- Email: [email protected]
Lamin B receptor (LBR) is involved in the induction of cellular senescence in human cells
Mechanisms of Ageing and Development 178 (2019) 25–32
Contents lists available at ScienceDirect
Mechanisms of Ageing and Development journal homepage: www.elsevier.com/locate/mechagedev
Lamin B receptor (LBR) is involved in the induction of cellular senescence in human cells
T
⁎
Rumi Araia, Atsuki Ena, Yuki Takaujia,b, Keisuke Makia, Kensuke Mikia,b, Michihiko Fujiia, , Dai Ayusawaa,b a b
Graduate School of Nanobioscience, Yokohama City University, 22-2 Seto, Kanazawa-ku, Yokohama, 236-0027, Japan Ichiban Life Corporation, 1-1-7 Horai-cho, Naka-ku, Yokohama, 231-0048, Japan
A R T I C LE I N FO
A B S T R A C T
Keywords: Cellular senescence LBR Nuclear envelope γ-H2AX ring Chromatin foci
Cellular senescence is a phenomenon of irreversible growth arrest in mammalian somatic cells in culture. Various stresses induce cellular senescence and indeed, we have found that excess thymidine effectively induces cellular senescence in human cells. Further, many reports indicate the implication of chromatin proteins in cellular senescence. Here we analysed the role of lamin B receptor (LBR), a nuclear envelope protein that regulates heterochromatin organization, in cellular senescence induced by excess thymidine. We then found that the LBR protein was down-regulated and showed aberrant localization in cells upon induction of cellular senescence by excess thymidine. Additionally, we also found that knock-down of LBR facilitated the induction of cellular senescence by excess thymidine in cancerous HeLa cells, and importantly, it induced cellular senescence in normal human diploid fibroblast TIG-7 cells. These results suggested that decreased LBR function is involved in the induction of cellular senescence in human cells.
1. Introduction Cellular senescence was originally defined as a phenomenon of irreversible growth arrest after a limited number of cell divisions in normal human diploid cells cultured in vitro (Hayflick and Moorehead, 1961). Senescent cells exhibit an irregularly enlarged and flat cell shape and up-regulate particular genes called the senescence-associated genes (Campisi, 1997). Similar phenomena are also induced in many types of cell with various means such as oxidative stress, DNA-damaging agents, cell cycle perturbations, chromatin-destabilizing agents, modulators of signalling pathways, and mutations in particular genes (Campisi and d’Adda di Fagagna, 2007). Since cellular senescence is characterized by permanent cell cycle arrest, the proteins that regulate cell cycle play important roles in cellular senescence. In normal somatic cells in culture, cell cycle regulators such as p53, p21, p16, and RB have major roles in cellular senescence because inactivation of these proteins helps cells escape from cellular senescence. However, immortalized cells lacking these proteins still undergo cellular senescence upon treatment with various stresses (Campisi and d’Adda di Fagagna, 2007). We have previously shown that excess thymidine effectively induces cellular senescence in immortalized cells as well as in normal human diploid fibroblasts (Kobayashi et al., 2008; Sumikawa et al., 2005).
⁎
Excess thymidine causes an increased level of dTTP that acts as a feedback inhibitor of ribonucleotide reductase (Eriksson et al., 1979), and then, starves the cells of dCTP and stalls DNA replication forks. Thus, the cells treated with excess thymidine slow down DNA replication, but they continue to synthesize RNA and proteins. Consequently, these cells show a marked accumulation of proteins and undergo unbalanced growth (Kim et al., 1965; Ross, 1983). Importantly, we have shown that prolonged unbalanced growth is causally involved in cellular senescence induced by excess thymidine (Kobayashi et al., 2008; Sumikawa et al., 2005; Takauji et al., 2016a, b). Besides, many lines of evidence indicate the implication of chromatin and chromatin proteins in cellular senescence. For instance, altered expression of lamin A/C and lamin B, both of which constitute the nuclear lamina, and altered structure of heterochromatin are observed in senescent cells (Dreesen et al., 2013; Freund et al., 2012; Narita et al., 2003; Sadaie et al., 2013; Shimi et al., 2011; Swanson et al., 2013; Ukekawa et al., 2007). Further, certain types of mutation in lamin A/C cause Hutchinson-Gilford progeria syndrome (De SandreGiovannoli et al., 2003; Eriksson et al., 2003). Thus, dysregulation of chromatin seems to be involved in the induction of cellular senescence. In line with this, we have previously shown that 5-bromodeoxyuridine (BrdU), a thymidine analogue that decondenses heterochromatin,
Corresponding author. E-mail address: [email protected] (M. Fujii).
https://doi.org/10.1016/j.mad.2019.01.001 Received 13 April 2018; Received in revised form 19 November 2018; Accepted 3 January 2019 Available online 04 January 2019 0047-6374/ © 2019 Elsevier B.V. All rights reserved.
Mechanisms of Ageing and Development 178 (2019) 25–32
R. Arai et al.
cells were washed three times with PBS, incubated with DAPI (4′,6diamidino-2-phenylindole) for 30 min, and mounted with an antifading reagent (Molecular probes). Immunofluorescence images were obtained by fluorescence microscopy (BZ-9000, Keyence).
effectively induces cellular senescence in many types of cell (Michishita et al., 1999; Zakharov et al., 1974). We then examined the localization of various nuclear envelope proteins in senescent cells because these proteins have key roles in organizing chromatin at the nuclear envelope (Solovei et al., 2013; Talamas and Capelson, 2015). Of these, we found that lamin B receptor (LBR) shows aberrant localization in both BrdUinduced and replicative senescent cells (Arai et al., 2016). LBR is an integral membrane protein embedded in the inner nuclear membrane, and was originally identified as a protein that interacts with lamin B (Worman et al., 1988). LBR also interacts with other chromatin proteins (Guarda et al., 2009; Polioudaki et al., 2001; Ye and Worman, 1996), and plays important roles in the organization of heterochromatin at the nuclear periphery (Solovei et al., 2013). These observations imply the possibility that LBR may be involved in induction of cellular senescence. In this study, we employed cervical tumour-derived HeLa cells and normal human diploid fibroblast TIG-7 cells, and examined the role of LBR in cellular senescence induced by excess thymidine. Although excess thymidine and BrdU act differently to induce cellular senescence (Arai et al., 2016; Kudo et al., 2016; Sumikawa et al., 2005; Suzuki et al., 2002), we found that both excess thymidine and BrdU similarly mislocalized and down-regulated the LBR protein in cells. A recent report indicates that knock-down of LBR does not induce cellular senescence in U2OS and MCF7 cells, though it slightly increases the population of senescent cells upon γ-irradiation in them (Lukasova et al., 2017). Thus, it was not clearly determined whether decreased LBR function has a causal role in the induction of cellular senescence in human cells. We here examined the effect of knock-down of LBR in human cells and found that its knock-down facilitated the induction of cellular senescence by excess thymidine in HeLa cells. Further, importantly, cellular senescence was induced by knock-down of LBR alone in TIG-7 cells. Our findings suggested the roles of LBR in the induction of cellular senescence in human cells.
2.4. Western blot analysis Cells were collected in the RIPA buffer (20 mM Tris-HCl, 150 mM NaCl, 0.1% SDS, 1% Nonidet P-40, 0.5% sodium deoxycholate, 2 μg/ml aprotinin, 2 μg/ml leupeptin, 1 mM phenylmethanesulfonyl fluoride, 10 mM dithiothreitol). Cell extracts were prepared by disruption of cells by sonication for 10–15 s on ice, and were subjected to western blot analysis as previously described (Michishita et al., 1999). The antibody against ß-tubulin was purchased from Santa Cruz Biotechnology. The signals were detected with an ECL chemiluminescence detection kit (GE healthcare lifesciences) on a chemiluminescence image analyser (ChemiDoc MP System, Bio-Rad) according to the supplier's instructions. 2.5. Senescence-associated ß-Galactosidase assay Cells were fixed in 2% formaldehyde/ 0.2% glutaraldehyde at room temperature for 5 min, and incubated at 37 °C with a fresh staining solution [1 mg/ml of 5-bromo-4-chloro-3-indolyl ß-D-galactoside, 40 mM citric acid-sodium phosphate (pH 6.0), 5 mM potassium ferricyanide, 5 mM potassium ferrocyanide, 150 mM NaCl, and 2 mM MgC12] as previously described (Michishita et al., 1999). 2.6. Construction of LBR knock-down constructs To construct the plasmids that express shRNAs against LBR, we annealed the following sets of oligonucleotides and inserted them into the pSilencer 1.0-U6 siRNA Expression Vector (Thermo Fisher Scientific) at the ApaI and EcoRV sites: 5′-GCCGACATTAAGGAAGCAA TTCAAGAGATTGCTTCCTTAATGTCGGCTTTTTT-3′ and 5′-AATTAAAA AAGCCGACATTAAGGAAGCAATCTCTTGAATTGCTTCCTTAATGTCGG CGGCC-3′ for LBRKD#1; 5′-GCTCTGGAAATGCTGTCTATTCAAGAGAT AGACAGCATTTCCAGAGCTTTTTT-3′ and 5′-AATTAAAAAAGCTCTGG AAATGCTGTCTATCTCTTGAATAGACAGCATTTCCAGAGCGGCC-3′ for LBRKD#2; 5′−CCGTATATTTCCATACATCTTCAAGAGAGATGTATGGA AATATACGGTTTTTT-3′ and 5′-AATTAAAAAACCGTATATTTCCATACA TCTCTCTTGAAGATGTATGGAAATATACGGGGCC-3′ for LBRKD#3; 5′-GCCTGGGAGTTCACTTTATTTCAAGAGAATAAAGTGAACTCCCAGG CTTTTTT-3′ and 5′-AATTAAAAAAGCCTGGGAGTTCACTTTATTCTCTT GAAATAAAGTGAACTCCCAGGCGGCC-3′ for LBRKD#4.
2. Materials and methods 2.1. Cell culture Cervical tumour-derived HeLa cells and normal human diploid fibroblast TIG-7 cells were obtained from the Japanese Collection of Research Bioresources (JCRB). HeLa cells were cultured in plastic dishes (Nunc) containing MEM medium (Nissui) supplemented with 5% foetal bovine serum (Cell culture bioscience) under 5% CO2 and 95% humidity as described previously (Michishita et al., 1999). TIG-7 cells were similarly cultured except that DMEM medium supplemented with 10% serum was used. Cellular senescence was induced by culturing cells with 1.5–2 mM of thymidine (Wako) or 50 μM of BrdU (Wako) for 4–14 d.
2.7. DNA transfection Plasmids (10 μg) were introduced to cells (106 cells) by electroporation with a high-efficiency electroporator (type NEPA21, Nepa Gene), and appropriate numbers of the cells (1 × 103-1 × 106 cells) were seeded on dishes or cover slips for further analyses.
2.2. Colony formation assay To determine the survival of cells, appropriate numbers of cells (1 × 103 - 1 × 104) were plated on 30- or 60-mm dishes, and allowed to grow for 1–2 weeks. To observe colony formation, cells were fixed with methanol and stained with Coomassie Brilliant Blue (CBB, Bio-Rad), and subjected to photography.
2.8. Quantitative real time RT-PCR Total RNA samples were prepared from cells by the acid guanidinium thiocyanate-phenol-chloroform extraction method (Chomczynski and Sacchi, 1987). mRNA was converted to cDNA by a reverse transcriptase (PrimeScript 1 st strand cDNA synthesis kit, Takara), and transcripts were quantified by quantitative real time PCR with a kit (Thunderbird qPCR mix, Toyobo) on a PCRmax Eco48 Real-Time PCR System (Asone) according to the manufacturer’s protocol. The primers used were as follows: 5′- TTAGGGCTTCCTCTTGGAGAA-3′ and 5′-ACC ATGTGGACCTGTCACTGT-3′ for p21; 5′−CCCAACGCACCGAATAG TTA-3′ and 5′-ACCAGCGTGTCCAGGAAG-3′ for p16; 5′- ACTGAGAGT GATTGAGAGTGGAC-3′ and 5′-AACCCTCTGCACCCAGTTTTC-3′ for IL8; 5′- TCTCATTGCAAGATCATCGCC-3′ and 5′−CCCCATGAATAACAC
2.3. Indirect immunofluorescence analysis Cells grown on a cover slip were fixed with 100% methanol for 15 min at -20 °C, washed three times with PBS, and incubated with 1% bovine serum albumin in PBS at room temperature for 1 h. After washing with PBS, the primary antibody against LBR (Cosmo Bio), or γH2AX (Cell Signaling) was mounted on a cover slip for 18 h. The cells were washed three times with PBS, and incubated with an alexa 568conjugated secondary antibody (Molecular Probes) for 3 h. Finally, the 26
Mechanisms of Ageing and Development 178 (2019) 25–32
R. Arai et al.
Fig. 1. Localization of LBR in excess thymidine-induced senescent cells. Localization of LBR was determined by immunohistochemical analysis with an antibody against LBR in HeLa cells (A) and TIG-7 cells (36 PDLs) (B) treated with excess thymidine (EdT, 1.5 mM) for 4 d. DNA was stained with DAPI. Scale bars: 50 μm.
3.2. Western blot analysis of LBR in senescent cells
AGCACC-3′ for SERPINE2/Nexin-1; 5′-GAAGGTGAAGGTCGGAGT CAA-3′ and 5′-GACAAGCTTCCCGTTCTCAG-3′ for GAPDH. Results were normalized with the expression of GAPDH.
We next examined the protein level of LBR by western blot analysis. We found that LBR was down-regulated in excess thymidine-induced senescence of HeLa and TIG-7 cells (Fig. 2A and B). LBR was also downregulated in replicative senescence of TIG-7 cells (Fig. 2B), and in BrdUinduced senescence of HeLa and TIG-7 cells (Fig. 2A and B). Then, senescent cells showed a decrease in the LBR protein as well as a change in its localization.
3. Results 3.1. Aberrant localization of LBR in senescent cells induced by excess thymidine LBR is localized at the nuclear envelope in proliferating cells, but diffuses in the nucleoplasm and cytoplasm in both BrdU-induced and replicative senescent cells (Arai et al., 2016). We then examined whether LBR shows a change in localization in cellular senescence induced by excess thymidine in HeLa and TIG-7 cells as well. We found that LBR showed a similar diffusive distribution pattern in excess thymidine-induced senescent cells, as observed in BrdU-induced and replicative senescent cells (Fig.1A and B) (Arai et al., 2016). Thus, aberrant localization of LBR was observed in excess thymidine-induced, BrdUinduced, and replicative senescent cells in common.
3.3. Facilitated induction of cellular senescence by knock-down of LBR in HeLa cells The above findings suggested that senescent cells show a decrease in LBR function. To investigate the role of LBR in cellular senescence, we constructed four knock-down vectors that express shRNAs against LBR (pLBRKD#1-4), and employed one vector, pLBRKD#3, which most efficiently down-regulated LBR in HeLa cells (Fig. 3A). We first examined the effect of knock-down of LBR on the growth of HeLa cells, but did not find differences in cell growth or morphology upon knock-down of LBR (Fig. 3B). Thus, cellular senescence was not induced by knock-down of 27
Mechanisms of Ageing and Development 178 (2019) 25–32
R. Arai et al.
cells: > 90% cells were positive for senescence-associated ß-galactosidase (SA-ß-gal); but it was less effectively induced by 0.6 mM of thymidine in HeLa cells: approximately 20% cells were positive for SA-ßgal (Fig. 3D and E). We then observed the growth of HeLa cells treated with knock-down of LBR in the presence of 0.6 mM of thymidine, and found that knock-down of LBR increased the population of senescent cells by approximately two-fold (Fig. 3D and E). This observation suggested that knock-down of LBR facilitated the induction of cellular senescence by excess thymidine. 3.4. Facilitated formation of chromatin foci by knock-down of LBR in HeLa cells treated with excess thymidine We examined the effect of knock-down of LBR on the formation of heterochromatin foci, a well-known marker of senescent cells (senescence-associated heterochromatic foci: SAHF) (Narita et al., 2003; Sadaie et al., 2013), in cells treated with excess thymidine. Upon treatment with excess thymidine for 7 days, the chromatin foci that were densely stained with DAPI were clearly observed in the cells transfected with the LBR knock-down vector or an empty vector; however, upon treatment with excess thymidine for 5 days, the foci were observed only in the cells transfected with the LBR knock-down vector (Fig. 4). This observation indicated that knock-down of LBR facilitated the formation of the DAPI-stained chromatin foci upon treatment with excess thymidine, and thus supported the view that knockdown of LBR facilitated the induction of cellular senescence by excess thymidine in HeLa cells.
Fig. 2. Western blot analysis of LBR in senescent cells. A, HeLa cells were induced to undergo cellular senescence by treating with BrdU (50 μM) or excess thymidine (EdT, 1.5 mM) for 4 d. Protein lysates were prepared from these cells, and subjected to western blot analysis with an antibody against LBR. B, TIG-7 cells entered cellular senescence at 72 PDLs (replicative senescent TIG7 cells). Young TIG-7 cells (39 PDLs) were induced to undergo cellular senescence by treating with BrdU (50 μM) or excess thymidine (EdT, 1.5 mM) for 4 d. Protein lysates were prepared from young TIG-7 cells (Young), replicative senescent TIG-7 cells (Senescent), BrdU-treated TIG-7 cells (BrdU), and excess thymidine-treated TIG-7 cells (EdT), and subjected to western blot analysis with an antibody against LBR.
3.5. Effect of knock-down of LBR on the localization of damaged DNA Excess thymidine stalls DNA replication forks and induces DNA damages which are detected by the formation of γ-H2AX foci. Immunostaining the cells with an antibody against γ-H2AX revealed a marked induction of γ-H2AX foci formation in HeLa cells upon treatment with excess thymidine (Takauji et al., 2016a) (Fig. 5B). Notably, we found that the γ-H2AX foci induced by excess thymidine preferentially located at the nuclear periphery (40–50% of the nuclei, Fig. 5B and C). We then examined the implication of LBR in the formation of γ-H2AX foci and found that knock-down of LBR significantly
LBR alone in HeLa cells. We also examined the protein level of lamin B1 which interacts with LBR (Worman et al., 1988), and found that lamin B1 was slightly decreased upon knock-down of LBR (Fig. 3C), though its decrease did not appear to have a significant effect on the growth of HeLa cells (Fig. 3B). We next examined the effect of knock-down of LBR on cellular senescence induced by excess thymidine. Cellular senescence was effectively induced by 1.5 mM of thymidine in HeLa
Fig. 3. Effect of knock-down of LBR on the induction of cellular senescence in HeLa cells. A, HeLa cells were transfected with pLBRKD#1-4 or an empty vector. Protein lysates were prepared from these cells and subjected to western blot analysis with an antibody against LBR. B, HeLa cells were transfected with pLBRKD#3 or an empty vector, and cultured for 10 d. The cells were photographed and stained with CBB. Scale bars: 100 μm. C, Protein lysates were prepared form HeLa cells transfected with pLBRKD#3 or an empty vector, and subjected to western blot analysis with an antibody against lamin B1. D, HeLa cells were transfected with pLBRKD#3 or an empty vector, and cultured with excess thymidine (EdT, 0.6 or 1.5 mM). Cells were stained with SA-ß-gal. Scale bars: 100 μm. E, The percentage of the SA-ß-gal-positive cells (D) was determined (> 100 cells). An asterisk indicates statistical significance, P < 0.05 (n=3).
28
Mechanisms of Ageing and Development 178 (2019) 25–32
R. Arai et al.
Fig. 4. Effect of knock-down of LBR on heterochromatin foci formation. HeLa cells transfected with pLBRKD#3 or an empty vector were cultured with excess thymidine (EdT, 2 mM) for 5–7 d, and stained with DAPI. Scale bars: 50 μm.
of normal human diploid fibroblasts, TIG-7. Young TIG-7 cells (36 PDLs) were transfected with the LBR knock-down vector together with pGKpuro, a plasmid that carries the puromycin-resistance gene, and were cultured in the presence of puromycin for 3 days to enrich the cells that expressed an shRNA against LBR. We subsequently observed the growth of these cells, and found that most of them ceased to grow with enlarged and flattened cell shapes and consequently formed tiny colonies (Fig. 6A). By contrast, the cells transfected with an empty
decreased the nuclear peripheral localization of the γ-H2AX foci, though it did not affect the foci formation per se (Fig. 5A–C). Thereby, LBR appeared to be involved in the recruitment of damaged DNA at the nuclear periphery upon treatment with excess thymidine.
3.6. Induction of cellular senescence by knock-down of LBR in TIG-7 cells We finally examined the effect of knock-down of LBR on the growth
Fig. 5. Effect of knock-down of LBR on DNA damages. A, HeLa cells were transfected with pLBRKD#3 or an empty vector and immunostained with an antibody against γ-H2AX. DNA was stained with DAPI. Scale bars: 50 μm. B, HeLa cells transfected with pLBRKD#3 or an empty vector were cultured with excess thymidine (EdT, 2 mM) for 1 d, and immunostained with an antibody against γ-H2AX. DNA was stained with DAPI. Arrowheads indicate the nuclear peripheral γH2AX. Scale bars: 50 μm. C, The percentage of the cells with nuclear peripheral γ-H2AX upon treatment with excess thymidine was determined (> 100 cells, n = 3). An asterisk indicates statistical significance, P < 0.05.
29
Mechanisms of Ageing and Development 178 (2019) 25–32
R. Arai et al.
Fig. 6. Induction of cellular senescence in TIG-7 cells by knock-down of LBR. A, TIG-7 cells were transfected with pLBRKD#3 or an empty vector together with pGKpuro, and cultured with puromycin for 3 d. These cells were subsequently cultured in normal medium for 8 d, and stained with SA-ß-gal. Formed colonies were stained with CBB. Scale bars: 100 μm. B, The percentage of the SA-ß-gal-positive cells (A) was determined (> 100 cells, n = 3). An asterisk indicates statistical significance, P < 0.05. C, TIG-7 cells were transfected with pLBRKD#3 or an empty vector as in (A), and the expression levels of the senescence-related genes (p21, p16, IL-8 and SERPINE2) were determined by quantitative RT-PCR analysis. The expression level of the gene is expressed as a value relative to that of the cells transfected with an empty vector (n = 3). An asterisk indicates statistical significance, P < 0.05.
senescence are controversial: some studies indicate that cellular senescence is induced by decreased or increased expression of lamin B, whereas not other studies (Barascu et al., 2012; Dreesen et al., 2013; Sadaie et al., 2013; Shimi et al., 2011). Sadaie et al. show that knockdown of lamin B alone does not largely affect cellular senescence or SAHF formation, but facilitates SAFH formation together with the expression of HMGA1/2 (Sadaie et al., 2013). Thus, the effect of lamin B expression appears to depend on the cellular context, and it would be interesting to examine whether LBR, which interacts with lamin B, may be involved in the cellular context-dependent effects caused by changes in lamin B expression. Since our previous study did not investigate the effect of decreased LBR function on the induction of cellular senescence (Arai et al., 2016), we here examined it in human cells. Recently, Lukasova et al. have reported that knock-down of LBR does not induce cellular senescence in U2OS and MCF7 cells, though it slightly increases the population of senescent cells upon γ-irradiation in these cells (by 1.1-fold in U2OS cells and 1.25-fold in MCF7 cells) (Lukasova et al., 2017). Thus, it was not clearly determined whether knock-down of LBR has a causal role in the induction of cellular senescence in human cells. We then examined the effect of knock-down of LBR in HeLa cells and showed that its knock-down facilitated the induction of cellular senescence by excess thymidine by approximately two-fold. Further, we found that, when HeLa cells were transfected with the increased amount of the knockdown vector (20 μg DNA/106 cells), a small fraction of the transfected cells exhibited enlarged and flattened cell shapes and were stained with SA-ß-gal, though most of the transfected cells continued to grow with normal cell shapes (Supplementary Fig. 1). This finding suggested that a small subset of HeLa cells are prone to undergo cellular senescence following knock-down of LBR, and suggested the possible role of LBR in the induction of cellular senescence in human cells. Moreover, we showed that cellular senescence was induced in normal human diploid fibroblast TIG-7 cells by knock-down of LBR alone. Thereby, these observations indicated that decreased LBR function would have a role in the induction of cellular senescence, and to our knowledge, this is the
vector continued to grow with normal cell shapes and formed normal colonies (Fig. 6A). We also found that the cells transfected with the LBR knock-down vector were stained with SA-ß-gal, which observation suggested that knock-down of LBR induced cellular senescence in TIG-7 cells (Fig. 6A and B). Further, we examined the expression of the senescence-related genes such as p21, p16, IL-8 (interleukin-8), and SERPINE2/nexin-I in TIG-7 cells, and showed that these genes were significantly up-regulated by knock-down of LBR (Fig. 6C). These findings suggested that decreased LBR function would have a role in the induction of cellular senescence in TIG-7 cells. 4. Discussion LBR plays crucial roles in the organization of heterochromatin at the nuclear envelope because the absence of LBR and lamin A causes detachment of heterochromatin from the nuclear envelope and re-distribution of it in the centre of the nucleus in all postmitotic cells (Solovei et al., 2013). In our previous study, we have shown that LBR shows aberrant localization in both BrdU-induced and replicative senescent cells (Arai et al., 2016). In the present study, we additionally showed that LBR similarly showed aberrant localization in excess thymidine-induced senescent cells, and also that LBR was down-regulated in BrdU-induced, excess thymidine-induced, and replicative senescent cells. Given that excess thymidine and BrdU induce cellular senescence probably through distinct mechanisms (Arai et al., 2016; Kudo et al., 2016; Sumikawa et al., 2005; Suzuki et al., 2002), aberrant localization and down-regulation of LBR might be commonly observed in cellular senescence regardless of the means to induce cellular senescence. Thus, LBR may have a role in the induction of cellular senescence. This view is consistent with the recent reports that several nuclear envelope proteins that include LBR are down-regulated upon induction of cellular senescence (Dou et al., 2015; Ivanov et al., 2013; Lenain et al., 2015; Lukasova et al., 2017). These reports indicate that both LBR and lamin B are concomitantly down-regulated in cellular senescence induced by oncogenes, etoposide, or γ-irradiation. The roles of lamin B in cellular 30
Mechanisms of Ageing and Development 178 (2019) 25–32
R. Arai et al.
first report that clearly describes the induction of cellular senescence by knock-down of LBR in human cells. The differential response to the knock-down of LBR in HeLa and TIG-7 cells might be due to differential activities of the p53 and RB proteins in them: i.e., these proteins are functionally inactivated by the expression of human papilloma virus E6/E7 in HeLa cells but not in TIG-7 cells. Indeed, we observed that knock-down of LBR up-regulated the expression of p21 and p16, the genes involved in the p53 and RB pathways, in TIG-7 cells. Then, it may be likely that more stringent control of cell cycle may be required for the induction of cellular senescence by knock-down of LBR in HeLa cells. What is the role of LBR in cellular senescence? We showed that knock-down of LBR did not increase γ-H2AX foci formation in HeLa cells or in excess thymidine-treated HeLa cells. Thus, DNA damage, which is well-known to induce cellular senescence in many types of cell, did not appear to have a causal role in the induction of cellular senescence by knock-down of LBR. Since LBR plays crucial roles in organizing heterochromatin at the nuclear envelope (Solovei et al., 2013), decreased LBR function would likely lead to altered chromatin organization in senescent cells. In this respect, it is worthy to note that excess thymidine induced the formation of DAPI-stained chromatin foci, and their formation was facilitated by knock-down of LBR. This finding suggested that LBR might be involved in the altered chromatin organization upon induction of cellular senescence by excess thymidine. Further, knock-down of LBR is demonstrated to lead to the relocalization and distension of centromeric heterochromatin, which are observed in senescent cells (Lukasova et al., 2017). Thus, it may be reasonable to speculate that altered chromatin organization due to decreased LBR function may contribute to the induction of cellular senescence. LBR is a multi-functional protein: the amino-terminal region of LBR encodes the domains for chromatin organization, and the carboxyterminal region encodes sterol reductase for cholesterol synthesis (Olins et al., 2010). We then examined whether decreased cholesterol synthesis due to decreased LBR function has a role in the induction of cellular senescence. However, we could not detect any suppressive effects of supplementation of cholesterol in medium on the induction of cellular senescence by excess thymidine in HeLa cells (data not shown). This observation did not support the possibility that decreased cholesterol is causative for the induction of cellular senescence by excess thymidine. Currently, the molecular mechanism by which excess thymidine mislocalizes and down-regulates LBR is unidentified. Interestingly, we found that γ-H2AX foci induced by excess thymidine preferentially located at the nuclear periphery in HeLa cells. Nuclear peripheral γ-H2AX foci could be identical to the “apoptotic ring” of γ-H2AX, which is temporally formed at the early stage of apoptosis (Solier and Pommier, 2009). However, the nuclear peripheral γ-H2AX foci in excess thymidine-treated cells were maintained for more prolonged periods probably because the cells were treated with the sub-lethal doses of thymidine that induce cellular senescence, but not apoptosis (Kudo et al., 2016; Takauji et al., 2016a). Then, persistent DNA damage might cause nuclear peripheral localization of damaged DNA in human cells. Interestingly of note, this phenomenon may be observed in other organisms as well because yeast cells are reported to target persistent DNA double strand beaks (DNA damages) to the nuclear periphery in a nuclear envelope protein-dependent manner (Kalocsay et al., 2009; Oza et al., 2009). Importantly, our experiments with knock-down of LBR suggested that LBR was involved in the localization of γ-H2AX foci at the nuclear periphery. Then, it may be possible to speculate that prolonged recruitment of damaged DNA at the nuclear periphery by LBR might interfere with the interaction between LBR and heterochromatin, and the decreased complex formation between LBR and heterochromatin might result in altered localization, destabilization and degradation of LBR. In this regard, it is interesting to note that several nuclear envelope proteins are degraded by autophagy in senescent cells (Dou et al., 2015; Lenain et al., 2015). Further analysis will be required
to understand the mechanism for the regulation of LBR in senescent cells. In summary, our findings suggested the possibility that decreased LBR function due to its aberrant localization and down-regulation would have a role in the induction of cellular senescence. Nuclear peripheral heterochromatin is not observed in mouse embryonic stem cells and emerges in many types of differentiated cell in the course of development with tissue-specific expression of lamin A and LBR (Solovei et al., 2013; Talamas and Capelson, 2015). Thus, lamins and lamin-interacting proteins appear to cooperatively function to organize heterochromatin during cellular differentiation. Thereby, it is intriguing to speculate that disorganization of heterochromatin may cause functional decline of differentiated cells that would consequently lead to the onset of senescence. Further analysis of the nuclear envelope proteins that regulate chromatin organization would provide novel insights into cellular senescence. Declarations of interest None. Acknowledgements This work was supported in part by a grant-in-aid for Scientific Research from the Ministry of Education, Science and Culture of Japan. Appendix A. Supplementary data Supplementary material related to this article can be found, in the online version, at doi:https://doi.org/10.1016/j.mad.2019.01.001. References Arai, R., En, A., Ukekawa, R., Miki, K., Fujii, M., Ayusawa, D., 2016. Aberrant localization of lamin B receptor (LBR) in cellular senescence in human cells. Biochem. Biophys. Res. Commun. 473, 1078–1083. Barascu, A., Le Chalony, C., Pennarun, G., Genet, D., Imam, N., Lopez, B., Bertrand, P., 2012. Oxidative stress induces an ATM-independent senescence pathway through p38 MAPK-mediated lamin B1 accumulation. EMBO J. 31, 1080–1094. Campisi, J., 1997. The biology of replicative senescence. Eur. J. Cancer 33, 703–709. Campisi, J., d’Adda di Fagagna, F., 2007. Cellular senescence: when bad things happen to good cells. Nat. Rev. Mol. Cell Biol. 8, 729–740. Chomczynski, P., Sacchi, N., 1987. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 162, 156–159. De Sandre-Giovannoli, A., Bernard, R., Cau, P., Navarro, C., Amiel, J., Boccaccio, I., Lyonnet, S., Stewart, C.L., Munnich, A., Le Merrer, M., Levy, N., 2003. Lamin a truncation in Hutchinson-Gilford progeria. Science 300, 2055. Dou, Z., Xu, C., Donahue, G., Shimi, T., Pan, J.A., Zhu, J., Ivanov, A., Capell, B.C., Drake, A.M., Shah, P.P., Catanzaro, J.M., Ricketts, M.D., Lamark, T., Adam, S.A., Marmorstein, R., Zong, W.X., Johansen, T., Goldman, R.D., Adams, P.D., Berger, S.L., 2015. Autophagy mediates degradation of nuclear lamina. Nature 527, 105–109. Dreesen, O., Chojnowski, A., Ong, P.F., Zhao, T.Y., Common, J.E., Lunny, D., Lane, E.B., Lee, S.J., Vardy, L.A., Stewart, C.L., Colman, A., 2013. Lamin B1 fluctuations have differential effects on cellular proliferation and senescence. J. Cell Biol. 200, 605–617. Eriksson, S., Thelander, L., Akerman, M., 1979. Allosteric regulation of calf thymus ribonucleoside diphosphate reductase. Biochemistry 18, 2948–2952. Eriksson, M., Brown, W.T., Gordon, L.B., Glynn, M.W., Singer, J., Scott, L., Erdos, M.R., Robbins, C.M., Moses, T.Y., Berglund, P., Dutra, A., Pak, E., Durkin, S., Csoka, A.B., Boehnke, M., Glover, T.W., Collins, F.S., 2003. Recurrent de novo point mutations in lamin A cause Hutchinson-Gilford progeria syndrome. Nature 423, 293–298. Freund, A., Laberge, R.M., Demaria, M., Campisi, J., 2012. Lamin B1 loss is a senescenceassociated biomarker. Mol. Biol. Cell 23, 2066–2075. Guarda, A., Bolognese, F., Bonapace, I.M., Badaracco, G., 2009. Interaction between the inner nuclear membrane lamin B receptor and the heterochromatic methyl binding protein, MeCP2. Exp. Cell Res. 315, 1895–1903. Hayflick, L., Moorehead, P.S., 1961. The serial cultivation of human diploid cell strains. Exp. Cell Res. 1961 (December (25)), 585–621. Ivanov, A., Pawlikowski, J., Manoharan, I., van Tuyn, J., Nelson, D.M., Rai, T.S., Shah, P.P., Hewitt, G., Korolchuk, V.I., Passos, J.F., Wu, H., Berger, S.L., Adams, P.D., 2013. Lysosome-mediated processing of chromatin in senescence. J. Cell Biol. 202, 129–143. Kalocsay, M., Hiller, N.J., Jentsch, S., 2009. Chromosome-wide Rad51 spreading and SUMO-H2A.Z-dependent chromosome fixation in response to a persistent DNA double-strand break. Mol. Cell 33, 335–343.
31
Mechanisms of Ageing and Development 178 (2019) 25–32
R. Arai et al.
Solier, S., Pommier, Y., 2009. The apoptotic ring: a novel entity with phosphorylated histones H2AX and H2B and activated DNA damage response kinases. Cell Cycle 8, 1853–1859. Solovei, I., Wang, A.S., Thanisch, K., Schmidt, C.S., Krebs, S., Zwerger, M., Cohen, T.V., Devys, D., Foisner, R., Peichl, L., Herrmann, H., Blum, H., Engelkamp, D., Stewart, C.L., Leonhardt, H., Joffe, B., 2013. LBR and lamin A/C sequentially tether peripheral heterochromatin and inversely regulate differentiation. Cell 152, 584–598. Sumikawa, E., Matsumoto, Y., Sakemura, R., Fujii, M., Ayusawa, D., 2005. Prolonged unbalanced growth induces cellular senescence markers linked with mechano transduction in normal and tumor cells. Biochem. Biophys. Res. Commun. 335, 558–565. Suzuki, T., Michishita, E., Ogino, H., Fujii, M., Ayusawa, D., 2002. Synergistic induction of the senescence-associated genes by 5-bromodeoxyuridine and AT-binding ligands in HeLa cells. Exp. Cell Res. 276, 174–184. Swanson, E.C., Manning, B., Zhang, H., Lawrence, J.B., 2013. Higher-order unfolding of satellite heterochromatin is a consistent and early event in cell senescence. J. Cell Biol. 203, 929–942. Takauji, Y., En, A., Miki, K., Ayusawa, D., Fujii, M., 2016a. Combinatorial effects of continuous protein synthesis, ERK-signaling, and reactive oxygen species on induction of cellular senescence. Exp. Cell Res. 345, 239–246. Takauji, Y., Wada, T., Takeda, A., Kudo, I., Miki, K., Fujii, M., Ayusawa, D., 2016b. Restriction of protein synthesis abolishes senescence features at cellular and organismal levels. Sci. Rep. 6, 18722. Talamas, J.A., Capelson, M., 2015. Nuclear envelope and genome interactions in cell fate. Front. Genet. 6, 95. Ukekawa, R., Miki, K., Fujii, M., Hirano, H., Ayusawa, D., 2007. Accumulation of multiple forms of lamin A with down-regulation of FACE-1 suppresses growth in senescent human cells. Genes Cells 12, 397–406. Worman, H.J., Yuan, J., Blobel, G., Georgatos, S.D., 1988. A lamin B receptor in the nuclear envelope. Proc. Natl. Acad. Sci. U. S. A. 85, 8531–8534. Ye, Q., Worman, H.J., 1996. Interaction between an integral protein of the nuclear envelope inner membrane and human chromodomain proteins homologous to Drosophila HP1. J. Biol. Chem. 271, 14653–14656. Zakharov, A.F., Baranovskaya, L.I., Ibraimov, A.I., Benjusch, V.A., Demintseva, V.S., Oblapenko, N.G., 1974. Differential spiralization along mammalian mitotic chromosomes. II. 5-bromodeoxyuridine and 5-bromodeoxycytidine-revealed differentiation in human chromosomes. Chromosoma 44, 343–359.
Kim, J.H., Kim, S.H., Eidinoff, M.L., 1965. Cell viability and nucleic acid metabolism after exposure of HeLa cells to excess thymidine and deoxyadenosine. Biochem. Pharmacol. 14, 1821–1829. Kobayashi, Y., Sakemura, R., Kumagai, A., Sumikawa, E., Fujii, M., Ayusawa, D., 2008. Nuclear swelling occurs during premature senescence mediated by MAP kinases in normal human fibroblasts. Biosci. Biotechnol. Biochem. 72, 1122–1125. Kudo, I., Nozawa, M., Miki, K., Takauji, Y., En, A., Fujii, M., Ayusawa, D., 2016. Dual roles of ERK1/2 in cellular senescence induced by excess thymidine in HeLa cells. Exp. Cell Res. 346, 216–223. Lenain, C., Gusyatiner, O., Douma, S., van den Broek, B., Peeper, D.S., 2015. Autophagymediated degradation of nuclear envelope proteins during oncogene-induced senescence. Carcinogenesis 36, 1263–1274. Lukasova, E., Kovar ik, A., Bac ikova, A., Falk, M., Kozubek, S., 2017. Loss of lamin B receptor is necessary to induce cellular senescence. Biochem. J. 474, 281–300. Michishita, E., Nakabayashi, K., Suzuki, T., Kaul, S.C., Ogino, H., Fujii, M., Mitsui, Y., Ayusawa, D., 1999. 5-Bromodeoxyuridine induces senescence-like phenomena in mammalian cells regardless of cell type or species. J. Biochem. 126, 1052–1059. Narita, M., Nunez, S., Heard, E., Lin, A.W., Hearn, S.A., Spector, D.L., Hannon, G.J., Lowe, S.W., 2003. Rb-mediated heterochromatin formation and silencing of E2F target genes during cellular senescence. Cell 113, 703–716. Olins, A.L., Rhodes, G., Welch, D.B., Zwerger, M., Olins, D.E., 2010. Lamin B receptor: multi-tasking at the nuclear envelope. Nucleus 1, 53–70. Oza, P., Jaspersen, S.L., Miele, A., Dekker, J., Peterson, C.L., 2009. Mechanisms that regulate localization of a DNA double-strand break to the nuclear periphery. Genes Dev. 23, 912–927. Polioudaki, H., Kourmouli, N., Drosou, V., Bakou, A., Theodoropoulos, P.A., Singh, P.B., Giannakouros, T., Georgatos, S.D., 2001. Histones H3/H4 form a tight complex with the inner nuclear membrane protein LBR and heterochromatin protein 1. EMBO Rep. 2, 920–925. Ross, D.W., 1983. Unbalanced cell growth and increased protein synthesis induced by chemotherapeutic agents. Blood Cells 1983 (9), 57–68. Sadaie, M., Salama, R., Carroll, T., Tomimatsu, K., Chandra, T., Young, A.R., Narita, M., Perez-Mancera, P.A., Bennett, D.C., Chong, H., Kimura, H., 2013. Redistribution of the Lamin B1 genomic binding profile affects rearrangement of heterochromatic domains and SAHF formation during senescence. Genes Dev. 27, 1800–1808. Shimi, T., Butin-Israeli, V., Adam, S.A., Hamanaka, R.B., Goldman, A.E., Lucas, C.A., Shumaker, D.K., Kosak, S.T., Chandel, N.S., Goldman, R.D., 2011. The role of nuclear lamin B1 in cell proliferation and senescence. Genes Dev. 25, 2579–2593.
32
Contents lists available at ScienceDirect
Mechanisms of Ageing and Development journal homepage: www.elsevier.com/locate/mechagedev
Lamin B receptor (LBR) is involved in the induction of cellular senescence in human cells
T
⁎
Rumi Araia, Atsuki Ena, Yuki Takaujia,b, Keisuke Makia, Kensuke Mikia,b, Michihiko Fujiia, , Dai Ayusawaa,b a b
Graduate School of Nanobioscience, Yokohama City University, 22-2 Seto, Kanazawa-ku, Yokohama, 236-0027, Japan Ichiban Life Corporation, 1-1-7 Horai-cho, Naka-ku, Yokohama, 231-0048, Japan
A R T I C LE I N FO
A B S T R A C T
Keywords: Cellular senescence LBR Nuclear envelope γ-H2AX ring Chromatin foci
Cellular senescence is a phenomenon of irreversible growth arrest in mammalian somatic cells in culture. Various stresses induce cellular senescence and indeed, we have found that excess thymidine effectively induces cellular senescence in human cells. Further, many reports indicate the implication of chromatin proteins in cellular senescence. Here we analysed the role of lamin B receptor (LBR), a nuclear envelope protein that regulates heterochromatin organization, in cellular senescence induced by excess thymidine. We then found that the LBR protein was down-regulated and showed aberrant localization in cells upon induction of cellular senescence by excess thymidine. Additionally, we also found that knock-down of LBR facilitated the induction of cellular senescence by excess thymidine in cancerous HeLa cells, and importantly, it induced cellular senescence in normal human diploid fibroblast TIG-7 cells. These results suggested that decreased LBR function is involved in the induction of cellular senescence in human cells.
1. Introduction Cellular senescence was originally defined as a phenomenon of irreversible growth arrest after a limited number of cell divisions in normal human diploid cells cultured in vitro (Hayflick and Moorehead, 1961). Senescent cells exhibit an irregularly enlarged and flat cell shape and up-regulate particular genes called the senescence-associated genes (Campisi, 1997). Similar phenomena are also induced in many types of cell with various means such as oxidative stress, DNA-damaging agents, cell cycle perturbations, chromatin-destabilizing agents, modulators of signalling pathways, and mutations in particular genes (Campisi and d’Adda di Fagagna, 2007). Since cellular senescence is characterized by permanent cell cycle arrest, the proteins that regulate cell cycle play important roles in cellular senescence. In normal somatic cells in culture, cell cycle regulators such as p53, p21, p16, and RB have major roles in cellular senescence because inactivation of these proteins helps cells escape from cellular senescence. However, immortalized cells lacking these proteins still undergo cellular senescence upon treatment with various stresses (Campisi and d’Adda di Fagagna, 2007). We have previously shown that excess thymidine effectively induces cellular senescence in immortalized cells as well as in normal human diploid fibroblasts (Kobayashi et al., 2008; Sumikawa et al., 2005).
⁎
Excess thymidine causes an increased level of dTTP that acts as a feedback inhibitor of ribonucleotide reductase (Eriksson et al., 1979), and then, starves the cells of dCTP and stalls DNA replication forks. Thus, the cells treated with excess thymidine slow down DNA replication, but they continue to synthesize RNA and proteins. Consequently, these cells show a marked accumulation of proteins and undergo unbalanced growth (Kim et al., 1965; Ross, 1983). Importantly, we have shown that prolonged unbalanced growth is causally involved in cellular senescence induced by excess thymidine (Kobayashi et al., 2008; Sumikawa et al., 2005; Takauji et al., 2016a, b). Besides, many lines of evidence indicate the implication of chromatin and chromatin proteins in cellular senescence. For instance, altered expression of lamin A/C and lamin B, both of which constitute the nuclear lamina, and altered structure of heterochromatin are observed in senescent cells (Dreesen et al., 2013; Freund et al., 2012; Narita et al., 2003; Sadaie et al., 2013; Shimi et al., 2011; Swanson et al., 2013; Ukekawa et al., 2007). Further, certain types of mutation in lamin A/C cause Hutchinson-Gilford progeria syndrome (De SandreGiovannoli et al., 2003; Eriksson et al., 2003). Thus, dysregulation of chromatin seems to be involved in the induction of cellular senescence. In line with this, we have previously shown that 5-bromodeoxyuridine (BrdU), a thymidine analogue that decondenses heterochromatin,
Corresponding author. E-mail address: [email protected] (M. Fujii).
https://doi.org/10.1016/j.mad.2019.01.001 Received 13 April 2018; Received in revised form 19 November 2018; Accepted 3 January 2019 Available online 04 January 2019 0047-6374/ © 2019 Elsevier B.V. All rights reserved.
Mechanisms of Ageing and Development 178 (2019) 25–32
R. Arai et al.
cells were washed three times with PBS, incubated with DAPI (4′,6diamidino-2-phenylindole) for 30 min, and mounted with an antifading reagent (Molecular probes). Immunofluorescence images were obtained by fluorescence microscopy (BZ-9000, Keyence).
effectively induces cellular senescence in many types of cell (Michishita et al., 1999; Zakharov et al., 1974). We then examined the localization of various nuclear envelope proteins in senescent cells because these proteins have key roles in organizing chromatin at the nuclear envelope (Solovei et al., 2013; Talamas and Capelson, 2015). Of these, we found that lamin B receptor (LBR) shows aberrant localization in both BrdUinduced and replicative senescent cells (Arai et al., 2016). LBR is an integral membrane protein embedded in the inner nuclear membrane, and was originally identified as a protein that interacts with lamin B (Worman et al., 1988). LBR also interacts with other chromatin proteins (Guarda et al., 2009; Polioudaki et al., 2001; Ye and Worman, 1996), and plays important roles in the organization of heterochromatin at the nuclear periphery (Solovei et al., 2013). These observations imply the possibility that LBR may be involved in induction of cellular senescence. In this study, we employed cervical tumour-derived HeLa cells and normal human diploid fibroblast TIG-7 cells, and examined the role of LBR in cellular senescence induced by excess thymidine. Although excess thymidine and BrdU act differently to induce cellular senescence (Arai et al., 2016; Kudo et al., 2016; Sumikawa et al., 2005; Suzuki et al., 2002), we found that both excess thymidine and BrdU similarly mislocalized and down-regulated the LBR protein in cells. A recent report indicates that knock-down of LBR does not induce cellular senescence in U2OS and MCF7 cells, though it slightly increases the population of senescent cells upon γ-irradiation in them (Lukasova et al., 2017). Thus, it was not clearly determined whether decreased LBR function has a causal role in the induction of cellular senescence in human cells. We here examined the effect of knock-down of LBR in human cells and found that its knock-down facilitated the induction of cellular senescence by excess thymidine in HeLa cells. Further, importantly, cellular senescence was induced by knock-down of LBR alone in TIG-7 cells. Our findings suggested the roles of LBR in the induction of cellular senescence in human cells.
2.4. Western blot analysis Cells were collected in the RIPA buffer (20 mM Tris-HCl, 150 mM NaCl, 0.1% SDS, 1% Nonidet P-40, 0.5% sodium deoxycholate, 2 μg/ml aprotinin, 2 μg/ml leupeptin, 1 mM phenylmethanesulfonyl fluoride, 10 mM dithiothreitol). Cell extracts were prepared by disruption of cells by sonication for 10–15 s on ice, and were subjected to western blot analysis as previously described (Michishita et al., 1999). The antibody against ß-tubulin was purchased from Santa Cruz Biotechnology. The signals were detected with an ECL chemiluminescence detection kit (GE healthcare lifesciences) on a chemiluminescence image analyser (ChemiDoc MP System, Bio-Rad) according to the supplier's instructions. 2.5. Senescence-associated ß-Galactosidase assay Cells were fixed in 2% formaldehyde/ 0.2% glutaraldehyde at room temperature for 5 min, and incubated at 37 °C with a fresh staining solution [1 mg/ml of 5-bromo-4-chloro-3-indolyl ß-D-galactoside, 40 mM citric acid-sodium phosphate (pH 6.0), 5 mM potassium ferricyanide, 5 mM potassium ferrocyanide, 150 mM NaCl, and 2 mM MgC12] as previously described (Michishita et al., 1999). 2.6. Construction of LBR knock-down constructs To construct the plasmids that express shRNAs against LBR, we annealed the following sets of oligonucleotides and inserted them into the pSilencer 1.0-U6 siRNA Expression Vector (Thermo Fisher Scientific) at the ApaI and EcoRV sites: 5′-GCCGACATTAAGGAAGCAA TTCAAGAGATTGCTTCCTTAATGTCGGCTTTTTT-3′ and 5′-AATTAAAA AAGCCGACATTAAGGAAGCAATCTCTTGAATTGCTTCCTTAATGTCGG CGGCC-3′ for LBRKD#1; 5′-GCTCTGGAAATGCTGTCTATTCAAGAGAT AGACAGCATTTCCAGAGCTTTTTT-3′ and 5′-AATTAAAAAAGCTCTGG AAATGCTGTCTATCTCTTGAATAGACAGCATTTCCAGAGCGGCC-3′ for LBRKD#2; 5′−CCGTATATTTCCATACATCTTCAAGAGAGATGTATGGA AATATACGGTTTTTT-3′ and 5′-AATTAAAAAACCGTATATTTCCATACA TCTCTCTTGAAGATGTATGGAAATATACGGGGCC-3′ for LBRKD#3; 5′-GCCTGGGAGTTCACTTTATTTCAAGAGAATAAAGTGAACTCCCAGG CTTTTTT-3′ and 5′-AATTAAAAAAGCCTGGGAGTTCACTTTATTCTCTT GAAATAAAGTGAACTCCCAGGCGGCC-3′ for LBRKD#4.
2. Materials and methods 2.1. Cell culture Cervical tumour-derived HeLa cells and normal human diploid fibroblast TIG-7 cells were obtained from the Japanese Collection of Research Bioresources (JCRB). HeLa cells were cultured in plastic dishes (Nunc) containing MEM medium (Nissui) supplemented with 5% foetal bovine serum (Cell culture bioscience) under 5% CO2 and 95% humidity as described previously (Michishita et al., 1999). TIG-7 cells were similarly cultured except that DMEM medium supplemented with 10% serum was used. Cellular senescence was induced by culturing cells with 1.5–2 mM of thymidine (Wako) or 50 μM of BrdU (Wako) for 4–14 d.
2.7. DNA transfection Plasmids (10 μg) were introduced to cells (106 cells) by electroporation with a high-efficiency electroporator (type NEPA21, Nepa Gene), and appropriate numbers of the cells (1 × 103-1 × 106 cells) were seeded on dishes or cover slips for further analyses.
2.2. Colony formation assay To determine the survival of cells, appropriate numbers of cells (1 × 103 - 1 × 104) were plated on 30- or 60-mm dishes, and allowed to grow for 1–2 weeks. To observe colony formation, cells were fixed with methanol and stained with Coomassie Brilliant Blue (CBB, Bio-Rad), and subjected to photography.
2.8. Quantitative real time RT-PCR Total RNA samples were prepared from cells by the acid guanidinium thiocyanate-phenol-chloroform extraction method (Chomczynski and Sacchi, 1987). mRNA was converted to cDNA by a reverse transcriptase (PrimeScript 1 st strand cDNA synthesis kit, Takara), and transcripts were quantified by quantitative real time PCR with a kit (Thunderbird qPCR mix, Toyobo) on a PCRmax Eco48 Real-Time PCR System (Asone) according to the manufacturer’s protocol. The primers used were as follows: 5′- TTAGGGCTTCCTCTTGGAGAA-3′ and 5′-ACC ATGTGGACCTGTCACTGT-3′ for p21; 5′−CCCAACGCACCGAATAG TTA-3′ and 5′-ACCAGCGTGTCCAGGAAG-3′ for p16; 5′- ACTGAGAGT GATTGAGAGTGGAC-3′ and 5′-AACCCTCTGCACCCAGTTTTC-3′ for IL8; 5′- TCTCATTGCAAGATCATCGCC-3′ and 5′−CCCCATGAATAACAC
2.3. Indirect immunofluorescence analysis Cells grown on a cover slip were fixed with 100% methanol for 15 min at -20 °C, washed three times with PBS, and incubated with 1% bovine serum albumin in PBS at room temperature for 1 h. After washing with PBS, the primary antibody against LBR (Cosmo Bio), or γH2AX (Cell Signaling) was mounted on a cover slip for 18 h. The cells were washed three times with PBS, and incubated with an alexa 568conjugated secondary antibody (Molecular Probes) for 3 h. Finally, the 26
Mechanisms of Ageing and Development 178 (2019) 25–32
R. Arai et al.
Fig. 1. Localization of LBR in excess thymidine-induced senescent cells. Localization of LBR was determined by immunohistochemical analysis with an antibody against LBR in HeLa cells (A) and TIG-7 cells (36 PDLs) (B) treated with excess thymidine (EdT, 1.5 mM) for 4 d. DNA was stained with DAPI. Scale bars: 50 μm.
3.2. Western blot analysis of LBR in senescent cells
AGCACC-3′ for SERPINE2/Nexin-1; 5′-GAAGGTGAAGGTCGGAGT CAA-3′ and 5′-GACAAGCTTCCCGTTCTCAG-3′ for GAPDH. Results were normalized with the expression of GAPDH.
We next examined the protein level of LBR by western blot analysis. We found that LBR was down-regulated in excess thymidine-induced senescence of HeLa and TIG-7 cells (Fig. 2A and B). LBR was also downregulated in replicative senescence of TIG-7 cells (Fig. 2B), and in BrdUinduced senescence of HeLa and TIG-7 cells (Fig. 2A and B). Then, senescent cells showed a decrease in the LBR protein as well as a change in its localization.
3. Results 3.1. Aberrant localization of LBR in senescent cells induced by excess thymidine LBR is localized at the nuclear envelope in proliferating cells, but diffuses in the nucleoplasm and cytoplasm in both BrdU-induced and replicative senescent cells (Arai et al., 2016). We then examined whether LBR shows a change in localization in cellular senescence induced by excess thymidine in HeLa and TIG-7 cells as well. We found that LBR showed a similar diffusive distribution pattern in excess thymidine-induced senescent cells, as observed in BrdU-induced and replicative senescent cells (Fig.1A and B) (Arai et al., 2016). Thus, aberrant localization of LBR was observed in excess thymidine-induced, BrdUinduced, and replicative senescent cells in common.
3.3. Facilitated induction of cellular senescence by knock-down of LBR in HeLa cells The above findings suggested that senescent cells show a decrease in LBR function. To investigate the role of LBR in cellular senescence, we constructed four knock-down vectors that express shRNAs against LBR (pLBRKD#1-4), and employed one vector, pLBRKD#3, which most efficiently down-regulated LBR in HeLa cells (Fig. 3A). We first examined the effect of knock-down of LBR on the growth of HeLa cells, but did not find differences in cell growth or morphology upon knock-down of LBR (Fig. 3B). Thus, cellular senescence was not induced by knock-down of 27
Mechanisms of Ageing and Development 178 (2019) 25–32
R. Arai et al.
cells: > 90% cells were positive for senescence-associated ß-galactosidase (SA-ß-gal); but it was less effectively induced by 0.6 mM of thymidine in HeLa cells: approximately 20% cells were positive for SA-ßgal (Fig. 3D and E). We then observed the growth of HeLa cells treated with knock-down of LBR in the presence of 0.6 mM of thymidine, and found that knock-down of LBR increased the population of senescent cells by approximately two-fold (Fig. 3D and E). This observation suggested that knock-down of LBR facilitated the induction of cellular senescence by excess thymidine. 3.4. Facilitated formation of chromatin foci by knock-down of LBR in HeLa cells treated with excess thymidine We examined the effect of knock-down of LBR on the formation of heterochromatin foci, a well-known marker of senescent cells (senescence-associated heterochromatic foci: SAHF) (Narita et al., 2003; Sadaie et al., 2013), in cells treated with excess thymidine. Upon treatment with excess thymidine for 7 days, the chromatin foci that were densely stained with DAPI were clearly observed in the cells transfected with the LBR knock-down vector or an empty vector; however, upon treatment with excess thymidine for 5 days, the foci were observed only in the cells transfected with the LBR knock-down vector (Fig. 4). This observation indicated that knock-down of LBR facilitated the formation of the DAPI-stained chromatin foci upon treatment with excess thymidine, and thus supported the view that knockdown of LBR facilitated the induction of cellular senescence by excess thymidine in HeLa cells.
Fig. 2. Western blot analysis of LBR in senescent cells. A, HeLa cells were induced to undergo cellular senescence by treating with BrdU (50 μM) or excess thymidine (EdT, 1.5 mM) for 4 d. Protein lysates were prepared from these cells, and subjected to western blot analysis with an antibody against LBR. B, TIG-7 cells entered cellular senescence at 72 PDLs (replicative senescent TIG7 cells). Young TIG-7 cells (39 PDLs) were induced to undergo cellular senescence by treating with BrdU (50 μM) or excess thymidine (EdT, 1.5 mM) for 4 d. Protein lysates were prepared from young TIG-7 cells (Young), replicative senescent TIG-7 cells (Senescent), BrdU-treated TIG-7 cells (BrdU), and excess thymidine-treated TIG-7 cells (EdT), and subjected to western blot analysis with an antibody against LBR.
3.5. Effect of knock-down of LBR on the localization of damaged DNA Excess thymidine stalls DNA replication forks and induces DNA damages which are detected by the formation of γ-H2AX foci. Immunostaining the cells with an antibody against γ-H2AX revealed a marked induction of γ-H2AX foci formation in HeLa cells upon treatment with excess thymidine (Takauji et al., 2016a) (Fig. 5B). Notably, we found that the γ-H2AX foci induced by excess thymidine preferentially located at the nuclear periphery (40–50% of the nuclei, Fig. 5B and C). We then examined the implication of LBR in the formation of γ-H2AX foci and found that knock-down of LBR significantly
LBR alone in HeLa cells. We also examined the protein level of lamin B1 which interacts with LBR (Worman et al., 1988), and found that lamin B1 was slightly decreased upon knock-down of LBR (Fig. 3C), though its decrease did not appear to have a significant effect on the growth of HeLa cells (Fig. 3B). We next examined the effect of knock-down of LBR on cellular senescence induced by excess thymidine. Cellular senescence was effectively induced by 1.5 mM of thymidine in HeLa
Fig. 3. Effect of knock-down of LBR on the induction of cellular senescence in HeLa cells. A, HeLa cells were transfected with pLBRKD#1-4 or an empty vector. Protein lysates were prepared from these cells and subjected to western blot analysis with an antibody against LBR. B, HeLa cells were transfected with pLBRKD#3 or an empty vector, and cultured for 10 d. The cells were photographed and stained with CBB. Scale bars: 100 μm. C, Protein lysates were prepared form HeLa cells transfected with pLBRKD#3 or an empty vector, and subjected to western blot analysis with an antibody against lamin B1. D, HeLa cells were transfected with pLBRKD#3 or an empty vector, and cultured with excess thymidine (EdT, 0.6 or 1.5 mM). Cells were stained with SA-ß-gal. Scale bars: 100 μm. E, The percentage of the SA-ß-gal-positive cells (D) was determined (> 100 cells). An asterisk indicates statistical significance, P < 0.05 (n=3).
28
Mechanisms of Ageing and Development 178 (2019) 25–32
R. Arai et al.
Fig. 4. Effect of knock-down of LBR on heterochromatin foci formation. HeLa cells transfected with pLBRKD#3 or an empty vector were cultured with excess thymidine (EdT, 2 mM) for 5–7 d, and stained with DAPI. Scale bars: 50 μm.
of normal human diploid fibroblasts, TIG-7. Young TIG-7 cells (36 PDLs) were transfected with the LBR knock-down vector together with pGKpuro, a plasmid that carries the puromycin-resistance gene, and were cultured in the presence of puromycin for 3 days to enrich the cells that expressed an shRNA against LBR. We subsequently observed the growth of these cells, and found that most of them ceased to grow with enlarged and flattened cell shapes and consequently formed tiny colonies (Fig. 6A). By contrast, the cells transfected with an empty
decreased the nuclear peripheral localization of the γ-H2AX foci, though it did not affect the foci formation per se (Fig. 5A–C). Thereby, LBR appeared to be involved in the recruitment of damaged DNA at the nuclear periphery upon treatment with excess thymidine.
3.6. Induction of cellular senescence by knock-down of LBR in TIG-7 cells We finally examined the effect of knock-down of LBR on the growth
Fig. 5. Effect of knock-down of LBR on DNA damages. A, HeLa cells were transfected with pLBRKD#3 or an empty vector and immunostained with an antibody against γ-H2AX. DNA was stained with DAPI. Scale bars: 50 μm. B, HeLa cells transfected with pLBRKD#3 or an empty vector were cultured with excess thymidine (EdT, 2 mM) for 1 d, and immunostained with an antibody against γ-H2AX. DNA was stained with DAPI. Arrowheads indicate the nuclear peripheral γH2AX. Scale bars: 50 μm. C, The percentage of the cells with nuclear peripheral γ-H2AX upon treatment with excess thymidine was determined (> 100 cells, n = 3). An asterisk indicates statistical significance, P < 0.05.
29
Mechanisms of Ageing and Development 178 (2019) 25–32
R. Arai et al.
Fig. 6. Induction of cellular senescence in TIG-7 cells by knock-down of LBR. A, TIG-7 cells were transfected with pLBRKD#3 or an empty vector together with pGKpuro, and cultured with puromycin for 3 d. These cells were subsequently cultured in normal medium for 8 d, and stained with SA-ß-gal. Formed colonies were stained with CBB. Scale bars: 100 μm. B, The percentage of the SA-ß-gal-positive cells (A) was determined (> 100 cells, n = 3). An asterisk indicates statistical significance, P < 0.05. C, TIG-7 cells were transfected with pLBRKD#3 or an empty vector as in (A), and the expression levels of the senescence-related genes (p21, p16, IL-8 and SERPINE2) were determined by quantitative RT-PCR analysis. The expression level of the gene is expressed as a value relative to that of the cells transfected with an empty vector (n = 3). An asterisk indicates statistical significance, P < 0.05.
senescence are controversial: some studies indicate that cellular senescence is induced by decreased or increased expression of lamin B, whereas not other studies (Barascu et al., 2012; Dreesen et al., 2013; Sadaie et al., 2013; Shimi et al., 2011). Sadaie et al. show that knockdown of lamin B alone does not largely affect cellular senescence or SAHF formation, but facilitates SAFH formation together with the expression of HMGA1/2 (Sadaie et al., 2013). Thus, the effect of lamin B expression appears to depend on the cellular context, and it would be interesting to examine whether LBR, which interacts with lamin B, may be involved in the cellular context-dependent effects caused by changes in lamin B expression. Since our previous study did not investigate the effect of decreased LBR function on the induction of cellular senescence (Arai et al., 2016), we here examined it in human cells. Recently, Lukasova et al. have reported that knock-down of LBR does not induce cellular senescence in U2OS and MCF7 cells, though it slightly increases the population of senescent cells upon γ-irradiation in these cells (by 1.1-fold in U2OS cells and 1.25-fold in MCF7 cells) (Lukasova et al., 2017). Thus, it was not clearly determined whether knock-down of LBR has a causal role in the induction of cellular senescence in human cells. We then examined the effect of knock-down of LBR in HeLa cells and showed that its knock-down facilitated the induction of cellular senescence by excess thymidine by approximately two-fold. Further, we found that, when HeLa cells were transfected with the increased amount of the knockdown vector (20 μg DNA/106 cells), a small fraction of the transfected cells exhibited enlarged and flattened cell shapes and were stained with SA-ß-gal, though most of the transfected cells continued to grow with normal cell shapes (Supplementary Fig. 1). This finding suggested that a small subset of HeLa cells are prone to undergo cellular senescence following knock-down of LBR, and suggested the possible role of LBR in the induction of cellular senescence in human cells. Moreover, we showed that cellular senescence was induced in normal human diploid fibroblast TIG-7 cells by knock-down of LBR alone. Thereby, these observations indicated that decreased LBR function would have a role in the induction of cellular senescence, and to our knowledge, this is the
vector continued to grow with normal cell shapes and formed normal colonies (Fig. 6A). We also found that the cells transfected with the LBR knock-down vector were stained with SA-ß-gal, which observation suggested that knock-down of LBR induced cellular senescence in TIG-7 cells (Fig. 6A and B). Further, we examined the expression of the senescence-related genes such as p21, p16, IL-8 (interleukin-8), and SERPINE2/nexin-I in TIG-7 cells, and showed that these genes were significantly up-regulated by knock-down of LBR (Fig. 6C). These findings suggested that decreased LBR function would have a role in the induction of cellular senescence in TIG-7 cells. 4. Discussion LBR plays crucial roles in the organization of heterochromatin at the nuclear envelope because the absence of LBR and lamin A causes detachment of heterochromatin from the nuclear envelope and re-distribution of it in the centre of the nucleus in all postmitotic cells (Solovei et al., 2013). In our previous study, we have shown that LBR shows aberrant localization in both BrdU-induced and replicative senescent cells (Arai et al., 2016). In the present study, we additionally showed that LBR similarly showed aberrant localization in excess thymidine-induced senescent cells, and also that LBR was down-regulated in BrdU-induced, excess thymidine-induced, and replicative senescent cells. Given that excess thymidine and BrdU induce cellular senescence probably through distinct mechanisms (Arai et al., 2016; Kudo et al., 2016; Sumikawa et al., 2005; Suzuki et al., 2002), aberrant localization and down-regulation of LBR might be commonly observed in cellular senescence regardless of the means to induce cellular senescence. Thus, LBR may have a role in the induction of cellular senescence. This view is consistent with the recent reports that several nuclear envelope proteins that include LBR are down-regulated upon induction of cellular senescence (Dou et al., 2015; Ivanov et al., 2013; Lenain et al., 2015; Lukasova et al., 2017). These reports indicate that both LBR and lamin B are concomitantly down-regulated in cellular senescence induced by oncogenes, etoposide, or γ-irradiation. The roles of lamin B in cellular 30
Mechanisms of Ageing and Development 178 (2019) 25–32
R. Arai et al.
first report that clearly describes the induction of cellular senescence by knock-down of LBR in human cells. The differential response to the knock-down of LBR in HeLa and TIG-7 cells might be due to differential activities of the p53 and RB proteins in them: i.e., these proteins are functionally inactivated by the expression of human papilloma virus E6/E7 in HeLa cells but not in TIG-7 cells. Indeed, we observed that knock-down of LBR up-regulated the expression of p21 and p16, the genes involved in the p53 and RB pathways, in TIG-7 cells. Then, it may be likely that more stringent control of cell cycle may be required for the induction of cellular senescence by knock-down of LBR in HeLa cells. What is the role of LBR in cellular senescence? We showed that knock-down of LBR did not increase γ-H2AX foci formation in HeLa cells or in excess thymidine-treated HeLa cells. Thus, DNA damage, which is well-known to induce cellular senescence in many types of cell, did not appear to have a causal role in the induction of cellular senescence by knock-down of LBR. Since LBR plays crucial roles in organizing heterochromatin at the nuclear envelope (Solovei et al., 2013), decreased LBR function would likely lead to altered chromatin organization in senescent cells. In this respect, it is worthy to note that excess thymidine induced the formation of DAPI-stained chromatin foci, and their formation was facilitated by knock-down of LBR. This finding suggested that LBR might be involved in the altered chromatin organization upon induction of cellular senescence by excess thymidine. Further, knock-down of LBR is demonstrated to lead to the relocalization and distension of centromeric heterochromatin, which are observed in senescent cells (Lukasova et al., 2017). Thus, it may be reasonable to speculate that altered chromatin organization due to decreased LBR function may contribute to the induction of cellular senescence. LBR is a multi-functional protein: the amino-terminal region of LBR encodes the domains for chromatin organization, and the carboxyterminal region encodes sterol reductase for cholesterol synthesis (Olins et al., 2010). We then examined whether decreased cholesterol synthesis due to decreased LBR function has a role in the induction of cellular senescence. However, we could not detect any suppressive effects of supplementation of cholesterol in medium on the induction of cellular senescence by excess thymidine in HeLa cells (data not shown). This observation did not support the possibility that decreased cholesterol is causative for the induction of cellular senescence by excess thymidine. Currently, the molecular mechanism by which excess thymidine mislocalizes and down-regulates LBR is unidentified. Interestingly, we found that γ-H2AX foci induced by excess thymidine preferentially located at the nuclear periphery in HeLa cells. Nuclear peripheral γ-H2AX foci could be identical to the “apoptotic ring” of γ-H2AX, which is temporally formed at the early stage of apoptosis (Solier and Pommier, 2009). However, the nuclear peripheral γ-H2AX foci in excess thymidine-treated cells were maintained for more prolonged periods probably because the cells were treated with the sub-lethal doses of thymidine that induce cellular senescence, but not apoptosis (Kudo et al., 2016; Takauji et al., 2016a). Then, persistent DNA damage might cause nuclear peripheral localization of damaged DNA in human cells. Interestingly of note, this phenomenon may be observed in other organisms as well because yeast cells are reported to target persistent DNA double strand beaks (DNA damages) to the nuclear periphery in a nuclear envelope protein-dependent manner (Kalocsay et al., 2009; Oza et al., 2009). Importantly, our experiments with knock-down of LBR suggested that LBR was involved in the localization of γ-H2AX foci at the nuclear periphery. Then, it may be possible to speculate that prolonged recruitment of damaged DNA at the nuclear periphery by LBR might interfere with the interaction between LBR and heterochromatin, and the decreased complex formation between LBR and heterochromatin might result in altered localization, destabilization and degradation of LBR. In this regard, it is interesting to note that several nuclear envelope proteins are degraded by autophagy in senescent cells (Dou et al., 2015; Lenain et al., 2015). Further analysis will be required
to understand the mechanism for the regulation of LBR in senescent cells. In summary, our findings suggested the possibility that decreased LBR function due to its aberrant localization and down-regulation would have a role in the induction of cellular senescence. Nuclear peripheral heterochromatin is not observed in mouse embryonic stem cells and emerges in many types of differentiated cell in the course of development with tissue-specific expression of lamin A and LBR (Solovei et al., 2013; Talamas and Capelson, 2015). Thus, lamins and lamin-interacting proteins appear to cooperatively function to organize heterochromatin during cellular differentiation. Thereby, it is intriguing to speculate that disorganization of heterochromatin may cause functional decline of differentiated cells that would consequently lead to the onset of senescence. Further analysis of the nuclear envelope proteins that regulate chromatin organization would provide novel insights into cellular senescence. Declarations of interest None. Acknowledgements This work was supported in part by a grant-in-aid for Scientific Research from the Ministry of Education, Science and Culture of Japan. Appendix A. Supplementary data Supplementary material related to this article can be found, in the online version, at doi:https://doi.org/10.1016/j.mad.2019.01.001. References Arai, R., En, A., Ukekawa, R., Miki, K., Fujii, M., Ayusawa, D., 2016. Aberrant localization of lamin B receptor (LBR) in cellular senescence in human cells. Biochem. Biophys. Res. Commun. 473, 1078–1083. Barascu, A., Le Chalony, C., Pennarun, G., Genet, D., Imam, N., Lopez, B., Bertrand, P., 2012. Oxidative stress induces an ATM-independent senescence pathway through p38 MAPK-mediated lamin B1 accumulation. EMBO J. 31, 1080–1094. Campisi, J., 1997. The biology of replicative senescence. Eur. J. Cancer 33, 703–709. Campisi, J., d’Adda di Fagagna, F., 2007. Cellular senescence: when bad things happen to good cells. Nat. Rev. Mol. Cell Biol. 8, 729–740. Chomczynski, P., Sacchi, N., 1987. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 162, 156–159. De Sandre-Giovannoli, A., Bernard, R., Cau, P., Navarro, C., Amiel, J., Boccaccio, I., Lyonnet, S., Stewart, C.L., Munnich, A., Le Merrer, M., Levy, N., 2003. Lamin a truncation in Hutchinson-Gilford progeria. Science 300, 2055. Dou, Z., Xu, C., Donahue, G., Shimi, T., Pan, J.A., Zhu, J., Ivanov, A., Capell, B.C., Drake, A.M., Shah, P.P., Catanzaro, J.M., Ricketts, M.D., Lamark, T., Adam, S.A., Marmorstein, R., Zong, W.X., Johansen, T., Goldman, R.D., Adams, P.D., Berger, S.L., 2015. Autophagy mediates degradation of nuclear lamina. Nature 527, 105–109. Dreesen, O., Chojnowski, A., Ong, P.F., Zhao, T.Y., Common, J.E., Lunny, D., Lane, E.B., Lee, S.J., Vardy, L.A., Stewart, C.L., Colman, A., 2013. Lamin B1 fluctuations have differential effects on cellular proliferation and senescence. J. Cell Biol. 200, 605–617. Eriksson, S., Thelander, L., Akerman, M., 1979. Allosteric regulation of calf thymus ribonucleoside diphosphate reductase. Biochemistry 18, 2948–2952. Eriksson, M., Brown, W.T., Gordon, L.B., Glynn, M.W., Singer, J., Scott, L., Erdos, M.R., Robbins, C.M., Moses, T.Y., Berglund, P., Dutra, A., Pak, E., Durkin, S., Csoka, A.B., Boehnke, M., Glover, T.W., Collins, F.S., 2003. Recurrent de novo point mutations in lamin A cause Hutchinson-Gilford progeria syndrome. Nature 423, 293–298. Freund, A., Laberge, R.M., Demaria, M., Campisi, J., 2012. Lamin B1 loss is a senescenceassociated biomarker. Mol. Biol. Cell 23, 2066–2075. Guarda, A., Bolognese, F., Bonapace, I.M., Badaracco, G., 2009. Interaction between the inner nuclear membrane lamin B receptor and the heterochromatic methyl binding protein, MeCP2. Exp. Cell Res. 315, 1895–1903. Hayflick, L., Moorehead, P.S., 1961. The serial cultivation of human diploid cell strains. Exp. Cell Res. 1961 (December (25)), 585–621. Ivanov, A., Pawlikowski, J., Manoharan, I., van Tuyn, J., Nelson, D.M., Rai, T.S., Shah, P.P., Hewitt, G., Korolchuk, V.I., Passos, J.F., Wu, H., Berger, S.L., Adams, P.D., 2013. Lysosome-mediated processing of chromatin in senescence. J. Cell Biol. 202, 129–143. Kalocsay, M., Hiller, N.J., Jentsch, S., 2009. Chromosome-wide Rad51 spreading and SUMO-H2A.Z-dependent chromosome fixation in response to a persistent DNA double-strand break. Mol. Cell 33, 335–343.
31
Mechanisms of Ageing and Development 178 (2019) 25–32
R. Arai et al.
Solier, S., Pommier, Y., 2009. The apoptotic ring: a novel entity with phosphorylated histones H2AX and H2B and activated DNA damage response kinases. Cell Cycle 8, 1853–1859. Solovei, I., Wang, A.S., Thanisch, K., Schmidt, C.S., Krebs, S., Zwerger, M., Cohen, T.V., Devys, D., Foisner, R., Peichl, L., Herrmann, H., Blum, H., Engelkamp, D., Stewart, C.L., Leonhardt, H., Joffe, B., 2013. LBR and lamin A/C sequentially tether peripheral heterochromatin and inversely regulate differentiation. Cell 152, 584–598. Sumikawa, E., Matsumoto, Y., Sakemura, R., Fujii, M., Ayusawa, D., 2005. Prolonged unbalanced growth induces cellular senescence markers linked with mechano transduction in normal and tumor cells. Biochem. Biophys. Res. Commun. 335, 558–565. Suzuki, T., Michishita, E., Ogino, H., Fujii, M., Ayusawa, D., 2002. Synergistic induction of the senescence-associated genes by 5-bromodeoxyuridine and AT-binding ligands in HeLa cells. Exp. Cell Res. 276, 174–184. Swanson, E.C., Manning, B., Zhang, H., Lawrence, J.B., 2013. Higher-order unfolding of satellite heterochromatin is a consistent and early event in cell senescence. J. Cell Biol. 203, 929–942. Takauji, Y., En, A., Miki, K., Ayusawa, D., Fujii, M., 2016a. Combinatorial effects of continuous protein synthesis, ERK-signaling, and reactive oxygen species on induction of cellular senescence. Exp. Cell Res. 345, 239–246. Takauji, Y., Wada, T., Takeda, A., Kudo, I., Miki, K., Fujii, M., Ayusawa, D., 2016b. Restriction of protein synthesis abolishes senescence features at cellular and organismal levels. Sci. Rep. 6, 18722. Talamas, J.A., Capelson, M., 2015. Nuclear envelope and genome interactions in cell fate. Front. Genet. 6, 95. Ukekawa, R., Miki, K., Fujii, M., Hirano, H., Ayusawa, D., 2007. Accumulation of multiple forms of lamin A with down-regulation of FACE-1 suppresses growth in senescent human cells. Genes Cells 12, 397–406. Worman, H.J., Yuan, J., Blobel, G., Georgatos, S.D., 1988. A lamin B receptor in the nuclear envelope. Proc. Natl. Acad. Sci. U. S. A. 85, 8531–8534. Ye, Q., Worman, H.J., 1996. Interaction between an integral protein of the nuclear envelope inner membrane and human chromodomain proteins homologous to Drosophila HP1. J. Biol. Chem. 271, 14653–14656. Zakharov, A.F., Baranovskaya, L.I., Ibraimov, A.I., Benjusch, V.A., Demintseva, V.S., Oblapenko, N.G., 1974. Differential spiralization along mammalian mitotic chromosomes. II. 5-bromodeoxyuridine and 5-bromodeoxycytidine-revealed differentiation in human chromosomes. Chromosoma 44, 343–359.
Kim, J.H., Kim, S.H., Eidinoff, M.L., 1965. Cell viability and nucleic acid metabolism after exposure of HeLa cells to excess thymidine and deoxyadenosine. Biochem. Pharmacol. 14, 1821–1829. Kobayashi, Y., Sakemura, R., Kumagai, A., Sumikawa, E., Fujii, M., Ayusawa, D., 2008. Nuclear swelling occurs during premature senescence mediated by MAP kinases in normal human fibroblasts. Biosci. Biotechnol. Biochem. 72, 1122–1125. Kudo, I., Nozawa, M., Miki, K., Takauji, Y., En, A., Fujii, M., Ayusawa, D., 2016. Dual roles of ERK1/2 in cellular senescence induced by excess thymidine in HeLa cells. Exp. Cell Res. 346, 216–223. Lenain, C., Gusyatiner, O., Douma, S., van den Broek, B., Peeper, D.S., 2015. Autophagymediated degradation of nuclear envelope proteins during oncogene-induced senescence. Carcinogenesis 36, 1263–1274. Lukasova, E., Kovar ik, A., Bac ikova, A., Falk, M., Kozubek, S., 2017. Loss of lamin B receptor is necessary to induce cellular senescence. Biochem. J. 474, 281–300. Michishita, E., Nakabayashi, K., Suzuki, T., Kaul, S.C., Ogino, H., Fujii, M., Mitsui, Y., Ayusawa, D., 1999. 5-Bromodeoxyuridine induces senescence-like phenomena in mammalian cells regardless of cell type or species. J. Biochem. 126, 1052–1059. Narita, M., Nunez, S., Heard, E., Lin, A.W., Hearn, S.A., Spector, D.L., Hannon, G.J., Lowe, S.W., 2003. Rb-mediated heterochromatin formation and silencing of E2F target genes during cellular senescence. Cell 113, 703–716. Olins, A.L., Rhodes, G., Welch, D.B., Zwerger, M., Olins, D.E., 2010. Lamin B receptor: multi-tasking at the nuclear envelope. Nucleus 1, 53–70. Oza, P., Jaspersen, S.L., Miele, A., Dekker, J., Peterson, C.L., 2009. Mechanisms that regulate localization of a DNA double-strand break to the nuclear periphery. Genes Dev. 23, 912–927. Polioudaki, H., Kourmouli, N., Drosou, V., Bakou, A., Theodoropoulos, P.A., Singh, P.B., Giannakouros, T., Georgatos, S.D., 2001. Histones H3/H4 form a tight complex with the inner nuclear membrane protein LBR and heterochromatin protein 1. EMBO Rep. 2, 920–925. Ross, D.W., 1983. Unbalanced cell growth and increased protein synthesis induced by chemotherapeutic agents. Blood Cells 1983 (9), 57–68. Sadaie, M., Salama, R., Carroll, T., Tomimatsu, K., Chandra, T., Young, A.R., Narita, M., Perez-Mancera, P.A., Bennett, D.C., Chong, H., Kimura, H., 2013. Redistribution of the Lamin B1 genomic binding profile affects rearrangement of heterochromatic domains and SAHF formation during senescence. Genes Dev. 27, 1800–1808. Shimi, T., Butin-Israeli, V., Adam, S.A., Hamanaka, R.B., Goldman, A.E., Lucas, C.A., Shumaker, D.K., Kosak, S.T., Chandel, N.S., Goldman, R.D., 2011. The role of nuclear lamin B1 in cell proliferation and senescence. Genes Dev. 25, 2579–2593.
32