- Email: [email protected]
Low dose of arsenic trioxide triggers oxidative stress in zebrafish brain: Expression of antioxidant genes
Ecotoxicology and Environmental Safety 107 (2014) 1–8
Contents lists available at ScienceDirect
Ecotoxicology and Environmental Safety journal homepage: www.elsevier.com/locate/ecoenv
Low dose of arsenic trioxide triggers oxidative stress in zebrafish brain: Expression of antioxidant genes Shuvasree Sarkar a, Sandip Mukherjee a, Ansuman Chattopadhyay b, Shelley Bhattacharya a,n a
Environmental Toxicology Laboratory, Department of Zoology, School of Life Science, Visva-Bharati University, Santiniketan, West Bengal 731235, India Radiation Genetics and Chemical Mutagenesis Laboratory, Department of Zoology, School of Life Science, Visva-Bharati University, Santiniketan, West Bengal 731235, India
b
art ic l e i nf o
a b s t r a c t
Article history: Received 17 February 2014 Received in revised form 8 May 2014 Accepted 13 May 2014
Occurrence of arsenic in the aquatic environment of West Bengal (India), Bangladesh and other countries are of immediate environmental concern. In the present study, zebrafish (Danio rerio) was used as a model to investigate oxidative stress related enzyme activities and expression of antioxidant genes in the brain to 50 mg/L arsenic trioxide for 90 days. In treated fish, generation of reactive oxygen species (ROS), malondialdehyde (MDA) and conjugated diene (CD) showed a triphasic response attaining a peak at the end of the exposure. In addition, a gradual increase in GSH level was noted until 60 days and at 90 days, a sudden fall was recorded which heightened arsenic toxicity. However, GSH level does not correlate well with the glutathione reductase (GR) activity. Generation of ROS in zebrafish brain due to As2O3 exposure was further evidenced by significant alteration of glutathione peroxidase (GPx) and catalase (CAT) activity, which converts H2O2 to water and helps in detoxication. Moreover, enhanced mRNA level of nuclear factor (erythroid-derived 2)-like 2 (Nrf2) in As2O3 exposed zebrafish indicates a protective role of Nrf2. kelch-like ECH-associated protein 1 (Keap1), a negative regulator of Nrf2, inversely correlates with the mRNA expression of Nrf2. As2O3 induced toxicity was also validated by the alteration in NRF2 and NRF2 dependent expression of proteins such as heme oxygenase1 (HO1) and NAD(P)H dehydrogenase quinone1 (NQO1). The mRNA expression of glutathione peroxidase (Gpx1), catalase (Cat), manganese superoxide dismutase (Mn-Sod), copper/zinc superoxide dismutase (Cu/Zn Sod) and cytochrome c oxidase1 (Cox1) were also up regulated. The expression of uncoupling protein 2 (Ucp2), an important mitochondrial enzyme was also subdued in arsenic exposed zebrafish. The oxidative stress induced by arsenic also cause reduced mRNA expression of B-cell lymphoma 2 (Bcl2) present in the inner mitochondrial membrane and thereby indicating onset of apoptosis in treated fish. It is concluded that even a low dose of arsenic trioxide is toxic enough to induce significant oxidative stress in zebrafish brain. & 2014 Published by Elsevier Inc.
Keywords: Arsenic trioxide Brain Low dose mRNA expression Oxidative stress Zebrafish
1. Introduction Arsenic (As) is ranked among the top ten hazardous substances by the Agency for Toxic Substances and Disease Registry (ATSDR, 2007). Exposure to arsenic is of particular interest because of its extensive global impact (IARC, 1987) as a wide spread pollutant (Flora et al., 2005). In India and Bangladesh, millions of people are exposed to arsenic poisoning through drinking water, since the ground level arsenic concentration is quite high in some locations. People in these countries often use this water for crop irrigation resulting in the introduction of arsenic in the food chain through various plants including rice (Luong et al., 2007). The World Health
n
Corresponding author. Fax: þ 91 3463 261176. E-mail address: [email protected] (S. Bhattacharya).
http://dx.doi.org/10.1016/j.ecoenv.2014.05.012 0147-6513/& 2014 Published by Elsevier Inc.
Organization (WHO, 1993) has set the arsenic standard for drinking water at 10 mg/L. However, in many developing countries including India, 50 mg/L arsenic is considered as an acceptable level for drinking water (BIS, 2010; Smith and Smith, 2004). According to the US EPA aquatic life criteria, acceptable limit of total arsenic concentration is 340 mg/L for acute exposure and 150 mg/L for chronic exposure in fresh water. In the present study a concentration of 50 mg/L arsenic trioxide was used since it did not cause any mortality of the zebrafish. In aquatic toxicology, oxidative stress is an important area of research (Livingstone, 2001). Heavy metals generate reactive oxygen species (ROS) (Ahamed and Siddiqui, 2007; Ercal et al., 2001), disrupt signal transduction (Druwe and Vaillancourt, 2010; Thevenod, 2009), affect gene expression (Gonzalez et al., 2010) and induce DNA damage (Bertin and Averbeck, 2006). Arsenicinduced oxidative stress has also been the focus of toxicological
2
S. Sarkar et al. / Ecotoxicology and Environmental Safety 107 (2014) 1–8
research for the last decade to evaluate its possible mechanism of toxicity. Like other vertebrates, fish try to counter oxidative stress using the first line defense system such as glutathione, vitamin C or E, carotenoids (Alvarez et al., 2005) or radical-scavenging enzymes like superoxide dismutase (SOD), catalase (CAT) and glutathione peroxidase (GPx) (Valavanidis et al., 2006). Bhattacharya et al. (2007) reported induction of oxidative stress accompanied by reduction in antioxidant enzyme activities in Clarias batrachus exposed to arsenic trioxide (As2O3). Increase in the antioxidant responses in gills of zebrafish (Danio rerio) exposed for two days to arsenate (1 mg/L) and alterations in the antioxidant system in different tissues of common carp (Cyprinus carpio) on exposure to both arsenite and arsenate are on record (Ventura-Lima et al., 2009a,b). However, antioxidant responses in zebrafish brain have not received much attention. To understand the clinical syndromes of arsenic-induced human diseases, it is important to use in vivo animal models. Amongst several animal models, zebrafish (D. rerio) is a popular vertebrate model system in toxicology because of its several important features such as ease in obtaining a large number of animals, low husbandry costs and well established genetic and genomic tools, including the availability of complete genome sequence. Genomic studies have proven that zebrafish and human generally share a common set of genes including highly conserved and similarly regulated genes (Catchen et al., 2011; Woods et al., 2005). Arsenic induced adverse effects on nervous system are caused by their inactivation of acetylcholinesterase (AChE), a vital biomarker of neurotoxicity (Page and Wilson, 1985). Arsenic also reacts with the thiol groups of proteins and enzymes and inhibits the catalytic activity (Vahidnia et al., 2007). DeCastro et al. (2009) reported behavioral and neurotoxic effects of arsenic in zebrafish while Richetti et al. (2011) demonstrated inhibition of acetylcholinesterase by heavy metal exposure. The objective of this study was to determine the adverse effect of arsenic trioxide in zebrafish brain at the dose of 50 mg/L which is equivalent to 37.87 mg/L of arsenic.
(CDNB), hydrogen peroxide (H2O2), 5, 50 dithiobis-2-nitrobenzoic acid (DTNB) and trichloroacetic acid (TCA) were purchased from Sisco Research Laboratory, Mumbai, India. Thiobarbituric acid was procured from Himedia Laboratories Pvt. Ltd. Mumbai, India. Anti-nuclear factor (erythroid-derived 2)-like 2 (NRF2), kelch-like ECH-associated protein 1 (KEAP1), heme oxygenase1 (HO1), NAD(P)H dehydrogenase quinine 1(NQO1), heat shock protein (HSP70) and α-tubulin antibodies were purchased from Santa Cruz Biotechnology Inc. (Santa Cruz, CA, USA). All alkaline phosphatase (ALP) conjugated secondary antibodies, 5-bromo-4-chloro-3- indolyl phosphate/nitroblue tetrazolium (BCIP/NBT), TRI reagent and dichlorofluoresceindiacetate (DCFH-DA) were procured from Sigma Chemical Co. (St. Louis, MO, USA). Power SYBR Green PCR Master Mix (CAS 67-68-5) was purchased from Applied Biosystem, Warrington, UK. All other chemicals used were of analytical grade. 2.3. Experimental design At first, 96 h LC50 of zebrafish was determined according to the graphical interpolation method of Doudoroff et al. (1951). Briefly, fish were exposed to different concentrations of As2O3 (10–50 mg/L). As2O3 added water was replaced daily throughout the experiment. A concurrent control of 20 fish was maintained under identical conditions and water was replaced daily. Experimental data were plotted on semi-logarithmic coordinate paper with test concentration on the logarithmic scale and percentage of survival on the arithmetic scale. A straight line was drawn between the two points which are above and below the 50 percent survival line. The point of intersection with 50 percent survival line was considered LC50 and thus the LC50 value of zebrafish for As2O3 was found to be 17.5 mg/L. In the present study, adult, mature, healthy zebrafish were exposed to 50 mg/L (1/350 of 96 h LC50) As2O3 for 90 days at triplicate at each treatment concentration and 10 fish were sampled at 7, 15, 30, 60 and 90 days of exposure. Brain was dissected from each group of 10 fish and kept for further analyses. No death of fish was noted during the entire experimental period. 2.4. Biochemical assays Zebrafish brain was homogenized in Tris–HCl buffer (pH 7.4) and centrifuged at 12,000 g for 15 min at 4 1C. The supernatants were used for biochemical analysis. Reactive oxygen species (ROS) were measured using DCFH-DA according to LeBel et al. (1992). Lipid peroxidation and congugated diene (CD) were assayed according to Buege and Aust (1978). Reduced glutathione (GSH) was estimated according to Ellman et al. (1961) and glutathione S-transferase (GST) according to Habig et al. (1974). Peroxisomal catalase (CAT) and cytosolic glutathione reductase (GR) activities were assayed by the method of Aebi (1984) and Kenji (1999) respectively. 2.5. Gene expression measurement
2. Materials and methods 2.1. Fish care and maintenance Adult and healthy wild type zebrafish of both sexes were obtained from a local fish supplier (average weight 0.687 0.05 g and average length 3.95 7 0.07 cm) and kept in aquaria. Prior to arsenic trioxide exposure, they were acclimatized in water at 257 1 1C, with a photoperiod of 14-h light/10-h dark for a week. The fish were fed twice a day with commercial food (Optimum, Thailand) and water was changed daily to discard metabolic wastes. All animal experiments were performed according to the guidelines of Institutional Animal Ethics Committee (IAEC), Visva-Bharati University. 2.2. Test chemicals Arsenic trioxide (As2O3) (CAS no. 1327-53-3) was purchased from Loba Chemie Pvt. Ltd. Mumbai, India. Reduced glutathione (GSH), 1- chloro-2, 4-dinitrobenzene
Total RNA was extracted from 20 zebrafish brain using TRI reagent (SigmaAldrich Co., 3050 Spruce Street, St.Louis, MO 63103 USA) according to the manufacturer's protocol. The quality and quantity of RNA was checked and cDNA synthesized from 2 mg total RNA using M-MuLV reverse transcriptase (#EP0351, Thermo Fisher Scientific Inc, Waltham, MA, USA). Quantitative real time PCR was performed using 10ml of Power SYBR Green PCR Master Mix (Applied Biosystems, Warrington Cheshire WA1 4 SR, UK), 1 ml of each primer and 2.5 ml of the cDNA. The following PCR protocol was used for the Bio-Rad CFX Connect™ Real Time PCR detection System ( Bio-Rad, Hercules, CA, USA): denaturation for 3 min at 95 1C, followed by 40 cycles of 95 1C for 10 s, 60 1C for 15 s. Fluorescent signals were measured at the annealing/extension step. As a house-keeping gene, gapdh transcript was used to standardize the results by eliminating variations in mRNA and cDNA quantity and quality, and each mRNA level was expressed as its ratio to gapdh mRNA. PCRs were performed thrice, in three separate runs. The relative quantification of gene expression among treatment groups were analyzed by the 2 ΔΔct method (Livak and Schmittgen, 2001). Sequences of the primers are shown in Table 1.
Table 1 Primer sequences for quantitative PCR used in this study. Gene
Forward primer (from 50 to 30 )
Reverse primer (from 50 to 30 )
GenBank accession no.
Nrf2 Keap1 Gpx1 Cat Mn SOD Cu/Zn SOD Cox1 Ucp2 Bcl2 Gapdh
AACGAGTTCTCCCTTCAGCA TGGATAACTACCTCTATGCCGT CCCTCTGTTTGCGTTCCTGA CTCCTGATGTGGCCCGATAC AGCGTGACTTTGGCTCATTT CAACACAAACGGCTGCATCA GACTACCCAGACGCCTATGC CAAGGGGTTCATGCCATCCT AACCCAAATTCTGCGCAACG AAGTTGGTATTAACGGATTCGGT
ATTTTGTCGCCGATTTTGTC CCTTGGTTAAATCCACCTAACAC TCTTGAATGGTTCCCCGTCC TCAGATGCCCGGCCATATTC ATGAGACCTGTGGTCCCTTG TTTGCAACACCACTGGCATC GAGGGCAGCCGTGTAATCAT GCTCAACTGGAACTGCATGC ATCTACCTGGGACGCCATCT GTAGACTCCACAACATAAGTAGCA
BC152659.1 NM_182864.2 BC164790.1 AF170069.1 NM_199976.1 BC055516.1 AY996924.1 BC065607.1 AY695820.1 NM_001115114.1
S. Sarkar et al. / Ecotoxicology and Environmental Safety 107 (2014) 1–8
2.6. Determination of protein Brain protein was measured according to Lowry et al. (1951) using bovine serum albumin (BSA) as the standard. 2.7. Western blot 80 μg brain protein from the control and treated samples were resolved in 10 percent sodium dodecyl sulfate- polyacrylamide gel electrophoresis (SDS-PAGE) at a constant voltage (60 V) for 2.5 h and then blotted onto a polyvinylidene fluoride (PVDF) membrane with the help of a semi-dry trans blot apparatus (Bio-Rad Trans BlotR TurboTM, USA). The membranes were first incubated with primary antibodies at a dilution of 1:1000 over night at 4 1C, followed by 4 h incubation with corresponding ALP-conjugated secondary antibodies at 1:2000 dilutions on continuous rocking platform. The immuno reactive bands were detected using BCIP/NBT. 2.8. Statistical analysis Results are shown as Mean 7 Standard Error of the Mean (S.E.M.) of three individual assays and statistical analyses were done following one-way analysis of variance (ANOVA) test. The level of significance was set at P o0.05 or 0.01 and indicated by ‘n’ or ‘nn’ respectively.
3. Results 3.1. Arsenic trioxide induced oxidative stress in zebrafish brain The levels of reactive oxygen species (ROS), lipid peroxidation (in terms of MDA and CD content) and GSH were measured to
3
evaluate the extent of oxidative stress imposed on the zebrafish brain by a low dose of As2O3 exposure. In As2O3 treated zebrafish, the degree superoxide production, MDA and CD levels followed a triphasic pattern of response throughout the exposure. It is clearly depicted from Fig. 1A that the degree of ROS level in As2O3 treated samples enhanced in a time dependent manner and significantly increased until 15 days. However, the increase was transient recording a decrease at 30 days of exposure which significantly elevated towards the end of exposure. A similar trend of MDA (Fig. 1B) and CD (Fig. 1C) levels was noted in As2O3 treated samples as compared to the control. The generation of ROS was accompanied by a biphasic pattern of GSH level in As2O3 treated zebrafish. Interestingly, GSH level in the treated fish was found to increase (1.5–4 folds) gradually in a time dependent manner to reach its highest level at 60 days followed by a sharp decline towards the end of the exposure (Fig. 1D). 3.2. Arsenic trioxide induced damage to GSH regulatory proteins It is clearly depicted in Fig. 2A that GST, an important detoxifying enzyme, significantly decreased with increasing time of As2O3 exposure against control up to 30 days of exposure. But 30 days onwards, GST activity significantly elevated until 60 days followed by a sharp decline towards the end of the exposure. However, the activity of the enzyme GR, which plays an important role in maintaining the cellular GSH pool, was found to be significantly elevated at 7, 30 and 90 days in As2O3 treated zebrafish. However,
Fig. 1. Time dependent level of reactive oxygen species (ROS, A), malondialdehyde (MDA, B), conjugated diene (CD, C) and reduced glutathione (GSH, D) in zebrafish brain after exposure to 50 mg/L arsenic trioxide. The results are expressed as mean 7 S.E.M of triplicate samples.* indicates significant difference at Po 0.05 and **indicates significant difference at P o0.01.
4
S. Sarkar et al. / Ecotoxicology and Environmental Safety 107 (2014) 1–8
Fig. 2. Time dependent activities of glutathione-s-transferase (GST, A), glutathione reductase (GR, B), glutathione peroxidase (GPx, C), and catalase (CAT, D) in zebrafish brain after exposure to 50 mg/L arsenic trioxide. The results are expressed as mean7 S.E.M of triplicate samples.* indicates significant difference at P o 0.05 and ** indicates significant difference at Po 0.01.
the elevation in GR level was transient recording a decline at 15 and 60 days of treatment against control (Fig. 2B). Besides alteration in GR activity, GPx activity significantly enhanced up to 30 days of exposure. A slight decrease in GPx activity was noted at 60 days followed by its elevation to reach the highest level (4 folds) against control at the end of the exposure (Fig. 2C). As2O3 induced oxidative damage was also evidenced by the triphasic pattern of CAT activity. It is clearly depicted from Fig. 2D that CAT activity gradually elevated up to 15 days followed by a remarkable decline at 30 days of As2O3 exposure. However 30 days onwards, CAT activity significantly increased to reach its highest level at 60 and 90 days of exposure against control (Fig. 2D). 3.3. Alteration in mRNA level of detoxification genes In the present study, expression of several important biomarker genes designated for toxicological responses were assessed. A triphasic pattern was noted in mRNA level of Nrf2 in As2O3 exposed zebrafish until 90 days (Fig. 3A). During the experiment, mRNA level of Nrf2 initially increased up to seven days and then reduced towards the control level in treated samples. Interestingly, Nrf2 expression after 15 days onwards gradually increased throughout the exposure as compared to the control. However, a biphasic pattern was noted in mRNA level of Keap1 over the exposure. Keap1 mRNA level significantly enhanced until 15 days followed by a sharp decline towards the end of the exposure (Fig. 3B). Besides alteration in mRNA levels of Nrf2 and Keap1, an increasing trend in expression of manganese superoxide dismutase (Mn-Sod) and copper/zinc superoxide dismutase (Cu/Zn-Sod)
was noteworthy until 15 days. The increase was transient recording a decline until 60 days of exposure which significantly elevated towards the end of exposure (Figs. 3C and D). As2O3 induced oxidative stress at low dose was further confirmed by enhanced mRNA level of glutathione peroxidase (Gpx) and catalase (Cat) (Fig. 3E and F) and reduced level of cytochrome c oxidase 1 (Cox1) (Fig. 3G). 3.4. Alteration in expression of inner mitochondrial membrane genes Expression of mitochondrial inner membrane genes related to regulation of ROS production, respiratory chain and ATP synthesis is depicted in Fig. 4. Uncoupling protein 2 (Ucp2) and B-cell lymphoma2 (Bcl2) play an important role in regulation of ROS production and antioxidant activity. Interestingly, mRNA level of Ucp2 in As2O3 exposed zebrafish significantly increased until 15 days followed by a sharp depletion towards the end of the exposure (Fig. 4A). The mRNA level of Bcl2 significantly decreased with As2O3 exposure as compared to the control (Fig. 4B). 3.5. Activation of stress related proteins Immunoblot analysis showed increased NRF2 expression in As2O3 treated zebrafish brain towards the end of the exposure against control (Fig. 5). Contrastingly, KEAP1 expression increased until 15 days followed by a slight decrease after 30 days of As2O3 exposure. Moreover, NRF2 dependent proteins i.e. HO1 and NQO1 overall increased throughout the exposure against control. Induction of oxidative stress was further confirmed by the enhanced
S. Sarkar et al. / Ecotoxicology and Environmental Safety 107 (2014) 1–8
5
Fig. 3. Relative mRNA levels of nuclear factor (erythroid-derived 2)-like 2 (Nrf2, A), kelch-like ECH-associated protein 1 (Keap1, B), manganese superoxide dismutase (MnSOD, C) copper/zinc superoxide dismutase (Cu/Zn SOD, D), glutathione peroxidase (Gpx1, E), catalase (Cat, F) and cytochrome c oxidase 1(Cox1, G) in zebrafish brain after exposure to 50 mg/L As2O3. The results are expressed as mean 7 S.E.M of triplicate samples.* indicates significant difference at Po 0.05 and ** indicates significant difference at Po 0.01.
expression of HSP 70 (representing cellular stress) in treated zebrafish as compared to the control. Interestingly, the pattern of HSP 70 expression was biphasic and the highest peak was recorded at the end of the exposure (Fig. 5).
4. Discussion In the present investigation, exposure of zebrafish to 50 mg/L As2O3 for 90 days caused no mortality which confirms that the dose is low and within the limits of USEPAaquatic life criteria. It is known that in general, all heavy metals and metalloids, including arsenic, are potent inducers of oxidative stress (Kitchin, 2001). Pathways of xenobiotic metabolism in fish are analogous to higher vertebrates and equally potent in eliminating a multitude of xenobiotics (Bhattacharya et al. 2007; Sarkar, 1997). In addition, Suhendrayatna et al. (2001) reported maximum accumulation of arsenic in brain as compared to other organs of Tilapia mossambica and thus brain may act as an important target organ for arsenic toxicity in fish. Interestingly, the present data clearly indicate that As2O3 significantly induces oxidative stress in zebrafish brain at a low dose of exposure.
ROS essentially generates oxidative stress and compromises antioxidant defense. Treatment with low dose of As2O3 generates ROS in zebrafish brain and the induction continues till the end of the exposure (90 days). Significant increase in ROS was recorded at 15 days and the peak at 90 days. However, ROS generation diminished on 30 days of exposure. The initial increase in ROS was probably due to a direct effect of As2O3 on superoxide generation, through its toxicity to mitochondria or loss of mitochondrial membrane potential (Pourahmad et al., 2003; Woo et al., 2002). Parallel activation of the antioxidant defense system of the cell reduces ROS generation. However, continuous As2O3 exposure was commensurate with enhanced ROS generation over time. A general pathway of toxicity for several environmental pollutants is mediated by the enhancement of intracellular ROS, which modulates the occurrence of cell damage via initiation and propagation of LPO (Gutteridge, 1995). Arsenic is known to induce peroxidation of membrane lipids in various organisms. Peroxidative damage in Anabas testudineus was reported to be caused by chronic exposure to arsenic (Das et al., 1998). Roy et al. (2004) and Bhattacharya and Bhattacharya (2005) reported oxidative stress in two fresh water teleost species, Channa punctatus and C. batrachus exposed to
6
S. Sarkar et al. / Ecotoxicology and Environmental Safety 107 (2014) 1–8
Fig. 4. Relative mRNA levels of uncoupling protein 2 (Ucp2, A), and B-cell lymphoma2 (Bcl2, B) in zebrafish brain after exposure to 50 mg/L arsenic trioxide. The results are expressed as mean 7 S.E.M of triplicate samples. * indicates significant difference at Po 0.05 and ** indicates significant difference at P o0.01.
Fig. 5. Protein expression of nuclear factor (erythroid-derived 2)-like 2 (NRF2), kelch-like ECH-associated protein 1 (KEAP1), Heme oxygenase 1(HO1), NAD(P)H dehydrogenase quinone 1(NQO1) and heat shock protein (HSP70) in zebrafish brain after exposure to 50 mg/L arsenic trioxide. Immunoblots were representative of three independent experiments.
As2O3 at 1/10 and 1/20 LC50 doses for 14 days. Lipid peroxidation produces conjugated diene (CD) and malondialdehyde (MDA). The level of MDA production in zebrafish brain was found to be high till the end of exposure recording a slight decrease at 30 days and the highest peak at 90 days of exposure. The rate of induction of CD and MDA was parallel, apparently due to the fact that CD is the
precursor of MDA in the cascade of intermediates formed during lipid peroxidation. Interestingly, CD and MDA production closely resemble the pattern of ROS generation in a time dependent manner. Therefore, a direct correlation of ROS profile and lipid peroxidation might be indicative of oxidative stress in response to the nonlethal dose of As2O3. The production of ROS is a normal aspect of cellular metabolism, but increased production of ROS may lead to oxidative stress consequently impairing the cellular antioxidant defense system. GSH provides the reducing equivalent and play an important role in cellular antioxidant system (Bhattacharya and Bhattacharya, 2005). GSH reacts with metals non-enzymatically like other thiols (Bhattacharya et al., 2007; Dalal and Bhattacharya, 1991; Sarkar, 1997) and can also act as a superoxide quencher on its own, apart from its role as a substrate for GST and GPx (Saez et al., 1990). Glutathione is a major non-protein thiol in mammals and heavy metals that have a high affinity for sulfhydryl (–SH) groups conjugate with glutathione (Rabenstein, 1989). The glutathione conjugates are subsequently converted to mercapturic acids which are readily excreted into the bile or urine (Chasseaud, 1976). Most studies on the relationship between cellular glutathione level and arsenic toxicity inferred that glutathione has a protective role against arsenic induced toxicity (Bhattacharya, 2004). In the present study, GSH levels increased with the time of exposure and remain high until 30 days. Both acute and chronic inorganic arsenic exposure is known to induce GSH levels as a stress response, either through an increased cystine uptake or by the enhanced activity of γ-glutamyl-cystinyl ligase (GCL) enzyme (Schuliga et al., 2002). The increased level of GSH in response to As2O3 until 60 days may be due to its ability to react with trivalent inorganic arsenicals as well as MMAIII and DMAIII and other methylated products of arsenic (Styblo et al., 1997, 1996). At 90 days depletion in GSH level was noted which heightened arsenic toxicity. The rate of alterations in GST activity in the current study clearly indicated the role of GSH–GST in detoxification of As2O3. The low level of GST activity with a concomitant rise in GSH level in response to chronic As2O3 exposure indicates the degree of toxicity of As2O3. Moreover, inhibition of GST activity could be either through direct action of the metal on the enzyme or indirectly via the production of ROS that interacts directly with the enzyme and/or down regulates GST genes through different mechanisms (Roling and Baldwin, 2006).On the other hand, a sudden increase in GST activity at 60 days of exposure indicates removal of arsenic from the brain of zebrafish. Since oxidative stress is the first response to environmental stressors (Livingstone, 2001), brain cells may initially stimulate antioxidant and detoxification responses to counter arsenic insult. The involvement of anti-oxidative enzymes such as GR, GPx and CAT play an important role in protecting cells from oxidative stress. The main function of glutathione reductase (GR) is to maintain the cellular homeostasis of GSH and GSSG ratio or the redox balance of the cell. In this study, GR activity increased at 7, 30 and 90 days of exposure. A significant inhibition was noted in GR activity which might be due to formation of high level of methylated trivalent arsenicals (Styblo and Thomas, 1995; Styblo et al., 1997; Chouchane and Snow, 2001). However, at 90 days, increase in GR activity was related to significant depletion of GSH. The generation of ROS in zebrafish brain due to As2O3 exposure was further evidenced by significant increase of glutathione peroxidase (GPx) and catalase (CAT) activity, which converts H2O2 to water and helps in detoxication. Thus, it is plausible that an increase in the activities of these enzymes contributes to the elimination of superoxide radicals from the cell. Similar results have been also reported by Bhattacharya and Bhattacharya (2005). GPx activity was found to corroborate well with ROS generation
S. Sarkar et al. / Ecotoxicology and Environmental Safety 107 (2014) 1–8
during As2O3 exposure to zebrafish. The increase in the GPx activity was found to be most prompt and stable throughout the exposure indicating the importance of this enzyme to combat oxidative stress generated in response to As2O3. Environmental contaminants causing oxidative stress are accompanied by the induction of antioxidant enzymes in fish as evidenced by Shi and Zhou (2010). They reported that perfluorooctanesulfonic acid (PFOS) exposure induced significant generation of ROS in zebrafish embryos, which in turn alters antioxidant enzymes to prevent oxidative damage. Richetti et al. (2011) also reported alterations in antioxidant capacity in the brain of zebrafish exposed to zinc chloride, mercury chloride, lead acetate and cadmium acetate. In the current study, enhanced levels of superoxide induced significant elevation of CAT activity which clearly indicates stimulation of the antioxidant defense system in zebrafish brain to combat As2O3 induced oxidative stress. Decrease in CAT activity at 30 days due to less amount of ROS production in As2O3 treated zebrafish. Nrf2–Keap1 system is present not only in mammals, but also in fish, suggesting that its role in cellular defense is conserved throughout evolution among vertebrates (Kobayashi and Yamamoto, 2005). A large number of antioxidant genes have also been identified in zebrafish (Craig et al., 2007; Liu et al., 2008), amongst which Nrf2 plays an important role in arsenic induced detoxification (Chen and Sung, 2005). In the present study, enhanced expression of Nrf2 in As2O3 exposed zebrafish indicates a protective role of Nrf2. Keap1, a negative regulator of Nrf2, inversely correlates with the mRNA expression of Nrf2. As2O3 induced toxicity was also validated by the alteration in NRF2 and NRF2 dependent expression of proteins such as HO1 and NQO1. Heat shock proteins (Hsp) expressed in numerous tissues of several animal species and their presence is often associated with a response to a harmful stress situation or to adverse life conditions. In the present investigation, HSP70 expression is high at 15 days, at 30 days it is downregulated and again increased at the end of exposure which may be due to a continuous As2O3 exposure for 90 days. The role of superoxide dismutase (SOD) is to detoxify superoxide radicals. Its activity in detoxication is critical because it generates cytotoxic H2O2 during detoxication of O2 d radical. Thus, activation of SOD requires concomitant activation of cytosolic GPx and/or catalase activity to protect cells from oxidative stress (Halliwell and Gutteridge, 1999). The mRNA expression of Mn-Sod and Cu/Zn Sod increased until 15 days of exposure followed by a gradual decline at 30 days which regained at end of exposure. In addition, increasing pattern in mRNA levels of Gpx and Cat was also noted until 30 days which slightly decreased at 60 days and then regained at the end of the exposure. The mRNA expression of these antioxidant genes did not correlate well with ROS production. The present findings suggest that these enzymes are controlled by transcriptional regulation rather by enzyme activity. A similar result was reported by Jin et al. (2010). They reported that, some antioxidant enzymes are controlled by enzyme activity and not by transcriptional levels, at least in case of SOD and CAT in zebrafish. It is possible that mRNA levels represent a snapshot of the cell activity at any given time and the protein activity might be regulated at the post-transcriptional level. Similarly, Olsvik et al. (2005) were not able to link hyperoxia induced mRNA expression of Cu/Zn Sod, Cat or Gpx in the liver of smoltifying salmon after long periods of exposure to 130 percent O2, even though GSH level suggested that an increased oxidative stress might have occurred. Craig et al. (2007) demonstrated that in copper exposure there was no association between increased transcription and enzyme activities related to the antioxidant stress in zebrafish. Alteration in mRNA level of Cox1 further confirms the stress condition of the treated fish. Ucp2 is involved in reduced production of superoxides during mitochondrial
7
electron transport (Giardina et al., 2008; Jin et al., 2010) which may be a plausible reason for initial activation of Ucp2 in the brain of zebrafish exposed to As2O3. Excess ROS generation by As2O3 with increasing time may be responsible for a reduced Ucp2 mRNA level. Such alterations in mRNA levels of several biomarker genes against As2O3 induced toxicity is reported here. However, depletion in mRNA level of Bcl2 suggests induction of apoptosis in the brain of zebrafish exposed to As2O3 at a low dose of 50 mg/L (1/ 350 LC50).
5. Conclusion It is concluded that As2O3 (50 mg/L) promotes oxidative stress in zebrafish brain affecting antioxidant enzyme (GST, GR, GPx and CAT) activities, endogenous GSH and MDA and also the mRNA levels of genes which encode antioxidant proteins (Nrf2, Keap1, Mn-Sod, Cu/Zn-Sod, Gpx, Cat), mitochondrial membrane proteins (Ucp2 and Bcl2) and proteins related to mitochondrial respiratory chain and ATP synthesis (such as Cox1). To the best of our knowledge, this is the first report on induction of oxidative stress by a low dose of As2O3 in the zebrafish brain.
Acknowledgments SS and SM are grateful to UGC, New Delhi for Research Fellowship in Science for Meritorious Students (RFSMS). SB acknowledges National Academy of Science, India (Grant No. NASI/323/12/20102011) for Senior Scientist Platinum Jubilee Fellowship. References Aebi, H., 1984. Catalase in vitro. Methods Enzymol. 105, 121–126. Agency for Toxic Substances and Disease Registry (ATSDR), 2007. Toxicological Profile for Arsenic. U.S. Department of Health and Human Services, Public Health Services, Atlanta, GA. Ahamed, M., Siddiqui, M.K., 2007. Low level lead exposure and oxidative stress: current opinions. Clin. Chim. Acta 383, 57–64. Alvarez, R.M., Morales, A.E., Sanz, A., 2005. Antioxidant defenses in fish: biotic and abiotic factors. Rev. Fish Biol. Fish. 15, 75–88. Bertin, G., Averbeck, D., 2006. Cadmium: cellular effects, modifications of biomolecules, modulation of DNA repair and genotoxic consequences (a review). Biochimie 88, 1549–1559. Bhattacharya, A., Bhattacharya, S., 2005. Induction of oxidative stress by arsenic in Clarias batrachus: involvement of peroxisomes. Ecotoxicol. Environ. Saf. 66, 178–187. Bhattacharya, S., Bhattacharya, A., Roy, S., 2007. Arsenic-induced responses in freshwater teleosts. Fish Physiol. Biochem. 33, 463–473. Bhattacharya, A., 2004. Intoxication signals, detoxication signals, and peroxisomal response of Clarias batrachus to arsenic (Ph.D. dissertation). Visva-Bharati University, Santiniketan, India. Buege, J.A., Aust, S.D., 1978. Microsomal lipid peroxidation. In: Fleischer, S., Packer, L. (Eds.), Methods in Enzymology. Academic Press, New York, pp. 302–310. Bureau of Indian Standard (BIS), 2010. Ground Water Quality in Shallow Aquifers of India. Central Ground Water Board, Ministry of Water Resources, Government of India, Faridabad. Catchen, J.M., Amores, A., Hohenlohe, P., Cresko, W., Postlethwait, J.H., 2011. Stacks: building and genotyping loci de novo from short-read sequences. G3: Genes Genomes Genet. 1, 171–182. Chasseaud, L.F., 1976. Conjugation with glutathione and mercapturic acid excretion. In: Arias, I.M., Jakoby, W.B. (Eds.), Glutathione: Metabolism and Function. Raven Press, New York, pp. 77–114. Chen, W.L., Sung, H.H., 2005. The toxic effect of phthalate esters on immune responses of giant freshwater prawn (Macrobrachium rosenbergii) via oral treatment. Aquat. Toxicol. 74, 160–171. Chouchane, S., Snow, E.T., 2001. in vitro effect of arsenical compounds on glutathione-related enzymes. Chem. Res. Toxicol. 14, 517–522. Craig, P.M., Wood, C.M., McClelland, G.B., 2007. Oxidative stress response and gene expression with acute copper exposure in zebrafish (Danio rerio). Am. J. Physiol. Regul. Integr. Comp. Physiol. 293, 1882–1892. Dalal, R., Bhattacharya, S., 1991. Effect of chronic nonlethal doses of nonmetals and metals on hepatic MT in Channa punctatus (Bloch). Indian J. Exp. Biol. 29, 693–694. Das, D., Sarkar, D., Bhattacharya, S., 1998. Lipid peroxidative damage by arsenic intoxication is countered by gluthione-glutathione S-transferase system and
8
S. Sarkar et al. / Ecotoxicology and Environmental Safety 107 (2014) 1–8
metallothionein in the liver of climbing perch, Anabas testudineus. Biomed. Environ. Sci. 11, 187–195. DeCastro, M.R., Ventura Lima, J., deFreitas, D.P.S., deSouza Valente, R., Dummer, N.S., deAguiar, R.B., dosSantos, L.C., Marins, L.F., Geracitano, L.A., Monserrat, J.M., Barros, D.M., 2009. Behavirol and neurotoxic effects of arsenic exposure in zebrafish (Danio rerio, Teleostei: Cyprinidae). Comp. Biochem. Physiol. C 150, 337–342. Doudoroff, P., Anderson, B.G., Burddic, D.E., Galtsoff, P.S., Hart, W.B., Patric, R., Strong, E.R., Shurber, E.W., Van Horn, W.M., 1951. Bioassay methods for the evaluation of acute toxicity of industrial wastes to fish. Sew. Ind. Wastes 23, 1380–1397. Druwe, I.L., Vaillancourt, R.R., 2010. Influence of arsenate and arsenite on signal transduction pathways: an update. Arch. Toxicol. 84, 585–596. Ellman, G.L., Courtney, K.D., Andres, V., FeatherstoneJr., 1961. A new and rapid colorimetric determination of Acetylcholinesterase activity. Biochem. Pharmacol. 7, 88–95. Ercal, N., Gurer-Orhan, H., Aykin-Burns, N., 2001. Toxic metals and oxidative stress part I: mechanisms involved in metal-induced oxidative damage. Curr. Top. Med. Chem. 1, 529–539. Flora, S.J.S., Bhadauria, S., Pant, S.C., Dhaked, R.K., 2005. Arsenic induced blood and brain oxidative stress and its responses to some thiolchelators in rats. Life Sci. 77, 2324–2337. Giardina, T.M., Steer, J.H., Lo, S.Z., Joyce, D.A., 2008. Uncoupling protein-2 accumulates rapidly in the inner mitochondrial membrane during mitochondrial reactive oxygen stress in macrophages. Biochem. Biophys. Acta Bioenerg. 1777, 118–129. Gonzalez, H.O., Hu, J., Gaworecki, K.M., Roling, J.A., Baldwin, W.S., Gardea-Torresdey, J.L., Bain, L.J., 2010. Dose-responsive gene expression changes in juvenile and adult mummichogs (Fundulus heteroclitus) after arsenic exposure. Mar. Environ. Res. 70, 133–141. Gutteridge, M.C., 1995. Lipid peroxidation and antioxidants as biomarker of tissue damage. Clin. Chem. 41, 1819–1828. Habig, W.H., Pabst, M.J., Jacoby, W.B., 1974. Glutathione-S-transferase. The first enzymatic step in mercapturic acid formation. J. Biol. Chem. 249, 7130–7139. Halliwell, B., Gutteridge, J.M.C., 1999. Free radicals in Biology and Medicine. Oxford Science Publication, Oxford University Press Inc., New York. IARC Monographs on the Evaluation of the Carcinogenic Risks to Humans, 1987. Suppl. 7, Overall Evaluations of Carcinogenicity: An Updating of IARC Monographs, Volumes 1–42. Jin, Y., Zhang, X., Shu, L., Chen, L., Sun, L., Qian, H., Liu, W., Fu, Z., 2010. Oxidative stress response and gene expression with atrazine exposure in adult female zebrafish (Danio rerio). Chemosphere 78, 846–852. Kenji, A., 1999. Glutathione reductase. In: Gutteridge, J.M.C., Taniguchi, N. (Eds.), Experimental Protocols for Reactive Oxygen and Nitrogen Species. Oxford University Press, New York, pp. 81–82. Kitchin, K.T., 2001. Recent advances in arsenic carcinogenesis: modes of action, animal model systems, and methylated arsenic metabolites. Toxicol. Appl. Pharm. 172, 249–261. Kobayashi, M., Yamamoto, M., 2005. Molecular mechanisms activating the Nrf2Keap1 pathway of antioxidant gene regulation. Antioxid. Redox Signal. 7 (3–4), 385–394. LeBel, C.P., Ischiropoulos, H., Bondy, S.C., 1992. Evaluation of the probe 20 , 70 dichlorofluorescin as an indicator of reactive oxygen species formation and oxidative stress. Chem. Res. Toxicol. 5, 227–231. Liu, Y., Wang, J.S., Wei, Y.H., Zhang, H.X., Xu, M.Q., Dai, J.Y., 2008. Induction of time dependent oxidative stress and related transcriptional effects of perfluorododecanoic acid in zebrafish liver. Aquat. Toxicol. 89, 242–250. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using real- time quantitative PCR and the 2 ΔΔct method. Methods 25, 402–408. Livingstone, D.R., 2001. Contaminant-stimulated reactive oxygen species production and oxidative damage in aquatic organisms. Mar. Pollut. Bull. 42, 656–666. Lowry, O.H., Rosebrough, N.J., Farr, A.L., Randall, R.J., 1951. Measurement of protein with the Folin phenol reagent. J. Biol. Chem. 193, 265–275. Luong, J.H.T., Majid, E., Male, K.B., 2007. Analytical tools for monitoring arsenic in the environment. Open Anal. Chem. J. 1, 7–14. Olsvik, P.A., Kristensen, T., Waagbo, R., Rosseland, B.O., Tollefsen, K.E., Baeverfjord, G., Berntssen, M.H., 2005. mRNA expression of antioxidant enzymes (SOD,CAT and GSH-Px) and lipid Peroxidative stress in liver of Atlantic salmon (Salmo salar) exposed to hyperoxic water during smoltification. Comp. Biochem. Physiol. C 141, 314–323.
Page, J.D., Wilson, I.B., 1985. Acetylcholinesterase: inhibition by tetranitromethane and arsenite. Binding of arsenite by tyrosine residues. J. Biol. Chem. 260, 1475–1478. Pourahmad, J., O’Brien, P.J., Jokar, F., Daraei, B., 2003. Carcinogenic metal inducedsites of reactive oxygen species formation in hepatocytes. Toxicol. in vitro 17, 803–810. Rabenstein, D.L., 1989. Metal complexes of glutathione and theirbiological significance. In: Dolphin, D., Avramovic, O., Poulson, R. (Eds.), Glutathione: Chemical, Biochemical and Medical Aspect. Wiley, New York, pp. 147–186. Richetti, S.K., Rosemberg, D.B., Ventura-Lima, J., Monserrat, J.M., Bogo, M.R., Bonan, C.D., 2011. Acetylcholinesterase activity and antioxidant capacity of zebrafish brain is altered by heavy metal exposure. Neurotoxicology 32, 116–122. Roling, J.A., Baldwin, W.S., 2006. Alteration in hepatic gene expression by trivalent chromium in Fundulus heteroclitus. Mar. Environ. Res. 62, 122–127. Roy, S., Bhattacharya, A., Roy, S., Bhattacharya, S., 2004. Arsenic induced lipid peroxidation at non-lethal doses. In: Bhattacharya, S., Maitra, S.K. (Eds.), Current Issues in Environmental and Fish Biology. Daya Publishing House, Delhi, pp. 52–63. Saez, G.T., Bannister, W.H., Bannister, J.V., 1990. Free radicals and thiol compoundsThe role of glutathione against free radical toxicity. In: Vina, J. (Ed.), Glutathione : Metabolism and Physiological Functions. CRC Press, Boca Raton, Fl, USA, pp. 237–254. Sarkar, D., 1997. Role of reduced glutathione, glutathione-S-transferase, metallothionein and lipid peroxidation in the detoxication mechanism in Ananbas testudineus (Bloch) (Ph.D. dissertation). Visva-Bharati University, Santiniketan, India. Schuliga, M., Chouchane, S., Snow, E.T., 2002. Upregulation of Glutathione related genes and enzyme activities in cultured human cells by sublethal concentration of inorganic arsenic. Toxicol. Sci. 70, 183–192. Shi, X.J., Zhou, B.S., 2010. The role of Nrf2 and MAPK pathways in PFOS-induced oxidative stress in zebrafish embryos. Toxicol. Sci. 115, 391–400. Smith, A.H., Smith, M.M., 2004. Arsenic drinking water regulations in developing countries with extensive exposure. Toxicology 198, 39–44. Styblo, M., Serves, S.V., Cullen, W.R., Thomas, D.J., 1997. Comperative inhibition of yeast glutathione reductase by arsenicals and arsenothiols. Chem. Res. Toxicol. 10, 27–33. Styblo, M., Thomas, D.J., 1995. in vitro inhibition of glutathione reductase by arseno triglutathione. Biochem. Pharmacol. 49, 971–974. Styblo, M., Delnomdedieu, M., Thomas, D.J., 1996. Mono and dimethylation of arsenic in rat liver cytosol in vitro. Chem. Biol. Interact. 99, 147–164. Suhendrayatna, Ohki, Nakajima, A., Maeda, S., T., 2001. Metabolism and organ distribution of arsenic in the freshwater fish Tilapia mossambica. Appl. Organometal. Chem. 15, 566–571. Thevenod, F., 2009. Cadmium and cellular signaling cascades: to be or not to be? Toxicol. Appl. Pharmacol. 238, 221–239. USEPA, 〈http://water.epa.gov/scitech/swguidance/standards/criteria/current/index. cfm#A〉. Vahidnia, A., vanderVoet, G.B., deWolf, F.A., 2007. Arsenic nurotoxicity—a review. Hum. Exp. Toxicol. 26, 823–832. Valavanidis, A., Vlahogianni, T., Dassenkis, M., Scoullos, M., 2006. Molecular biomarker of oxidative stress in aquatic organisms in relation to toxic environmental pollutants. Ecotoxicol. Environ. 64, 178–189Saf 64, 178–189. Ventura-Lima, J., Castro, M.R., Acosta, D., Fattorini, D., Regoli, F., Carvalho, L.M., Bohrer, D., Geracitano, L.A., Barros, D.M., Silva, R.S., Bonan, C.D., Bogo, M.R., Monserrat, J.M., 2009a. Effects of arsenic (As) exposure on the antioxidant status of gills of the zebrafish Danio rerio (Cypridinae). Comp. Biochem. Physiol. C 149, 538–543. Ventura-Lima, J., Fattorini, D., Regoli, F., Monserrat, J.M., 2009b. Effects of different inorganic arsenic species in Cyprinus carpio (Cyprinidae) tissues after shorttime exposure: bioaccumulation, biotransformation and biological responses. Environ. Pollut. 157, 3479–3484. WHO, 1993. Guidelines for Drinking Water Quality: Recommendations, 1. World Health Organization, Geneva. Woo, S.H., Park, C.I., Park, M.J., Lee, H.C., Lee, S.J., Chun, Y.J., Lee, S.H., Hong, S.I., Rhee, C.H., 2002. Arsenic trioxide induces apoptosis through reactive oxygen speciesdependent pathway and loss of mitochondrial membrane potential in HeLa cells. Int. J. Oncol. 21, 57–63. Woods, I.G., Wilson, C., Friedlander, B., Chang, P., Reyes, D.K., Nix, R., Kelly, P.D., Chu, F., Postlethwait, J.H., Talbot, W.S., 2005. The zebrafish gene map defines ancestral vertebrate chromosomes. Genome Res. 15, 1307–1314.
Contents lists available at ScienceDirect
Ecotoxicology and Environmental Safety journal homepage: www.elsevier.com/locate/ecoenv
Low dose of arsenic trioxide triggers oxidative stress in zebrafish brain: Expression of antioxidant genes Shuvasree Sarkar a, Sandip Mukherjee a, Ansuman Chattopadhyay b, Shelley Bhattacharya a,n a
Environmental Toxicology Laboratory, Department of Zoology, School of Life Science, Visva-Bharati University, Santiniketan, West Bengal 731235, India Radiation Genetics and Chemical Mutagenesis Laboratory, Department of Zoology, School of Life Science, Visva-Bharati University, Santiniketan, West Bengal 731235, India
b
art ic l e i nf o
a b s t r a c t
Article history: Received 17 February 2014 Received in revised form 8 May 2014 Accepted 13 May 2014
Occurrence of arsenic in the aquatic environment of West Bengal (India), Bangladesh and other countries are of immediate environmental concern. In the present study, zebrafish (Danio rerio) was used as a model to investigate oxidative stress related enzyme activities and expression of antioxidant genes in the brain to 50 mg/L arsenic trioxide for 90 days. In treated fish, generation of reactive oxygen species (ROS), malondialdehyde (MDA) and conjugated diene (CD) showed a triphasic response attaining a peak at the end of the exposure. In addition, a gradual increase in GSH level was noted until 60 days and at 90 days, a sudden fall was recorded which heightened arsenic toxicity. However, GSH level does not correlate well with the glutathione reductase (GR) activity. Generation of ROS in zebrafish brain due to As2O3 exposure was further evidenced by significant alteration of glutathione peroxidase (GPx) and catalase (CAT) activity, which converts H2O2 to water and helps in detoxication. Moreover, enhanced mRNA level of nuclear factor (erythroid-derived 2)-like 2 (Nrf2) in As2O3 exposed zebrafish indicates a protective role of Nrf2. kelch-like ECH-associated protein 1 (Keap1), a negative regulator of Nrf2, inversely correlates with the mRNA expression of Nrf2. As2O3 induced toxicity was also validated by the alteration in NRF2 and NRF2 dependent expression of proteins such as heme oxygenase1 (HO1) and NAD(P)H dehydrogenase quinone1 (NQO1). The mRNA expression of glutathione peroxidase (Gpx1), catalase (Cat), manganese superoxide dismutase (Mn-Sod), copper/zinc superoxide dismutase (Cu/Zn Sod) and cytochrome c oxidase1 (Cox1) were also up regulated. The expression of uncoupling protein 2 (Ucp2), an important mitochondrial enzyme was also subdued in arsenic exposed zebrafish. The oxidative stress induced by arsenic also cause reduced mRNA expression of B-cell lymphoma 2 (Bcl2) present in the inner mitochondrial membrane and thereby indicating onset of apoptosis in treated fish. It is concluded that even a low dose of arsenic trioxide is toxic enough to induce significant oxidative stress in zebrafish brain. & 2014 Published by Elsevier Inc.
Keywords: Arsenic trioxide Brain Low dose mRNA expression Oxidative stress Zebrafish
1. Introduction Arsenic (As) is ranked among the top ten hazardous substances by the Agency for Toxic Substances and Disease Registry (ATSDR, 2007). Exposure to arsenic is of particular interest because of its extensive global impact (IARC, 1987) as a wide spread pollutant (Flora et al., 2005). In India and Bangladesh, millions of people are exposed to arsenic poisoning through drinking water, since the ground level arsenic concentration is quite high in some locations. People in these countries often use this water for crop irrigation resulting in the introduction of arsenic in the food chain through various plants including rice (Luong et al., 2007). The World Health
n
Corresponding author. Fax: þ 91 3463 261176. E-mail address: [email protected] (S. Bhattacharya).
http://dx.doi.org/10.1016/j.ecoenv.2014.05.012 0147-6513/& 2014 Published by Elsevier Inc.
Organization (WHO, 1993) has set the arsenic standard for drinking water at 10 mg/L. However, in many developing countries including India, 50 mg/L arsenic is considered as an acceptable level for drinking water (BIS, 2010; Smith and Smith, 2004). According to the US EPA aquatic life criteria, acceptable limit of total arsenic concentration is 340 mg/L for acute exposure and 150 mg/L for chronic exposure in fresh water. In the present study a concentration of 50 mg/L arsenic trioxide was used since it did not cause any mortality of the zebrafish. In aquatic toxicology, oxidative stress is an important area of research (Livingstone, 2001). Heavy metals generate reactive oxygen species (ROS) (Ahamed and Siddiqui, 2007; Ercal et al., 2001), disrupt signal transduction (Druwe and Vaillancourt, 2010; Thevenod, 2009), affect gene expression (Gonzalez et al., 2010) and induce DNA damage (Bertin and Averbeck, 2006). Arsenicinduced oxidative stress has also been the focus of toxicological
2
S. Sarkar et al. / Ecotoxicology and Environmental Safety 107 (2014) 1–8
research for the last decade to evaluate its possible mechanism of toxicity. Like other vertebrates, fish try to counter oxidative stress using the first line defense system such as glutathione, vitamin C or E, carotenoids (Alvarez et al., 2005) or radical-scavenging enzymes like superoxide dismutase (SOD), catalase (CAT) and glutathione peroxidase (GPx) (Valavanidis et al., 2006). Bhattacharya et al. (2007) reported induction of oxidative stress accompanied by reduction in antioxidant enzyme activities in Clarias batrachus exposed to arsenic trioxide (As2O3). Increase in the antioxidant responses in gills of zebrafish (Danio rerio) exposed for two days to arsenate (1 mg/L) and alterations in the antioxidant system in different tissues of common carp (Cyprinus carpio) on exposure to both arsenite and arsenate are on record (Ventura-Lima et al., 2009a,b). However, antioxidant responses in zebrafish brain have not received much attention. To understand the clinical syndromes of arsenic-induced human diseases, it is important to use in vivo animal models. Amongst several animal models, zebrafish (D. rerio) is a popular vertebrate model system in toxicology because of its several important features such as ease in obtaining a large number of animals, low husbandry costs and well established genetic and genomic tools, including the availability of complete genome sequence. Genomic studies have proven that zebrafish and human generally share a common set of genes including highly conserved and similarly regulated genes (Catchen et al., 2011; Woods et al., 2005). Arsenic induced adverse effects on nervous system are caused by their inactivation of acetylcholinesterase (AChE), a vital biomarker of neurotoxicity (Page and Wilson, 1985). Arsenic also reacts with the thiol groups of proteins and enzymes and inhibits the catalytic activity (Vahidnia et al., 2007). DeCastro et al. (2009) reported behavioral and neurotoxic effects of arsenic in zebrafish while Richetti et al. (2011) demonstrated inhibition of acetylcholinesterase by heavy metal exposure. The objective of this study was to determine the adverse effect of arsenic trioxide in zebrafish brain at the dose of 50 mg/L which is equivalent to 37.87 mg/L of arsenic.
(CDNB), hydrogen peroxide (H2O2), 5, 50 dithiobis-2-nitrobenzoic acid (DTNB) and trichloroacetic acid (TCA) were purchased from Sisco Research Laboratory, Mumbai, India. Thiobarbituric acid was procured from Himedia Laboratories Pvt. Ltd. Mumbai, India. Anti-nuclear factor (erythroid-derived 2)-like 2 (NRF2), kelch-like ECH-associated protein 1 (KEAP1), heme oxygenase1 (HO1), NAD(P)H dehydrogenase quinine 1(NQO1), heat shock protein (HSP70) and α-tubulin antibodies were purchased from Santa Cruz Biotechnology Inc. (Santa Cruz, CA, USA). All alkaline phosphatase (ALP) conjugated secondary antibodies, 5-bromo-4-chloro-3- indolyl phosphate/nitroblue tetrazolium (BCIP/NBT), TRI reagent and dichlorofluoresceindiacetate (DCFH-DA) were procured from Sigma Chemical Co. (St. Louis, MO, USA). Power SYBR Green PCR Master Mix (CAS 67-68-5) was purchased from Applied Biosystem, Warrington, UK. All other chemicals used were of analytical grade. 2.3. Experimental design At first, 96 h LC50 of zebrafish was determined according to the graphical interpolation method of Doudoroff et al. (1951). Briefly, fish were exposed to different concentrations of As2O3 (10–50 mg/L). As2O3 added water was replaced daily throughout the experiment. A concurrent control of 20 fish was maintained under identical conditions and water was replaced daily. Experimental data were plotted on semi-logarithmic coordinate paper with test concentration on the logarithmic scale and percentage of survival on the arithmetic scale. A straight line was drawn between the two points which are above and below the 50 percent survival line. The point of intersection with 50 percent survival line was considered LC50 and thus the LC50 value of zebrafish for As2O3 was found to be 17.5 mg/L. In the present study, adult, mature, healthy zebrafish were exposed to 50 mg/L (1/350 of 96 h LC50) As2O3 for 90 days at triplicate at each treatment concentration and 10 fish were sampled at 7, 15, 30, 60 and 90 days of exposure. Brain was dissected from each group of 10 fish and kept for further analyses. No death of fish was noted during the entire experimental period. 2.4. Biochemical assays Zebrafish brain was homogenized in Tris–HCl buffer (pH 7.4) and centrifuged at 12,000 g for 15 min at 4 1C. The supernatants were used for biochemical analysis. Reactive oxygen species (ROS) were measured using DCFH-DA according to LeBel et al. (1992). Lipid peroxidation and congugated diene (CD) were assayed according to Buege and Aust (1978). Reduced glutathione (GSH) was estimated according to Ellman et al. (1961) and glutathione S-transferase (GST) according to Habig et al. (1974). Peroxisomal catalase (CAT) and cytosolic glutathione reductase (GR) activities were assayed by the method of Aebi (1984) and Kenji (1999) respectively. 2.5. Gene expression measurement
2. Materials and methods 2.1. Fish care and maintenance Adult and healthy wild type zebrafish of both sexes were obtained from a local fish supplier (average weight 0.687 0.05 g and average length 3.95 7 0.07 cm) and kept in aquaria. Prior to arsenic trioxide exposure, they were acclimatized in water at 257 1 1C, with a photoperiod of 14-h light/10-h dark for a week. The fish were fed twice a day with commercial food (Optimum, Thailand) and water was changed daily to discard metabolic wastes. All animal experiments were performed according to the guidelines of Institutional Animal Ethics Committee (IAEC), Visva-Bharati University. 2.2. Test chemicals Arsenic trioxide (As2O3) (CAS no. 1327-53-3) was purchased from Loba Chemie Pvt. Ltd. Mumbai, India. Reduced glutathione (GSH), 1- chloro-2, 4-dinitrobenzene
Total RNA was extracted from 20 zebrafish brain using TRI reagent (SigmaAldrich Co., 3050 Spruce Street, St.Louis, MO 63103 USA) according to the manufacturer's protocol. The quality and quantity of RNA was checked and cDNA synthesized from 2 mg total RNA using M-MuLV reverse transcriptase (#EP0351, Thermo Fisher Scientific Inc, Waltham, MA, USA). Quantitative real time PCR was performed using 10ml of Power SYBR Green PCR Master Mix (Applied Biosystems, Warrington Cheshire WA1 4 SR, UK), 1 ml of each primer and 2.5 ml of the cDNA. The following PCR protocol was used for the Bio-Rad CFX Connect™ Real Time PCR detection System ( Bio-Rad, Hercules, CA, USA): denaturation for 3 min at 95 1C, followed by 40 cycles of 95 1C for 10 s, 60 1C for 15 s. Fluorescent signals were measured at the annealing/extension step. As a house-keeping gene, gapdh transcript was used to standardize the results by eliminating variations in mRNA and cDNA quantity and quality, and each mRNA level was expressed as its ratio to gapdh mRNA. PCRs were performed thrice, in three separate runs. The relative quantification of gene expression among treatment groups were analyzed by the 2 ΔΔct method (Livak and Schmittgen, 2001). Sequences of the primers are shown in Table 1.
Table 1 Primer sequences for quantitative PCR used in this study. Gene
Forward primer (from 50 to 30 )
Reverse primer (from 50 to 30 )
GenBank accession no.
Nrf2 Keap1 Gpx1 Cat Mn SOD Cu/Zn SOD Cox1 Ucp2 Bcl2 Gapdh
AACGAGTTCTCCCTTCAGCA TGGATAACTACCTCTATGCCGT CCCTCTGTTTGCGTTCCTGA CTCCTGATGTGGCCCGATAC AGCGTGACTTTGGCTCATTT CAACACAAACGGCTGCATCA GACTACCCAGACGCCTATGC CAAGGGGTTCATGCCATCCT AACCCAAATTCTGCGCAACG AAGTTGGTATTAACGGATTCGGT
ATTTTGTCGCCGATTTTGTC CCTTGGTTAAATCCACCTAACAC TCTTGAATGGTTCCCCGTCC TCAGATGCCCGGCCATATTC ATGAGACCTGTGGTCCCTTG TTTGCAACACCACTGGCATC GAGGGCAGCCGTGTAATCAT GCTCAACTGGAACTGCATGC ATCTACCTGGGACGCCATCT GTAGACTCCACAACATAAGTAGCA
BC152659.1 NM_182864.2 BC164790.1 AF170069.1 NM_199976.1 BC055516.1 AY996924.1 BC065607.1 AY695820.1 NM_001115114.1
S. Sarkar et al. / Ecotoxicology and Environmental Safety 107 (2014) 1–8
2.6. Determination of protein Brain protein was measured according to Lowry et al. (1951) using bovine serum albumin (BSA) as the standard. 2.7. Western blot 80 μg brain protein from the control and treated samples were resolved in 10 percent sodium dodecyl sulfate- polyacrylamide gel electrophoresis (SDS-PAGE) at a constant voltage (60 V) for 2.5 h and then blotted onto a polyvinylidene fluoride (PVDF) membrane with the help of a semi-dry trans blot apparatus (Bio-Rad Trans BlotR TurboTM, USA). The membranes were first incubated with primary antibodies at a dilution of 1:1000 over night at 4 1C, followed by 4 h incubation with corresponding ALP-conjugated secondary antibodies at 1:2000 dilutions on continuous rocking platform. The immuno reactive bands were detected using BCIP/NBT. 2.8. Statistical analysis Results are shown as Mean 7 Standard Error of the Mean (S.E.M.) of three individual assays and statistical analyses were done following one-way analysis of variance (ANOVA) test. The level of significance was set at P o0.05 or 0.01 and indicated by ‘n’ or ‘nn’ respectively.
3. Results 3.1. Arsenic trioxide induced oxidative stress in zebrafish brain The levels of reactive oxygen species (ROS), lipid peroxidation (in terms of MDA and CD content) and GSH were measured to
3
evaluate the extent of oxidative stress imposed on the zebrafish brain by a low dose of As2O3 exposure. In As2O3 treated zebrafish, the degree superoxide production, MDA and CD levels followed a triphasic pattern of response throughout the exposure. It is clearly depicted from Fig. 1A that the degree of ROS level in As2O3 treated samples enhanced in a time dependent manner and significantly increased until 15 days. However, the increase was transient recording a decrease at 30 days of exposure which significantly elevated towards the end of exposure. A similar trend of MDA (Fig. 1B) and CD (Fig. 1C) levels was noted in As2O3 treated samples as compared to the control. The generation of ROS was accompanied by a biphasic pattern of GSH level in As2O3 treated zebrafish. Interestingly, GSH level in the treated fish was found to increase (1.5–4 folds) gradually in a time dependent manner to reach its highest level at 60 days followed by a sharp decline towards the end of the exposure (Fig. 1D). 3.2. Arsenic trioxide induced damage to GSH regulatory proteins It is clearly depicted in Fig. 2A that GST, an important detoxifying enzyme, significantly decreased with increasing time of As2O3 exposure against control up to 30 days of exposure. But 30 days onwards, GST activity significantly elevated until 60 days followed by a sharp decline towards the end of the exposure. However, the activity of the enzyme GR, which plays an important role in maintaining the cellular GSH pool, was found to be significantly elevated at 7, 30 and 90 days in As2O3 treated zebrafish. However,
Fig. 1. Time dependent level of reactive oxygen species (ROS, A), malondialdehyde (MDA, B), conjugated diene (CD, C) and reduced glutathione (GSH, D) in zebrafish brain after exposure to 50 mg/L arsenic trioxide. The results are expressed as mean 7 S.E.M of triplicate samples.* indicates significant difference at Po 0.05 and **indicates significant difference at P o0.01.
4
S. Sarkar et al. / Ecotoxicology and Environmental Safety 107 (2014) 1–8
Fig. 2. Time dependent activities of glutathione-s-transferase (GST, A), glutathione reductase (GR, B), glutathione peroxidase (GPx, C), and catalase (CAT, D) in zebrafish brain after exposure to 50 mg/L arsenic trioxide. The results are expressed as mean7 S.E.M of triplicate samples.* indicates significant difference at P o 0.05 and ** indicates significant difference at Po 0.01.
the elevation in GR level was transient recording a decline at 15 and 60 days of treatment against control (Fig. 2B). Besides alteration in GR activity, GPx activity significantly enhanced up to 30 days of exposure. A slight decrease in GPx activity was noted at 60 days followed by its elevation to reach the highest level (4 folds) against control at the end of the exposure (Fig. 2C). As2O3 induced oxidative damage was also evidenced by the triphasic pattern of CAT activity. It is clearly depicted from Fig. 2D that CAT activity gradually elevated up to 15 days followed by a remarkable decline at 30 days of As2O3 exposure. However 30 days onwards, CAT activity significantly increased to reach its highest level at 60 and 90 days of exposure against control (Fig. 2D). 3.3. Alteration in mRNA level of detoxification genes In the present study, expression of several important biomarker genes designated for toxicological responses were assessed. A triphasic pattern was noted in mRNA level of Nrf2 in As2O3 exposed zebrafish until 90 days (Fig. 3A). During the experiment, mRNA level of Nrf2 initially increased up to seven days and then reduced towards the control level in treated samples. Interestingly, Nrf2 expression after 15 days onwards gradually increased throughout the exposure as compared to the control. However, a biphasic pattern was noted in mRNA level of Keap1 over the exposure. Keap1 mRNA level significantly enhanced until 15 days followed by a sharp decline towards the end of the exposure (Fig. 3B). Besides alteration in mRNA levels of Nrf2 and Keap1, an increasing trend in expression of manganese superoxide dismutase (Mn-Sod) and copper/zinc superoxide dismutase (Cu/Zn-Sod)
was noteworthy until 15 days. The increase was transient recording a decline until 60 days of exposure which significantly elevated towards the end of exposure (Figs. 3C and D). As2O3 induced oxidative stress at low dose was further confirmed by enhanced mRNA level of glutathione peroxidase (Gpx) and catalase (Cat) (Fig. 3E and F) and reduced level of cytochrome c oxidase 1 (Cox1) (Fig. 3G). 3.4. Alteration in expression of inner mitochondrial membrane genes Expression of mitochondrial inner membrane genes related to regulation of ROS production, respiratory chain and ATP synthesis is depicted in Fig. 4. Uncoupling protein 2 (Ucp2) and B-cell lymphoma2 (Bcl2) play an important role in regulation of ROS production and antioxidant activity. Interestingly, mRNA level of Ucp2 in As2O3 exposed zebrafish significantly increased until 15 days followed by a sharp depletion towards the end of the exposure (Fig. 4A). The mRNA level of Bcl2 significantly decreased with As2O3 exposure as compared to the control (Fig. 4B). 3.5. Activation of stress related proteins Immunoblot analysis showed increased NRF2 expression in As2O3 treated zebrafish brain towards the end of the exposure against control (Fig. 5). Contrastingly, KEAP1 expression increased until 15 days followed by a slight decrease after 30 days of As2O3 exposure. Moreover, NRF2 dependent proteins i.e. HO1 and NQO1 overall increased throughout the exposure against control. Induction of oxidative stress was further confirmed by the enhanced
S. Sarkar et al. / Ecotoxicology and Environmental Safety 107 (2014) 1–8
5
Fig. 3. Relative mRNA levels of nuclear factor (erythroid-derived 2)-like 2 (Nrf2, A), kelch-like ECH-associated protein 1 (Keap1, B), manganese superoxide dismutase (MnSOD, C) copper/zinc superoxide dismutase (Cu/Zn SOD, D), glutathione peroxidase (Gpx1, E), catalase (Cat, F) and cytochrome c oxidase 1(Cox1, G) in zebrafish brain after exposure to 50 mg/L As2O3. The results are expressed as mean 7 S.E.M of triplicate samples.* indicates significant difference at Po 0.05 and ** indicates significant difference at Po 0.01.
expression of HSP 70 (representing cellular stress) in treated zebrafish as compared to the control. Interestingly, the pattern of HSP 70 expression was biphasic and the highest peak was recorded at the end of the exposure (Fig. 5).
4. Discussion In the present investigation, exposure of zebrafish to 50 mg/L As2O3 for 90 days caused no mortality which confirms that the dose is low and within the limits of USEPAaquatic life criteria. It is known that in general, all heavy metals and metalloids, including arsenic, are potent inducers of oxidative stress (Kitchin, 2001). Pathways of xenobiotic metabolism in fish are analogous to higher vertebrates and equally potent in eliminating a multitude of xenobiotics (Bhattacharya et al. 2007; Sarkar, 1997). In addition, Suhendrayatna et al. (2001) reported maximum accumulation of arsenic in brain as compared to other organs of Tilapia mossambica and thus brain may act as an important target organ for arsenic toxicity in fish. Interestingly, the present data clearly indicate that As2O3 significantly induces oxidative stress in zebrafish brain at a low dose of exposure.
ROS essentially generates oxidative stress and compromises antioxidant defense. Treatment with low dose of As2O3 generates ROS in zebrafish brain and the induction continues till the end of the exposure (90 days). Significant increase in ROS was recorded at 15 days and the peak at 90 days. However, ROS generation diminished on 30 days of exposure. The initial increase in ROS was probably due to a direct effect of As2O3 on superoxide generation, through its toxicity to mitochondria or loss of mitochondrial membrane potential (Pourahmad et al., 2003; Woo et al., 2002). Parallel activation of the antioxidant defense system of the cell reduces ROS generation. However, continuous As2O3 exposure was commensurate with enhanced ROS generation over time. A general pathway of toxicity for several environmental pollutants is mediated by the enhancement of intracellular ROS, which modulates the occurrence of cell damage via initiation and propagation of LPO (Gutteridge, 1995). Arsenic is known to induce peroxidation of membrane lipids in various organisms. Peroxidative damage in Anabas testudineus was reported to be caused by chronic exposure to arsenic (Das et al., 1998). Roy et al. (2004) and Bhattacharya and Bhattacharya (2005) reported oxidative stress in two fresh water teleost species, Channa punctatus and C. batrachus exposed to
6
S. Sarkar et al. / Ecotoxicology and Environmental Safety 107 (2014) 1–8
Fig. 4. Relative mRNA levels of uncoupling protein 2 (Ucp2, A), and B-cell lymphoma2 (Bcl2, B) in zebrafish brain after exposure to 50 mg/L arsenic trioxide. The results are expressed as mean 7 S.E.M of triplicate samples. * indicates significant difference at Po 0.05 and ** indicates significant difference at P o0.01.
Fig. 5. Protein expression of nuclear factor (erythroid-derived 2)-like 2 (NRF2), kelch-like ECH-associated protein 1 (KEAP1), Heme oxygenase 1(HO1), NAD(P)H dehydrogenase quinone 1(NQO1) and heat shock protein (HSP70) in zebrafish brain after exposure to 50 mg/L arsenic trioxide. Immunoblots were representative of three independent experiments.
As2O3 at 1/10 and 1/20 LC50 doses for 14 days. Lipid peroxidation produces conjugated diene (CD) and malondialdehyde (MDA). The level of MDA production in zebrafish brain was found to be high till the end of exposure recording a slight decrease at 30 days and the highest peak at 90 days of exposure. The rate of induction of CD and MDA was parallel, apparently due to the fact that CD is the
precursor of MDA in the cascade of intermediates formed during lipid peroxidation. Interestingly, CD and MDA production closely resemble the pattern of ROS generation in a time dependent manner. Therefore, a direct correlation of ROS profile and lipid peroxidation might be indicative of oxidative stress in response to the nonlethal dose of As2O3. The production of ROS is a normal aspect of cellular metabolism, but increased production of ROS may lead to oxidative stress consequently impairing the cellular antioxidant defense system. GSH provides the reducing equivalent and play an important role in cellular antioxidant system (Bhattacharya and Bhattacharya, 2005). GSH reacts with metals non-enzymatically like other thiols (Bhattacharya et al., 2007; Dalal and Bhattacharya, 1991; Sarkar, 1997) and can also act as a superoxide quencher on its own, apart from its role as a substrate for GST and GPx (Saez et al., 1990). Glutathione is a major non-protein thiol in mammals and heavy metals that have a high affinity for sulfhydryl (–SH) groups conjugate with glutathione (Rabenstein, 1989). The glutathione conjugates are subsequently converted to mercapturic acids which are readily excreted into the bile or urine (Chasseaud, 1976). Most studies on the relationship between cellular glutathione level and arsenic toxicity inferred that glutathione has a protective role against arsenic induced toxicity (Bhattacharya, 2004). In the present study, GSH levels increased with the time of exposure and remain high until 30 days. Both acute and chronic inorganic arsenic exposure is known to induce GSH levels as a stress response, either through an increased cystine uptake or by the enhanced activity of γ-glutamyl-cystinyl ligase (GCL) enzyme (Schuliga et al., 2002). The increased level of GSH in response to As2O3 until 60 days may be due to its ability to react with trivalent inorganic arsenicals as well as MMAIII and DMAIII and other methylated products of arsenic (Styblo et al., 1997, 1996). At 90 days depletion in GSH level was noted which heightened arsenic toxicity. The rate of alterations in GST activity in the current study clearly indicated the role of GSH–GST in detoxification of As2O3. The low level of GST activity with a concomitant rise in GSH level in response to chronic As2O3 exposure indicates the degree of toxicity of As2O3. Moreover, inhibition of GST activity could be either through direct action of the metal on the enzyme or indirectly via the production of ROS that interacts directly with the enzyme and/or down regulates GST genes through different mechanisms (Roling and Baldwin, 2006).On the other hand, a sudden increase in GST activity at 60 days of exposure indicates removal of arsenic from the brain of zebrafish. Since oxidative stress is the first response to environmental stressors (Livingstone, 2001), brain cells may initially stimulate antioxidant and detoxification responses to counter arsenic insult. The involvement of anti-oxidative enzymes such as GR, GPx and CAT play an important role in protecting cells from oxidative stress. The main function of glutathione reductase (GR) is to maintain the cellular homeostasis of GSH and GSSG ratio or the redox balance of the cell. In this study, GR activity increased at 7, 30 and 90 days of exposure. A significant inhibition was noted in GR activity which might be due to formation of high level of methylated trivalent arsenicals (Styblo and Thomas, 1995; Styblo et al., 1997; Chouchane and Snow, 2001). However, at 90 days, increase in GR activity was related to significant depletion of GSH. The generation of ROS in zebrafish brain due to As2O3 exposure was further evidenced by significant increase of glutathione peroxidase (GPx) and catalase (CAT) activity, which converts H2O2 to water and helps in detoxication. Thus, it is plausible that an increase in the activities of these enzymes contributes to the elimination of superoxide radicals from the cell. Similar results have been also reported by Bhattacharya and Bhattacharya (2005). GPx activity was found to corroborate well with ROS generation
S. Sarkar et al. / Ecotoxicology and Environmental Safety 107 (2014) 1–8
during As2O3 exposure to zebrafish. The increase in the GPx activity was found to be most prompt and stable throughout the exposure indicating the importance of this enzyme to combat oxidative stress generated in response to As2O3. Environmental contaminants causing oxidative stress are accompanied by the induction of antioxidant enzymes in fish as evidenced by Shi and Zhou (2010). They reported that perfluorooctanesulfonic acid (PFOS) exposure induced significant generation of ROS in zebrafish embryos, which in turn alters antioxidant enzymes to prevent oxidative damage. Richetti et al. (2011) also reported alterations in antioxidant capacity in the brain of zebrafish exposed to zinc chloride, mercury chloride, lead acetate and cadmium acetate. In the current study, enhanced levels of superoxide induced significant elevation of CAT activity which clearly indicates stimulation of the antioxidant defense system in zebrafish brain to combat As2O3 induced oxidative stress. Decrease in CAT activity at 30 days due to less amount of ROS production in As2O3 treated zebrafish. Nrf2–Keap1 system is present not only in mammals, but also in fish, suggesting that its role in cellular defense is conserved throughout evolution among vertebrates (Kobayashi and Yamamoto, 2005). A large number of antioxidant genes have also been identified in zebrafish (Craig et al., 2007; Liu et al., 2008), amongst which Nrf2 plays an important role in arsenic induced detoxification (Chen and Sung, 2005). In the present study, enhanced expression of Nrf2 in As2O3 exposed zebrafish indicates a protective role of Nrf2. Keap1, a negative regulator of Nrf2, inversely correlates with the mRNA expression of Nrf2. As2O3 induced toxicity was also validated by the alteration in NRF2 and NRF2 dependent expression of proteins such as HO1 and NQO1. Heat shock proteins (Hsp) expressed in numerous tissues of several animal species and their presence is often associated with a response to a harmful stress situation or to adverse life conditions. In the present investigation, HSP70 expression is high at 15 days, at 30 days it is downregulated and again increased at the end of exposure which may be due to a continuous As2O3 exposure for 90 days. The role of superoxide dismutase (SOD) is to detoxify superoxide radicals. Its activity in detoxication is critical because it generates cytotoxic H2O2 during detoxication of O2 d radical. Thus, activation of SOD requires concomitant activation of cytosolic GPx and/or catalase activity to protect cells from oxidative stress (Halliwell and Gutteridge, 1999). The mRNA expression of Mn-Sod and Cu/Zn Sod increased until 15 days of exposure followed by a gradual decline at 30 days which regained at end of exposure. In addition, increasing pattern in mRNA levels of Gpx and Cat was also noted until 30 days which slightly decreased at 60 days and then regained at the end of the exposure. The mRNA expression of these antioxidant genes did not correlate well with ROS production. The present findings suggest that these enzymes are controlled by transcriptional regulation rather by enzyme activity. A similar result was reported by Jin et al. (2010). They reported that, some antioxidant enzymes are controlled by enzyme activity and not by transcriptional levels, at least in case of SOD and CAT in zebrafish. It is possible that mRNA levels represent a snapshot of the cell activity at any given time and the protein activity might be regulated at the post-transcriptional level. Similarly, Olsvik et al. (2005) were not able to link hyperoxia induced mRNA expression of Cu/Zn Sod, Cat or Gpx in the liver of smoltifying salmon after long periods of exposure to 130 percent O2, even though GSH level suggested that an increased oxidative stress might have occurred. Craig et al. (2007) demonstrated that in copper exposure there was no association between increased transcription and enzyme activities related to the antioxidant stress in zebrafish. Alteration in mRNA level of Cox1 further confirms the stress condition of the treated fish. Ucp2 is involved in reduced production of superoxides during mitochondrial
7
electron transport (Giardina et al., 2008; Jin et al., 2010) which may be a plausible reason for initial activation of Ucp2 in the brain of zebrafish exposed to As2O3. Excess ROS generation by As2O3 with increasing time may be responsible for a reduced Ucp2 mRNA level. Such alterations in mRNA levels of several biomarker genes against As2O3 induced toxicity is reported here. However, depletion in mRNA level of Bcl2 suggests induction of apoptosis in the brain of zebrafish exposed to As2O3 at a low dose of 50 mg/L (1/ 350 LC50).
5. Conclusion It is concluded that As2O3 (50 mg/L) promotes oxidative stress in zebrafish brain affecting antioxidant enzyme (GST, GR, GPx and CAT) activities, endogenous GSH and MDA and also the mRNA levels of genes which encode antioxidant proteins (Nrf2, Keap1, Mn-Sod, Cu/Zn-Sod, Gpx, Cat), mitochondrial membrane proteins (Ucp2 and Bcl2) and proteins related to mitochondrial respiratory chain and ATP synthesis (such as Cox1). To the best of our knowledge, this is the first report on induction of oxidative stress by a low dose of As2O3 in the zebrafish brain.
Acknowledgments SS and SM are grateful to UGC, New Delhi for Research Fellowship in Science for Meritorious Students (RFSMS). SB acknowledges National Academy of Science, India (Grant No. NASI/323/12/20102011) for Senior Scientist Platinum Jubilee Fellowship. References Aebi, H., 1984. Catalase in vitro. Methods Enzymol. 105, 121–126. Agency for Toxic Substances and Disease Registry (ATSDR), 2007. Toxicological Profile for Arsenic. U.S. Department of Health and Human Services, Public Health Services, Atlanta, GA. Ahamed, M., Siddiqui, M.K., 2007. Low level lead exposure and oxidative stress: current opinions. Clin. Chim. Acta 383, 57–64. Alvarez, R.M., Morales, A.E., Sanz, A., 2005. Antioxidant defenses in fish: biotic and abiotic factors. Rev. Fish Biol. Fish. 15, 75–88. Bertin, G., Averbeck, D., 2006. Cadmium: cellular effects, modifications of biomolecules, modulation of DNA repair and genotoxic consequences (a review). Biochimie 88, 1549–1559. Bhattacharya, A., Bhattacharya, S., 2005. Induction of oxidative stress by arsenic in Clarias batrachus: involvement of peroxisomes. Ecotoxicol. Environ. Saf. 66, 178–187. Bhattacharya, S., Bhattacharya, A., Roy, S., 2007. Arsenic-induced responses in freshwater teleosts. Fish Physiol. Biochem. 33, 463–473. Bhattacharya, A., 2004. Intoxication signals, detoxication signals, and peroxisomal response of Clarias batrachus to arsenic (Ph.D. dissertation). Visva-Bharati University, Santiniketan, India. Buege, J.A., Aust, S.D., 1978. Microsomal lipid peroxidation. In: Fleischer, S., Packer, L. (Eds.), Methods in Enzymology. Academic Press, New York, pp. 302–310. Bureau of Indian Standard (BIS), 2010. Ground Water Quality in Shallow Aquifers of India. Central Ground Water Board, Ministry of Water Resources, Government of India, Faridabad. Catchen, J.M., Amores, A., Hohenlohe, P., Cresko, W., Postlethwait, J.H., 2011. Stacks: building and genotyping loci de novo from short-read sequences. G3: Genes Genomes Genet. 1, 171–182. Chasseaud, L.F., 1976. Conjugation with glutathione and mercapturic acid excretion. In: Arias, I.M., Jakoby, W.B. (Eds.), Glutathione: Metabolism and Function. Raven Press, New York, pp. 77–114. Chen, W.L., Sung, H.H., 2005. The toxic effect of phthalate esters on immune responses of giant freshwater prawn (Macrobrachium rosenbergii) via oral treatment. Aquat. Toxicol. 74, 160–171. Chouchane, S., Snow, E.T., 2001. in vitro effect of arsenical compounds on glutathione-related enzymes. Chem. Res. Toxicol. 14, 517–522. Craig, P.M., Wood, C.M., McClelland, G.B., 2007. Oxidative stress response and gene expression with acute copper exposure in zebrafish (Danio rerio). Am. J. Physiol. Regul. Integr. Comp. Physiol. 293, 1882–1892. Dalal, R., Bhattacharya, S., 1991. Effect of chronic nonlethal doses of nonmetals and metals on hepatic MT in Channa punctatus (Bloch). Indian J. Exp. Biol. 29, 693–694. Das, D., Sarkar, D., Bhattacharya, S., 1998. Lipid peroxidative damage by arsenic intoxication is countered by gluthione-glutathione S-transferase system and
8
S. Sarkar et al. / Ecotoxicology and Environmental Safety 107 (2014) 1–8
metallothionein in the liver of climbing perch, Anabas testudineus. Biomed. Environ. Sci. 11, 187–195. DeCastro, M.R., Ventura Lima, J., deFreitas, D.P.S., deSouza Valente, R., Dummer, N.S., deAguiar, R.B., dosSantos, L.C., Marins, L.F., Geracitano, L.A., Monserrat, J.M., Barros, D.M., 2009. Behavirol and neurotoxic effects of arsenic exposure in zebrafish (Danio rerio, Teleostei: Cyprinidae). Comp. Biochem. Physiol. C 150, 337–342. Doudoroff, P., Anderson, B.G., Burddic, D.E., Galtsoff, P.S., Hart, W.B., Patric, R., Strong, E.R., Shurber, E.W., Van Horn, W.M., 1951. Bioassay methods for the evaluation of acute toxicity of industrial wastes to fish. Sew. Ind. Wastes 23, 1380–1397. Druwe, I.L., Vaillancourt, R.R., 2010. Influence of arsenate and arsenite on signal transduction pathways: an update. Arch. Toxicol. 84, 585–596. Ellman, G.L., Courtney, K.D., Andres, V., FeatherstoneJr., 1961. A new and rapid colorimetric determination of Acetylcholinesterase activity. Biochem. Pharmacol. 7, 88–95. Ercal, N., Gurer-Orhan, H., Aykin-Burns, N., 2001. Toxic metals and oxidative stress part I: mechanisms involved in metal-induced oxidative damage. Curr. Top. Med. Chem. 1, 529–539. Flora, S.J.S., Bhadauria, S., Pant, S.C., Dhaked, R.K., 2005. Arsenic induced blood and brain oxidative stress and its responses to some thiolchelators in rats. Life Sci. 77, 2324–2337. Giardina, T.M., Steer, J.H., Lo, S.Z., Joyce, D.A., 2008. Uncoupling protein-2 accumulates rapidly in the inner mitochondrial membrane during mitochondrial reactive oxygen stress in macrophages. Biochem. Biophys. Acta Bioenerg. 1777, 118–129. Gonzalez, H.O., Hu, J., Gaworecki, K.M., Roling, J.A., Baldwin, W.S., Gardea-Torresdey, J.L., Bain, L.J., 2010. Dose-responsive gene expression changes in juvenile and adult mummichogs (Fundulus heteroclitus) after arsenic exposure. Mar. Environ. Res. 70, 133–141. Gutteridge, M.C., 1995. Lipid peroxidation and antioxidants as biomarker of tissue damage. Clin. Chem. 41, 1819–1828. Habig, W.H., Pabst, M.J., Jacoby, W.B., 1974. Glutathione-S-transferase. The first enzymatic step in mercapturic acid formation. J. Biol. Chem. 249, 7130–7139. Halliwell, B., Gutteridge, J.M.C., 1999. Free radicals in Biology and Medicine. Oxford Science Publication, Oxford University Press Inc., New York. IARC Monographs on the Evaluation of the Carcinogenic Risks to Humans, 1987. Suppl. 7, Overall Evaluations of Carcinogenicity: An Updating of IARC Monographs, Volumes 1–42. Jin, Y., Zhang, X., Shu, L., Chen, L., Sun, L., Qian, H., Liu, W., Fu, Z., 2010. Oxidative stress response and gene expression with atrazine exposure in adult female zebrafish (Danio rerio). Chemosphere 78, 846–852. Kenji, A., 1999. Glutathione reductase. In: Gutteridge, J.M.C., Taniguchi, N. (Eds.), Experimental Protocols for Reactive Oxygen and Nitrogen Species. Oxford University Press, New York, pp. 81–82. Kitchin, K.T., 2001. Recent advances in arsenic carcinogenesis: modes of action, animal model systems, and methylated arsenic metabolites. Toxicol. Appl. Pharm. 172, 249–261. Kobayashi, M., Yamamoto, M., 2005. Molecular mechanisms activating the Nrf2Keap1 pathway of antioxidant gene regulation. Antioxid. Redox Signal. 7 (3–4), 385–394. LeBel, C.P., Ischiropoulos, H., Bondy, S.C., 1992. Evaluation of the probe 20 , 70 dichlorofluorescin as an indicator of reactive oxygen species formation and oxidative stress. Chem. Res. Toxicol. 5, 227–231. Liu, Y., Wang, J.S., Wei, Y.H., Zhang, H.X., Xu, M.Q., Dai, J.Y., 2008. Induction of time dependent oxidative stress and related transcriptional effects of perfluorododecanoic acid in zebrafish liver. Aquat. Toxicol. 89, 242–250. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using real- time quantitative PCR and the 2 ΔΔct method. Methods 25, 402–408. Livingstone, D.R., 2001. Contaminant-stimulated reactive oxygen species production and oxidative damage in aquatic organisms. Mar. Pollut. Bull. 42, 656–666. Lowry, O.H., Rosebrough, N.J., Farr, A.L., Randall, R.J., 1951. Measurement of protein with the Folin phenol reagent. J. Biol. Chem. 193, 265–275. Luong, J.H.T., Majid, E., Male, K.B., 2007. Analytical tools for monitoring arsenic in the environment. Open Anal. Chem. J. 1, 7–14. Olsvik, P.A., Kristensen, T., Waagbo, R., Rosseland, B.O., Tollefsen, K.E., Baeverfjord, G., Berntssen, M.H., 2005. mRNA expression of antioxidant enzymes (SOD,CAT and GSH-Px) and lipid Peroxidative stress in liver of Atlantic salmon (Salmo salar) exposed to hyperoxic water during smoltification. Comp. Biochem. Physiol. C 141, 314–323.
Page, J.D., Wilson, I.B., 1985. Acetylcholinesterase: inhibition by tetranitromethane and arsenite. Binding of arsenite by tyrosine residues. J. Biol. Chem. 260, 1475–1478. Pourahmad, J., O’Brien, P.J., Jokar, F., Daraei, B., 2003. Carcinogenic metal inducedsites of reactive oxygen species formation in hepatocytes. Toxicol. in vitro 17, 803–810. Rabenstein, D.L., 1989. Metal complexes of glutathione and theirbiological significance. In: Dolphin, D., Avramovic, O., Poulson, R. (Eds.), Glutathione: Chemical, Biochemical and Medical Aspect. Wiley, New York, pp. 147–186. Richetti, S.K., Rosemberg, D.B., Ventura-Lima, J., Monserrat, J.M., Bogo, M.R., Bonan, C.D., 2011. Acetylcholinesterase activity and antioxidant capacity of zebrafish brain is altered by heavy metal exposure. Neurotoxicology 32, 116–122. Roling, J.A., Baldwin, W.S., 2006. Alteration in hepatic gene expression by trivalent chromium in Fundulus heteroclitus. Mar. Environ. Res. 62, 122–127. Roy, S., Bhattacharya, A., Roy, S., Bhattacharya, S., 2004. Arsenic induced lipid peroxidation at non-lethal doses. In: Bhattacharya, S., Maitra, S.K. (Eds.), Current Issues in Environmental and Fish Biology. Daya Publishing House, Delhi, pp. 52–63. Saez, G.T., Bannister, W.H., Bannister, J.V., 1990. Free radicals and thiol compoundsThe role of glutathione against free radical toxicity. In: Vina, J. (Ed.), Glutathione : Metabolism and Physiological Functions. CRC Press, Boca Raton, Fl, USA, pp. 237–254. Sarkar, D., 1997. Role of reduced glutathione, glutathione-S-transferase, metallothionein and lipid peroxidation in the detoxication mechanism in Ananbas testudineus (Bloch) (Ph.D. dissertation). Visva-Bharati University, Santiniketan, India. Schuliga, M., Chouchane, S., Snow, E.T., 2002. Upregulation of Glutathione related genes and enzyme activities in cultured human cells by sublethal concentration of inorganic arsenic. Toxicol. Sci. 70, 183–192. Shi, X.J., Zhou, B.S., 2010. The role of Nrf2 and MAPK pathways in PFOS-induced oxidative stress in zebrafish embryos. Toxicol. Sci. 115, 391–400. Smith, A.H., Smith, M.M., 2004. Arsenic drinking water regulations in developing countries with extensive exposure. Toxicology 198, 39–44. Styblo, M., Serves, S.V., Cullen, W.R., Thomas, D.J., 1997. Comperative inhibition of yeast glutathione reductase by arsenicals and arsenothiols. Chem. Res. Toxicol. 10, 27–33. Styblo, M., Thomas, D.J., 1995. in vitro inhibition of glutathione reductase by arseno triglutathione. Biochem. Pharmacol. 49, 971–974. Styblo, M., Delnomdedieu, M., Thomas, D.J., 1996. Mono and dimethylation of arsenic in rat liver cytosol in vitro. Chem. Biol. Interact. 99, 147–164. Suhendrayatna, Ohki, Nakajima, A., Maeda, S., T., 2001. Metabolism and organ distribution of arsenic in the freshwater fish Tilapia mossambica. Appl. Organometal. Chem. 15, 566–571. Thevenod, F., 2009. Cadmium and cellular signaling cascades: to be or not to be? Toxicol. Appl. Pharmacol. 238, 221–239. USEPA, 〈http://water.epa.gov/scitech/swguidance/standards/criteria/current/index. cfm#A〉. Vahidnia, A., vanderVoet, G.B., deWolf, F.A., 2007. Arsenic nurotoxicity—a review. Hum. Exp. Toxicol. 26, 823–832. Valavanidis, A., Vlahogianni, T., Dassenkis, M., Scoullos, M., 2006. Molecular biomarker of oxidative stress in aquatic organisms in relation to toxic environmental pollutants. Ecotoxicol. Environ. 64, 178–189Saf 64, 178–189. Ventura-Lima, J., Castro, M.R., Acosta, D., Fattorini, D., Regoli, F., Carvalho, L.M., Bohrer, D., Geracitano, L.A., Barros, D.M., Silva, R.S., Bonan, C.D., Bogo, M.R., Monserrat, J.M., 2009a. Effects of arsenic (As) exposure on the antioxidant status of gills of the zebrafish Danio rerio (Cypridinae). Comp. Biochem. Physiol. C 149, 538–543. Ventura-Lima, J., Fattorini, D., Regoli, F., Monserrat, J.M., 2009b. Effects of different inorganic arsenic species in Cyprinus carpio (Cyprinidae) tissues after shorttime exposure: bioaccumulation, biotransformation and biological responses. Environ. Pollut. 157, 3479–3484. WHO, 1993. Guidelines for Drinking Water Quality: Recommendations, 1. World Health Organization, Geneva. Woo, S.H., Park, C.I., Park, M.J., Lee, H.C., Lee, S.J., Chun, Y.J., Lee, S.H., Hong, S.I., Rhee, C.H., 2002. Arsenic trioxide induces apoptosis through reactive oxygen speciesdependent pathway and loss of mitochondrial membrane potential in HeLa cells. Int. J. Oncol. 21, 57–63. Woods, I.G., Wilson, C., Friedlander, B., Chang, P., Reyes, D.K., Nix, R., Kelly, P.D., Chu, F., Postlethwait, J.H., Talbot, W.S., 2005. The zebrafish gene map defines ancestral vertebrate chromosomes. Genome Res. 15, 1307–1314.