- Email: [email protected]
Loss of heterozygosity and microsatellite instability on chromosome arm 10q in neuroblastoma
Cancer Genetics and Cytogenetics 174 (2007) 1e8
Loss of heterozygosity and microsatellite instability on chromosome arm 10q in neuroblastoma ´ ngel Pestan˜ad, Ignacio J. Encı´oa, Paula La´zcoza, Jorge Mun˜ozb, Manuel Nistalc, A Javier S. Castresanab,* a Department of Health Sciences, Public University of Navarra, 31006 Pamplona, Spain Molecular Neuro-Oncology Laboratory, University of Navarra, Irunlarrea 1, 31008 Pamplona, Spain c Department of Pathology, La Paz Hospital, Paseo de la Castellana 261, 28046 Madrid, Spain d Institute for Biomedical Research, CSIC-UAM, C/Arturo Duperier 4, 28029 Madrid, Spain
b
Received 21 June 2006; received in revised form 31 July 2006; accepted 7 August 2006
Abstract
Tumor suppressor genes can be inactivated by various mechanisms, including promoter hypermethylation and loss of heterozygosity. We screened the 10q locus for loss of heterozygosity and the promoter methylation status of PTEN, MGMT, MXI1, and FGFR2 in neuroblastic tumors and neuroblastoma cell lines. Expression of these genes in cell lines was analyzed with reverse transcriptaseepolymerase chain reaction. Loss of heterozygosity at 10q was detected in 18% of tumors and microsatellite instability in 14%. Promoter hypermethylation of MGMT appeared in 8% of tumors and 25% of cell lines. Correlation between methylation status and lack of expression was evident for PTEN, FGFR2, and MXI1 and was less clear for MGMT. No associations between these alterations and MYCN amplification, 1p deletion, or aggressive tumor histology could be demonstrated, singly or in combination. These data suggest that 10q alterations might be implicated in the development of a small number of neuroblastomas. Ó 2007 Elsevier Inc. All rights reserved.
1. Introduction Neuroblastic tumors are the most frequently occurring solid extracranial tumors during childhood. Apart from spontaneous regression in patients less than 12 months old, the full clinical spectrum of these tumors includes a very aggressive behavior and unresponsiveness to treatment. Most pediatric cancer deaths under 5 year of age are due to neuroblastoma. Depending on their schwannian stroma component, these tumors are classified as neuroblastoma, nodular or intermixed ganglioneuroblastoma, or ganglioneuroma. The genetic alterations most frequently found in neuroblastoma are gain of 17q, loss of heterozygosity (LOH) at 11q, MYCN amplification, and 1p36 allelic loss. Other alterations described include gains of 4q, 6p, 7q, 11q, and 18q; amplification of MDM2 and MYCL genes; allelic losses at 14q, and 10q [1e3]. A high frequency of LOH at 10q has been described in tumors such as glioblastoma [4], melanoma [5], prostate [6], and endometrium cancer [7]. Loss of heterozygosity
* Corresponding author. Tel.: þ34-948-425600; fax: þ34-948-425652. E-mail address: [email protected] (J.S. Castresana). 0165-4608/07/$ e see front matter Ó 2007 Elsevier Inc. All rights reserved. doi:10.1016/j.cancergencyto.2006.08.014
at 10q is the most frequent genetic alteration in glioblastomas, occurring in approximately 80% of cases [8]. LOH at 10q25~qter has even been described in familial neuroblastomas [9]. These data suggest that alterations of tumor suppressor genes located within this region may be important in neuroblastoma tumorigenesis and progression. Cancerrelated genes located at 10q include PTEN, DMBT1, MGMT, FGFR2, and MXI1. The phosphatase and tensin homolog (mutated in multiple advanced cancers 1) gene (PTEN ) on chromosome 10 was described in 1997 by three independent groups [9e11]. Located at 10q23.3, PTEN codes for a phospholipid phosphatase with high homology to the cytoskeletal proteins tensin and auxilin in their N-termini [11]. This protein suppresses growth and cell proliferation through the Akt/ PKB pathway [12,13] and promotes cell cycle stop and apoptosis [14]. Moreover, PTEN has been related to metastasis (overexpression of PTEN inhibited cell migration, whereas antisense PTEN enhanced migration) [15], inhibition of angiogenesis [16], and to good responsiveness to chemotherapeutic treatments [17]. PTEN mutations after LOH at 10q have been reported in various tumors, including glioblastoma [18], prostate [19] and endometrial cancer [20].
2
P. La´zcoz et al. / Cancer Genetics and Cytogenetics 174 (2007) 1e8
The deleted in malignant brain tumors 1 gene (DMBT1), located at 10q25.3~26.1, is a member of the scavenger receptor cysteine-rich (SRCR) protein family [21] described in 1997 by Mollenhauer et al. [22]. DMBT1 homozygous deletions have been detected in medulloblastoma [22], oligodendroglioma [23], and lung and gastrointestinal cancers [24,25]. Allelic losses of microsatellite markers flanking this gene locus have been described in various tumors, including prostate cancer [6] and glioblastoma [26,27]. The O6-methylguanine-DNA methyltransferase gene (MGMT ), located at 10q26.1, codes for a protein implicated in DNA repair, one that specifically removes promutagenic alkyl groups from the O6 position of guanine. MGMT inactivation produces mutationsdin particular, G:C/A:T transitions. Promoter methylation of this gene in glioblastomas has been associated with increased frequency of G:C/A:T TP53 mutations [28]. The fibroblast growth factor receptor 2 gene (FGFR2) belongs to a gene family that codes for tyrosine kinase receptors. These proteins are implicated in cell proliferation, differentiation, and migration, and also apoptosis inhibition. FGFR2, located at 10q26, has 22 exons and is the biggest gene of the FGFR gene family [29e32]. Amplification and overexpression of FGFR2 in breast tumors [33], and FGFR2 downregulation in prostate cancer [34] have been described. The tumor suppressor gene MAX interactor 1 (MXI1) spans a region of ~60 kb at 10q24~q25 and comprises 6 exons [35]. This gene is a member of the v-myc myelocytomatosis viral oncogene homolog (MYC ) family of transcription factors and codes for a B-HLH-LZ protein [36]. MXI1 allelic losses have been described in glioblastomas [37] and prostate cancer [38]. Our objective was to analyze the possible importance of promoter hypermethylation of PTEN, MGMT, FGFR2, and MXI1 genes and of allelic losses on chromosome arm 10q in neuroblastic tumors.
German Collection of Microorganisms and Cell Cultures (DSMZ, Braunschweig, Germany). All cell lines were grown with Dulbecco’s modified Eagle’s medium supplemented with 10% fetal bovine serum, 2% L-glutamine, and nonessential amino acids (5%), following manufacturer instructions.
2. Materials and methods
2.4. Sodium bisulfite modification
2.1. Samples and cell lines
DNA from the 41 tumors and the 12 cell lines was modified with sodium bisulfite using the CpGenome DNA modification kit (Chemicon, Temecula, CA) according to the manufacturer’s protocol.
Frozen neuroblastic tumors were obtained from Hospital La Paz, Madrid, Spain (n 5 41; 26 neuroblastomas, 12 ganglioneuroblastomas, and 3 ganglioneuromas). DNA isolated from blood samples of 21 patients was used as negative control for LOH analysis. Clinicopathological data included patient age and sex, tumor location, diagnosis, Shimada’s index, and cell proliferation index (Ki67). Twelve neuroblastoma cell lines were also used in methylation and expression analysis. Cell lines SK-N-DZ, SKN-SH, SK-N-Be(2), SK-N-FI, Be(2)C, and MC-IXC were provided by the American Type Culture Collection (ATCC, Manassas, VA) and cell lines IMR-32, Kelly, SIMA, SHSY5Y, SK-N-MC, and MHH-NB-11 were provided by the
2.2. Nucleic acids extraction DNA from frozen tumor specimens was obtained by means of phenolechloroform purification [39]. DNA from cell lines was extracted using the Wizard genomic DNA purification kit (Promega, Madison, WI), according to the manufacturer’s protocol. RNA from cell lines was obtained with the QuickPrep total RNA extraction kit (Amersham Biosciences, Buckinghamshire, UK), according to the manufacturer’s instructions. 2.3. LOH and MSI analysis Blood and tumor DNA from 21 patients were screened for LOH on chromosome arm 10q with the following polymorphic markers: PTENCA (near PTEN ), D10S597, D10S221 (near MXI1), D10S209, D10S587 (near DMBT1), and D10S214 (near MGMT ). Approximately 50 ng of DNA template was amplified in a total volume of 25 mL containing 10 pmol of each primer, 1 unit of Taq DNA polymerase (BioTaq; Bioline, London, UK), 2 mmol/L MgCl2, 10 reaction buffer, and 0.2 mmol/ L of each dNTP. Reactions were heated at 95 C for 5 minutes, followed by 35 cycles at 94 C for 30 seconds, 60 C (for D10S209 and D10S587) or 61 C (for D10S214, D10S597, and D10S221) or 59 C (for PTENCA) for 30 seconds, and 72 C for 1 minute. A final extension step at 72 C for 10 minutes was applied. After amplification, 17 mL of the polymerase chain reaction (PCR) product was subjected to electrophoresis through a 15% polyacrylamide gel. The DNA bands were visualized after ethidium bromide staining.
2.5. Methylation-specific polymerase chain reaction Methylation-specific polymerase chain reaction (MSP) was used to examine methylation at promoter regions of the PTEN, MGMT, MXI1, and FGFR2 genes. The PCRs were performed in a final volume of 25 mL containing 2e2.5 mmol/L MgCl2, 5e10 pmol each primer, 0.8 mmol/L dNTPs, 5% dimethyl sulfoxide (DMSO), 1 unit of Taq polymerase (AmpliTaq Gold; Applied Biosystems, Foster City, CA), and 60 ng of sodium bisulfite-modified
P. La´zcoz et al. / Cancer Genetics and Cytogenetics 174 (2007) 1e8
3
Table 1 Primers and conditions for methylation-specific polymerase chain reaction Gene PTEN U M MGMT U M FGFR2 U M MXI1 U M
Primer forward (50 e30 )
Primer reverse (50 e30 )
Size, bp
T, C
Cycles
GTGTTGGTGGAGGTAGTTGTTT TTCGTTCGTCGTCGTCGTATTT
ACCACTTAACTCTAAACCACAACCA GCCGCTTAACTCTAAACCGCAACCG
162 206
62 62
38 38
GAGAGATTTGTGTTTTGGGTTTAGTG ATTCGCGTTTCGGGTTTAGC
CCTTCAACCAATACAAACCAAACAA CGACCGATACAAACCGAACG
236 227
62 62
38 38
TGTTTTGAGTTTTTGTAATTTGTGA GCGTTTTGAGTTTTCGTAATTCGC
TAATCCTTAAATCTTCACCAACACC AATAATCCTTAAATCTTCGCCGACG
181 184
54 62
38 35
GGTTGGAGATTTTTTAGTGTTTTGT GTCGGAGATTTTTTAGCGTTTCGT
CAACCTCTAAAACCCAATTACACCAC CTCTAAAACCCGATTACGCCG
238 233
62 62
30e35 30e35
Abbreviations: M, methylated; T, temperature; U, unmethylated.
or unmodified DNA. Annealing temperatures were from 54 C to 62 C. Next, 10 mL of each PCR product was loaded onto a 2.5% agarose gel stained with ethidium bromide (0.1 mL/mL). Primer sequences are described in Table 1. 2.6. RT-PCR One microgram of RNA from each cell line was mixed with 1 mL dNTPs 10 mmol/L, and 1 mL 250 mmol/L random primers in a final volume of 12 mL. The mixture was heated at 65 C for 5 minutes. Then, 4 mL 5 reaction buffer and 2 mL 0.1 mmol/L dithiothreitol were added. The mixture was heated at 42 C for 2 minutes, and incubated with 1 mL of Superscript II RNA reverse transcriptase (Invitrogen Life Technologies, Carlsbad, CA). Samples were heated at 25 C for 10 minutes and at 42 C for 50 minutes. A final step at 70 C for 15 minutes was used. cDNAs were stored at 20 C until their use. Approximately 75 ng of cDNA was amplified in a total volume of 25 mL containing 0.2 mmol/L of each dNTP, 1.5e2.5 mmol/L MgCl2, 10 reaction buffer, 5e10 pmol of each primer, 5% DMSO, and 1 unit of Taq DNA polymerase (AmpliTaq Gold). Primers for MGMT, FGFR2, MXI1, and TFR amplification were designed with Oligo 4.0 software (Molecular Biology Insights [MBI], Hamel, MN). Primers and conditions used for PTEN RT-PCR were as previously described [40] (Table 2). A fragment of the
transferrin receptor gene (TFRC) was amplified as an internal control. 2.7. Statistical analysis Fisher’s exact test was used to screen for any statistical association among LOH and MSI at 10q, promoter hypermethylation of PTEN, MGMT, FGFR2, and MXI1 genes, and clinicopathological data of tumors.
3. Results 3.1. LOH and MSI analysis LOH and MSI were determined with six polymorphic markers (D10S209, D10S214, D10S221, D10S587, D10S597, and PTENCA) located on chromosome arm 10q. We found LOH, MSI, or both at five of the six markers: D10S209, D10S221, D10S587, D10S597, and PTENCA (Table 3; Fig. 1). 3.2. Promoter methylation We studied the promoter methylation status of PTEN, MGMT, FGFR2, and MXI1 in 41 neuroblastic tumors and 12 neuroblastoma cell lines by MSP. We found hypermethylation only at the MGMT promoter, in 8% of tumors
Table 2 Primers and conditions for reverse transcriptaseepolymerase chain reaction Gene PTEN primer 1 primer 2 primer 3 MGMT FGFR2 MXI1 TFR
Primer forward (50 -30 )
Primer reverse (50 -30 )
Size, bp
T, C
Cycles
282 139 136 298
50 62 60 60
40 35 35 30
CTCCAATTCAGGACCCACACGAC AAGTACAGCTTCACCTTAAA CGGGAAGACAAGTTCATGTAC GGGGAAGCTGGAGCTGTCTG TTTAAGCAGGAGCATCGCATTG GGCACACAACACTTGGTTTGC GTCAATGTCCCAAACGTCACCAGA
TCTCCGAATTTCACAACCTTCA ACGTGTGATTGATGGACCCGT AGCTGTTCCAGTCGCCACTTT ATTTCGGGAATGCTGAGAAAACAGACAGA
Abbreviation: T, temperature. PTEN RT-PCR was performed in two steps: first, with primers 1 and 2, and second with primers 3 and 2 (nested PCR).
P. La´zcoz et al. / Cancer Genetics and Cytogenetics 174 (2007) 1e8
4
Table 3 Loss of heterozygosity and microsatellite instability and promoter methylation in neuroblastic tumors LOH/MSI
Methylation
Tumor
Diagnostic
D10S209
D10S214
D10S221
D10S587
D10S597
PTENCA
PTEN
MGMT
FGFR2
MXI1
1 17 94 3 5 7 8 9 10 61 82 83 86 92 107 12 13 14 15 16 18 33 37 34 45 48 51 52 63 64 73 77 85 87 90 91 95 96 97 99 102
GN GN GN GNB GNB GNB GNB GNB GNB GNB GNB GNB GNB GNB GNB NB NB NB NB NB NB NB NB NB NB NB NB NB NB NB NB NB NB NB NB NB NB NB NB NB NB
n.d. n.d. n.d. n.d. n.d. n.d. n.d. n.d. n.d. n.d. n.d. n.d. n.d. n.d. n.d. n.d. n.d. n.d. n.d. n.a. n.a. n.d. MSI n.a. n.d. n.d. n.d. n.d.
n.d. n.d. n.d. n.d. n.d. n.d. n.d. n.d. n.d. n.d. n.d. n.d. n.d. n.d. n.d. n.d. n.d. n.d. n.a. n.a. n.d. n.a. n.d. n.d. n.d. n.d.
n.d. n.d. n.d. n.d. n.d. n.d. n.d. n.d. MSI n.d. n.d. n.d. n.d. n.d. n.d. n.d. n.d. n.d. n.d. n.d. n.a. n.a. n.d. LOH n.a. n.d. n.d. MSI n.d. n.d.
n.d. n.d. n.d. n.d. n.d. n.d. n.d. n.d. n.d. n.d. n.d. n.d. n.d. n.d. n.d. n.d. n.d. n.d. n.d. n.a. n.d. MSI n.a. n.d. n.d. n.d. n.d.
n.d. n.d. n.d. n.d. n.d. n.d. n.d. n.d. n.d. n.d. n.d. n.d. n.d. n.d. n.d. n.d. n.d. n.d. n.d. n.a. n.a. n.d. MSI n.a. n.d. n.d. n.a. n.d. n.d.
n.d. n.d. n.d. n.d. n.d. n.d. n.d. n.d. n.d. n.d. LOH n.d. n.d. n.d. n.d. n.d. n.d. n.d. n.d. n.d. n.a. n.a. n.a. n.d. MSI n.a. n.d. n.d. n.a. n.d. n.d. LOH
n.a. n.a. n.a. n.a. n.a. n.a.
B n.a. n.a. n.a. n.a. n.a. n.a. B B
n.a. n.a. n.a. n.a. n.a. n.a.
n.a. n.a. n.a. n.a. n.a. n.a.
Abbreviations: GN, ganglioneuroma; GNB, ganglioneuroblastoma; LOH, loss of heterozygosity; MSI, microsatellite instability; n.a., not amplified; NB, neuroblastoma; n.d., not determined; B, hemimethylated; , unmethylated, no loss of heterozygosity or microsatellite instability.
and in 3 cell lines: SK-N-SH, SK-N-MC, and IMR-32 (Tables 3 and 4; Fig. 2). 3.3. RT-PCR We analyzed the expression of PTEN, MGMT, FGFR2, and MXI1 genes in 12 neuroblastoma cell lines by semiquantitative RT-PCR. All cell lines expressed those genes (Table 4). 3.4. Statistical analysis Fisher’s exact test did not reveal any significant association between the genetic alterations found in tumor samples and clinicopathological data.
4. Discussion Several tumors present structural alterations on chromosome 10 as their most common genetic event. Moreover, in glioblastomas, oligodendrogliomas, and meningiomas, LOH at 10q is associated with tumor progression and poor prognosis [23,41e44]. Other nonenervous system tumors, such as melanomas and prostate tumors, also show LOH, and some of them MSI, at 10q [6,45]. Allelic losses are frequent in neuroblastic tumors. Loss of chromosome 1p is the most frequent genetic alteration found in these tumors and it, together with MYCN amplification, predicts poor outcome [46]. LOH at 11q has been described in 50% of stage 4 high-risk neuroblastomas without MYCN amplification [47]. Losses on other
P. La´zcoz et al. / Cancer Genetics and Cytogenetics 174 (2007) 1e8
Fig. 1. (A) Loss of heterozygosity at D10S221 polymorphic marker and (B) microsatellite instability at D10S209 polymorphic marker in neuroblastic tumors. Polymerase chain reaction (PCR) products were run in a 15% polyacrylamide gel and visualized after ethidium bromide staining (0.5 mg/mL) Lanes N and T, DNA from peripheral blood and from tumor tissue of the same patient (indicated by sample number). Lane M1: 10-bp DNA ladder; lane M2: 1 kb Plus DNA ladder. Sample number 64 showed both loss of heterozygosity and microsatellite instability.
chromosomal regions (e.g., 14q, 9p, 2q, and 10q) are less frequent, and not all of them are associated with prognosis [47,48]. In the present study, we analyzed LOH and MSI on chromosome arm 10q by using six polymorphic markers in 21 neuroblastic tumors. We found LOH in 18% and MSI in 14% of tumors. Aberrant promoter methylation as a tumor suppressor mechanism of inactivation has been described in several tumors. Methylation of several genes, including MGMT, SLIT2, CD44, CFLAR (alias FLIP), and RASSF1A, has been described in neuroblastomas [49e54]. Moreover, CpG methylation profiles characterize different clinical subgroups and strongly correlate with outcome [55,56]. In the present study, we examined the promoter hypermethylation of PTEN, MGMT, FGFR2, and MXI1 genes in 41
5
neuroblastic tumors and 12 neuroblastoma cell lines. To our knowledge, this report is the first to analyze methylation status of PTEN, FGFR2, and MXI1 in neuroblastic tumors. PTEN inactivation by promoter hypermethylation has been described in various tumors, including lung, endometrial, and gastric carcinomas [57e59]. Whang et al. [60] restored PTEN expression in prostate cancer cell lines by in vitro treatment with the demethylating agent 5-azadeoxycytidine, indicating that PTEN promoter hypermethylation reduces or avoids its expression, at least in this type of tumor. Baeza et al. [61] reported PTEN methylation in 35% of glioblastomas, and in 36% of glioblastoma cell lines. Moritake et al. [62] showed that the PTEN gene is very infrequently mutated in neuroblastomas (only one cell line of the 16 neuroblastoma cell lines and 11 tumors analyzed displayed a mutation, a 1-bp frameshift deletion in exon 7, and an allelic loss in the opposite allele was revealed by a microsatellite analysis). In the present study, we did not find PTEN methylation in any neuroblastic tumor or neuroblastoma cell lines. All neuroblastoma cell lines showed normal levels of PTEN expression. Several tumors, such as leukemias and lymphomas [63], showed lack of expression of the MGMT gene associated with promoter hypermethylation. In nervous system tumors, MGMT hypermethylation has been described in ependymomas, oligodendrogliomas, neurofibromas, neurofibrosarcomas, diffuse astrocytomas, and glioblastomas [64e68]. In neuroblastomas, Bello et al. [69] and Gonza´lez-Go´mez et al. [50] reported MGMT methylation in 29 and 27% of tumors analyzed, respectively. We found promoter hypermethylation of this gene in 8% of tumors and 25% of cell lines, but no cell line showed lack of expression; we did not see a good correlation between promoter methylation and lack of expression. Mutations in the FGFR2 gene are present in several syndromes with craniosynostosis, such as the Pfeiffer, Apert, and Crouzon syndromes [70]. The gene is amplified and
Table 4 Promoter hypermethylation and expression in neuroblastoma cell lines Methylation
Expression
Cell line
PTEN
MGMT
FGFR2
MXI1
PTEN
MGMT
FGFR2
MXI1
Kelly SIMA MCIXC SKNFI SHSY5Y SKNSH SKNMC IMR32 MHHNB11 SKNBe(2) SKNDZ BE(2)C
B B B
þ n.e. þ þ þ þ þ þ þ þ þ þ
þ /þ þ þ þ /þ þ þ þ þ /þ þ
þ þ þ þ þ þ þ þ þ þ þ þ
þ þ þ þ þ þ þ þ þ þ þ þ
Abbreviations: n.e., nonevaluable; B, Hemimethylated; , unmethylated/lack of expression; þ, expression; /þ, low expression.
6
P. La´zcoz et al. / Cancer Genetics and Cytogenetics 174 (2007) 1e8
Pediatrı´a, Madrid, for the V Premio Nutribe´n de Investigacio´n Pedia´trica, and the Fundacio´ Agrupacio´ Mu´tua, Barce´ mbito de la Infancia. lona, for the VI Premio A
References Fig. 2. MGMT promoter hypermethylation in neuroblastic tumors determined by methylation-specific polymerase chain reaction. After bisulfite treatment of tumor genomic DNA, PCR products were run in 2.5% agarose gels stained with 0.1 mg/mL ethidium bromide. Lane M: 1 kb Plus DNA Ladder. Lane 1: DNA obtained from blood of a normal donor (negative control of methylation). Lanes 2e12: DNA from neuroblastic tumors to be tested for MGMT promoter methylation. Lane 13: CpGenome universal methylated DNA (positive control for methylation). Lane 14: water. U, unmethylated; M, methylated.
overexpressed in breast cancer, but downregulated in prostate tumors [33,34]. We analyzed FGFR2 methylation status in 41 neuroblastic tumors and 12 neuroblastoma cell lines, and did not find promoter hypermethylation. All cell lines showed expression of this gene. MXI1 allelic losses have been described in glioblastomas, melanomas, and prostate cancer [37,38,71]. However, mutations of this gene are less frequent in glioblastomas [4]. In a recent study, Kim and Carroll [72] reported the importance of several genes, including MXI1, in MYCN autoregulation in neuroblastomas. They found that the autoregulatory circuit was operative both in single copy MYCN and in amplified cell lines, and that MXI1 was not implicated in this regulation. In the present study, we did not find MXI1 promoter hypermethylation in neuroblastoma tumors and cell lines. Moreover, we did not see reduction of expression in the cell lines. Our results suggest that LOH and MSI on chromosome arm 10q may be responsible for tumorigenesis in only a small percentage of neuroblastic tumors. For that small number of these tumors, however, methylation analysis of PTEN, MGMT, FGFR2, and MXI1 genes revealed that MGMT promoter hypermethylation could be an important genetic alteration. In conclusion, genetic alterations on chromosome arm 10q are not frequent in neuroblastic tumors, although alterations in this region are frequent in other nervous system tumors.
Acknowledgments This research was supported in part by grants from the Departamentos de Salud y de Educacio´n del Gobierno de Navarra, Pamplona; Fondo de Investigacio´n Sanitaria (PI031356), and Ministerio de Ciencia y Tecnologı´a y Fondo Europeo de Desarrollo Regional (BFI2003-08775), Madrid. P.L. received a predoctoral fellowship from the Universidad Pu´blica de Navarra, Pamplona. J.M. was a fellow from the Ministerio de Educacio´n, Cultura y Deporte, Madrid. J.S.C. thanks the Asociacio´n Espan˜ola de
[1] Brodeur G. Neuroblastoma: biological insights into a clinical enigma. Nat Rev Cancer 2003;3:203e16. [2] Schwab M, Shimada H, Joshi V, Brodeur GM. Neuroblastic tumors of adrenal gland and sympathetic nervous system. In: Kleihues P, Cavenee WK, editors. Pathology and genetics of tumors of the nervous system. 2nd ed. World Health Organization classification of tumours. Lyon: IARC Press, 2000. pp. 153e61. [3] van Noesel MM, Versteeg R. Pediatric neuroblastomas: genetic and epigenetic ‘‘Danse Macabre.’’. Gene 2004;325:1e15. [4] Fults D, Pedone CA, Thompson GE, Uchiyama CM, Gumpper KL, Iliev D, Vinson VL, Tavtigian SV, Perry WL 3rd. Microsatellite deletion mapping on chromosome 10q and mutation analysis of MMAC1, FAS, and MXI1 in human glioblastoma multiforme. Int J Oncol 1998;12:905e10. [5] Healy E, Belgaid C, Takata M, Harrison D, Zhu NW, Burd DA, Rigby HS, Matthews JN, Rees JL. Prognostic significance of allelic losses in primary melanoma. Oncogene 1998;16:2213e8. [6] Leube B, Drechsler M, Muhlmann K, Schafer R, Schulz WA, Santourlidis S, Anastasiadis A, Ackermann R, Visakorpi T, Muller W, Royer-Pokora B. Refined mapping of allele loss at chromosome 10q23e26 in prostate cancer. Prostate 2002;50:135e44. [7] Peiffer SL, Herzog TJ, Tribune DJ, Mutch DG, Gersell DJ, Goodfellow PJ. Allelic loss of sequences from the long arm of chromosome 10 and replication errors in endometrial cancers. Cancer Res 1995;55:1922e6. [8] Fujisawa H, Kurrer M, Reis RM, Yonekawa Y, Kleihues P, Ohgaki H. Acquisition of the glioblastoma phenotype during astrocytoma progression is associated with loss of heterozygosity on 10q25-qter. Am J Pathol 1999;155:387e94. [9] Altura RA, Maris JM, Li H, Boyett JM, Brodeur GM, Look AT. Novel regions of chromosomal loss in familial neuroblastoma by comparative genomic hybridization. Genes Chromosomes Cancer 1997;19:176e84. [10] Li DM, Sun H. TEP1, encoded by a candidate tumor suppressor locus, is a novel protein tyrosine phosphatase regulated by transforming growth factor beta. Cancer Res 1997;57:2124e9. [11] Steck PA, Pershouse MA, Jasser SA, Yung WK, Lin H, Ligon AH, Langford LA, Baumgard ML, Hattier T, Davis T, Frye C, Hu R, Swedlund B, Teng DH, Tavtigian SV. Identification of a candidate tumour suppressor gene, MMAC1, at chromosome 10q23.3 that is mutated in multiple advanced cancers. Nat Genet 1997;15:356e62. [12] Maehama T, Dixon JE. The tumor suppressor, PTEN/MMAC1, dephosphorylates the lipid second messenger, phosphatidylinositol 3,4,5-trisphosphate. J Biol Chem 1998;273:13375e8. [13] Myers MP, Pass I, Batty IH, Van der Kaay J, Stolarov JP, Hemmings BA, Wigler MH, Downes CP, Tonks NK. The lipid phosphatase activity of PTEN is critical for its tumor suppressor function. Proc Natl Acad Sci U S A 1998;95:13513e8. [14] Furnari FB, Lin H, Huang HS, Cavenee WK. Growth suppression of glioma cells by PTEN requires a functional phosphatase catalytic domain. Proc Natl Acad Sci U S A 1997;94:12479e84. [15] Tamura M, Gu J, Matsumoto K, Aota S, Parsons R, Yamada KM. Inhibition of cell migration, spreading, and focal adhesions by tumor suppressor PTEN. Science 1998;280:1614e7. [16] Wen S, Stolarov J, Myers MP, Su JD, Wigler MH, Tonks NK, Durden DL. PTEN controls tumor-induced angiogenesis. Proc Natl Acad Sci U S A 2001;98:4622e7. [17] Kim D, Dan HC, Park S, Yang L, Liu Q, Kaneko S, Ning J, He L, Yang H, Sun M, Nicosia SV, Cheng JQ. AKT/PKB signaling
P. La´zcoz et al. / Cancer Genetics and Cytogenetics 174 (2007) 1e8
[18]
[19]
[20] [21]
[22]
[23]
[24]
[25]
[26]
[27]
[28]
[29] [30]
[31] [32]
[33]
[34]
[35] [36]
mechanisms in cancer and chemoresistance. Front Biosci 2005;10: 975e84. Bostrom J, Cobbers JM, Wolter M, Tabatabai G, Weber RG, Lichter P, Collins VP, Reifenberger G. Mutation of the PTEN (MMAC1) tumor suppressor gene in a subset of glioblastomas but not in meningiomas with loss of chromosome arm 10q. Cancer Res 1998;58:29e33. Teng DH, Hu R, Lin H, Davis T, Iliev D, Frye C, Swedlund B, Hansen KL, Vinson VL, Gumpper KL, Ellis L, El-Naggar A, Frazier M, Jasser S, Langford LA, Lee J, Mills GB, Pershouse MA, Pollack RE, Tornos C, Troncoso P, Yung WK, Fujii G, Berson A, Steck PA. MMAC1/PTEN mutations in primary tumor specimens and tumor cell lines. Cancer Res 1997;57:5221e5. Risinger JI, Hayes AK, Berchuck A, Barrett JC. PTEN/MMAC1 mutations in endometrial cancers. Cancer Res 1997;57:4736e8. Resnick D, Pearson A, Krieger M. The SRCR superfamily: a family reminiscent of the Ig superfamily. Trends Biochem Sci 1994;19: 5e8. Mollenhauer J, Wiemann S, Scheurlen W, Korn B, Hayashi Y, Wilgenbus KK, von Deimling A, Poustka A. DMBT1, a new member of the SRCR superfamily, on chromosome 10q25.3-26.1 is deleted in malignant brain tumours. Nat Genet 1997;17:32e9. Sanson M, Leuraud P, Aguirre-Cruz L, He J, Marie Y, CartalatCarel S, Mokhtari K, Duffau H, Delattre JY, Hoang-Xuan K. Analysis of loss of chromosome 10q, DMBT1 homozygous deletions, and PTEN mutations in oligodendrogliomas. J Neurosurg 2002;97: 1397e401. Mori M, Shiraishi T, Tanaka S, Yamagata M, Mafune K, Tanaka Y, Ueo H, Barnard GF, Sugimachi K. Lack of DMBT1 expression in oesophageal, gastric and colon cancers. Br J Cancer 1999;79:211e3. Wu W, Kemp BL, Proctor ML, Gazdar AF, Minna JD, Hong WK, Mao L. Expression of DMBT1, a candidate tumor suppressor gene, is frequently lost in lung cancer. Cancer Res 1999;59:1846e51. Somerville RP, Shoshan Y, Eng C, Barnett G, Miller D, Cowell JK. Molecular analysis of two putative tumour suppressor genes, PTEN and DMBT, which have been implicated in glioblastoma multiforme disease progression. Oncogene 1998;17:1755e7. Lin H, Bondy ML, Langford LA, Hess KR, Delclos GL, Wu X, Chan W, Pershouse MA, Yung WK, Steck PA. Allelic deletion analyses of MMAC/PTEN and DMBT1 loci in gliomas: relationship to prognostic significance. Clin Cancer Res 1998;4:2447e54. Nakamura M, Watanabe T, Yonekawa Y, Kleihues P, Ohgaki H. Promoter methylation of the DNA repair gene MGMT in astrocytomas is frequently associated with G:C/A:T mutations of the TP53 tumor suppressor gene. Carcinogenesis 2001;22:1715e9. Klint P, Claesson-Welsh L. Signal transduction by fibroblast growth factor receptors. Front Biosci 1999;4:D165e77. Klint P, Kanda S, Kloog Y, Claesson-Welsh L. Contribution of Src and Ras pathways in FGF-2 induced endothelial cell differentiation. Oncogene 1999;18:3354e64. Powers CJ, McLeskey SW, Wellstein A. Fibroblast growth factors, their receptors and signaling. Endocr Relat Cancer 2000;7:165e97. Katoh M. FGFR2 and WDR11 are neighboring oncogene and tumor suppressor gene on human chromosome 10q26. Int J Oncol 2003;22: 1155e9. Moffa AB, Tannheimer SL, Ethier SP. Transforming potential of alternatively spliced variants of fibroblast growth factor receptor 2 in human mammary epithelial cells. Mol Cancer Res 2004;2: 643e52. Yasumoto H, Matsubara A, Mutaguchi K, Usui T, McKeehan WL. Restoration of fibroblast growth factor receptor 2 suppresses growth and tumorigenicity of malignant human prostate carcinoma PC-3 cells. Prostate 2004;61:236e42. Wechsler DS, Shelly CA, Dang CV. Genomic organization of human MXI1, a putative tumor suppressor gene. Genomics 1996;32:466e70. Lee TC, Ziff EB. Mxi1 is a repressor of the c-myc promoter and reverses activation by USF. J Biol Chem 1999;274:595e606.
7
[37] Albarosa R, DiDonato S, Finocchiaro G. Redefinition of the coding sequence of the MXI1 gene and identification of a polymorphic repeat in the 30 non-coding region that allows the detection of loss of heterozygosity of chromosome 10q25 in glioblastomas. Hum Genet 1995;95:709e11. [38] Prochownik EV, Eagle Grove L, Deubler D, Zhu XL, Stephenson RA, Rohr LR, Yin X, Brothman AR. Commonly occurring loss and mutation of the MXI1 gene in prostate cancer. Genes Chromosomes Cancer 1998;22:295e304. [39] Sambrook J, Russell DW. Molecular cloning: a laboratory manual. 3rd edition. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press, 2001. [40] Taniyama K, Goodison S, Ito R, Bookstein R, Miyoshi N, Tahara E, Tarin D, Urquidi V. PTEN expression is maintained in sporadic colorectal tumours. J Pathol 2001;194:341e8. [41] Ohgaki H, Dessen P, Jourde B, Horstmann S, Nishikawa T, Di Patre PL, Burkhard C, Schuler D, Probst-Hensch NM, Maiorka PC, Baeza N, Pisani P, Yonekawa Y, Yasargil MG, Lutolf UM, Kleihues P. Genetic pathways to glioblastoma: a population-based study. Cancer Res 2004;64:6892e9. [42] Daido S, Takao S, Tamiya T, Ono Y, Terada K, Ito S, Ouchida M, Date I, Ohmoto T, Shimizu K. Loss of heterozygosity on chromosome 10q associated with malignancy and prognosis in astrocytic tumors, and discovery of novel loss regions. Oncol Rep 2004;12: 789e95. [43] Leuraud P, Dezamis E, Aguirre-Cruz L, Taillibert S, Lejeune J, Robin E, Mokhtari K, Boch AL, Cornu P, Delattre JY, Sanson M. Prognostic value of allelic losses and telomerase activity in meningiomas. J Neurosurg 2004;100:303e9. [44] Thiessen B, Maguire JA, McNeil K, Huntsman D, Martin MA, Horsman D. Loss of heterozygosity for loci on chromosome arms 1p and 10q in oligodendroglial tumors: relationship to outcome and chemosensitivity. J Neurooncol 2003;64:271e8. [45] Hussein MR, Sun M, Roggero E, Sudilovsky EC, Tuthill RJ, Wood GS, Sudilovsky O. Loss of heterozygosity, microsatellite instability, and mismatch repair protein alterations in the radial growth phase of cutaneous malignant melanomas. Mol Carcinog 2002;34: 35e44. [46] Grosfeld JL. Risk-based management of solid tumors in children. Am J Surg 2000;180:322e7. [47] Mora J, Cheung NK, Kushner BH, LaQuaglia MP, Kramer K, Fazzari M, Heller G, Chen L, Gerald WL. Clinical categories of neuroblastoma are associated with different patterns of loss of heterozygosity on chromosome arm 1p. J Mol Diagn 2000;2:37e46. [48] Westermann F, Schwab M. Genetic parameters of neuroblastomas. Cancer Lett 2002;184:127e47. [49] Agathanggelou A, Dallol A, Zochbauer-Muller S, Morrissey C, Honorio S, Hesson L, Martinsson T, Fong KM, Kuo MJ, Yuen PW, Maher ER, Minna JD, Latif F. Epigenetic inactivation of the candidate 3p21.3 suppressor gene BLU in human cancers. Oncogene 2003;22:1580e8. [50] Gonzalez-Gomez P, Bello MJ, Lomas J, Arjona D, Alonso ME, Aminoso C, Lopez-Marin I, Anselmo NP, Sarasa JL, Gutierrez M, Casartelli C, Rey JA. Aberrant methylation of multiple genes in neuroblastic tumours. relationship with MYCN amplification and allelic status at 1p. Eur J Cancer 2003;39:1478e85. [51] Yang Q, Zage P, Kagan D, Tian Y, Seshadri R, Salwen HR, Liu S, Chlenski A, Cohn SL. Association of epigenetic inactivation of RASSF1A with poor outcome in human neuroblastoma. Clin Cancer Res 2004;10:8493e500. [52] Yan P, Muhlethaler A, Bourloud KB, Beck MN, Gross N. Hypermethylation-mediated regulation of CD44 gene expression in human neuroblastoma. Genes Chromosomes Cancer 2003;36:129e38. [53] Astuti D, Da Silva NF, Dallol A, Gentle D, Martinsson T, Kogner P, Grundy R, Kishida T, Yao M, Latif F, Maher ER. SLIT2 promoter methylation analysis in neuroblastoma, Wilms’ tumour and renal cell carcinoma. Br J Cancer 2004;90:515e21.
8
P. La´zcoz et al. / Cancer Genetics and Cytogenetics 174 (2007) 1e8
[54] van Noesel MM, van Bezouw S, Voute PA, Herman JG, Pieters R, Versteeg R. Clustering of hypermethylated genes in neuroblastoma. Genes Chromosomes Cancer 2003;38:226e33. [55] Banelli B, Gelvi I, Di Vinci A, Scaruffi P, Casciano I, Allemanni G, Bonassi S, Tonini GP, Romani M. Distinct CpG methylation profiles characterize different clinical groups of neuroblastic tumors. Oncogene 2005;24:5619e28. [56] Abe M, Ohira M, Kaneda A, Yagi Y, Yamamoto S, Kitano Y, Takato T, Nakagawara A, Ushijima T. CpG island methylator phenotype is a strong determinant of poor prognosis in neuroblastomas. Cancer Res 2005;65:828e34. [57] Kang YH, Lee HS, Kim WH. Promoter methylation and silencing of PTEN in gastric carcinoma. Lab Invest 2002;82:285e91. [58] Salvesen HB, MacDonald N, Ryan A, Jacobs IJ, Lynch ED, Akslen LA, Das S. PTEN methylation is associated with advanced stage and microsatellite instability in endometrial carcinoma. Int J Cancer 2001;91:22e6. [59] Soria JC, Lee HY, Lee JI, Wang L, Issa JP, Kemp BL, Liu DD, Kurie JM, Mao L, Khuri FR. Lack of PTEN expression in non-small cell lung cancer could be related to promoter methylation. Clin Cancer Res 2002;8:1178e84. [60] Whang YE, Wu X, Suzuki H, Reiter RE, Tran C, Vessella RL, Said JW, Isaacs WB, Sawyers CL. Inactivation of the tumor suppressor PTEN/MMAC1 in advanced human prostate cancer through loss of expression. Proc Natl Acad Sci U S A 1998;95:5246e50. [61] Baeza N, Weller M, Yonekawa Y, Kleihues P, Ohgaki H. PTEN methylation and expression in glioblastomas. Acta Neuropathol (Berl) 2003;106:479e85. [62] Moritake H, Horii Y, Kuroda H, Sugimoto T. Analysis of PTEN/ MMAC1 alteration in neuroblastoma. Cancer Genet Cytogenet 2001;125:151e5. [63] Gallardo F, Esteller M, Pujol RM, Costa C, Estrach T, Servitje O. Methylation status of the p15, p16 and MGMT promoter genes in primary cutaneous T-cell lymphomas. Haematologica 2004;89:1401e3. [64] Esteller M, Garcia-Foncillas J, Andion E, Goodman SN, Hidalgo OF, Vanaclocha V, Baylin SB, Herman JG. Inactivation of the DNA-
[65]
[66]
[67]
[68]
[69]
[70]
[71]
[72]
repair gene MGMT and the clinical response of gliomas to alkylating agents. N Engl J Med 2000;343:1350e4. Alonso ME, Bello MJ, Gonzalez-Gomez P, Arjona D, Lomas J, de Campos JM, Isla A, Sarasa JL, Rey JA. Aberrant promoter methylation of multiple genes in oligodendrogliomas and ependymomas. Cancer Genet Cytogenet 2003;144:134e42. Gonzalez-Gomez P, Bello MJ, Arjona D, Alonso ME, Lomas J, De Campos JM, Kusak ME, Gutierrez M, Sarasa JL, Rey JA. Aberrant CpG island methylation in neurofibromas and neurofibrosarcomas. Oncol Rep 2003;10:1519e23. Komine C, Watanabe T, Katayama Y, Yoshino A, Yokoyama T, Fukushima T. Promoter hypermethylation of the DNA repair gene O6-methylguanine-DNA methyltransferase is an independent predictor of shortened progression free survival in patients with low-grade diffuse astrocytomas. Brain Pathol 2003;13:176e84. Esteller M, Hamilton SR, Burger PC, Baylin SB, Herman JG. Inactivation of the DNA repair gene O6-methylguanine-DNA methyltransferase by promoter hypermethylation is a common event in primary human neoplasia. Cancer Res 1999;59:793e7. Bello MJ, Alonso ME, Aminoso C, Anselmo NP, Arjona D, Gonzalez-Gomez P, Lopez-Marin I, de Campos JM, Gutierrez M, Isla A, Kusak ME, Lassaletta L, Sarasa JL, Vaquero J, Casartelli C, Rey JA. Hypermethylation of the DNA repair gene MGMT: association with TP53 G:C to A:T transitions in a series of 469 nervous system tumors. Mutat Res 2004;554:23e32. Lapunzina P, Fernandez A, Sanchez Romero JM, Delicado A, Saenz de Pipaon M, Lopez Pajares I, Molano J. A novel insertion in the FGFR2 gene in a patient with Crouzon phenotype and sacrococcygeal tail. Birth Defects Res A Clin Mol Teratol 2005;73: 61e4. Ariyanayagam-Baksh SM, Baksh FK, Swalsky PA, Finkelstein SD. Loss of heterozygosity in the MXI1 gene is a frequent occurrence in melanoma. Mod Pathol 2003;16:992e5. Kim MK, Carroll WL. Autoregulation of the N-myc gene is operative in neuroblastoma and involves histone deacetylase 2. Cancer 2004;101:2106e15.
Loss of heterozygosity and microsatellite instability on chromosome arm 10q in neuroblastoma ´ ngel Pestan˜ad, Ignacio J. Encı´oa, Paula La´zcoza, Jorge Mun˜ozb, Manuel Nistalc, A Javier S. Castresanab,* a Department of Health Sciences, Public University of Navarra, 31006 Pamplona, Spain Molecular Neuro-Oncology Laboratory, University of Navarra, Irunlarrea 1, 31008 Pamplona, Spain c Department of Pathology, La Paz Hospital, Paseo de la Castellana 261, 28046 Madrid, Spain d Institute for Biomedical Research, CSIC-UAM, C/Arturo Duperier 4, 28029 Madrid, Spain
b
Received 21 June 2006; received in revised form 31 July 2006; accepted 7 August 2006
Abstract
Tumor suppressor genes can be inactivated by various mechanisms, including promoter hypermethylation and loss of heterozygosity. We screened the 10q locus for loss of heterozygosity and the promoter methylation status of PTEN, MGMT, MXI1, and FGFR2 in neuroblastic tumors and neuroblastoma cell lines. Expression of these genes in cell lines was analyzed with reverse transcriptaseepolymerase chain reaction. Loss of heterozygosity at 10q was detected in 18% of tumors and microsatellite instability in 14%. Promoter hypermethylation of MGMT appeared in 8% of tumors and 25% of cell lines. Correlation between methylation status and lack of expression was evident for PTEN, FGFR2, and MXI1 and was less clear for MGMT. No associations between these alterations and MYCN amplification, 1p deletion, or aggressive tumor histology could be demonstrated, singly or in combination. These data suggest that 10q alterations might be implicated in the development of a small number of neuroblastomas. Ó 2007 Elsevier Inc. All rights reserved.
1. Introduction Neuroblastic tumors are the most frequently occurring solid extracranial tumors during childhood. Apart from spontaneous regression in patients less than 12 months old, the full clinical spectrum of these tumors includes a very aggressive behavior and unresponsiveness to treatment. Most pediatric cancer deaths under 5 year of age are due to neuroblastoma. Depending on their schwannian stroma component, these tumors are classified as neuroblastoma, nodular or intermixed ganglioneuroblastoma, or ganglioneuroma. The genetic alterations most frequently found in neuroblastoma are gain of 17q, loss of heterozygosity (LOH) at 11q, MYCN amplification, and 1p36 allelic loss. Other alterations described include gains of 4q, 6p, 7q, 11q, and 18q; amplification of MDM2 and MYCL genes; allelic losses at 14q, and 10q [1e3]. A high frequency of LOH at 10q has been described in tumors such as glioblastoma [4], melanoma [5], prostate [6], and endometrium cancer [7]. Loss of heterozygosity
* Corresponding author. Tel.: þ34-948-425600; fax: þ34-948-425652. E-mail address: [email protected] (J.S. Castresana). 0165-4608/07/$ e see front matter Ó 2007 Elsevier Inc. All rights reserved. doi:10.1016/j.cancergencyto.2006.08.014
at 10q is the most frequent genetic alteration in glioblastomas, occurring in approximately 80% of cases [8]. LOH at 10q25~qter has even been described in familial neuroblastomas [9]. These data suggest that alterations of tumor suppressor genes located within this region may be important in neuroblastoma tumorigenesis and progression. Cancerrelated genes located at 10q include PTEN, DMBT1, MGMT, FGFR2, and MXI1. The phosphatase and tensin homolog (mutated in multiple advanced cancers 1) gene (PTEN ) on chromosome 10 was described in 1997 by three independent groups [9e11]. Located at 10q23.3, PTEN codes for a phospholipid phosphatase with high homology to the cytoskeletal proteins tensin and auxilin in their N-termini [11]. This protein suppresses growth and cell proliferation through the Akt/ PKB pathway [12,13] and promotes cell cycle stop and apoptosis [14]. Moreover, PTEN has been related to metastasis (overexpression of PTEN inhibited cell migration, whereas antisense PTEN enhanced migration) [15], inhibition of angiogenesis [16], and to good responsiveness to chemotherapeutic treatments [17]. PTEN mutations after LOH at 10q have been reported in various tumors, including glioblastoma [18], prostate [19] and endometrial cancer [20].
2
P. La´zcoz et al. / Cancer Genetics and Cytogenetics 174 (2007) 1e8
The deleted in malignant brain tumors 1 gene (DMBT1), located at 10q25.3~26.1, is a member of the scavenger receptor cysteine-rich (SRCR) protein family [21] described in 1997 by Mollenhauer et al. [22]. DMBT1 homozygous deletions have been detected in medulloblastoma [22], oligodendroglioma [23], and lung and gastrointestinal cancers [24,25]. Allelic losses of microsatellite markers flanking this gene locus have been described in various tumors, including prostate cancer [6] and glioblastoma [26,27]. The O6-methylguanine-DNA methyltransferase gene (MGMT ), located at 10q26.1, codes for a protein implicated in DNA repair, one that specifically removes promutagenic alkyl groups from the O6 position of guanine. MGMT inactivation produces mutationsdin particular, G:C/A:T transitions. Promoter methylation of this gene in glioblastomas has been associated with increased frequency of G:C/A:T TP53 mutations [28]. The fibroblast growth factor receptor 2 gene (FGFR2) belongs to a gene family that codes for tyrosine kinase receptors. These proteins are implicated in cell proliferation, differentiation, and migration, and also apoptosis inhibition. FGFR2, located at 10q26, has 22 exons and is the biggest gene of the FGFR gene family [29e32]. Amplification and overexpression of FGFR2 in breast tumors [33], and FGFR2 downregulation in prostate cancer [34] have been described. The tumor suppressor gene MAX interactor 1 (MXI1) spans a region of ~60 kb at 10q24~q25 and comprises 6 exons [35]. This gene is a member of the v-myc myelocytomatosis viral oncogene homolog (MYC ) family of transcription factors and codes for a B-HLH-LZ protein [36]. MXI1 allelic losses have been described in glioblastomas [37] and prostate cancer [38]. Our objective was to analyze the possible importance of promoter hypermethylation of PTEN, MGMT, FGFR2, and MXI1 genes and of allelic losses on chromosome arm 10q in neuroblastic tumors.
German Collection of Microorganisms and Cell Cultures (DSMZ, Braunschweig, Germany). All cell lines were grown with Dulbecco’s modified Eagle’s medium supplemented with 10% fetal bovine serum, 2% L-glutamine, and nonessential amino acids (5%), following manufacturer instructions.
2. Materials and methods
2.4. Sodium bisulfite modification
2.1. Samples and cell lines
DNA from the 41 tumors and the 12 cell lines was modified with sodium bisulfite using the CpGenome DNA modification kit (Chemicon, Temecula, CA) according to the manufacturer’s protocol.
Frozen neuroblastic tumors were obtained from Hospital La Paz, Madrid, Spain (n 5 41; 26 neuroblastomas, 12 ganglioneuroblastomas, and 3 ganglioneuromas). DNA isolated from blood samples of 21 patients was used as negative control for LOH analysis. Clinicopathological data included patient age and sex, tumor location, diagnosis, Shimada’s index, and cell proliferation index (Ki67). Twelve neuroblastoma cell lines were also used in methylation and expression analysis. Cell lines SK-N-DZ, SKN-SH, SK-N-Be(2), SK-N-FI, Be(2)C, and MC-IXC were provided by the American Type Culture Collection (ATCC, Manassas, VA) and cell lines IMR-32, Kelly, SIMA, SHSY5Y, SK-N-MC, and MHH-NB-11 were provided by the
2.2. Nucleic acids extraction DNA from frozen tumor specimens was obtained by means of phenolechloroform purification [39]. DNA from cell lines was extracted using the Wizard genomic DNA purification kit (Promega, Madison, WI), according to the manufacturer’s protocol. RNA from cell lines was obtained with the QuickPrep total RNA extraction kit (Amersham Biosciences, Buckinghamshire, UK), according to the manufacturer’s instructions. 2.3. LOH and MSI analysis Blood and tumor DNA from 21 patients were screened for LOH on chromosome arm 10q with the following polymorphic markers: PTENCA (near PTEN ), D10S597, D10S221 (near MXI1), D10S209, D10S587 (near DMBT1), and D10S214 (near MGMT ). Approximately 50 ng of DNA template was amplified in a total volume of 25 mL containing 10 pmol of each primer, 1 unit of Taq DNA polymerase (BioTaq; Bioline, London, UK), 2 mmol/L MgCl2, 10 reaction buffer, and 0.2 mmol/ L of each dNTP. Reactions were heated at 95 C for 5 minutes, followed by 35 cycles at 94 C for 30 seconds, 60 C (for D10S209 and D10S587) or 61 C (for D10S214, D10S597, and D10S221) or 59 C (for PTENCA) for 30 seconds, and 72 C for 1 minute. A final extension step at 72 C for 10 minutes was applied. After amplification, 17 mL of the polymerase chain reaction (PCR) product was subjected to electrophoresis through a 15% polyacrylamide gel. The DNA bands were visualized after ethidium bromide staining.
2.5. Methylation-specific polymerase chain reaction Methylation-specific polymerase chain reaction (MSP) was used to examine methylation at promoter regions of the PTEN, MGMT, MXI1, and FGFR2 genes. The PCRs were performed in a final volume of 25 mL containing 2e2.5 mmol/L MgCl2, 5e10 pmol each primer, 0.8 mmol/L dNTPs, 5% dimethyl sulfoxide (DMSO), 1 unit of Taq polymerase (AmpliTaq Gold; Applied Biosystems, Foster City, CA), and 60 ng of sodium bisulfite-modified
P. La´zcoz et al. / Cancer Genetics and Cytogenetics 174 (2007) 1e8
3
Table 1 Primers and conditions for methylation-specific polymerase chain reaction Gene PTEN U M MGMT U M FGFR2 U M MXI1 U M
Primer forward (50 e30 )
Primer reverse (50 e30 )
Size, bp
T, C
Cycles
GTGTTGGTGGAGGTAGTTGTTT TTCGTTCGTCGTCGTCGTATTT
ACCACTTAACTCTAAACCACAACCA GCCGCTTAACTCTAAACCGCAACCG
162 206
62 62
38 38
GAGAGATTTGTGTTTTGGGTTTAGTG ATTCGCGTTTCGGGTTTAGC
CCTTCAACCAATACAAACCAAACAA CGACCGATACAAACCGAACG
236 227
62 62
38 38
TGTTTTGAGTTTTTGTAATTTGTGA GCGTTTTGAGTTTTCGTAATTCGC
TAATCCTTAAATCTTCACCAACACC AATAATCCTTAAATCTTCGCCGACG
181 184
54 62
38 35
GGTTGGAGATTTTTTAGTGTTTTGT GTCGGAGATTTTTTAGCGTTTCGT
CAACCTCTAAAACCCAATTACACCAC CTCTAAAACCCGATTACGCCG
238 233
62 62
30e35 30e35
Abbreviations: M, methylated; T, temperature; U, unmethylated.
or unmodified DNA. Annealing temperatures were from 54 C to 62 C. Next, 10 mL of each PCR product was loaded onto a 2.5% agarose gel stained with ethidium bromide (0.1 mL/mL). Primer sequences are described in Table 1. 2.6. RT-PCR One microgram of RNA from each cell line was mixed with 1 mL dNTPs 10 mmol/L, and 1 mL 250 mmol/L random primers in a final volume of 12 mL. The mixture was heated at 65 C for 5 minutes. Then, 4 mL 5 reaction buffer and 2 mL 0.1 mmol/L dithiothreitol were added. The mixture was heated at 42 C for 2 minutes, and incubated with 1 mL of Superscript II RNA reverse transcriptase (Invitrogen Life Technologies, Carlsbad, CA). Samples were heated at 25 C for 10 minutes and at 42 C for 50 minutes. A final step at 70 C for 15 minutes was used. cDNAs were stored at 20 C until their use. Approximately 75 ng of cDNA was amplified in a total volume of 25 mL containing 0.2 mmol/L of each dNTP, 1.5e2.5 mmol/L MgCl2, 10 reaction buffer, 5e10 pmol of each primer, 5% DMSO, and 1 unit of Taq DNA polymerase (AmpliTaq Gold). Primers for MGMT, FGFR2, MXI1, and TFR amplification were designed with Oligo 4.0 software (Molecular Biology Insights [MBI], Hamel, MN). Primers and conditions used for PTEN RT-PCR were as previously described [40] (Table 2). A fragment of the
transferrin receptor gene (TFRC) was amplified as an internal control. 2.7. Statistical analysis Fisher’s exact test was used to screen for any statistical association among LOH and MSI at 10q, promoter hypermethylation of PTEN, MGMT, FGFR2, and MXI1 genes, and clinicopathological data of tumors.
3. Results 3.1. LOH and MSI analysis LOH and MSI were determined with six polymorphic markers (D10S209, D10S214, D10S221, D10S587, D10S597, and PTENCA) located on chromosome arm 10q. We found LOH, MSI, or both at five of the six markers: D10S209, D10S221, D10S587, D10S597, and PTENCA (Table 3; Fig. 1). 3.2. Promoter methylation We studied the promoter methylation status of PTEN, MGMT, FGFR2, and MXI1 in 41 neuroblastic tumors and 12 neuroblastoma cell lines by MSP. We found hypermethylation only at the MGMT promoter, in 8% of tumors
Table 2 Primers and conditions for reverse transcriptaseepolymerase chain reaction Gene PTEN primer 1 primer 2 primer 3 MGMT FGFR2 MXI1 TFR
Primer forward (50 -30 )
Primer reverse (50 -30 )
Size, bp
T, C
Cycles
282 139 136 298
50 62 60 60
40 35 35 30
CTCCAATTCAGGACCCACACGAC AAGTACAGCTTCACCTTAAA CGGGAAGACAAGTTCATGTAC GGGGAAGCTGGAGCTGTCTG TTTAAGCAGGAGCATCGCATTG GGCACACAACACTTGGTTTGC GTCAATGTCCCAAACGTCACCAGA
TCTCCGAATTTCACAACCTTCA ACGTGTGATTGATGGACCCGT AGCTGTTCCAGTCGCCACTTT ATTTCGGGAATGCTGAGAAAACAGACAGA
Abbreviation: T, temperature. PTEN RT-PCR was performed in two steps: first, with primers 1 and 2, and second with primers 3 and 2 (nested PCR).
P. La´zcoz et al. / Cancer Genetics and Cytogenetics 174 (2007) 1e8
4
Table 3 Loss of heterozygosity and microsatellite instability and promoter methylation in neuroblastic tumors LOH/MSI
Methylation
Tumor
Diagnostic
D10S209
D10S214
D10S221
D10S587
D10S597
PTENCA
PTEN
MGMT
FGFR2
MXI1
1 17 94 3 5 7 8 9 10 61 82 83 86 92 107 12 13 14 15 16 18 33 37 34 45 48 51 52 63 64 73 77 85 87 90 91 95 96 97 99 102
GN GN GN GNB GNB GNB GNB GNB GNB GNB GNB GNB GNB GNB GNB NB NB NB NB NB NB NB NB NB NB NB NB NB NB NB NB NB NB NB NB NB NB NB NB NB NB
n.d. n.d. n.d. n.d. n.d. n.d. n.d. n.d. n.d. n.d. n.d. n.d. n.d. n.d. n.d. n.d. n.d. n.d. n.d. n.a. n.a. n.d. MSI n.a. n.d. n.d. n.d. n.d.
n.d. n.d. n.d. n.d. n.d. n.d. n.d. n.d. n.d. n.d. n.d. n.d. n.d. n.d. n.d. n.d. n.d. n.d. n.a. n.a. n.d. n.a. n.d. n.d. n.d. n.d.
n.d. n.d. n.d. n.d. n.d. n.d. n.d. n.d. MSI n.d. n.d. n.d. n.d. n.d. n.d. n.d. n.d. n.d. n.d. n.d. n.a. n.a. n.d. LOH n.a. n.d. n.d. MSI n.d. n.d.
n.d. n.d. n.d. n.d. n.d. n.d. n.d. n.d. n.d. n.d. n.d. n.d. n.d. n.d. n.d. n.d. n.d. n.d. n.d. n.a. n.d. MSI n.a. n.d. n.d. n.d. n.d.
n.d. n.d. n.d. n.d. n.d. n.d. n.d. n.d. n.d. n.d. n.d. n.d. n.d. n.d. n.d. n.d. n.d. n.d. n.d. n.a. n.a. n.d. MSI n.a. n.d. n.d. n.a. n.d. n.d.
n.d. n.d. n.d. n.d. n.d. n.d. n.d. n.d. n.d. n.d. LOH n.d. n.d. n.d. n.d. n.d. n.d. n.d. n.d. n.d. n.a. n.a. n.a. n.d. MSI n.a. n.d. n.d. n.a. n.d. n.d. LOH
n.a. n.a. n.a. n.a. n.a. n.a.
B n.a. n.a. n.a. n.a. n.a. n.a. B B
n.a. n.a. n.a. n.a. n.a. n.a.
n.a. n.a. n.a. n.a. n.a. n.a.
Abbreviations: GN, ganglioneuroma; GNB, ganglioneuroblastoma; LOH, loss of heterozygosity; MSI, microsatellite instability; n.a., not amplified; NB, neuroblastoma; n.d., not determined; B, hemimethylated; , unmethylated, no loss of heterozygosity or microsatellite instability.
and in 3 cell lines: SK-N-SH, SK-N-MC, and IMR-32 (Tables 3 and 4; Fig. 2). 3.3. RT-PCR We analyzed the expression of PTEN, MGMT, FGFR2, and MXI1 genes in 12 neuroblastoma cell lines by semiquantitative RT-PCR. All cell lines expressed those genes (Table 4). 3.4. Statistical analysis Fisher’s exact test did not reveal any significant association between the genetic alterations found in tumor samples and clinicopathological data.
4. Discussion Several tumors present structural alterations on chromosome 10 as their most common genetic event. Moreover, in glioblastomas, oligodendrogliomas, and meningiomas, LOH at 10q is associated with tumor progression and poor prognosis [23,41e44]. Other nonenervous system tumors, such as melanomas and prostate tumors, also show LOH, and some of them MSI, at 10q [6,45]. Allelic losses are frequent in neuroblastic tumors. Loss of chromosome 1p is the most frequent genetic alteration found in these tumors and it, together with MYCN amplification, predicts poor outcome [46]. LOH at 11q has been described in 50% of stage 4 high-risk neuroblastomas without MYCN amplification [47]. Losses on other
P. La´zcoz et al. / Cancer Genetics and Cytogenetics 174 (2007) 1e8
Fig. 1. (A) Loss of heterozygosity at D10S221 polymorphic marker and (B) microsatellite instability at D10S209 polymorphic marker in neuroblastic tumors. Polymerase chain reaction (PCR) products were run in a 15% polyacrylamide gel and visualized after ethidium bromide staining (0.5 mg/mL) Lanes N and T, DNA from peripheral blood and from tumor tissue of the same patient (indicated by sample number). Lane M1: 10-bp DNA ladder; lane M2: 1 kb Plus DNA ladder. Sample number 64 showed both loss of heterozygosity and microsatellite instability.
chromosomal regions (e.g., 14q, 9p, 2q, and 10q) are less frequent, and not all of them are associated with prognosis [47,48]. In the present study, we analyzed LOH and MSI on chromosome arm 10q by using six polymorphic markers in 21 neuroblastic tumors. We found LOH in 18% and MSI in 14% of tumors. Aberrant promoter methylation as a tumor suppressor mechanism of inactivation has been described in several tumors. Methylation of several genes, including MGMT, SLIT2, CD44, CFLAR (alias FLIP), and RASSF1A, has been described in neuroblastomas [49e54]. Moreover, CpG methylation profiles characterize different clinical subgroups and strongly correlate with outcome [55,56]. In the present study, we examined the promoter hypermethylation of PTEN, MGMT, FGFR2, and MXI1 genes in 41
5
neuroblastic tumors and 12 neuroblastoma cell lines. To our knowledge, this report is the first to analyze methylation status of PTEN, FGFR2, and MXI1 in neuroblastic tumors. PTEN inactivation by promoter hypermethylation has been described in various tumors, including lung, endometrial, and gastric carcinomas [57e59]. Whang et al. [60] restored PTEN expression in prostate cancer cell lines by in vitro treatment with the demethylating agent 5-azadeoxycytidine, indicating that PTEN promoter hypermethylation reduces or avoids its expression, at least in this type of tumor. Baeza et al. [61] reported PTEN methylation in 35% of glioblastomas, and in 36% of glioblastoma cell lines. Moritake et al. [62] showed that the PTEN gene is very infrequently mutated in neuroblastomas (only one cell line of the 16 neuroblastoma cell lines and 11 tumors analyzed displayed a mutation, a 1-bp frameshift deletion in exon 7, and an allelic loss in the opposite allele was revealed by a microsatellite analysis). In the present study, we did not find PTEN methylation in any neuroblastic tumor or neuroblastoma cell lines. All neuroblastoma cell lines showed normal levels of PTEN expression. Several tumors, such as leukemias and lymphomas [63], showed lack of expression of the MGMT gene associated with promoter hypermethylation. In nervous system tumors, MGMT hypermethylation has been described in ependymomas, oligodendrogliomas, neurofibromas, neurofibrosarcomas, diffuse astrocytomas, and glioblastomas [64e68]. In neuroblastomas, Bello et al. [69] and Gonza´lez-Go´mez et al. [50] reported MGMT methylation in 29 and 27% of tumors analyzed, respectively. We found promoter hypermethylation of this gene in 8% of tumors and 25% of cell lines, but no cell line showed lack of expression; we did not see a good correlation between promoter methylation and lack of expression. Mutations in the FGFR2 gene are present in several syndromes with craniosynostosis, such as the Pfeiffer, Apert, and Crouzon syndromes [70]. The gene is amplified and
Table 4 Promoter hypermethylation and expression in neuroblastoma cell lines Methylation
Expression
Cell line
PTEN
MGMT
FGFR2
MXI1
PTEN
MGMT
FGFR2
MXI1
Kelly SIMA MCIXC SKNFI SHSY5Y SKNSH SKNMC IMR32 MHHNB11 SKNBe(2) SKNDZ BE(2)C
B B B
þ n.e. þ þ þ þ þ þ þ þ þ þ
þ /þ þ þ þ /þ þ þ þ þ /þ þ
þ þ þ þ þ þ þ þ þ þ þ þ
þ þ þ þ þ þ þ þ þ þ þ þ
Abbreviations: n.e., nonevaluable; B, Hemimethylated; , unmethylated/lack of expression; þ, expression; /þ, low expression.
6
P. La´zcoz et al. / Cancer Genetics and Cytogenetics 174 (2007) 1e8
Pediatrı´a, Madrid, for the V Premio Nutribe´n de Investigacio´n Pedia´trica, and the Fundacio´ Agrupacio´ Mu´tua, Barce´ mbito de la Infancia. lona, for the VI Premio A
References Fig. 2. MGMT promoter hypermethylation in neuroblastic tumors determined by methylation-specific polymerase chain reaction. After bisulfite treatment of tumor genomic DNA, PCR products were run in 2.5% agarose gels stained with 0.1 mg/mL ethidium bromide. Lane M: 1 kb Plus DNA Ladder. Lane 1: DNA obtained from blood of a normal donor (negative control of methylation). Lanes 2e12: DNA from neuroblastic tumors to be tested for MGMT promoter methylation. Lane 13: CpGenome universal methylated DNA (positive control for methylation). Lane 14: water. U, unmethylated; M, methylated.
overexpressed in breast cancer, but downregulated in prostate tumors [33,34]. We analyzed FGFR2 methylation status in 41 neuroblastic tumors and 12 neuroblastoma cell lines, and did not find promoter hypermethylation. All cell lines showed expression of this gene. MXI1 allelic losses have been described in glioblastomas, melanomas, and prostate cancer [37,38,71]. However, mutations of this gene are less frequent in glioblastomas [4]. In a recent study, Kim and Carroll [72] reported the importance of several genes, including MXI1, in MYCN autoregulation in neuroblastomas. They found that the autoregulatory circuit was operative both in single copy MYCN and in amplified cell lines, and that MXI1 was not implicated in this regulation. In the present study, we did not find MXI1 promoter hypermethylation in neuroblastoma tumors and cell lines. Moreover, we did not see reduction of expression in the cell lines. Our results suggest that LOH and MSI on chromosome arm 10q may be responsible for tumorigenesis in only a small percentage of neuroblastic tumors. For that small number of these tumors, however, methylation analysis of PTEN, MGMT, FGFR2, and MXI1 genes revealed that MGMT promoter hypermethylation could be an important genetic alteration. In conclusion, genetic alterations on chromosome arm 10q are not frequent in neuroblastic tumors, although alterations in this region are frequent in other nervous system tumors.
Acknowledgments This research was supported in part by grants from the Departamentos de Salud y de Educacio´n del Gobierno de Navarra, Pamplona; Fondo de Investigacio´n Sanitaria (PI031356), and Ministerio de Ciencia y Tecnologı´a y Fondo Europeo de Desarrollo Regional (BFI2003-08775), Madrid. P.L. received a predoctoral fellowship from the Universidad Pu´blica de Navarra, Pamplona. J.M. was a fellow from the Ministerio de Educacio´n, Cultura y Deporte, Madrid. J.S.C. thanks the Asociacio´n Espan˜ola de
[1] Brodeur G. Neuroblastoma: biological insights into a clinical enigma. Nat Rev Cancer 2003;3:203e16. [2] Schwab M, Shimada H, Joshi V, Brodeur GM. Neuroblastic tumors of adrenal gland and sympathetic nervous system. In: Kleihues P, Cavenee WK, editors. Pathology and genetics of tumors of the nervous system. 2nd ed. World Health Organization classification of tumours. Lyon: IARC Press, 2000. pp. 153e61. [3] van Noesel MM, Versteeg R. Pediatric neuroblastomas: genetic and epigenetic ‘‘Danse Macabre.’’. Gene 2004;325:1e15. [4] Fults D, Pedone CA, Thompson GE, Uchiyama CM, Gumpper KL, Iliev D, Vinson VL, Tavtigian SV, Perry WL 3rd. Microsatellite deletion mapping on chromosome 10q and mutation analysis of MMAC1, FAS, and MXI1 in human glioblastoma multiforme. Int J Oncol 1998;12:905e10. [5] Healy E, Belgaid C, Takata M, Harrison D, Zhu NW, Burd DA, Rigby HS, Matthews JN, Rees JL. Prognostic significance of allelic losses in primary melanoma. Oncogene 1998;16:2213e8. [6] Leube B, Drechsler M, Muhlmann K, Schafer R, Schulz WA, Santourlidis S, Anastasiadis A, Ackermann R, Visakorpi T, Muller W, Royer-Pokora B. Refined mapping of allele loss at chromosome 10q23e26 in prostate cancer. Prostate 2002;50:135e44. [7] Peiffer SL, Herzog TJ, Tribune DJ, Mutch DG, Gersell DJ, Goodfellow PJ. Allelic loss of sequences from the long arm of chromosome 10 and replication errors in endometrial cancers. Cancer Res 1995;55:1922e6. [8] Fujisawa H, Kurrer M, Reis RM, Yonekawa Y, Kleihues P, Ohgaki H. Acquisition of the glioblastoma phenotype during astrocytoma progression is associated with loss of heterozygosity on 10q25-qter. Am J Pathol 1999;155:387e94. [9] Altura RA, Maris JM, Li H, Boyett JM, Brodeur GM, Look AT. Novel regions of chromosomal loss in familial neuroblastoma by comparative genomic hybridization. Genes Chromosomes Cancer 1997;19:176e84. [10] Li DM, Sun H. TEP1, encoded by a candidate tumor suppressor locus, is a novel protein tyrosine phosphatase regulated by transforming growth factor beta. Cancer Res 1997;57:2124e9. [11] Steck PA, Pershouse MA, Jasser SA, Yung WK, Lin H, Ligon AH, Langford LA, Baumgard ML, Hattier T, Davis T, Frye C, Hu R, Swedlund B, Teng DH, Tavtigian SV. Identification of a candidate tumour suppressor gene, MMAC1, at chromosome 10q23.3 that is mutated in multiple advanced cancers. Nat Genet 1997;15:356e62. [12] Maehama T, Dixon JE. The tumor suppressor, PTEN/MMAC1, dephosphorylates the lipid second messenger, phosphatidylinositol 3,4,5-trisphosphate. J Biol Chem 1998;273:13375e8. [13] Myers MP, Pass I, Batty IH, Van der Kaay J, Stolarov JP, Hemmings BA, Wigler MH, Downes CP, Tonks NK. The lipid phosphatase activity of PTEN is critical for its tumor suppressor function. Proc Natl Acad Sci U S A 1998;95:13513e8. [14] Furnari FB, Lin H, Huang HS, Cavenee WK. Growth suppression of glioma cells by PTEN requires a functional phosphatase catalytic domain. Proc Natl Acad Sci U S A 1997;94:12479e84. [15] Tamura M, Gu J, Matsumoto K, Aota S, Parsons R, Yamada KM. Inhibition of cell migration, spreading, and focal adhesions by tumor suppressor PTEN. Science 1998;280:1614e7. [16] Wen S, Stolarov J, Myers MP, Su JD, Wigler MH, Tonks NK, Durden DL. PTEN controls tumor-induced angiogenesis. Proc Natl Acad Sci U S A 2001;98:4622e7. [17] Kim D, Dan HC, Park S, Yang L, Liu Q, Kaneko S, Ning J, He L, Yang H, Sun M, Nicosia SV, Cheng JQ. AKT/PKB signaling
P. La´zcoz et al. / Cancer Genetics and Cytogenetics 174 (2007) 1e8
[18]
[19]
[20] [21]
[22]
[23]
[24]
[25]
[26]
[27]
[28]
[29] [30]
[31] [32]
[33]
[34]
[35] [36]
mechanisms in cancer and chemoresistance. Front Biosci 2005;10: 975e84. Bostrom J, Cobbers JM, Wolter M, Tabatabai G, Weber RG, Lichter P, Collins VP, Reifenberger G. Mutation of the PTEN (MMAC1) tumor suppressor gene in a subset of glioblastomas but not in meningiomas with loss of chromosome arm 10q. Cancer Res 1998;58:29e33. Teng DH, Hu R, Lin H, Davis T, Iliev D, Frye C, Swedlund B, Hansen KL, Vinson VL, Gumpper KL, Ellis L, El-Naggar A, Frazier M, Jasser S, Langford LA, Lee J, Mills GB, Pershouse MA, Pollack RE, Tornos C, Troncoso P, Yung WK, Fujii G, Berson A, Steck PA. MMAC1/PTEN mutations in primary tumor specimens and tumor cell lines. Cancer Res 1997;57:5221e5. Risinger JI, Hayes AK, Berchuck A, Barrett JC. PTEN/MMAC1 mutations in endometrial cancers. Cancer Res 1997;57:4736e8. Resnick D, Pearson A, Krieger M. The SRCR superfamily: a family reminiscent of the Ig superfamily. Trends Biochem Sci 1994;19: 5e8. Mollenhauer J, Wiemann S, Scheurlen W, Korn B, Hayashi Y, Wilgenbus KK, von Deimling A, Poustka A. DMBT1, a new member of the SRCR superfamily, on chromosome 10q25.3-26.1 is deleted in malignant brain tumours. Nat Genet 1997;17:32e9. Sanson M, Leuraud P, Aguirre-Cruz L, He J, Marie Y, CartalatCarel S, Mokhtari K, Duffau H, Delattre JY, Hoang-Xuan K. Analysis of loss of chromosome 10q, DMBT1 homozygous deletions, and PTEN mutations in oligodendrogliomas. J Neurosurg 2002;97: 1397e401. Mori M, Shiraishi T, Tanaka S, Yamagata M, Mafune K, Tanaka Y, Ueo H, Barnard GF, Sugimachi K. Lack of DMBT1 expression in oesophageal, gastric and colon cancers. Br J Cancer 1999;79:211e3. Wu W, Kemp BL, Proctor ML, Gazdar AF, Minna JD, Hong WK, Mao L. Expression of DMBT1, a candidate tumor suppressor gene, is frequently lost in lung cancer. Cancer Res 1999;59:1846e51. Somerville RP, Shoshan Y, Eng C, Barnett G, Miller D, Cowell JK. Molecular analysis of two putative tumour suppressor genes, PTEN and DMBT, which have been implicated in glioblastoma multiforme disease progression. Oncogene 1998;17:1755e7. Lin H, Bondy ML, Langford LA, Hess KR, Delclos GL, Wu X, Chan W, Pershouse MA, Yung WK, Steck PA. Allelic deletion analyses of MMAC/PTEN and DMBT1 loci in gliomas: relationship to prognostic significance. Clin Cancer Res 1998;4:2447e54. Nakamura M, Watanabe T, Yonekawa Y, Kleihues P, Ohgaki H. Promoter methylation of the DNA repair gene MGMT in astrocytomas is frequently associated with G:C/A:T mutations of the TP53 tumor suppressor gene. Carcinogenesis 2001;22:1715e9. Klint P, Claesson-Welsh L. Signal transduction by fibroblast growth factor receptors. Front Biosci 1999;4:D165e77. Klint P, Kanda S, Kloog Y, Claesson-Welsh L. Contribution of Src and Ras pathways in FGF-2 induced endothelial cell differentiation. Oncogene 1999;18:3354e64. Powers CJ, McLeskey SW, Wellstein A. Fibroblast growth factors, their receptors and signaling. Endocr Relat Cancer 2000;7:165e97. Katoh M. FGFR2 and WDR11 are neighboring oncogene and tumor suppressor gene on human chromosome 10q26. Int J Oncol 2003;22: 1155e9. Moffa AB, Tannheimer SL, Ethier SP. Transforming potential of alternatively spliced variants of fibroblast growth factor receptor 2 in human mammary epithelial cells. Mol Cancer Res 2004;2: 643e52. Yasumoto H, Matsubara A, Mutaguchi K, Usui T, McKeehan WL. Restoration of fibroblast growth factor receptor 2 suppresses growth and tumorigenicity of malignant human prostate carcinoma PC-3 cells. Prostate 2004;61:236e42. Wechsler DS, Shelly CA, Dang CV. Genomic organization of human MXI1, a putative tumor suppressor gene. Genomics 1996;32:466e70. Lee TC, Ziff EB. Mxi1 is a repressor of the c-myc promoter and reverses activation by USF. J Biol Chem 1999;274:595e606.
7
[37] Albarosa R, DiDonato S, Finocchiaro G. Redefinition of the coding sequence of the MXI1 gene and identification of a polymorphic repeat in the 30 non-coding region that allows the detection of loss of heterozygosity of chromosome 10q25 in glioblastomas. Hum Genet 1995;95:709e11. [38] Prochownik EV, Eagle Grove L, Deubler D, Zhu XL, Stephenson RA, Rohr LR, Yin X, Brothman AR. Commonly occurring loss and mutation of the MXI1 gene in prostate cancer. Genes Chromosomes Cancer 1998;22:295e304. [39] Sambrook J, Russell DW. Molecular cloning: a laboratory manual. 3rd edition. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press, 2001. [40] Taniyama K, Goodison S, Ito R, Bookstein R, Miyoshi N, Tahara E, Tarin D, Urquidi V. PTEN expression is maintained in sporadic colorectal tumours. J Pathol 2001;194:341e8. [41] Ohgaki H, Dessen P, Jourde B, Horstmann S, Nishikawa T, Di Patre PL, Burkhard C, Schuler D, Probst-Hensch NM, Maiorka PC, Baeza N, Pisani P, Yonekawa Y, Yasargil MG, Lutolf UM, Kleihues P. Genetic pathways to glioblastoma: a population-based study. Cancer Res 2004;64:6892e9. [42] Daido S, Takao S, Tamiya T, Ono Y, Terada K, Ito S, Ouchida M, Date I, Ohmoto T, Shimizu K. Loss of heterozygosity on chromosome 10q associated with malignancy and prognosis in astrocytic tumors, and discovery of novel loss regions. Oncol Rep 2004;12: 789e95. [43] Leuraud P, Dezamis E, Aguirre-Cruz L, Taillibert S, Lejeune J, Robin E, Mokhtari K, Boch AL, Cornu P, Delattre JY, Sanson M. Prognostic value of allelic losses and telomerase activity in meningiomas. J Neurosurg 2004;100:303e9. [44] Thiessen B, Maguire JA, McNeil K, Huntsman D, Martin MA, Horsman D. Loss of heterozygosity for loci on chromosome arms 1p and 10q in oligodendroglial tumors: relationship to outcome and chemosensitivity. J Neurooncol 2003;64:271e8. [45] Hussein MR, Sun M, Roggero E, Sudilovsky EC, Tuthill RJ, Wood GS, Sudilovsky O. Loss of heterozygosity, microsatellite instability, and mismatch repair protein alterations in the radial growth phase of cutaneous malignant melanomas. Mol Carcinog 2002;34: 35e44. [46] Grosfeld JL. Risk-based management of solid tumors in children. Am J Surg 2000;180:322e7. [47] Mora J, Cheung NK, Kushner BH, LaQuaglia MP, Kramer K, Fazzari M, Heller G, Chen L, Gerald WL. Clinical categories of neuroblastoma are associated with different patterns of loss of heterozygosity on chromosome arm 1p. J Mol Diagn 2000;2:37e46. [48] Westermann F, Schwab M. Genetic parameters of neuroblastomas. Cancer Lett 2002;184:127e47. [49] Agathanggelou A, Dallol A, Zochbauer-Muller S, Morrissey C, Honorio S, Hesson L, Martinsson T, Fong KM, Kuo MJ, Yuen PW, Maher ER, Minna JD, Latif F. Epigenetic inactivation of the candidate 3p21.3 suppressor gene BLU in human cancers. Oncogene 2003;22:1580e8. [50] Gonzalez-Gomez P, Bello MJ, Lomas J, Arjona D, Alonso ME, Aminoso C, Lopez-Marin I, Anselmo NP, Sarasa JL, Gutierrez M, Casartelli C, Rey JA. Aberrant methylation of multiple genes in neuroblastic tumours. relationship with MYCN amplification and allelic status at 1p. Eur J Cancer 2003;39:1478e85. [51] Yang Q, Zage P, Kagan D, Tian Y, Seshadri R, Salwen HR, Liu S, Chlenski A, Cohn SL. Association of epigenetic inactivation of RASSF1A with poor outcome in human neuroblastoma. Clin Cancer Res 2004;10:8493e500. [52] Yan P, Muhlethaler A, Bourloud KB, Beck MN, Gross N. Hypermethylation-mediated regulation of CD44 gene expression in human neuroblastoma. Genes Chromosomes Cancer 2003;36:129e38. [53] Astuti D, Da Silva NF, Dallol A, Gentle D, Martinsson T, Kogner P, Grundy R, Kishida T, Yao M, Latif F, Maher ER. SLIT2 promoter methylation analysis in neuroblastoma, Wilms’ tumour and renal cell carcinoma. Br J Cancer 2004;90:515e21.
8
P. La´zcoz et al. / Cancer Genetics and Cytogenetics 174 (2007) 1e8
[54] van Noesel MM, van Bezouw S, Voute PA, Herman JG, Pieters R, Versteeg R. Clustering of hypermethylated genes in neuroblastoma. Genes Chromosomes Cancer 2003;38:226e33. [55] Banelli B, Gelvi I, Di Vinci A, Scaruffi P, Casciano I, Allemanni G, Bonassi S, Tonini GP, Romani M. Distinct CpG methylation profiles characterize different clinical groups of neuroblastic tumors. Oncogene 2005;24:5619e28. [56] Abe M, Ohira M, Kaneda A, Yagi Y, Yamamoto S, Kitano Y, Takato T, Nakagawara A, Ushijima T. CpG island methylator phenotype is a strong determinant of poor prognosis in neuroblastomas. Cancer Res 2005;65:828e34. [57] Kang YH, Lee HS, Kim WH. Promoter methylation and silencing of PTEN in gastric carcinoma. Lab Invest 2002;82:285e91. [58] Salvesen HB, MacDonald N, Ryan A, Jacobs IJ, Lynch ED, Akslen LA, Das S. PTEN methylation is associated with advanced stage and microsatellite instability in endometrial carcinoma. Int J Cancer 2001;91:22e6. [59] Soria JC, Lee HY, Lee JI, Wang L, Issa JP, Kemp BL, Liu DD, Kurie JM, Mao L, Khuri FR. Lack of PTEN expression in non-small cell lung cancer could be related to promoter methylation. Clin Cancer Res 2002;8:1178e84. [60] Whang YE, Wu X, Suzuki H, Reiter RE, Tran C, Vessella RL, Said JW, Isaacs WB, Sawyers CL. Inactivation of the tumor suppressor PTEN/MMAC1 in advanced human prostate cancer through loss of expression. Proc Natl Acad Sci U S A 1998;95:5246e50. [61] Baeza N, Weller M, Yonekawa Y, Kleihues P, Ohgaki H. PTEN methylation and expression in glioblastomas. Acta Neuropathol (Berl) 2003;106:479e85. [62] Moritake H, Horii Y, Kuroda H, Sugimoto T. Analysis of PTEN/ MMAC1 alteration in neuroblastoma. Cancer Genet Cytogenet 2001;125:151e5. [63] Gallardo F, Esteller M, Pujol RM, Costa C, Estrach T, Servitje O. Methylation status of the p15, p16 and MGMT promoter genes in primary cutaneous T-cell lymphomas. Haematologica 2004;89:1401e3. [64] Esteller M, Garcia-Foncillas J, Andion E, Goodman SN, Hidalgo OF, Vanaclocha V, Baylin SB, Herman JG. Inactivation of the DNA-
[65]
[66]
[67]
[68]
[69]
[70]
[71]
[72]
repair gene MGMT and the clinical response of gliomas to alkylating agents. N Engl J Med 2000;343:1350e4. Alonso ME, Bello MJ, Gonzalez-Gomez P, Arjona D, Lomas J, de Campos JM, Isla A, Sarasa JL, Rey JA. Aberrant promoter methylation of multiple genes in oligodendrogliomas and ependymomas. Cancer Genet Cytogenet 2003;144:134e42. Gonzalez-Gomez P, Bello MJ, Arjona D, Alonso ME, Lomas J, De Campos JM, Kusak ME, Gutierrez M, Sarasa JL, Rey JA. Aberrant CpG island methylation in neurofibromas and neurofibrosarcomas. Oncol Rep 2003;10:1519e23. Komine C, Watanabe T, Katayama Y, Yoshino A, Yokoyama T, Fukushima T. Promoter hypermethylation of the DNA repair gene O6-methylguanine-DNA methyltransferase is an independent predictor of shortened progression free survival in patients with low-grade diffuse astrocytomas. Brain Pathol 2003;13:176e84. Esteller M, Hamilton SR, Burger PC, Baylin SB, Herman JG. Inactivation of the DNA repair gene O6-methylguanine-DNA methyltransferase by promoter hypermethylation is a common event in primary human neoplasia. Cancer Res 1999;59:793e7. Bello MJ, Alonso ME, Aminoso C, Anselmo NP, Arjona D, Gonzalez-Gomez P, Lopez-Marin I, de Campos JM, Gutierrez M, Isla A, Kusak ME, Lassaletta L, Sarasa JL, Vaquero J, Casartelli C, Rey JA. Hypermethylation of the DNA repair gene MGMT: association with TP53 G:C to A:T transitions in a series of 469 nervous system tumors. Mutat Res 2004;554:23e32. Lapunzina P, Fernandez A, Sanchez Romero JM, Delicado A, Saenz de Pipaon M, Lopez Pajares I, Molano J. A novel insertion in the FGFR2 gene in a patient with Crouzon phenotype and sacrococcygeal tail. Birth Defects Res A Clin Mol Teratol 2005;73: 61e4. Ariyanayagam-Baksh SM, Baksh FK, Swalsky PA, Finkelstein SD. Loss of heterozygosity in the MXI1 gene is a frequent occurrence in melanoma. Mod Pathol 2003;16:992e5. Kim MK, Carroll WL. Autoregulation of the N-myc gene is operative in neuroblastoma and involves histone deacetylase 2. Cancer 2004;101:2106e15.