptasensor. Fig. 6. Photocurrent responses of the aptasensor towards 100 nM DCF in the presence of interferences.

24

A Intensity (a.u)

B

G-CdS

GO 0

10

20

30

40

50

60

70

80

90

2 (Degrees)

C

D

Fig. 1.

25

140

2.0

120

PL intensity/ a.u

2.2

Absorbance

1.8 1.6 1.4 1.2

A

100 80 60 40 20

1.0

500

550

600

650

Wavelength/ nm

0.8 0.6 0.4

b a

0.2 200

300

400

500

600

700

Wavelength/ nm

2.0

B

c

Photocurrent/ A

1.6 1.2

b 0.8 0.4

a

0.0 0

10

20

30

40

Time/ s

1.8

50

C

1.6

Photocurrent/ A

1.4 1.2 1.0 0.8 0.6 0.4 0.2 0.0

0

5

8

12

15

Volume of Au/ L

20

25

Fig. 2. 26

A

2.0

B

1.8

c e

Photocurrent/ A

1.6 1.4 1.2

d

1.0

b

0.8 0.6 0.4 0.2

a

0.0 0

10

20

30

40

Time/ s Fig. 3.

27

50

2.0

A

1.8

Photocurrent/ A

1.6

II a

1.4 1.2 1.0 0.8 0.6

I a

b

b

0.4 0.2 0.0

Time/ s

1.6

B

Photocurrent/ A

1.4 1.2 1.0

I b

II b

a

0.8 0.6

a

0.4 0.2 0.0

Time/ s Fig. 4.

28

f

A

1.8

e

1.6

d

Photocurrent/ A

1.4

a

1.2

c

b

1.0 0.8 0.6 0.4 0.2 0.0

Time/ s

B

0.7 0.6

PI/ A

0.5 0.4 0.3 0.2 0.1 0.0 0

20

40

60

80

100

120

Concentration/ nM

Fig. 5.

29

140

0.6 0.5

PI/ A

0.4 0.3 0.2 0.1 0.0

Control

AA

DOP

PCT

Fig. 6.

30

GLU

Table 1. Comparison of various modified electrodes and analytical techniques for diclofenac determination. Method/ Electrode materials

Linear range / M

LOD / M

Reference

EPPGE-SWCNT

1.0×10-11- 5.0×10-7

8.2×10-10

[28]

MWCNT-CPE

5×10-6- 6.0×10-4

2.0×10-6

[29]

EPPGE

1.0×10-8-1.0×10-6

6.2×10-9

[30]

MWCNT/Cu(OH)2 NPs/ IL

1.8×10-7- 1.19×10-4

4.0×10-8

[31]

MgFe2O4-GPE

1.0×10-7-5.8×10-4

6.0×10-8

[32]

PDDA-GR

1.0×10-5-1.0×10-4

6.09×10-7

[34]

Electrochemical aptasensor

0- 5.0×10-6

2.7×10-7

[36]

Impedimetric aptasensor

1.0×10-8-2.0×10-7

2.7×10-9

[37]

Au/MWCNT/GCE

3.0×10-8-2.0×10-6

2.00×10-8

[48]

Potentiometry- Ppy-ISE

3.1×10-4- 1.1×10-2

1.9×10-4

[49]

Fe2O3@SiO2/ MWCNT-CPE

5.0×10-7-1.0×10-4

4.0×10-8

[50]

Photoelectrochemical aptasensor

1.0×10-9- 1.5×10-7

7.8×10-10

This work

Table 2. PEC analysis of DCF in lake water based on aptamer-Au/GR-CdS sensor. Amount added (nM)

Found (nM)

Recovery (%)

RSD (%)

50

51.32

102.64

2.92

100

107.64

107.64

4.01

Table 3. Determination of DCF in selected pharmaceutical formulations. Company

Determined by PEC (mg)

Determined by HPLC (mg)

Huaxin EASEHEAL

8.155 ± 0.2 8.585 ± 0.3

7.835 ± 0.1 9.126 ± 0.1

31