Low glycaemic index foods from wild barley and amylose-only barley lines

Journal of Functional Foods 40 (2018) 408–416

Contents lists available at ScienceDirect

Journal of Functional Foods journal homepage: www.elsevier.com/locate/jff

Low glycaemic index foods from wild barley and amylose-only barley lines a,⁎

b

c

T

d

Domenico Sagnelli , Simona Chessa , Giuseppina Mandalari , Mario Di Martino , Waraporn Sorndeche, Gianfranco Mamonef, Eva Vinczeg, Grégoire Buillona, ⁎ Dennis Sandris Nielsena, Maria Wiesea, Andreas Blennowa, Kim H. Hebelstrupg, a

University of Copenhagen, Frederiksberg C, Denmark Institute of Food Research, Norwich, United Kingdom c University of Messina, Messina, Italy d University of Napoli, Napoli, Italy e Suranaree University of Technology, Nakhon Ratchasima, Thailand f Institute of Food Sciences, CNR, Avellino, Italy g Aarhus University, Slagelse, Denmark b

A R T I C L E I N F O

A B S T R A C T

Keywords: Diabetes Hordeum spontaneum Transgenic food Resistant starch Glycaemic index Dietary fibre Beta-glucan

In this study, we explored possibilities to develop low glycaemic-index foods from barley (Hordeum vulgare – Hv). Barley has a potential to suppress postprandial blood glucose levels, possibly because of its high content of β-glucan (BG). BG content is particularly high in Hordeum vulgare Subsp. spontaneum (Hs), which is the wild ancestor of cultivated barley. Increasing amylose content in starch is another way to decrease the glycaemic index of a starch-rich-food. Therefore, a recently developed Amylose-only barley grain (AO) containing a 99% amylose starch was included. Two in vitro gastro-intestinal models were used to predict glycaemic indices (pGIs). Grains and bread from Hs and AO showed lower pGIs as compared to Hv. The low pGI value of AO was due to the resistant starch. The low pGI of Hs barley grains was caused by increased viscosity of the digesta. A simulated colon was used to predict potential effects on microbiota.

1. Introduction Since 2007, diabetes mellitus (DM) has been considered to be epidemic by the Centre for Disease Control and Prevention (NCC-CC, 2008). DM causes high postprandial blood glucose levels. Pioneering research revealed the effects of specific foods on suppressing postprandial blood glucose level (Jenkins et al., 1988). It is now well established that a diet rich in dietary fibres (DF) supports a decrease in postprandial blood glucose level, facilitate the satiety and has antioxidant and anti-inflammatory properties (Dikeman & Fahey, 2006; Giuberti, Gallo, Moschini, & Masoero, 2015; Marciani et al., 2001). However, the mechanisms behind these effects are diverse, interlinked, and not well clarified. Starch is one of the most abundant crop polysaccharides on earth and therefore a major source of post-prandial blood glucose. Starch consists of two major components, amylose and amylopectin, which differ in their branching and molecular size. Amylose is a linear polymer composed of α(1-4) linked glucose units. Amylopectin is a highly branched polymer with α(1-4) linked D-glucose backbone and ∼5% of α(1-6) linked branches (Damager, Engelsen, Blennow, Møller,

⁎

& Motawia, 2010). Dietary starch is mostly digested in the small intestine by pancreatic α-amylase (EC 3.2.1.1) and mucosal α-glucosidases (EC 3.2.1.20). The latter consists of two membrane-bound protein complexes, maltase-glucoamylase (MGAM) and sucrase-isomaltase (SI) (Dhital, Lin, Hamaker, Gidley, & Muniandy, 2013). Only a part of the ingested starch is hydrolyzed and absorbed in the small intestine. The non-digested fraction, defined as resistant starch (RS) reaches the colon where it is fermented and acts as a prebiotic food (Englyst & Hudson, 1996; Englyst, Kingman, Hudson, & Cummings, 2007). It is possible that minor parts of the RS may even escape the colon to be excreted in faeces. For these reasons, RS is classified as a type of dietary fibre. Starches with higher amylose fractions have been shown to produce more RS (Carciofi et al., 2012). Several studies describe attempts to increase amylose content in the starch fraction of various crops. However, so far the only crop type that produces an amylose-only (> 99%) type of starch was reported by us in 2012 (Carciofi et al., 2012). Cereal grains are a major worldwide food and feed source, and it is valued for its high content of complex carbohydrates and high amount of soluble and insoluble dietary fibres. On a global scale, barley grain is used mostly for animal feed (65%) and in beer and other alcohol

Corresponding authors. E-mail addresses: [email protected] (D. Sagnelli), [email protected] (K.H. Hebelstrup).

https://doi.org/10.1016/j.jff.2017.11.028 Received 28 July 2017; Received in revised form 20 November 2017; Accepted 20 November 2017 1756-4646/ © 2017 Elsevier Ltd. All rights reserved.

Journal of Functional Foods 40 (2018) 408–416

D. Sagnelli et al.

2. Materials and methods

productions (33%) and only little for direct human consumption (2%) (Idehen, Tang, & Sang, 2017). However, there is an increasing consumer interest in barley-based food, because of its health-promoting potentials. The high content of phytonutrients in the whole barley grain has tremendous effects on dietary metabolism and health. Wheat fibres, including the predominately-insoluble arabinoxylan, showed a weaker effect on reducing postprandial blood sugar levels as well as on lowering transit time control compared to barley (Harland, 2015a, 2015b). Hordeum vulgare Subsp. spontaneum (Hs, wild barley) is the wild ancestor of the modern barley and is interfertile with it. However, due to the domestication syndrome, the morphology of the two plants differs significantly, which is believed to be caused by human selection under cultivation of the plant (Hebelstrup, 2017). The major differences are of agronomic importance. For example, Hs barley has brittle rachis, which helps to facilitate the dispersion of seeds, whereas this trait has been lost during the event(s) of domestication of Hordeum vulgare making the plants more manageable from an agronomic point of view (Pourkheirandish et al., 2015). Another example is grain size, where cultivated barley produces much larger and plump grains than those of Hs barley plants. Not only morphologic but also nutritional traits were significantly changed during the evolution of cereal crops because of selection under domestication. In particular, the grain's composition of nutrients changed trough domestication to favour the starch content at the expenses of many bioactive constituents. An example is represented by the β-glucans (BG) β(1-3) β(1-4) mixed-linkage (BG). BGs are present in modern barley with an average content of around 5% of the dry mass. However, the content of BGs in Hs barley grain was found to be 8–10% (Ferrari, Finocchiaro, Stanca, & Gianinetti, 2009; Jilal, Grando, Henry, Rice, & Ceccarelli, 2013; Stuart, Loi, & Fincher, 1988). BGs are part of the cell wall in both aleurone and endosperm tissues of the grain. Oats and barley are the only cereal grains with significant amounts of BG. This polysaccharide is a multifunctional dietary fibre with food health benefits. BG is one of the major non-cellulosic polysaccharides among those found in grasses. β(1-3) β(1-4) mixed-linkage BG structure composed predominantly of cellotriosyl (β(1-4), DP3) and cellotetraosyl (β(1-4), DP4) residues connected via single β(1-3) linkages. The relative distribution and amounts of the triosyl, tetraosyl and longer blocks along the BG chain are essential for the physical aggregation and the solubility of BG. As an effect, more repetitive structures in BG results in more aggregation and lower solubility. The molecular structure of BG varies for different crops and is important for its physical properties like viscosity or molecular weight (Gemen, de Vries, & Slavin, 2011; Lazaridou & Biliaderis, 2007; Lazaridou, Biliaderis, & Izydorczyk, 2003; Lazaridou, Biliaderis, Micha-Screttas, & Steele, 2004; Mikkelsen, Jespersen, Larsen, Blennow, & Engelsen, 2013; Tiwari & Cummins, 2012; Tiwari et al., 2011). Human intervention has shown that intake of BG shifts colonic microbiota towards increased production of short chain fatty acids (van Zanten et al., 2012) and interestingly, whole grain meals can reduce second meal appetite, possibly as an effect of changes in colonic fermentation (Ibrügger et al., 2014). In this study, we have conducted in vitro digestions simulating that of the upper gastrointestinal tract (GI). The models used were a static in vitro digestion (Minekus et al., 2014) and a dynamic gastric model (DGM - The Model gut©). These are in vitro techniques that simulate the physio-chemical and mechanical conditions found in human gastric and duodenal digestion. Our results show that a diet based on either wildbarley (Hs) or genetically engineered amylose-only (AO) barley grain may potential have suppressing and anti-diabetic effects on post-prandial blood glucose levels. The data revealed very different mechanisms for the two types of barley grains.

2.1. Materials Grains of wild-type (WT) barley (Hordeum vulgare cv Golden Promise, Hv), wild barley Hordeum vulgare subsp. spontaneum (The Nordic Gene Bank, accession number NGB7313-2, Hs) and amyloseonly (AO, a line where starch in the grains consists of > 99% amylose) (Carciofi et al., 2012) were propagated in a greenhouse at Aarhus University, Flakkebjerg (55°19′26.4″N 11°23′26.8″E). All chemicals and enzymes used were provided by Sigma-Aldrich (St. Louis, MO, USA), unless otherwise stated. Grains were milled to produce whole grain flour in a Fidibus 21 tabletop miller (KoMo GmbH, Otzberg-Lengfeld, Germany). 2.2. Methods 2.2.1. BG and starch content Total starch and BG content of meals were measured using Megazyme International Ltd. (USA) kits. The BG content was determined using the β-Glucan Assay AACC Method 32-23.01, AOAC Method 995.16, EBC Methods 3.11.1, 4.16.1 and 8.11.1 ICC Standard Method No. 166, Codex Type II Method. Starch content was determined using the total starch AOAC method 996.11/AACC method 76.13. Glucose content was analysed by the PGO enzyme system (Glucose Oxidase/Peroxidase - P7119 Sigma-Aldrich). The amylose:amylopectin ratio was estimated using the iodide solution method (Bay-Smidt, Blennow, Bojko, & Møller, 1999). 2.2.2. Hordein extraction and SDS-polyacrylamide gel electrophoresis Mature barley grains were milled using a KoMo Fidibus 21 corundum/ceramic mill. Barley alcohol-soluble proteins (hordeins) were extracted from 50 mg of flour using 0.500 ml 70% ethanol solution and magnetically stirred for 60 min at 20 °C. Proteins in the supernatant were recovered after drying, separated on SDS-PAGE and stained with Coomassie blue G-250 using HiMark™ Pre-stained protein standard (Novex® by Life Technologies™) as Mw standard. 2.2.3. α-Amylase inhibitor extraction and characterization Protein extraction. Proteins were extracted from 100 mg of flour by 1 ml of 50 mM Tris-HCl pH 7.8, 100 mM KCl, 5 mM EDTA, for 20 min at 23 °C under continuous mixing. The mixture was centrifuged at 10,000g for 20 min and extraction of the pellet repeated twice. Chloroform/ methanol (CM) soluble proteins were extracted by adding 5 volumes of 0.1 M ammonium formate in methanol to the supernatant incubated at 4 °C overnight, centrifuged at 10,000g for 20 min. The pellet (CM insoluble) was discarded. Proteins were recovered from the supernatant by precipitation with cold acetone and stored at −20 °C. Proteomic analysis. Proteins were analysed by SDS-PAGE (Bio-rad, Mini-Protean) using precasted linear gels (TGX Gel 12% acrylamide). Protein bands were excised, destained by repeated washing with 25 mM Ambic in 50% acetonitrile, digested at 37 °C with trypsin (12.5 ng/μl) in 25 mM Ambic and peptides extracted in 5% formic acid/acetonitrile (1/ 1, v/v). Digested samples were lyophilized in a rotor evaporator centrifuge. LC-MS/MS mass spectrometry was performed using a Q Exactive Orbitrap mass spectrometer (Thermo Scientific, San Jose, CA, USA), online coupled with an Ultimate 3000 UH-LC instrument (Thermo Scientific). The protocol for LC-MS/MS analysis was performed according to Di Stasio and coworkers (Di Stasio et al., 2017). 2.2.4. In vitro static digestion of cooked grains Barley grains were cooked in boiling water for 40 min and cooled to room temperature. A standardized static in vitro digestion method was used with slight modifications (Minekus et al., 2014). The simulated digestion fluids: Simulated Salivary Fluid (SSF, pH 7), Simulated Gastric Fluid (SGF, pH 2) and Simulated Intestinal Fluid (SIF, pH 3) were 409

Journal of Functional Foods 40 (2018) 408–416

D. Sagnelli et al.

Castello, & Vidal-Brotons, 2013). Amylase inhibition was measured by determining the decreasing absorbance of iodine-starch complexes at 580 nm using gelatinized Zea mays starch as substrate. The experiment was performed in a 96 wells plate measuring the absorbance for 30 min during a time-course. The reaction was stopped with a diluted iodide solution every 5 min. The viscosity during the cooking and amylolytic process were monitored using a Rapid Visco-Analyzer (RVA, Newport Scientific, New South Wales, Australia). To obtain a fully gelatinized starch, cooking of the flour (10% in SIF), was performed starting with a mixing step at 960 rpm for 90 s at 37 °C, followed by a pasting step at 170 rpm, a temperature ramp from 37 °C to 95 °C for 5 min, an isotherm at 95 °C for 5 min, a cooling ramp from 95 °C to 37 °C, for 5 min, and a final isotherm, at 37 °C for 10 min. The inhibition of a thermostable α-amylase activity (0.075 KNU, Termamyl, Novozymes, Denmark) was monitored measuring the digestion rate as a function of the decreased viscosity. The decrease in viscosity was measured by RVA (170 rpm, 37 °C, 60 min). The kinetics of inhibition of the enzyme activity by endogenous visco-mechanical inhibition was calculated using a modified first-order kinetic equation (Sorba & Sopade, 2013):

prepared to mimic the physio-chemical conditions in the human gut. The chewing during the oral phase was simulated to produce a bolus, by using a mincer (Kitchen Craft). A 5 g (dry weight, d.w.) portion of minced barley was mixed with SSF at a 1:1 (w:w) ratio and CaCl2 (final concentration 0.75 mmol L−1) and human salivary α-amylase (in SSF 90 IU mL−1, A1031 Sigma Aldrich) were added. The bolus was incubated for 5 min at 37 °C with a shaking speed of 170 rpm. In the gastric phase, the oral bolus was mixed with one volume of SGF solution additioned of CaCl2 (final concentration 0.075 mmol L−1), porcine pepsin (in SGF 1200 IU mL−1) and fungal lipase (in SGF 60 IU mL−1). Triplicate aliquots were withdrawn for further analysis at two time-points (0 and 120 min). For the subsequent intestinal phase, the gastric chime was mixed with one volume of SIF stock solution augmented with CaCl2 (final concentration 0.3 mmol L−1) and pancreatic α-amylase (In SIF 200 IU mL−1) as porcine pancreatin 8X, (P7545 Sigma-Aldrich). The samples were incubated for 4 h at 37 °C and at 170 rpm shaking speed. Triplicate aliquots were withdrawn at different time-points (0, 30, 60, 90, 120, 180 and 240 min). The digestion was interrupted by adding one volume of 96% ethanol and snap frozen in liq. N2. Following digestion, the samples were centrifuged at 10,000g for 10 min, the pellets were washed twice using 80% ethanol, and the two collected supernatants were pooled. The content of glucose was analysed using the PGO enzymes kit (SigmaAldrich). The amount of resistant starch was measured using a simplified protocol of the in vitro static digestion method above described.

RVAVt = RVAV0 + RVAV∞− 0 × (1−e−Kvis ) where RVAVt is RVA viscosity (cP) at time t (min), RVAV0 is viscosity at time t = 0, RVAV∞ is the viscosity at time t with t − ∞. The RVAV∞ was fixed to viscosity after one h of digestion. 2.2.7. Small-scale baking trials Bread was baked in muffin size paper cups placed in a standard 12cup pan (dimensions: width 7.6 cm ∗ high 1.5 cm) using ‘AmoHvid’ as wheat flour (Lantmannen, Cerealia A/S, Vejle, Denmark) and the selected barley flours. The starter was prepared mixing flour, water, and fresh yeast in the proportions 44:37:19. Sugar was added to the mixture at a final ratio to the flour of 2:100. The dough was prepared with a flour mix of wheat and barley at a 50:50 ratio. The mix was augmented with the addition of Thise Acido skimmed milk 0.1 % (Thise Mejeri, Roslev, DK), and water with the proportions 68:27:5 flour:water:milk. Pig fat and salt were added to the mixture at a final ratio with the flour of 2:1:100. The dough was carefully mixed, transferred to the pans and proofed at 26 ± 1 °C for 1 h. The dough was baked for 25 min at 175 °C in an oven with air circulation. Bread based on 100% barley flour were also prepared. However, those bread were not used in the subsequent digestion tests due to a non-optimal alveolation.

SSF: 15.1 mmol L−1 KCl, 13.6 mmol L−1 NaHCO3, pH 7; SGF: 6.9 mmol L−1 KCl, 47.2 mmol L−1 NaCl, 12.5 mmol L−1 NaHCO3, pH 2; SIF: 6.8 mmol L−1 KCl, 38.4 mmol L−1 NaCl, 85 mmol L−1 NaHCO3, pH 7. The oral and gastric phases were analysed as the static method protocol. For the intestinal phase, the incubation was prolonged to 16 h (at 37 °C, 170 rpm). Samples were collected in triplicate. 2.2.5. Digestion rate measurement and glycaemic index prediction modelling The rate of starch digestion was expressed as a percentage (%) of hydrolyzed starch (HS) over the digestion time by using PGO enzymes. The % HS was calculated using the following equation:

HS (%) =

Glucose released (g ) × 0.89 × 100 TLS (g )

2.2.8. In vitro dynamic digestion of bread The dynamic digestion was performed to simulate the oral, gastric and duodenal phase using 100 g bread pieces. The oral procedure was performed simulating the chewing of the bread in the mouth by a mincer as previously described (Mandalari et al., 2013). SSF (50 mL) at pH 6.9 (0.15 M NaCl, 3 mM urea) with human salivary amylase (450 U) was added to the processed bread and mixed for 5 min. The resulting paste comprised equal amounts of the solid and aqueous phases as calculated by human chewing (Institute of Food Research, unpublished data). The individual bread samples subjected to oral processing were fed onto the dynamic gastric model (DGM) for 42 min in the presence of priming acid (20 mL) and 100 ml of water (Pitino et al., 2010). The priming acid was used to mimic the prime volume and concentration of acidic fluid (Mandalari et al., 2014) present in a fasted stomach. The simulated gastric enzyme solution was prepared by dissolving porcine gastric mucosa pepsin and a gastric lipase analogue from Rhizopus oryzae (Amano Enzyme Inc. Nagoya, Japan) in the above-described salt mixture (no acid) at a final concentration of 9000 U mL−1 and 60 U mL−1 for pepsin and lipase, respectively. A suspension of single-shelled lecithin liposomes (Lipid Products, South Nutfield, Surrey, UK) (Mandalari et al., 2008), was added to the gastric enzyme solution at a final concentration of 0.127 mM. Six samples (G1-G6, 40 g for each

(1)

where 0.89 is the molar mass conversion from glucose to anyhydroglucose and TLS is the total starch in the digested sample. To estimate the pGIs of the food specimens the percentages of starch hydrolysis over the digestion period were plotted (hydrolysis curves). The hydrolysis indices (HI) were calculated as the area under the curve (AUC) with respect to the reference food (white bread) using the following equation:

HI =

AUC of test food·100 AUC of standard (White Bread )

(2)

The in vitro hydrolysis indices (HI) were correlated to in vivo GI data of barley products (Granfeldt, Liljeberg, Drews, Newman, & Björck, 1994) allowing the definition of a linear correlation for the calculation of the pGIs (Hettiaratchi, Ekanayake, & Welihinda, 2012). 2.2.6. Measurement of α-amylase inhibition Crude proteins, extracted as described in Section 2.2.3, were used to monitor the relative inhibitory effect on the pancreatic α-amylase. Crude polyphenols were extracted using a ratio between flour/water/ acetone of 1:10:30 (w:v:v) mixed for 1 h at 4 °C. Polyphenols were solubilized by acidification in trifluoroacetic acid (Librán, Mayor, Garcia410

Journal of Functional Foods 40 (2018) 408–416

D. Sagnelli et al.

donor as described (Wiese et al., 2017). For the fermentation of pulverized bread digesta, the media was supplemented with 50 mM MES (SIGMA-Aldrich) buffer and divided into 9 batches. Each batch was supplemented with one of the substrates (1% w/v of digesta, consisting of 50:50 wheat/barley bread of AO or Hs or Hv grain or 100% wheat bread, either from 20 or 200 min after the beginning of the duodenal digestion). One batch was kept for negative control without substrate. The fermentations were performed for each substrate in duplicates. In order to mimic the passage through the colon, fermentations were performed controlling the increment from pH 5.7 to 6.9 over 24 h periods. For nucleic acid extraction, 1 ml of each fermentation endpoint (24 h) was pelleted by centrifugation at 13.000g for 10 min and nucleic acids were extracted from the pellet using the Power Soil Kit protocol (MoBio Laboratories). The FastPrep bead-beating step was performed in 3 cycles of 15 s each at a speed of 6.5 M/s in a FastPrep-24 TM Homogenizer (MP). Nucleic acid quantity and quality were measured using a NanoDrop 1000 (Thermo Scientific). The faecal microbiota composition of in vitro fermentation samples was determined using tag-encoded 16S rRNA gene MiSeq-based (Illumina, CA, USA) high throughput sequencing. The V3 region of the 16S rRNA gene was amplified using primers compatible with the Nextera Index Kit (Illumina) NXt_338_F: 5′–TCGTCGGCAGCGTCAGATGTGTATAAGAGACA GACWCCTACGGGWGGCAGCAG–3′ and NXt_518_R: 5′–GTCTCGTGGGCT CGGAGATGTGTATAAGAGACAGATTACCGCGGCTGCTGG–3′ the PCR reactions and library preparation was conducted as described in Kristensen et al. (2016). The raw dataset containing pair-ended reads with corresponding quality scores were merged and trimmed using fastq_mergepairs and fastq_filter scripts implemented in the UPARSE pipeline. The minimum overlap length was set to 10 base pairs (bp). The minimum length of merged reads was 150 bp, the maximum expected error E was 2.0, and the first truncating position with quality score was N ≤ 4. Purging the dataset from chimeric reads and constructing de novo Operational Taxonomic Units (OTU) were conducted using the UPARSE pipeline. The Green Genes (13.8) 16S rRNA gene collection was used as a reference database. Quantitative Insight Into Microbial Ecology (QIIME) open source software (1.7.0 and 1.8.0) was used for the subsequent analysis steps (Caporaso et al., 2010).

meal) were ejected from the antrum of the DGM at 7-min intervals. Each gastric sample was weighed, its pH recorded and adjusted to 7.0 with 1 M NaOH to inhibit gastric enzyme activity. Representative samples (2 g) were withdrawn as described above. Individual gastric samples (25 g, G1 to G6) were transferred, upon ejection, to a Sterilin plastic tube for duodenal digestion and physiological concentrations of simulated bile solution (3.12 mL) and pancreatic enzyme solution (9.37 mL) was added. The samples were incubated at 37 °C with shaking (170 RPM) for 197 min. Ten (10) aliquots (2 g) were sampled during duodenal incubation and added to 8 mL of ethanol for starch and glucose analysis. Simulated bile (6.5 mM lecithin, 4 mM cholesterol, 12.5 mM sodium taurocholate and 12.5 mM sodium glycodeoxycholate, in a solution containing 146.0 mM NaCl, 2.6 mM CaCl2 and 4.8 mM KCl) was prepared fresh daily. Pancreatic enzyme solution contained 125.0 mM NaCl, 0.6 mM CaCl2, 0.3 mM MgCl2 and 4.1 μM ZnSO4·7H2O. Porcine pancreatic lipase (590 U mL−1), porcine colipase (3.2 μg mL−1), porcine trypsin (11 U mL−1), bovine α-chymotrypsin (24 U mL−1) and porcine α-amylase (300 U mL−1) were added to the pancreatic solution. 2.2.9. Statistical analysis Statistical analysis were performed with one-way ANOVA using Origin-Pro software. Post hoc analysis using Tukey test significant difference was used to pairwise means comparison, results were considered significant at p < .05 (Mandalari et al., 2016). 2.2.10. Ion-exchange and size exclusion chromatographic analysis of digesta Subsequently, the duodenal digestion, soluble mono- di- and oligosaccharides were extracted in 80% ethanol at three-time points (0, 2 and 4 h). The samples were washed twice by centrifugation (10,000g for 10 min) with 80% ethanol. The supernatants were pooled, lyophilized and re-suspended in 1 mL of milliQ water. Maltooligosaccharides including isomaltooligosaccharides (IMOs) were identified by high-performance anion exchange chromatography with pulsed amperometric detection (HPAEC-PAD, Dionex) using linear maltooligosaccharides as standards. Their α-glucan identity was verified by their sensitivity to amyloglucosidase treatment (Megazyme International Ltd.). Samples were injected on a CarboPacPA-200 column using 0.4 mL min−1 flow rate, 150 mM isocratic NaOH and the following NaOAc gradient profile: 0–5 min: 0–110 mM linear gradient, 5–30 min: 110–350 mM convex gradient. The pellets from the dynamic digestions were freeze-dried and examined by size exclusion chromatography (SEC) using a Viscotek System (Malvern, UK) equipped with a GS-620 HQ column (Shodex) attached to a TDA 302 module (Triple detector array) comprising a refractive index detector (RI), a four-bridge visco-meter detector (VIS) and a light scattering detector (LS). The LS comprised a right-angle light scattering (RALS) and a low angle light scattering (LALS) that measures the scattered light at 7° and 90° with respect to the incident beam. The instrument was calibrated using pullulan (50 kDa, polydispersity 1.07, Showa Denko) solubilized in MilliQ water (1mg/mL) at 99 °C for 120 min at 1000 rpm. Elution was performed with 50 mM ammonium formate (HCO2NH4) buffer and 0.5 mL min−1 flow rate. Samples were filtered through a 0.22 μm centrifuge filter and 50 μl sample injected (GPCmax module) into the column and separated at 60 °C. Selected samples were treated with lichenase (Megazyme, (1-3)-(1-4)-β-Dglucan 4-glucanohydrolase) and α-amylase (Thermamyl, Novozymes) prior to analysis to identify the nature of the oligosaccharides. Data were analysed using the OmniSec Software 4.7 (Malvern Instrument, Ltd.) and OriginPro 2016.

3. Results and discussion 3.1. Composition of barley grains and static in vitro digestion The grains used in this study were first characterized with respect to dietary polysaccharides and fibre content (Table 1). The AO and the Hs grains had a lower content of starch than Hv. The Hs grains showed the higher content of BG as compared to both Hv and AO, and such contents are unusual for cultivated barley varieties (Hebelstrup, 2017). The Hs and Hv starches contained 27 and 30% of amylose, respectively, which is typical for most barley cultivars. AO had 99% of amylose. This suggests that the AO and Hs grains have new dietary potentials with a high content of dietary fibres which are not present in existing commercial cultivars. The grains were subsequently tested for their digestibility using a Table 1 Starch, amylose and BG contents in the barley grains.

2.2.11. In vitro fermentation media, conditions, and analysis The miniature in vitro colon model ‘CoMiniGut’ was used for the investigation of gut microbial fermentation of bread substrates (Wiese et al., 2017). The faecal inoculum was prepared from one healthy adult 411

Sample

Total starch (%)

Amylose (%)

Resistant Starch (%)

BG (%)

Hordeum v. spontaneum Hordeum vulgare Amylose-only

35 ± 3

27 ± 3

5

10 ± 1

50 ± 5 45 ± 4

30 ± 1 99 ± 1

5 12

5.0 ± 0.5 5±1

Journal of Functional Foods 40 (2018) 408–416

D. Sagnelli et al.

Table 1). No significant difference in inhibitor profiles or trypsin fragments were observed between Hs, AO and Hv grain. All three samples had a main polypeptide band at approximately 14.0 kDa. Sequence data identified two main α-amylase inhibitors, NCBI gi|585290 and gi|452325. Protein coverage data generated by peptide sequencing might be not fully exhaustive due to a lack of Hs barley proteomic and genomic sequences in the database. However, taking into account that limitation, mass spectrometry analysis revealed no differences between the investigated α-amylase inhibitors of Hs barley grain and Hv grain and AO, therefore suggest that there are no additional amylase inhibitors in Hs. We also tested possible inhibition of α-amylase induced by extracted crude protein and polyphenols from Hv, Hs and AO grains. No significant difference was detected between the three types of grains (Supplementary Fig. 3). This result suggests that no proteinaceous or polyphenol inhibitors caused the observed suppressed digestion. To test the hypothesis that the low pGI of Hs grain is based on mechanical and physical inhibition, we analysed the digestion rates as a function of the viscosity of cooked grain slurry. The starch was hydrolyzed in situ in an RVA canister. First, the starches were gelatinized by boiling and re-cooling while monitoring the pasting behaviour (Fig. 2A). After gelatinization and cooling at 37 °C, the viscosity was measured for 60 min without added α-amylase (170 rpm). The final viscosity was noted when a viscosity plateau was reached. The Hs grain had the highest final viscosity, 1.5-fold higher than Hv, despite its lower starch content and is therefore likely due to other compounds than starch, such as BG. The AO flour showed a very low final viscosity and a general lack of gelatinization, which was expected because amylose does not gelatinize at temperatures below 100 °C. To measure the mechanical inhibition, a thermostable α-amylase was added to all the samples before starting the viscosity monitoring. The digestion rate of the Hs (0.0001 cP/s) was 10-fold lower than Hv (0.0012 cP/s), suggesting that the inhibition may be directly correlated with the higher viscosity. These results corroborate with in vivo data of meals augmented with soluble fibres that demonstrated a significant reduction in plasma glucose levels attributed to the increased viscosity of meals consumed (Dikeman & Fahey, 2006). To confirm the effect of BG on the final high viscosity of the Hs grain, lichenase (0.02 U), specifically hydrolyzing the β-1,4 bonds in BG, was added instead of α-amylase in a separate experiment. The viscosity of the Hs grain slurry showed a major drop as an effect of lichenase compared with the effect of amylase (Fig. 2B). This result supports the hypothesis that higher viscosity of the Hs grain is due to its higher content of soluble BG. Inhibition of α-amylase activity through structural and mechanical interactions was demonstrated for cellulose being capable of inhibiting α-amylase through a non-specific binding mechanism, probably due to adsorption of the enzyme in the cellulosic matrix (Dhital, Gidley, & Warren, 2015).

Fig. 1. Simulated in vitro static duodenal digestion of cooked Hv, Hs, and AO barley grains. Hydrolysis is given as percentage of hydrolyzed starch of the total starch fraction.

static in vitro model. After 30 min of digestion of the Hv grains, already 20% of the starch was digested (Fig. 1). The AO and the Hs grains showed a much lower rate of starch digestion and had no significant difference between each other (p < .05). Previously, we showed that the starch fraction from AO is resistant to α-amylase hydrolysis (Carciofi et al., 2012) suggesting that the low digestion rate is due to the intrinsic properties of this starch. These results are possibly due to the scarce availability of free chains in the AO-starch matrix. Indeed, it has been shown that it is flexible α-glucan chains increased in number during hydrothermal processing of normal starch which are the primary substrates of pancreatic α-amylase (Baldwin et al., 2015; Patel et al., 2017). The Hs grain showed a digestion profile similar to AO despite normal amylose content (Table 1). It has previously been shown that correlation of the in vitro hydrolysis index (HI) with in vivo glycaemic index (GI) can be applied to calculate a predicted glycaemic index (pGI) (Granfeldt et al., 1994). We used this method to calculate pGI for the different grains (Table 2). The pGI of AO and Hs grains were much lower than that of Hv grains. Since Hs grains have amylose content similar to the cultivated Hv grains, we suggest that its low pGI is due to inhibition of the α-amylase used in the assay. 3.2. Effect of potential α-amylase inhibitors We investigated three possible hypotheses to explain low pGI in the Hs grain as apparent inhibition of starch hydrolysis: (i) inhibition by grain proteins, (ii) inhibition by grain polyphenols, and (iii) mechanical inhibition imparted by the high viscosity of the cooked Hs grains. To detect the presence and activity of any α-amylase inhibitors in the Hs grains, proteins were purified according to their methanol solubility and identified by SDS-PAGE (Supplementary Fig. 1) and LC-MS/ MS analysis of their tryptic digests was recorded (Supplementary

3.3. Baking trials: Dynamic in vitro bread digestion and CoMiniGut trials In addition to the static model, digestion was also simulated using a dynamic gastrointestinal model (DGM) to better mimic the complex gastrointestinal environment. An attempt to analyse grains with DGM failed due to the inhomogeneous consistency of the bolus. Therefore, a bread model was used providing a more homogenous food system. Previous studies aiming to investigate the beneficial effects of soluble BGs in bread observed different results. In a study using whole grain wheat bread, no clear effect of soluble BG was found on digestion rates due to the low content (Gélinas & McKinnon, 2013). A human exposure assessment model based on data collected from subjects that consumed wheat/barley model breads (Tiwari & Cummins, 2012), highlighted that intake of higher amount of BG in enriched breads had increased nutritional health benefits. We prepared bread using a sour-dough and a 50:50 (w:w) ratio between Tritcum aestivum (Ta) and barley whole grain flour as described in material and methods. The 50:50 bread showed a comparable degree

Table 2 Hydrolysis Index (HI) and predicted glycaemic Index (pGI) of Hs grain, Hv and AO relative to 100% wheat bread (Ta). Specimen

HI

pGI (Grain)

pGI (Bread)

Hs AO Hv Ta

20 40 100 100

17 16 35 NA

13 34 100 96

NA = not analysed.

412

Journal of Functional Foods 40 (2018) 408–416

D. Sagnelli et al.

Fig. 2. Determination of the mechanical inhibition of α-amylase activity. (A) RVA pasting curves of AO, Hs grain flour and Hv grain flour. (B) RVA viscosity measure (37 °C) of 10% in water Hs flour treated with α-amylase or lichenase.

the samples were analysed prior and after the treatment with amyloglucosidase. These data showed that at the retention time of 14 and 16 min residual glucans resist to hydrolysis (Supplementary Fig. 5). This result indicates the presence of soluble oligosaccharides resistant to amyloglucosidase, implying the absence of glycoside bonds of α(1-4) type. Interestingly, the peak area ratio between glucose, maltose and maltotriose released from the control wheat bread was 1:1:0.2 while for the Hs 50:50 bread the ratio was 1:3:3. These data suggest differential hydrolytic effects taking place in the two bread systems, possibly caused by the mechanical inhibition of the amylase. To the best of our knowledge, this effect was not observed in previous studies and additional studies are needed to confirm it. Furthermore, our data show that the α-amylase used in the experiment is capable of releasing glucose from starch during the digestion, which is an unusual activity on gelatinised substrate. This evidence needs further investigation. At the start and end of the duodenal digestions, HMFs were analysed using a triple SEC system, before and after lichenase or α-amylase treatment. The chromatographic profiles of the samples collected after 5 min of duodenal digestion showed a widespread distribution of polysaccharides between 5 and 11.4 mL retention volume (Rv) (Fig. 4D) with one major unresolved peak and one minor peak. After the enzymatic treatment with lichenase or α-amylase extensive hydrolysis of both starch and BG was observed. An increase of lower Mw polysaccharides is indicated by the peaks at higher Rv. After 4 h of duodenal digestion, the HMFs were mostly composed by BG (Fig. 4). A major unresolved peak is visible at 13.1 mL Rv. After the α-amylase treatment, the chromatographic profiles of all the samples were similar. However, for lichenase treatment, the shoulder of the major chromatographic peak (12.4 mL) disappeared, correlating the shoulder to a lichenase-sensitive BG. New peaks containing low Mw oligosaccharides appeared at higher retention volume (14.3 mL) and the area of the peak at a retention volume of 13.1 mL increased. Hence, new low Mw glycans were generated as consequence of the enzymatic treatment. The time course of the dynamic digestion of the bread showed differential starch hydrolysis for the four bread types (Fig. 5). The Hs 50:50 bread and AO 50:50 bread showed a lower rate of starch hydrolysis as compared to the 100% wheat bread. The Hv:Ta (50:50) showed a starch digestion rate comparable to that of the 100% wheat control bread. No significant difference was found between the Ta and Hv bread digestions (p < .05). The remaining mean pair comparisons were significantly different (p < .05). The low rate of starch digestion for Hs bread can be explained by the effect of the higher BG content

of alveolation (Supplementary Fig. 2A). However, bread prepared with 100% barley whole grain flour exhibited an irregular alveolation and the 100% AO bread collapsed (Supplementary Fig. 2B). A possible explanation is the general low gluten formation in barley bread (Gupta, Bawa, & Semwal, 2011). Prior to digestion, the 50:50 breads were characterized with respect to the content of starch and BG (Supplementary Table 2). The content of BG was generally higher in the 50:50 bread than in the 100% wheat bread (control), with the blend with Hs being the highest (Supplementary Table 2). The soluble fraction of the duodenal digesta, containing the low molecular weight carbohydrates (LMFs DP: 1–10) and the insoluble fraction containing the high molecular weight carbohydrates (HMFs – Mw ∼ 900–10 kDa) were collected for further analysis. The LMFs were analysed at the time points 0, 2 and 4 h of duodenal digestion by HPAEC-PAD. The objective of such analysis was to demonstrate the presence of iso-maltooligosaccharides (IMOs) in the digesta. Branched maltooligosaccharides, so-called IMOs, were identified according to the elution time, based on linear maltooligosaccharide standards (Fig. 3 and Supplementary Fig. 4). The presence of IMOs was detected in all the samples at the start and the end of the duodenal digestion. The presence of a smaller amount of glucans at time 0 is due to the salivary α-amylase. To characterize the structures of all glucans present in the digesta

Fig. 3. Low molecular weight carbohydrate of Hs grain 50:50 bread and control 100% wheat bread analysed by HPAEC-PAD showing soluble resistant glucans present at the end of the digestion (4 h). The standards represent linear maltooligosaccharides M2 to M7 (Linear MOS).

413

Journal of Functional Foods 40 (2018) 408–416

D. Sagnelli et al.

Fig. 4. Undigested polysaccharides fraction analysed by SEC. (A) Hv 50:50 bread. (B) Hs 50:50 bread. (C) AO 50:50 bread. (D) Chromatogram for of Hv 50:50 bread showing details of the enzymatic treatments at high molecular size.

(Supplementary Table 2). In other studies it has been shown that a substitution of wheat flour with barley flour (that contains more BG) increases the amount of high molecular weight BG after the cooking process (Tiwari et al., 2011). Furthermore, a parallel reason for the slower digestion can be the more complex network of aggregated proteins formed as result of the baking process in which the starch granules are embedded (Smith et al., 2015; Zhang, Luo, & Zhang, 2017) . The Hs grain showed higher amounts of gliadins which is known to be associated with the ability to form a thicker gluten network (Supplementary Fig. 6). The pGI values (Table 2) for the AO and Hs grain bread were considerably lower than for the Hv and 100% wheat breads; this result supports the observations obtained from the static digestion. However, we consider the DGM data, disclosing a difference between the AO and the Hs bread, more physiologically relevant. The AO grains showed a higher pGI as a 50:50 bread in the DGM whereas the Hs grains also had a low pGI even when mixed 50:50 with wheat flour in the bread. Since the low digestibility of AO is due to its intrinsic starch structure, its effect on pGI is likely diluted when it is mixed with wheat flower. However, the inhibitory effect on starch hydrolysis from Hs barley grain is preserved in a mix with wheat flower, which contains more of quickly digestible starch. This suggests that Hs barley flour can be used as an additive in baking to dominantly reduce the GI of bread, maybe even at lower quantities than that of 50% used in these trials.

Fig. 5. Dynamic digestion of wheat:barley 50:50 and control 100% wheat bread. In both AO and Hs digestions the α-amylase was less active during the intestinal digestion. The glucans released due to the salivary α-amylase were baselined with specific samples collected for that purpose.

414

Journal of Functional Foods 40 (2018) 408–416

D. Sagnelli et al.

index than the domesticated varieties. A simulated colon system ‘CoMiniGut’ demonstrated the ability of barley bread to stimulate the gut microbiota characterized by higher titres of bacteroidetes and actinobacteria. We observed that the effect on lowering the pGI in AO plants was diluted when mixing with wheat flour in bread. However, for the Hs grain, the inhibitory effect on starch hydrolysis was preserved when mixing with wheat flour. In summary, this work suggests potentials of using specialised types of barley whole grain flour in bread manufacturing towards foods with very low glycaemic indexes. Flour from Hs barley grain can be particular useful due to the dominant inhibitory effect on starch hydrolysis observed in bread with mixes of barley and wheat flour. Acknowledgement This work was funded by The Danish Council for Independent Research Technology and Production Sciences and The Carlsberg Foundation. Fig. 6. Relative abundance of microbiota groups after the fermentation of bread digesta. The samples fermented represented the start and the end of the duodenal digestion.

Appendix A. Supplementary material Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/j.jff.2017.11.028.

Colonic fermentation simulations were performed on the DGM digesta by the minigut model described in materials and methods. The fermentation of the samples representing the first 20 min of the digestion showed an increasing of abundancy of firmicutes for digesta of AO and Hv bread, whereas wheat and Hs grain bread digesta were lower in firmicutes in comparison with the control (Fig. 6). Wheat bread showed an ability to stimulate the growth of proteobacteria. Furthermore, actinobacteria were better stimulated by Hs grain bread digesta, being 30fold more abundant than in that of the control (Fig. 6). The samples representing the last 20 min of digestion behaved differently, in particular bacteroidetes and actinobacteria were more abundant for all the digesta. Particularly AO fermentation showed an increase of actinobacteria as compared with the fermentation of the samples representing the early stages of the digestion (Fig. 6). The Bacteroidetes were more abundant in the fermentation of Hs grain digesta. During the fermentation representing the early stage of digestion, Hs grain bread digesta increased the abundance of actinobacteria to the detriment of bacteriodetes and firmicutes, the latter usually associated with obesity. In obese mice, it has been observed that a shift to a fatrestricted diet and decrease in body weight was associated with a decrease of firmicutes (Ley, Turnbaugh, Klein, & Gordon, 2006). A similar result for Hv and AO bread digesta was observed on the samples representing the late stage of the digestion. Fluctuations in the level of proteobacteria were observed in wheat bread digesta from the early to the late stage of digestion. Proteobacteria are associated with dysbiosis and a compromised ability to maintain a balanced microbial intestinal flora (Yang & Jobin, 2014). In summary, these results show potential abilities of barley-based bread to modulate the gut microbiota towards a healthier gut microbial community.

References Baldwin, A. J., Egan, D. L., Warren, F. J., Barker, P. D., Dobson, C. M., Butterworth, P. J., & Ellis, P. R. (2015). Investigating the mechanisms of amylolysis of starch granules by solution-state NMR. Biomacromolecules, 16(5), 1614–1621. http://dx.doi.org/10. 1021/acs.biomac.5b00190. Bay-Smidt, M., Blennow, A., Bojko, M., & Møller, B. L. (1999). The effect of phosphate and amylopectin molecular size on peak viscosity of starch pastes. Annual Transact Nordic Rheology Society, (7), 31–38. Caporaso, J. G., Kuczynski, J., Stombaugh, J., Bittinger, K., Bushman, F. D., Costello, E. K., ... Knight, R. (2010). QIIME allows analysis of high-throughput community sequencing data. Nature Methods, 7(5), 335–336. Carciofi, M., Blennow, A., Jensen, S. L., Shaik, S. S., Henriksen, A., Buleon, A., ... Hebelstrup, K. F. (2012). Concerted suppression of all starch branching enzyme genes in barley produces amylose-only starch granules. BMC Plant Biology, 12, 223. http:// dx.doi.org/10.1186/1471-2229-12-223. Damager, I., Engelsen, S. B., Blennow, A., Møller, B. L., & Motawia, M. S. (2010). First principles insight into the alpha-glucan structures of starch: Their synthesis, conformation, and hydration. Chemical Reviews, 110(4), 2049–2080. http://dx.doi.org/ 10.1021/cr900227t. Dhital, Gidley, M. J., & Warren, F. J. (2015). Inhibition of alpha-amylase activity by cellulose: Kinetic analysis and nutritional implications. Carbohydrate Polymers, 123, 305–312. http://dx.doi.org/10.1016/j.carbpol.2015.01.039. Dhital, S., Lin, A. H.-M., Hamaker, B. R., Gidley, M. J., & Muniandy, A. (2013). Mammalian mucosal α-glucosidases coordinate with α-amylase in the initial starch hydrolysis stage to have a role in starch digestion beyond glucogenesis. PLoS ONE, 8(4), e62546. http://dx.doi.org/10.1371/journal.pone.0062546. Di Stasio, L., Picariello, G., Mongiello, M., Nocerino, R., Berni Canani, R., Bavaro, S., ... Mamone, G. (2017). Peanut digestome: Identification of digestion resistant IgE binding peptides. Food and Chemical Toxicology, 107(Part A), 88–98. http://dx.doi. org/10.1016/j.fct.2017.06.029. Dikeman, C. L., & Fahey, G. C. (2006). Viscosity as related to dietary fiber: A review. Critical Reviews in Food Science and Nutrition, 46(8), 649–663. http://dx.doi.org/10. 1080/10408390500511862. Englyst, H. N., & Hudson, G. J. (1996). The classification and measurement of dietary carbohydrates. Food Chemistry, 57(1), 15–21. http://dx.doi.org/10.1016/03088146(96)00056-8. Englyst, H. N., Kingman, S. M., Hudson, G. J., & Cummings, J. H. (2007). Measurement of resistant starch in vitro and in vivo. British Journal of Nutrition, 75(05), 749. http:// dx.doi.org/10.1079/bjn19960178. Ferrari, B., Finocchiaro, F., Stanca, A. M., & Gianinetti, A. (2009). Optimization of air classification for the production of β-glucan-enriched barley flours. Journal of Cereal Science, 50(2), 152–158. http://dx.doi.org/10.1016/j.jcs.2009.04.007. Gélinas, P., & McKinnon, C. (2013). Dietary fibre and β-glucan in strong bread wheat cultivars: Does it matter? International Journal of Food Science & Technology, 48(3), 670–672. http://dx.doi.org/10.1111/j.1365-2621.2012.03216.x. Gemen, R., de Vries, J. F., & Slavin, J. L. (2011). Relationship between molecular structure of cereal dietary fiber and health effects: Focus on glucose/insulin response and gut health. Nutrition Reviews, 69(1), 22–33. http://dx.doi.org/10.1111/j.17534887.2010.00357.x. Giuberti, G., Gallo, A., Moschini, M., & Masoero, F. (2015). New insight into the role of resistant starch in pig nutrition. Animal Feed Science and Technology, 201, 1–13. http://dx.doi.org/10.1016/j.anifeedsci.2015.01.004. Granfeldt, Y., Liljeberg, H., Drews, A., Newman, R., & Björck, I. (1994). Glucose and

4. Conclusion Barley grains and bread with amylose-only (AO), as well as Hs barley, exhibited very low pGI, due to a suppressed starch digestibility. For Hs barley grain the effect of lowering pGI was due to a protective viscosity effect imparted by its high content of BG while the low pGI of the AO barley grain and bread was most likely due to an inherently slow digestibility of the > 99% amylose starch. The effect of the grains was also tested by a physiologically more relevant in vitro dynamic gastrointestinal model, DGM system. Using this model, we demonstrated that bread based on 50% barley flour and 50 % wheat flour had a lower pGI when using either amylose-only barley grain or Hs barley grain. The data support the view that Hs cereal grains have a lower glycaemic 415

Journal of Functional Foods 40 (2018) 408–416

D. Sagnelli et al.

structural analysis. British Journal of Nutrition, 112(9), 1521–1529. http://dx.doi.org/ 10.1017/S0007114514002414. Mandalari, G., Merali, Z., Ryden, P., Chessa, S., Bisignano, C., Barreca, D., ... Waldron, K. W. (2016). Durum wheat particle size affects starch and protein digestion in vitro. European Journal of Nutrition. http://dx.doi.org/10.1007/s00394-016-1321-y. Marciani, L., Gowland, P. A., Spiller, R. C., Manoj, P., Moore, R. J., Young, P., & FilleryTravis, A. J. (2001). Effect of meal viscosity and nutrients on satiety, intragastric dilution, and emptying assessed by MRI. American Journal of Physiology – Gastrointestinal and Liver Physiology, 280(6), G1227–G1233. Mikkelsen, M. S., Jespersen, B. M., Larsen, F. H., Blennow, A., & Engelsen, S. B. (2013). Molecular structure of large-scale extracted beta-glucan from barley and oat: Identification of a significantly changed block structure in a high beta-glucan barley mutant. Food Chemistry, 136(1), 130–138. http://dx.doi.org/10.1016/j.foodchem. 2012.07.097. Minekus, M., Alminger, M., Alvito, P., Ballance, S., Bohn, T., Bourlieu, C., ... Brodkorb, A. (2014). A standardised static in vitro digestion method suitable for food – An international consensus. Food & Function, 5(6), 1113–1124. http://dx.doi.org/10.1039/ c3fo60702j. NCC-CC (2008). Type 2 diabetes: National clinical guideline for management in primary and secondary care (update). (NICE Clinical Guidelines) Available from: < https:// www.ncbi.nlm.nih.gov/books/NBK53885/ > , 66. Patel, H., Royall, P. G., Gaisford, S., Williams, G. R., Edwards, C. H., Warren, F. J., ... Butterworth, P. J. (2017). Structural and enzyme kinetic studies of retrograded starch: Inhibition of alpha-amylase and consequences for intestinal digestion of starch. Carbohydrate Polymers, 164, 154–161. http://dx.doi.org/10.1016/j.carbpol. 2017.01.040. Pitino, I., Randazzo, C. L., Mandalari, G., Lo Curto, A., Faulks, R. M., Le Marc, Y., ... Wickham, M. S. (2010). Survival of Lactobacillus rhamnosus strains in the upper gastrointestinal tract. Food Microbiology, 27, 1121–1127. Pourkheirandish, M., Hensel, G., Kilian, B., Senthil, N., Chen, G., Sameri, M., ... Komatsuda, T. (2015). Evolution of the grain dispersal system in barley. Cell, 162(3), 527–539. http://dx.doi.org/10.1016/j.cell.2015.07.002. Smith, F., Pan, X., Bellido, V., Toole, G. A., Gates, F. K., Wickham, M. S. J., & Mills, E. N. C. (2015). Digestibility of gluten proteins is reduced by baking and enhanced by starch digestion. Molecular Nutrition & Food Research, 59(10), 2034–2043. http://dx. doi.org/10.1002/mnfr.201500262. Sorba, A., & Sopade, P. A. (2013). Changes in rapid visco-analysis (RVA) viscosity reveal starch digestion behaviours. Starch - Stärke, 65(5–6), 437–442. Stuart, I. M., Loi, L., & Fincher, G. B. (1988). Varietal and environmental variations in (1→3, 1→4)-β-glucan levels and (1→3, 1→4)-β-glucanase potential in barley: Relationships to malting quality. Journal of Cereal Science, 7(1), 61–71. http://dx.doi. org/10.1016/S0733-5210(88)80060-2. Tiwari, U., & Cummins, E. (2012). Dietary exposure assessment of β-glucan in a barley and oat based bread. LWT – Food Science and Technology, 47(2), 413–420. http://dx. doi.org/10.1016/j.lwt.2012.02.002. Tiwari, U., Cummins, E., Sullivan, P., Flaherty, J. O., Brunton, N., & Gallagher, E. (2011). Probabilistic methodology for assessing changes in the level and molecular weight of barley β-glucan during bread baking. Food Chemistry, 124(4), 1567–1576. http://dx. doi.org/10.1016/j.foodchem.2010.07.119. van Zanten, G. C., Knudsen, A., Röytiö, H., Forssten, S., Lawther, M., Blennow, A., ... Jespersen, L. (2012). The effect of selected synbiotics on microbial composition and short-chain fatty acid production in a model system of the human colon. PLoS ONE, 7(10), e47212. http://dx.doi.org/10.1371/journal.pone.0047212. Wiese, M., Khakimov, B., Nielsen, S., Sørensen, H., van den Berg, F., & Sandris Nielsen, D. (2017). CoMiniGut – a small volume in vitro colon model for the screening of gut microbial fermentation processes. PeerJ. Yang, Y., & Jobin, C. (2014). Microbial imbalance and intestinal pathologies: Connections and contributions. Disease Models & Mechanisms, 7(10), 1131–1142. http://dx.doi. org/10.1242/dmm.016428. Zhang, J., Luo, K., & Zhang, G. (2017). Impact of native form oat β-glucan on starch digestion and postprandial glycemia. Journal of Cereal Science, 73, 84–90. http://dx. doi.org/10.1016/j.jcs.2016.11.013.

insulin responses to barley products: Influence of food structure and amylose-amylopectin ratio. The American Journal of Clinical Nutrition, 59(5), 1075–1082. Gupta, M., Bawa, A. S., & Semwal, A. D. (2011). Effect of baley flour blending on functional, baking and organoleptic characteristics of high-fiber rusks. Journal of Food Processing & Preservation, 35(1), 46–63. http://dx.doi.org/10.1111/j.1745-4549. 2009.00446.x. Harland, J. (2015a). 5 – Authorised EU health claims for oat and barley grain fibre A2 Sadler, M.J. Foods, nutrients and food ingredients with authorised EU health claims: Volume 2 (pp. 97–108). Oxford: Woodhead Publishing. Harland, J. (2015b). 6 – Authorised EU health claims for wheat bran fibre A2 - Sadler, M. J. Foods, nutrients and food ingredients with authorised EU health claims: Volume 2 (pp. 109–127). Oxford: Woodhead Publishing. Hebelstrup, K. H. (2017). Differences in nutritional quality between wild and domesticated forms of barley and emmer wheat. Plant Science, 256, 1–4. Hettiaratchi, U. P. K., Ekanayake, S., & Welihinda, J. (2012). Prediction of glycaemic indices (GI) of meals by starch hydrolysis indices. Food Research International Journal, 19, 1153–1159. Ibrügger, S., Vigsnæs, L. K., Blennow, A., Škuflić, D., Raben, A., Lauritzen, L., & Kristensen, M. (2014). Second meal effect on appetite and fermentation of wholegrain rye foods. Appetite, 80(Supplement C), 248–256. http://dx.doi.org/10.1016/j. appet.2014.05.026. Idehen, E., Tang, Y., & Sang, S. (2017). Bioactive phytochemicals in barley. Journal of Food and Drug Analysis, 25(1), 148–161. http://dx.doi.org/10.1016/j.jfda.2016.08. 002. Jenkins, D. J. A., Wesson, V., Wolever, T. M. S., Jenkins, A. L., Kalmusky, J., Guidici, S., ... Wong, G. S. (1988). Wholemeal versus wholegrain breads: Proportion of whole or cracked grain and the glycaemic response. BMJ, 297. Jilal, A., Grando, S., Henry, R. J., Rice, N., & Ceccarelli, S. (2013). Agronomic and quality attributes of worldwide primitive barley subspecies. In G. Zhang, C. Li, & X. Liu (Eds. ), Advance in barley sciences: Proceedings of 11th international barley genetics symposium (pp. 115–123). Dordrecht: Springer, Netherlands. Kristensen, K. H. S., Wiese, M., Rytter, M. J. H., Özçam, M., Hansen, L. H., Namusoke, H., ... Nielsen, D. S. (2016). Gut microbiota in children hospitalized with oedematous and non-oedematous severe acute malnutrition in Uganda. PLOS Neglected Tropical Diseases, 10(1). Lazaridou, A., & Biliaderis, C. G. (2007). Molecular aspects of cereal β-glucan functionality: Physical properties, technological applications and physiological effects. Journal of Cereal Science, 46(2), 101–118. http://dx.doi.org/10.1016/j.jcs.2007.05. 003. Lazaridou, A., Biliaderis, C. G., & Izydorczyk, M. S. (2003). Molecular size effects on rheological properties of oat β-glucans in solution and gels. Food Hydrocolloids, 17(5), 693–712. http://dx.doi.org/10.1016/s0268-005x(03)00036-5. Lazaridou, A., Biliaderis, C. G., Micha-Screttas, M., & Steele, B. R. (2004). A comparative study on structure–function relations of mixed-linkage (1→3), (1→4) linear β-dglucans. Food Hydrocolloids, 18(5), 837–855. http://dx.doi.org/10.1016/j.foodhyd. 2004.01.002. Ley, R. E., Turnbaugh, P. J., Klein, S., & Gordon, J. I. (2006). Microbial ecology: Human gut microbes associated with obesity. Nature, 444(7122), 1022–1023 < http://www. nature.com/nature/journal/v444/n7122/suppinfo/4441022a_S1.html > . Librán, C. M., Mayor, L., Garcia-Castello, E. M., & Vidal-Brotons, D. (2013). Polyphenol extraction from grape wastes: Solvent and pH effect. Agricultural Sciences, 04(09), 56–62. http://dx.doi.org/10.4236/as.2013.49B010. Mandalari, G., Bisignano, C., Filocamo, A., Chessa, S., Sarò, M., Torre, G., ... Dugo, P. (2013). Bioaccessibility of pistachio polyphenols, xanthophylls, and tocopherols during simulated human digestion. Nutrition, 29(1), 338–344. http://dx.doi.org/10. 1016/j.nut.2012.08.004. Mandalari, G., Faulks, R. M., Rich, G. T., Lo Turco, V., Picout, D. R., Lo Curto, R. B., ... Wickham, M. S. J. (2008). Release of protein, lipid, and vitamin E from almond seeds during digestion. Journal of Agricultural and Food Chemistry, 56(9), 3409–3416. http://dx.doi.org/10.1021/jf073393v. Mandalari, G., Grundy, M. M. L., Grassby, T., Parker, M. L., Cross, K. L., Chessa, S., ... Waldron, K. W. (2014). The effects of processing and mastication on almond lipid bioaccessibility using novel methods of in vitro digestion modelling and micro-

416