Latex protein extracts from Calotropis procera with immunomodulatory properties protect against experimental infections with Listeria monocytogenes

ARTICLE IN PRESS

JID: PHYMED

[m5G;April 15, 2016;20:4]

Phytomedicine xxx (2016) xxx–xxx

Contents lists available at ScienceDirect

Phytomedicine journal homepage: www.elsevier.com/locate/phymed

Latex protein extracts from Calotropis procera with immunomodulatory properties protect against experimental infections with Listeria monocytogenes Q1

Danielle Cristina de Oliveira Nascimento a, Maria Taciana Ralph a, Jacqueline Ellen Camelo Batista a, Diogo Manoel Farias da Silva b, Manoel Adrião Gomes Filho b, Nylane Maria Alencar c, Nilma Cintra Leal d, Márcio Viana Ramos e, Jose Vitor Lima-Filho a,∗ a

Departamento de Biologia, Universidade Federal Rural de Pernambuco, Recife-PE, Brazil Departamento de Morfologia e Fisiologia Animal, Universidade Federal Rural de Pernambuco, Recife-PE, Brazil c Departamento de Fisiologia e Farmacologia, Universidade Federal do Ceará, Fortaleza-CE, Brazil d Departamento de Microbiologia, Centro de Pesquisa Aggeu Magalhães, Fiocruz, Recife, PE e Departamento de Bioquímica e Biologia Molecular, Universidade Federal do Ceará, Fortaleza-CE, Brazil b

a r t i c l e

i n f o

Article history: Received 14 October 2015 Revised 22 March 2016 Accepted 30 March 2016 Available online xxx Keywords: Laticifer fluid Experimental infections Cytokines Intracellular infection

a b s t r a c t Background: The latex from medicinal plant Calotropis procera is often used in folk medicine against infectious and inflammatory diseases. Purpose: In this study, we investigate a protein fraction with immunomodulatory properties, named LPPI , against experimental infections, in vitro and in vivo, with a virulent strain of Listeria monocytogenes. Study design: LPPI was exposed to cultured macrophages or Swiss mice and then challenged with L. monocytogenes. Methods: Peritoneal macrophages were obtained from Swiss mice, and cultured in 96-well microplates. Soluble latex proteins (LP) were subjected to fractionation by ion-exchange chromatography. The major peak (LPPI ) was added into wells at 10 or 100 μg/ml. Albumin (100 μg/ml) was used for comparison between protein treatments. After incubation for 1 h at 5% CO2 / 37°C, the supernatant was discarded and 0.2 ml of L. monocytogenes overnight culture was added in the wells. Following 4 h and 24 h infection, the cytokine mRNA expression was evaluated as well as the number of intracellular colony forming units. Swiss mice (n = 16) were injected intraperitoneally (i.p.) with LPPI (5 and 10 mg/kg) while the control mice received albumin (10 mg/kg) or LP (10 mg/kg). After 24 h, all animal groups were challenged with L. monocytogenes (106 CFU/ ml), also by i.p. route. Results: LPPI was not toxic to uninfected macrophages (pMØ) and significantly increased mRNA expression of TNF-α , IL-6, IL-1β and iNOS. Following infection, cell viability was reduced by 50% in albumintreated pMØ (control); but only 17% in pMØ treated with LPPI at 100 μg/ml. In this case, LPPI increased expression of TNF-α and IL-6 whereas the number of bacterial colony forming units was reduced 100-fold in comparison to control groups. Swiss mice pretreated with LPPI showed dose-dependent survival rates that reached 80%, while mice that received albumin died 1–3 days after infection. After 24 h infection, leukocyte migration to the infectious foci was high in LPPI -treated mice whereas the number of viable bacteria in the peritoneal fluid, liver and bloodstream were significantly reduced.

Abbreviations: LP, entire set of latex soluble proteins from C. Procera; LPPI , protein fraction (peak 1) obtained from LP through ion-exchange chromatography; LPPII , protein fraction (peak 2) obtained from LP through ion-exchange chromatography; LPPIII , protein fraction (peak 3) obtained from LP through ion-exchange chromatography; pMø, mice peritoneal macrophages; mRNA, messenger RNA; cDNA, complementary DNA; TNF-α , Tumor Necrosis Factor alpha; IL-6, interleukin 6; IL-1β , Interleukin-1 beta; inos, inducible Nitric Oxide Synthase; i.p., intraperitoneal; NK, Natural Killer lymphocytes. ∗ Corresponding author. Rua Dom Manoel de Medeiros, s/n, Departamento de Biologia, Lab. de Microbiologia e Imunologia (LAMIM), Universidade Federal Rural

de Pernambuco, Campus Dois Irmãos, Recife, Pernambuco CEP 52171-900, Brazil. Tel.: + 55 31 81 33206312. E-mail address: [email protected], [email protected] (J.V. Lima-Filho).

http://dx.doi.org/10.1016/j.phymed.2016.03.012 0944-7113/© 2016 Elsevier GmbH. All rights reserved.

Please cite this article as: D.C.d.O. Nascimento et al., Latex protein extracts from Calotropis procera with immunomodulatory properties protect against experimental infections with Listeria monocytogenes, Phytomedicine (2016), http://dx.doi.org/10.1016/j.phymed.2016.03.012

JID: PHYMED 2

ARTICLE IN PRESS

[m5G;April 15, 2016;20:4]

D.C.d.O. Nascimento et al. / Phytomedicine xxx (2016) xxx–xxx

Conclusion: We conclude that LPPI present immunomodulatory properties that are beneficial for prevention of systemic bacterial infections caused by the intracellular bacteria L. monocytogenes. © 2016 Elsevier GmbH. All rights reserved.

1

Introduction

Microorganisms

57

2

L. monocytogenes (strain LM619) was isolated from a human clinical case and kindly provided by Dr. Nilma Cintra Leal, who maintained the bacterium as part of the culture collection of Fiocruz-Recife, PE. The bacteria were incubated overnight in brainheart infusion broth (BHI), and culture inocula were adjusted after spectrophotometer reading at 630 nm (O.D. 0.5, 108 cells per ml).

58

Latex proteins from C. procera

64

51

About 10% of Angiosperm species release laticifer fluids when their tissues are damaged (Farrel et al., 1991). Although these lattices apparently do not play a role in primary metabolism, at least part of the success of flowering plants in various environments is related to their protective functions against insects and microorganisms as well as their role in wound healing (Konno, 2011). Plants’ lattices are sources of bioactive compounds, including analgesic alkaloids like morphine (Papaver spp.), glycosides with effects on cardiac function (Asclepias spp.), sesquiterpene lactones (Lactuca spp.) and digestive proteases (Carica papaya and Ficus spp.) (Agrawal, 2005). Calotropis procera (Aiton) Dryand. (Apocynaceae) is a laticifer plant broadly distributed in arid and semi-arid regions of Africa, Asia and South America (Kakkar et al., 2012). Its biological activities include antitumor, antipyretic, analgesic, antiinflammatory and inflammatory action (Dewan et al., 20 0 0a and 20 0 0b; Arya and Kumar, 20 05; Choedon et al., 20 06; Alencar et al., 2006). In a previous work, C. procera latex protein fractions with immunomodulatory properties were obtained by ion exchange chromatography from the whole set of soluble proteins (LP) (Alencar et al., 2004; Alencar et al., 2006). The major peak, named LPPI , showed to be devoid of protease activity and rich in proteins with chitinolytic activity (Oliveira et al., 2007; Freitas et al. (2007). Accordingly, proteomic analysis based in two-dimensional electrophoresis and mass spectrometry analyses, n-terminal amino acid sequence and specific enzymatic assays performed in our laboratory have shown that LPPI harbor isoforms of chitinase-like proteins (unpublished data). LPPI harbor inflammatory plus antiinflammatory properties depending on administration route in a model of peritonitis induced by carrageenan (Oliveira et al., 2012). We have shown that i.p. injection of LP or LPPI into the peritoneal cavity of Swiss mice prevent septic shock in a model of Salmonella-mediated inflammation (Lima-Filho et al., 2010; Oliveira et al., 2012). LPPI treatments reduced the bacterial load in bloodstreams, liver and spleen enhancing 100% survival in comparison to control animals that died 1–3 days after infection (Oliveira et al., 2012). Listeria monocytogenes is the etiological agent of human listeriosis, a serious food-borne bacterial illness with clinical manifestations ranging from gastroenteritis to severe invasive forms. This bacterium has tropism for the nervous system and can cross the blood-brain barrier, causing meningitis and encephalitis (Hof et al., 1997). The success in resolving listeriosis requires participation of innate and acquired cell immunity mechanisms, involving neutrophils, macrophages, NK cells, T lymphocytes and an array of cytokines (Harty et al., 1996). Considering the promising effect of LPPI on prevention of experimental systemic infections caused by S. enterica serovar Typhimurium, the goal of this study was to investigate its role in the immune response during experimental infections with a virulent strain of L. monocytogenes.

52

Material and methods

In vitro toxicity test

53

All procedures were performed in accordance with internationally accepted principles for the use of laboratory animals, and were approved by the experimental ethics committee of Federal Rural University of Pernambuco (License 024/2014).

The pMØ values were obtained according to item 2.4. After 12– 16 h of incubation, the supernatant was removed and the wells were washed three times with phosphate buffered saline (PBS, pH 7.4). Sterile stock solutions of LPPI were prepared in RPMI medium

3 4 5 6 7 8 9 10 11 Q2

12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50

54 55 56

A plant specimen of C. procera (Voucher No. 32663) was deposited in the Prisco Bezerra Herbarium, Federal University of Ceará, Brazil. Latex proteins were obtained as described by Alencar et al. (2004). Briefly, the latex was collected in plastic tubes through incisions in the shoot apex of healthy plants, using a sharp blade. Then, sterilized distilled water was added to complete a ratio of 1:1 (v: v). This solution was subjected to centrifugation at 50 0 0 g (10°C for 10 min) and the precipitate, mainly consisting of rubber, was discarded. The supernatant was dialyzed against distilled water (1:10, v: v) at 8°C for 60 h. After being centrifuged at 50 0 0 g (10°C for 10 min), a clear supernatant rich in proteins and devoid of rubber was obtained. These soluble proteins (LP) were lyophilized and then subjected to fractionation by ion exchange chromatography with a CM Sepharose fast-flow column previously equilibrated with 50 mM of acetate buffer (pH 5.0) (Ramos et al., 2009). Three protein fractions, named LPPI , and LPPII LPPIII , were obtained, lyophilized and then stored at room temperature until use. The major peak (LPPI ), which is devoid of protease activity (Oliveira et al., 2007), was used in the present study (Fig. I, supplementary file).

59 60 61 62 63

65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84

Animals

85

Swiss mice (Mus musculus) were obtained from the Biotery of Keizo Asami Immunopathology Laboratory (LIKA) at Federal University of Pernambuco. The animals weighed 30–35 g and were maintained in cages with controlled lighting (12 h light/dark cycles), temperature of 25°C, with free access to water and standard feed (Purina, Pauline, SP, Brazil).

86

Peritoneal macrophages

92

Peritoneal macrophages (pMØ) were obtained by washing the mice’s peritoneal cavities with Roswell Park Memorial Institute (RPMI) medium plus 20% fetal calf serum (FCS), penicillin (100 U/ml) and streptomycin (100 μg/ml), preheated to 37°C. The cell cultures were quantified in a Neubauer chamber by the Trypan blue exclusion method, and adjusted to contain 1 × 107 cells/ml. Then, 0.2 ml was added per well in 96-well plates (2 × 106 cells/well). The experiments were conducted after overnight incubation at 5% CO2 /37°C.

Please cite this article as: D.C.d.O. Nascimento et al., Latex protein extracts from Calotropis procera with immunomodulatory properties protect against experimental infections with Listeria monocytogenes, Phytomedicine (2016), http://dx.doi.org/10.1016/j.phymed.2016.03.012

87 88 89 90 91

93 94 95 96 97 98 99 100 101 102 103 104 105 106

JID: PHYMED

ARTICLE IN PRESS

[m5G;April 15, 2016;20:4]

D.C.d.O. Nascimento et al. / Phytomedicine xxx (2016) xxx–xxx

116

without antibiotics and twofold diluted into wells to produce final concentrations ranging from 3.12 to 400 μg/ml. Doxorubicin (10 μg/ml) was used as positive control. After 24 h, 20 μl of resazurin (0.15 mg/ml in sterile PBS) was added to each well. After another incubation period at 5% CO2 /37°C for 4 h, spectrophotometer readings were made at 630 nm. Cell viability was expressed as percentage relative to untreated pMØ. Toxicity was classified: inactive (1–20%), weakly active (20–50%), moderately active (50–70%) or very active (70–100%) (Fouche et al., 2008). All experiments were performed in triplicate.

117

In vitro experimental infections with L. monocytogenes

107 108 109 110 111 112 113 114 115

118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 166 167

Initially, 96-well plates were cultured with pMØ, as described above. Then, 0.2 ml of LPPI (10 or 100 μg/ml in RPMI) or albumin (100 μg/ml) was added in the wells. After incubation for 1 h at 5% CO2 / 37°C, the supernatant was discarded and 0.2 ml of L. monocytogenes overnight culture was added in the wells at multiplicity of infection 10 (m.o.i.) (2 × 106 CFU per well in RPMI). After a new incubation period (5% CO2 /37°C for 1 h), the supernatant was discarded and the cells were washed with PBS. Then, 0.2 ml of gentamycin (100 μg/ml in RPMI) was added to the wells and the plates were incubated for another hour (5% CO2 /37°C). Afterwards, the supernatant was discarded and the cells were washed twice with RPMI medium preheated to 37°C. Finally, gentamycin (10 μg/ml in RPMI) was added in the wells and 4 h and 24 h after infection, 20 μl of resazurin was add to measure cell viability as previously detailed. Cell viability was expressed as percentage relative to untreated plus uninfected pMØ. All experiments were performed in triplicate. Quantification of L. monocytogenes in pMØ After 4 h and 24 h of infection (m.o.i. 10), 40 μl of 0.2% Triton X100 was added to wells and the plates were left on ice for 20 min. Then, tenfold serial dilutions were carried out in PBS using 96-well microplates. Quantification of colony forming units was performed through the “drop plate” method on selective Listeria agar (OXOID, Basingstoke, UK) after overnight incubation at 37°C. Gene expression of pro-inflammatory cytokines in pMØ treated with LPPI The mRNA expression of pro-inflammatory cytokines was analyzed in pMØ cultures treated with LPPI (10 to 100 μg/ml) or albumin (100 μg/ml) for 1 h, and then infected or not by LM619 for 4 h and 24 h. In this case, the assay was conducted in 48well plates (1 ml final volume per well). Bacterial lipopolysaccharide (2 μg/ml, Sigma) was used as positive control. After incubation at 5% CO2 /37°C, the supernatant was stored at –20°C in a freezer and pMØ cultures were submitted to chemical cell lysis with Trizol (Sigma). Total RNA extraction was carried out as described everywhere. Construction of cDNA was performed with a commercial kit (Sigma M-MLV Reverse Transcriptase). Quantitative realtime PCR reactions were conducted following the manufacturer’s instructions (Sigma SYBR-Green/Quantitative RT-PCR Kit). The following primers were used: Mouse β -actin (Internal Control) – 5 ATATCGCTGCGCTGGTCGTC 3 , 5 AGGATGGCGTGAGGGAGAGC 3 ; Tumor Necrosis Factor-α (TNF-α ) - 5 GATCTCAAAGACAACCAACTAGTG 3 , 5 CTCCAGCTGGAAGACTCCTCCCAG 3 ; Interleukin-6 (IL-6) – 5 TAATTCATATCTTCAACCAAGAGG 3 , 5 TTGTCTAATGG GAACGTCACAC 3 ); Interleukin-1β (IL-1β ) – 5 AATCTCACAGCAGCACATCAA 3 , 5 AGCCCATACTTTAGGAAGACA 3 , and inducible nitric oxide synthase enzyme (iNOS) - 5 TGTGGCTACCACATTGAAGAA 3 , 5 TCATGATAACGTT TCTGGCTCTT 3 . The PCR reaction (20 μl) was performed as follows: 40 cycles at 95°C for 35 s plus 60°C for 60 s (Q series Rotor Gene - Qiagen). The data were analyzed according

3

to Dussault and Pouliot (2006). The following formula was used for comparison of the expression levels of genes of interest (G.I.) between control and experimental groups:

Ct = [(CtG.I.Control − Ct ActinControl ) 

168 169 170



− CtG.I.Experimental − Ct ActinExperimental ]

The results were expressed in terms of fold variation using the following formula: 2 CT

172

In vivo experimental infections with L. monocytogenes

173

Since naïve macrophages represent more than 50% of leukocytes into the peritoneal cavity (Ray and Dittel, 2010), Swiss mice (n = 16) were injected intraperitoneally (i.p.) with 0.2 ml of LPPI (5 and 10 mg/kg), diluted in sterile PBS, pH 7.2, while the control mice received 0.2 ml of albumin (10 mg/kg) or LP (10 mg/kg). After 24 h, all animal groups were challenged with LM619 (0.2 ml; 106 CFU/ml), also by i.p. route. The clinical symptoms and survival after infection were monitored daily for seven days. After infection for 4 h and 24 h, four mice from each group were euthanized by use of inhalatory isoflurane for collection of biological material. The surviving animals were euthanized at the end of the experiment. Quantification of L. monocytogenes in vivo The brain, spleen and the liver of animals from all groups were aseptically removed, and homogenized in PBS pH 7.2. These organ suspensions and samples of blood and peritoneal fluid were subjected to tenfold serial dilutions, and 0.1 ml aliquots were plated onto selective Listeria agar (OXOID). After overnight incubation at 37 °C, the number of colony forming units (CFU) were expressed as Log CFU per g of organ or ml of blood or peritoneal fluid. Leukocyte cell counts For total white blood cell counting, 20 μl of blood or peritoneal fluid was homogenized with 380 μl of Turk’s reagent. An aliquot of this solution was used for leukocyte counting in a Neubauer chamber using an optical microscope. The differential count was made from smears stained with eosin methylene blue-Giemsa (Horobin et al., 2011). Statistical analysis Statistical differences between groups were obtained by analysis of variance (ANOVA) followed by the Bonferroni multiple comparison test with confidence interval set as P < 0.05. These analyses were performed and the corresponding graphs were obtained using the PRISM program version 5.0.

171

174 175 176 177 178 179 180 181 182 183 184 185 186 187 188 189 190 191 192 193 194 195 196 197 198 199 200 201 202 203 204 205 206 207

Results

208

Toxicity assays with peritoneal macrophages (pMØ) have shown that LPPI is not toxic, with cell viability higher than 98% at doses ranging from 3.1 to 200 μg/ml, and higher than 95% at the dose of 400 μg/ml, 24 h after exposure (data not shown). Conversely, viability of macrophages treated with doxorubicin (10 μg/ml) was reduced and reached only 83% (data not shown). Thus, experimental infections with L. monocytogenes 619 (LM619) were conducted in pMØ pre-treated for 1 h with LPPI at 10 or 100 μg/ml or albumin 100 μg/ml. In this case, cell viability was reduced by 50% in pMØ infected with LM619; but only 17% in pMØ treated with LPPI at 100 μg/ml 24 h after infection (Fig. 1A). Accordingly, the number of colony forming units in LPPI -treated pMØ was 100-fold reduced in comparison to albumin control cells, which correlated with higher

209

Please cite this article as: D.C.d.O. Nascimento et al., Latex protein extracts from Calotropis procera with immunomodulatory properties protect against experimental infections with Listeria monocytogenes, Phytomedicine (2016), http://dx.doi.org/10.1016/j.phymed.2016.03.012

210 211 212 213 214 215 216 217 218 219 220 221

JID: PHYMED 4

ARTICLE IN PRESS

[m5G;April 15, 2016;20:4]

D.C.d.O. Nascimento et al. / Phytomedicine xxx (2016) xxx–xxx

Fig. 1. Macrophage cell viability and number of bacterial colony forming units after infection with L. monocytogenes (strain LM619). Peritoneal macrophages were treated with LPPI for 1 h and then infected with LM619 (m.o.i. 10). (A) cell viability was measured as the capacity to reduce resazurin into the resofurin product. (B) the number of viable CFU was measured from macrophage lysates through drop plate methodology cultured in selective Listeria agar. The data represents the average of at least three independent measurements. ∗ Significant difference in comparison to macrophages stimulated with Albumin (ALB) (P < 0.05).

222 223 224 225 226 227 228 229 230 231 232 233

cell viability (Fig. 1B) (P < 0.05). In vitro antimicrobial activity assays confirmed that LP and LPPI were not inhibitory against LM619 at concentrations ranging from 0.0019 to 10 0 0 μg/ml. The gene expression of pro-inflammatory cytokines and iNOS was investigated in cell cultures of pMØ treated with LPPI . The results indicated that TNF-α , IL-6 and IL-1β as iNOS mRNA transcripts were up regulated by LPPI in a dose-dependent manner in uninfected pMØ, after exposure for 4 h and 24 h (P < 0.05) (Fig. 2). However, although LPPI treatment increase expression of TNF-α as early as 4 h after infection with LM619 (P < 0.05), the cytokine was down-regulated 24 h post-infection (Fig. 3). In addition, IL-1β mRNA transcripts were produced at similar levels between control and experimen-

tal groups whereas IL-6 was upregulated after infection for 24 h (P < 0.05) (Fig. 3). None transcripts for iNOS were recorded after infection with LM619 for all groups. Due to lack of toxicity and the protection afforded by LPPI against infection with virulent L. monocytogenes in vitro, this protein fraction was used for in vivo experiments. Swiss mice pretreated with a single inoculum of LPPI , 24 h before i.p. challenge with LM619 showed dose-dependent survival rates that reached 80%, while mice that received albumin died 1–3 days after infection (Fig. 4) (P < 0.05). Conversely, similar pretreatment with the entire set of C. procera latex proteins (LP) did not increase survival following infection (Fig. 4). The i.p. inocula with LPPI induced

Please cite this article as: D.C.d.O. Nascimento et al., Latex protein extracts from Calotropis procera with immunomodulatory properties protect against experimental infections with Listeria monocytogenes, Phytomedicine (2016), http://dx.doi.org/10.1016/j.phymed.2016.03.012

234 235 236 237 238 239 240 241 242 243 244 245

JID: PHYMED

ARTICLE IN PRESS

[m5G;April 15, 2016;20:4]

D.C.d.O. Nascimento et al. / Phytomedicine xxx (2016) xxx–xxx

5

Fig. 2. mRNA expression of pro-inflammatory cytokines and iNOS enzyme in peritoneal macrophages treated with LPPI . Comparative real-time PCR results are expressed in fold variation relative to untreated/uninfected macrophages. Lipopolysaccharide (2 μg/ml) was used as technical control. The data represents the average of at least three independent measurements. ∗ P < 0.05 through ANOVA followed by Bonferroni test, comparison between dosages (10 and 100 μg/ml) at the same time period.

246 247 248 249 250 251 252 253 254 255 256 257 258

accumulation of leukocytes in the peritoneal cavity, and increased the number of circulating leukocytes in the bloodstream as early as 4 h after infection (P < 0.05) (Fig. 5). After infection for 24 h, leukocyte migration into the peritoneal cavity was significantly higher in LPPI -treated mice in comparison to control groups (P < 0.05). This was accompanied by a reduction in the number of circulating leukocytes in all animal groups but less intense in mice that received LPPI (P < 0.05) (Fig. 5). The infection caused by LM619 resulted in neutrophilia and lymphopenia 4 h after infection, which was at least partially reversed by treatment with both LP and LPPI (Table 1). No changes were observed in the blood levels of eosinophils, monocytes and basophils of all animal groups (Table 1). After 24 h infection, the number of viable bacteria in the

peritoneal fluid, liver and bloodstream were significantly reduced in LPPI -treated mice (P < 0.05) (Fig. 6). Indeed, LM619 was not detected in the brain of mice pretreated with LPPI , after 4 h and 24 h, whereas the bacterial load reached 103 per g/organ in the brain of the control animals (Fig. 6C). No differences in the bacterial load were observed in spleens of all animal groups after infection (P 0.05).

259 260 261 262 263 264 265

Discussion

266

Early activation of innate immune responses is essential for host survival after infection with L. monocytogenes. Following infection, circulating and resident macrophages release TNF-α and

268

Please cite this article as: D.C.d.O. Nascimento et al., Latex protein extracts from Calotropis procera with immunomodulatory properties protect against experimental infections with Listeria monocytogenes, Phytomedicine (2016), http://dx.doi.org/10.1016/j.phymed.2016.03.012

267 269

ARTICLE IN PRESS

JID: PHYMED 6

[m5G;April 15, 2016;20:4]

D.C.d.O. Nascimento et al. / Phytomedicine xxx (2016) xxx–xxx

Fig. 3. mRNA expression of pro-inflammatory cytokines in LPPI pretreated peritoneal macrophages infected with L. monocytogenes (strain LM619). Comparative real-time PCR results are expressed in fold variation relative to unstimulated/uninfected macrophages. The data represents the average of at least three independent measurements. ∗ P < 0.05, Student t-test, significant difference in comparison to macrophages stimulated with Albumin (ALB). Tabel 1 Leukocyte cell counts in the bloodstream of Swiss mice pretreated with LP or LPPI following infection with L. monocytogenes (strain LM619). Treatment

Total Leukocytes (103 cells/mm3 )

Differential leukocytes count (103 cells/mm3 ) Eosinophils

4h

24 h

∗

Healthy animal Albumin 10 mg/kg LP 10 mg/kg LPPI 10 mg/kg Healthy animal Albumin 10 mg/kg LP 10 mg/kg LPPI 10 mg/kg

2.98 4.30 2.73 5.90 3.01 1.66 1.19 2.40

± ± ± ± ± ± ± ±

0.25 1.54 4.35∗ 3.65∗ 0.87 0.87 0.53 1.14∗

0.39 0.40 0.19 0.42 0.41 0.30 0.10 0.50

± ± ± ± ± ± ± ±

0.39 0.13 0.19 0.42 0.4 0.18 0.10 0.20

Lymphocytes 72.46 50.01 76.06 87.01 68.16 15.93 23.96 36.09

± ± ± ± ± ± ± ±

2.23 1.30 1.44∗ 0.15∗ 2.02 0.96 0.85∗ 0.70∗

Neutrphils 19.60 40.81 15.10 17.62 17.90 9.70 38.68 41.16

± ± ± ± ± ± ± ±

3.01 1.48 1.45∗ 0.12∗ 2.93 1.14 0.81∗ 0.59∗

Monocytes 12.80 8.52 9.46 10.14 11.40 4.20 5.26 4.15

± ± ± ± ± ± ± ±

3.21 0.07 0.09 0.09 2.11 0.18 0.07 0.13

Basophils 0.0 0.30 0.0 0.04 0.0 0.02 0.01 0.20

± ± ± ± ± ± ± ±

0.0 0.30 0.0 0.03 0.0 0.04 0.01 0.20

Significant difference in comparison to mice administered with Albumin (P < 0.05).

Please cite this article as: D.C.d.O. Nascimento et al., Latex protein extracts from Calotropis procera with immunomodulatory properties protect against experimental infections with Listeria monocytogenes, Phytomedicine (2016), http://dx.doi.org/10.1016/j.phymed.2016.03.012

JID: PHYMED

ARTICLE IN PRESS

[m5G;April 15, 2016;20:4]

D.C.d.O. Nascimento et al. / Phytomedicine xxx (2016) xxx–xxx

7

Fig. 4. Survival of Swiss mice pretreated with LPPI from C. procera and infected with Listeria monocytogenes (strain LM619). The control groups received Albumin or the whole set of soluble proteins of C. procera latex (LP). Results are expressed as mean ± SD and data comparison was by Student’s t-test or analyses of variance (ANOVA) followed by the Bonferroni test. ∗ Significant difference in comparison to LP and Albumin animal groups (P < 0.05).

Fig. 5. Total leukocyte cell counts in the bloodstream and peritoneal fluid of LPPI pretreated mice infected with L. monocytogenes (strain LM619). ∗ Significant difference in comparison to Albumin group (ALB) (P < 0.05).

270 271 272 273

IL-12, evoking IFN-γ production by NK cells, an important primary defense response (Tripp et al., 1993). Granulocytes and macrophages impair the proliferation of L. monocytogenes in the liver and spleen, and therefore the oxidative burst and the pro-

duction of nitric oxide (NO) in activated phagocytic cells contributes to bacterial clearance (Conlan and North, 1994). We have shown that treatments with LPPI up-regulates pro-inflammatory cytokines, which are important in leukocyte activation and recruitment. Previously, although LPPI was cytotoxic to different neoplastic cells lines, none toxic effect was recorded against healthy human leukocytes (Oliveira et al., 2007). Accordingly, here we corroborate these findings since toxicity was not noticeable against peritoneal macrophages from Swiss mice. Although TNF-α was down-regulated 24 h post-infection of pMØ with L. monocytogenes strain LM619, we confirmed that LPPI prompted TNF-α at early time points and IL-6 mRNA transcripts 24 h after infection. This enhanced intracellular bacterial killing and reduced the bacterial load by at least 100-fold. However, although the LPPI treatments to uninfected pMØ up-regulated iNOs gene expression, no transcripts were recorded after infection with LM619. It is well known that L. monocytogenes can overcome early immune responses, although the mechanisms are not clear. Gouin et al. (2010), showed that InlC (internalin family) impairs phosphorylation and delays Iκ B degradation often induced by TNF-α , abrogating activation of NF-κ B. The bacteria are also resistant to serum complement, impairing formation of the membrane attachment complex (Brown, 1985). Nevertheless, we assumed that a reduction in the bacterial load in LPPI -treated pMØ was probably due to reactive oxygen species derived from the oxidative burst. Experimental infections carried out in Swiss mice have shown that a single administration with LPPI significantly increased survival after challenge with L. monocytogens LM619. On the other hand, similar treatments with albumin or LP did not protect the animals. This finding indicates that proteolytic peptidases from C. procera latex are not involved with protection against L. monocytogenes. Furthermore, control animals showed piloerection and prostration whereas these clinical symptoms were mild and only observed in some mice of the LPPI -group. The pretreatment with LPPI induced significant accumulation of leukocyte in the bloodstreams as early as 4 h after challenge, and increased migration of leukocytes into the peritoneal cavity, producing a tenfold reduction in the local bacterial load and limiting the spread of L. monocytogenes to several organs. The bacterial load was also reduced in the brain and the liver 24 h after infection; but not in the spleen. Severe bacterial infections usually cause failure of migration of leukocytes to the infectious foci, among other inflammatory disorders, leading to septic shock and death (Benjamim et al., 2002; Alves-Filho et al., 2005). Following intravenous inoculation, L. monocytogenes is captured from the bloodstream by resident

Please cite this article as: D.C.d.O. Nascimento et al., Latex protein extracts from Calotropis procera with immunomodulatory properties protect against experimental infections with Listeria monocytogenes, Phytomedicine (2016), http://dx.doi.org/10.1016/j.phymed.2016.03.012

274 275 276 277 278 279 280 281 282 283 284 285 286 287 288 289 290 291 292 293 294 295 296 297 298 299 300 301 302 303 304 305 306 307 308 309 310 311 312 313 314 315 316 317 318

JID: PHYMED 8

ARTICLE IN PRESS

[m5G;April 15, 2016;20:4]

D.C.d.O. Nascimento et al. / Phytomedicine xxx (2016) xxx–xxx

Fig. 6. Bacterial colony forming units in different organs besides the bloodstream and peritoneal fluid of LPPI pretreated mice infected with L. monocytogenes (strain LM619). ∗ Significant difference in comparison to Albumin animal group (ALB) (P < 0.05).

319 320 321 322 323 324 325 326 327 328 329

macrophages in the spleen and liver Aichele (2003). Immunosuppression after L. monocytogenes infection usually results in increased apoptosis of resident and circulating lymphocytes (Jiang et al., 2003; Henkis et al., 2009). We confirmed that experimental infections with LM619 caused lymphopenia, which was markedly reduced in mice treated with LPPI , 24 h post-infection. Likewise, LPPI induced proliferation of neutrophils in the bloodstream whereas untreated mice showed neutropenia. Recently, Chaudhary et al. (2015) have shown intravenous injection with LPPI is antiedematogenic and normalized the levels of oxidative stress markers with preservation of tissue architec-

ture in comparison to diclofenac. Although the role of mammalian chitinases on inflammation is not clear, chitinase 3-like-1 (CHI3L1) expressed by macrophages increases internalization of intracellular bacteria such as Salmonella (Kawada et al., 2007). Here we have shown that LPPI rich in plant chitinases can positively influence the immune response and potentially mimic mammalian chitinases against intracellular bacterial infections. Since medicinal plants have been used worldwide to treat infections and inflammatory diseases, we conclude that selected bioactive proteins with immunomodulatory properties from the latex of C. procera are interesting tools for prevention of intracellular bacterial infections.

Please cite this article as: D.C.d.O. Nascimento et al., Latex protein extracts from Calotropis procera with immunomodulatory properties protect against experimental infections with Listeria monocytogenes, Phytomedicine (2016), http://dx.doi.org/10.1016/j.phymed.2016.03.012

330 331 332 333 334 335 336 337 338 339 340

ARTICLE IN PRESS

JID: PHYMED

[m5G;April 15, 2016;20:4]

D.C.d.O. Nascimento et al. / Phytomedicine xxx (2016) xxx–xxx

341 342 Q3

343 344

Conflict of interest The authors declare no conflict of interest. Uncited references Agrawal and Konno, 2009, Seiber et al., 1982

345

Acknowledgments

346

352

This study was funded by the Brazilian National Research Council (CNPq). The Office to improve the University Personnel (CAPES) granted a doctoral scholarship for the first author Danielle CO Nascimento. This study is part of the consortium Molecular Biotechnology of Plant Latex supported by the RENORBIO, Brazil. We also thank Dr. Maria Helena Ribeiro for the supply of animals used in this study.

353

Supplementary materials

354 355

Supplementary material associated with this article can be found, in the online version, at doi:10.1016/j.phymed.2016.03.012.

356

References

357 358 359 360 361 362 363 364 365 366 367 368 369 370 371 372 373 374 375 376 377 378 379 380 381 382 383 384 385 386 387 388 389 390

Agrawal, A.a., Konno, K., 2009. Latex: A model for understanding mechanisms, ecology, and evolution of plant defense against herbivory. Annu. Rev. Ecol. Evol. Syst. 40, 311–331. Aichele, P., Zinke, J., Grode, L., Schwendener, R.a., Kaufmann, S.H.E., Seiler, P., 2003. Macrophages of the splenic marginal zone are essential for trapping of bloodborne particulate antigen but dispensable for induction of specific T cell responses. J. Immunol. 171, 1148–1155. Alencar, N.M.N., Figueiredo, I.S.T., Vale, M.R., Bitencurt, F.S., Oliveira, J.S., Ribeiro, R.A., Ramos, M.V., 2004. Anti-inflammatory effect of the latex from Calotropis procera in three different experimental models: Peritonitis, paw edema and hemorrhagic cystitis. Planta Med. 70, 1144–1149. Alencar, N.M.N., Oliveira, J.S., Mesquita, R.O., Lima, M.W., Vale, M.R., Etchells, J.P., Freitas, C.D.T., Ramos, M.V., 2006. Pro- and anti-inflammatory activities of the latex from Calotropis procera (Ait.) R.Br. are triggered by compounds fractionated by dialysis. Inflamm. Res. 55, 559–564. Alves-Filho, J.C., Benjamim, C.F., Tavares-Murta, B.M., Cunha, F.Q., 2005. Failure of neutrophil migration toward infectious focus in severe sepsis: a critical event for the outcome of this syndrome. Mem. Inst. Oswaldo Cruz 100 Suppl 223– 226. Arya, S., Kumar, V.L., 2005. Antiinflammatory efficacy of extracts of latex of Calotropis procera against different mediators of inflammation. Mediators Inflamm 2005, 228–232. Benjamim, C.F., Silva, J., Farias Benjamim, C., Santana Silva, J., Bruno Fortes, Z., Aparecida Oliveira, M., Henrique Ferreira, S., Queiroz Cunha, F., 2002. Inhibition of leukocyte rolling by nitric oxide during sepsis leads to reduced migration of active microbicidal neutrophils. Infect. Immun. 70, 3602–3610. Brown, E.J., 1985. Interaction of gram-positive microorganisms with complement. Curr. Top. Microbiol. Immunol. 121, 159–187. Chaudhary, P., de Araújo, V.C., Ramos, M.V., Kumar, V.L, 2015. Antiedematogenic and antioxidant properties of high molecular weight protein sub-fraction of Calotropis procera latex in rat. J. Basic Clin. Pharm. 6, 69–73. Choedon, T., Mathan, G., Arya, S., Kumar, V.L., Kumar, V., 2006. Anticancer and cytotoxic properties of the latex of Calotropis procera in a transgenic mouse model of hepatocellular carcinoma. World J. Gastroenterol. 12, 2517–2522.

347 348 349 350 351

9

Conlan, J.W., North, R.J., 1994. Neutrophils are essential for early anti-Listeria defense in the liver, but not in the spleen or peritoneal cavity, as revealed by a granulocyte-depleting monoclonal antibody. J Exp Med 179, 259–268. Dewan, S., Kumar, S., Kumar, V.L., 20 0 0a. Antipyretic effect of latex of Calotropis procera. Indian J. Pharmacol. 32, 247–252. Dewan, S., Sangraula, H., Kumar, V.L., 20 0 0b. Preliminary studies on the analgesic activity of latex of Calotropris procera. J. Ethnopharmacol. 73, 307–311. Dussault, A.-A., Pouliot, M., 2006. Rapid and simple comparison of messenger RNA levels using real-time PCR. Biol. Proced. Online 8, 1–10. Farrel, B.D., Dussourd, D.E., Mitter, C., 1991. Escalation of plant defense: do latex/resin canals spur plant diversification. Amer. Nat. 138, 881–900. Fouche, G., Cragg, G.M., Pillay, P., Kolesnikova, N., Maharaj, V.J., Senabe, J., 2008. In vitro anticancer screening of South African plants. J. Ethnopharmacol. 119, 455– 461. Freitas, C.D.T., Oliveira, J.S., Miranda, M.R. a, Macedo, N.M.R., Sales, M.P., VillasBoas, L.a., Ramos, M.V., 2007. Enzymatic activities and protein profile of latex from Calotropis procera. Plant Physiol. Biochem. 45, 781–789. Gouin, E., Adib-Conquy, M., Balestrino, D., Nahori, M.-A., Villiers, V., Colland, F., Dramsi, S., Dussurget, O., Cossart, P., 2010. The Listeria monocytogenes InlC protein interferes with innate immune responses by targeting the Iκ B kinase subunit IKKα . Proc. Natl. Acad. Sci. U. S. A. 107, 17333–17338. Harty, J.T., Lenz, L.L., Bevan, M.J., 1996. Primary and secondary immune responses to Listeria monocytogenes. Curr. Opin. Immunol. 8, 526–530. Henkin, C.S., Coelho, J.S., Paganella, M.C., Siqueira, R.M., Dias, F.S., 2009. Sepsis: a current view. Sci. Med. 19, 135–145. Hof, H., Nichterlein, T., Kretschmar, M., 1997. Management of listeriosis. Clin. Microbiol. Rev. 10, 345–357. Horobin, R.W., 2011. How Romanowsky stains work and why they remain valuable including a proposed universal Romanowsky staining mechanism and a rational troubleshooting scheme. Biotech. Histochem. 86, 36–51. Jiang, J., Lau, L.L., Shen, H., 2003. Selective depletion of nonspecific T cells during the early stage of immune responses to infection. J. Immunol. 171, 4352–4358. Kakkar, A., Verma, D.R., Suryavanshi, S., Dubey, P., 2012. Characterization of chemical constituents of Calotropis procera. Chem. Nat. Compd. 48, 155–157. Kawada, M., Hachiya, Y., Arihiro, A., Mizoguchi, E., 2007. Role of mammalian chitinases in inflammatory conditions. Keio J. Med. 56, 21–27. Konno, K., 2011. Plant latex and other exudates as plant defense systems: roles of various defense chemicals and proteins contained therein. Phytochemistry 72, 1510–1530. Lima-Filho, J.V., Patriota, J.M., Silva, A.F.B., Filho, N.T., Oliveira, R.S.B., Alencar, N.M.N., Ramos, M.V., 2010. Proteins from latex of Calotropis procera prevent septic shock due to lethal infection by Salmonella enterica serovar Typhimurium. J. Ethnopharmacol. 129, 327–334. Oliveira, J.S., Pereira Bezerra, D., Teixeira de Freitas, C.D., Delano Barreto Marinho Filho, J., Odorico de Moraes, M., Pessoa, C., Costa-Lotufo, L.V., Ramos, M.V., 2007. In vitro cytotoxicity against different human cancer cell lines of laticifer proteins of Calotropis procera (Ait.). R. Br. Toxicol. in Vitro 21, 1563–1573. Oliveira, R.S.B., Figueiredo, I.S.T., Freitas, L.B.N., Pinheiro, R.S.P., Brito, G.A.C., Alencar, N.M.N., Ramos, M.V., Ralph, M.T., Lima-Filho, J.V., 2012. Inflammation induced by phytomodulatory proteins from the latex of Calotropis procera (Asclepiadaceae) protects against Salmonella infection in a murine model of typhoid fever. Inflamm. Res. 61, 689–698. Ray, A., Dittel, B.N., 2010. Isolation of mouse peritoneal cavity cells. J. Vis. Exp. 28, 1488. Ramos, M. V, Oliveira, J.S., Figueiredo, J.G., Figueiredo, I.S.T., Kumar, V.L., Bitencourt, F.S., Cunha, F.Q., Oliveira, R.S.B., Bomfim, L.R., Vitor Lima-Filho, J., Alencar, N.M.N., 2009. Involvement of NO in the inhibitory effect of Calotropis procera latex protein fractions on leukocyte rolling, adhesion and infiltration in rat peritonitis model. J. Ethnopharmacol. 125, 387–392. Seiber, J.N., Nelson, C.J., Mark Lee, S., 1982. Cardenolides in the latex leaves of seven Asclepias species and Calotropis procera. Phytochemistry 21, 2343–2348. Tripp, C.S., Wolf, S.F., Unanue, E.R., 1993. Interleukin 12 and tumor necrosis factor alpha are costimulators of interferon gamma production by natural killer cells in severe combined immunodeficiency mice with listeriosis, and interleukin 10 is a physiologic antagonist. P. Natl. Acad. Sci. USA 90, 3725–3729.

Please cite this article as: D.C.d.O. Nascimento et al., Latex protein extracts from Calotropis procera with immunomodulatory properties protect against experimental infections with Listeria monocytogenes, Phytomedicine (2016), http://dx.doi.org/10.1016/j.phymed.2016.03.012

391 392 393 394 395 396 397 398 399 400 401 402 403 404 405 406 407 408 409 410 411 412 413 414 415 416 417 418 419 420 421 422 423 424 425 426 427 428 429 430 431 432 433 434 435 436 437 438 439 440 441 442 443 444 445 446 447 448 449 450 451 452 453 454 455