- Email: [email protected]
Lung symptoms in pseudohypoaldosteronism type 1 are associated with deficiency of the α-subunit of the epithelial sodium channel
L
Lung symptoms in pseudohypoaldosteronism type 1
are associated with deficiency of the α-subunit of the epithelial sodium channel
Charlotta Schaedel, MD, Lars Marthinsen, MD, Ann-Charlotte Kristoffersson, BS, Ragnhild Kornfält, MD, PhD, Karl Olof Nilsson, MD, PhD, Bo Orlenius, MD, and Lars Holmberg, MD, PhD
Objective: To study patients with autosomal recessive pseudohypoaldosteronism type 1 and to relate pulmonary disease to gene mutations of the epithelial sodium channel (ENaC). Study design: Clinical and laboratory data were collected from 4 Swedish patients with pseudohypoaldosteronism type 1. The genes for ENaC and cystic fibrosis transmembrane conductance regulator were analyzed for mutations with methods including DNA sequencing. Results: Three novel mutations were found in the α-gene of ENaC, 2 frameshifts (1449delC and 729delA) and 1 missense mutation resulting in the substitution of leucine for serine 562 in the α-chain (S562L). The 1449delC mutation was found in all patients in either homozygous or heterozygous form and seems to be the predominant cause of pseudohypoaldosteronism in Sweden. The allele coding for S562L also contained a transition converting tryptophan 493 to arginine (W493R), which seems to be a rare polymorphism. All patients had pulmonary symptoms to various degrees. The bacterial findings resembled, to some extent, those in cystic fibrosis, but development of chronic lung disease and progressive decline in lung function were not observed. Conclusions: Genetic deficiencies of the α subunit of the ENaC are associated with prominent lung symptoms, which are, however, clearly different from those in cystic fibrosis. (J Pediatr 1999;135:739-45)
recently found to be caused by mutations in the mineralocorticoid receptor2 and seems to improve with age. The autosomal recessive form affects multiple organs such as the kidneys, colon, See related article, p. 786. sweat and salivary glands, and the lungs and has been associated with mutations in the genes encoding the amiloridesensitive epithelial sodium channel.3,4 The channel is located in the apical membrane and controls sodium reabsorption in the kidneys and colon and regulates fluid secretion in the lungs.5,6 It is composed of 3 homologous subunits α, β, and γ, which assemble in a heterotetrameric structure containing 2 α, 1 β, and 1 γ.7 Each subunit comprises a large hydrophilic extracellular loop, 2 hydrophobic transmembrane domains, and short intracellular NH2- and CFTR
Pseudohypoaldosteronism type 1 is characterized by severe neonatal salt wasting, which results in hyponatremia, hyperkalemia, dehydration, and
metabolic acidosis despite high levels of plasma aldosterone.1 There are 2 forms of PHA1. The autosomal dominant form, affecting only the kidneys, was
From the Department of Pediatrics, University Hospitals in Lund and Malmö, Lund University, Lund and Malmö, Sweden; Department of Pediatrics, Linköping, Sweden; and the Department of Pediatrics, Halmstad, Sweden.
Supported by grants from the Swedish Medical Research Council (4997), the Thelma Zoega Foundation, the Royal Physiographic Society, Kock’s Foundation, and Slättens Ideella Barnhjälp. Submitted for publication Dec 14, 1998; revision received May 7, 1999; accepted Aug 9, 1999. Reprint requests: Charlotta Schaedel, MD, Department of Pediatrics, University Hospital, S-221 85 Lund, Sweden. Copyright © 1999 by Mosby, Inc. 0022-3476/99/$8.00 + 0 9/21/102349
Cystic fibrosis transmembrane conductance regulator ENaC Epithelial sodium channel PCR Polymerase chain reaction PHA1 Pseudohypoaldosteronism type 1 SSCP Single-stranded conformation polymorphism
COOH termini.8-10 The gene for αENaC is located on chromosome 12, and those for βENaC and γENaC are on chromosome 16.11 Only very few PHA1-causing mutations have been found until now. A frameshift and a stop mutation (I68fr, R508X) in the α gene and a missense mutation, G37S, in 739
SCHAEDEL ET AL
the β gene were described by Chang et al.3 A splice site mutation (318-1 G→A) in the γ gene was reported by Strautnieks et al.4 In the lungs, ENaC regulates the quantity and composition of respiratory tract fluid. Interestingly, a few patients with the recessive form of PHA1 have been described as having recurrent pulmonary infections similar to those in cystic fibrosis,12-14 which is also a disorder of disturbed electrolyte transport. In this study we examined 4 children, from 3 unrelated families, with the recessive form of PHA1. We found 3 novel mutations and provide evidence that lung symptoms are prominent in patients with mutations involving the α subunit of ENaC.
METHODS Patients Four patients (2 from 1 family; the elder patient is deceased) with the recessive form of PHA1 and their families were analyzed for mutations in the ENaC genes. The 3 families were all from Sweden and are unrelated as far as we have been able to determine. The parents in each family were also unrelated. Informed consent was obtained from the patients and their families.
DNA Extraction Genomic DNA was isolated from EDTA blood according to standard methods15 or with the use of QIAamp blood kits (Qiagen). DNA from the deceased patient was extracted from a dried blood spot on a filter paper (obtained for phenylketonuria testing of the newborn and stored by SBL, Stockholm, Sweden, for 14 years).
THE JOURNAL OF PEDIATRICS DECEMBER 1999 primers,16 one in each pair labeled with fluorescence. The polymerase chain reaction products were analyzed with the Applied Biosystem 373 Sequencer GeneScan (Cybergene AB, Stockholm, Sweden). An intragenic polymorphism ACC/GCC in exon 13 of the α subunit17 was investigated with AciI cleavage of the amplified exon.
Sequencing All coding exons of αENaC and exons 4, 7, 8, 10, 11, and 12 of βENaC were amplified with previously described primers,3 except for 2 changes: (A3F GGCACAGATGAGGACCCTGAC and A8F GAGGCACTTCCTCTGTCCTCTG, R. P. Lifton, personal communication). A1F and A2R were used for amplification of exon 2.18 In general, the conditions were 35 cycles of denaturation for 30 seconds at 94°C, annealing for 15 seconds at 55°C, and extension for 1 minute at 72°C. The products were purified with PCR Purification Kit QIAquick (Qiagen). Automatic sequencing was performed by using the ABI PRISM Big Dye Terminator Cycle Sequencing Ready Reaction Kit (Perkin Elmer) on an ABI 310 sequencer (PE Applied Biosystems). The primers used for sequencing were the same as those for amplification. To resolve an ambiguous double sequence in exon 4 of patient 3, we cloned the alleles in the pCR2.1-TOPO vector, using the TOPO TA cloning system (Invitrogen). Normal clones and clones containing the mutation were sequenced as described above. Nucleotide and amino acid positions are given relative to the translation start according to the method of McDonald et al.9 Exons are denoted according to the method of Chang et al.3
Microsatellite Polymorphism Genotyping and Determination of an Intragenic Polymorphism
Single-Stranded Conformation Polymorphism
The genotypes of polymorphic marker loci linked to αENaC, D12S314, and D12S93 and to βγENaC, D16S412, and D16S403 were determined with published oligonucleotide
SSCP was performed in 12.5% polyacrylamide gels with the GenePhor system (Pharmacia, Uppsala, Sweden). The electrophoreses were run at various temperatures between 5°C and
740
20°C. The gels were silver-stained with the GenePhor kit according to the manufacturer’s instructions.
Restriction Enzyme Cleavages Exons 4, 10, and 13 of the αENaC gene were amplified in patients, parents, and siblings by primers described3 and cleaved by AciI, MnlI, MscI, MslI, and RsaI (New England BioLabs), respectively, as indicated below. Restriction fragments were analyzed by electrophoresis in 12.5% polyacrylamide with the same system as for SSCP but without denaturation. Forty-six healthy control individuals were studied by MnlI digestion of exon 13. Thirty-one healthy subjects were studied by MscI cleavage of a fragment of exon 10, obtained by PCR amplification with the forward primer A11F (5´AACACTGAGCACCTTTCTCCATC) and the reverse primer (5´ACCTGGGATGTCACCGATGGCC). The latter contains a mismatch (indicated in bold) 5 nucleotides from the 3´ end, which creates an MscI site (TGGCCA) in the wild type, but not in alleles in which T1477 is mutated (see Results).
CF Analysis In patient 3, the whole coding portion of the CFTR gene was sequenced. The other patients were studied for the 3 most common mutations in Sweden: ∆F508, 394delTT, and 3659delC. Measurement of the potential difference over the nasal mucosa was done according to the method of Alton et al.19 Sweat chloride concentrations were measured by using the quantitative pilocarpine iontophoretic method.20
Cultures Cultures from blood, nasopharynx, and sputum were done by standard bacteriologic techniques.
CASE HISTORIES Patient 1 is a 2-year-old girl who had symptoms of PHA1 at the age of 9
SCHAEDEL ET AL
THE JOURNAL OF PEDIATRICS VOLUME 135, NUMBER 6 Table I. Laboratory data at diagnosis in 4 patients with recessive PHA1
Patient No. 1 2 3 4 Normal values
Mutation
Age at diagnosis (d)
1449delC/1449delC 729delA/1449delC 729delA/1449delC S562L/1449delC
9 5 4 11
Serum sodium conc (mmol/L) 116 124 129 106 136-146
Serum Plasma potassium aldosterone conc conc (mmol/L) (nmol/L) 10.4 10.4 8.4 11.4 3.5-5.0
33 30.9 13.3 6 0.15-0.9
Plasma renin conc (µg/L/h)
Sweat chloride conc (mmol/L)
4125* 60 27.4 60.3 0.2-2
131 — 110 155 < 60
conc, Concentration. *Plasma renin concentration in patient 1 was measured as nanograms per liter (normal value <250 ng/L).
Table II. Clinical characteristics of 3 children with PHA1 caused by mutations of the αENaC gene
Patient No.
No. of bronchopneumonia episodes
1
3
3
21
Mostly lower right and left lung and middle lobe
4
2
Left lower lobe and middle lobe
Chest x-ray infiltrates
Bacterial findings Sputum
Middle lobe and lower right lung
Nasopharynx Staphylococcus aureus, H influenzae, Streptococcus pneumoniae
P aeruginosa, Staphylococcus aureus, H influenzae
No. of IV antibiotic treatments 3
21
2
IV, Intravenous.
days. Hyponatremia, hyperkalemia, elevated plasma renin and aldosterone levels, and a high sweat chloride concentration were found (Table I). She was treated with sodium supplements. The patient has had several periods of fever with coughing, wheezing, and excessive mucus in the respiratory tract since the age of 8 months and has been hospitalized 3 times for bronchopneumonia requiring intravenous antibiotics. Chest x-ray films have demonstrated infiltrates in the middle lobe and other parts of the right lung (Table II), but the infiltrates always respond to appropriate treatment. Bronchoscopy was not performed. Nasopharyngeal cultures have grown Staphylococcus aureus, Haemophilus influenzae, Streptococcus
pneumoniae, and Moraxella catarrhalis on various occasions; and blood cultures have been positive for Staphylococcus aureus (in association with a central venous line). Patient 2, born in 1984, is the deceased brother of patient 3. He was admitted to the hospital at the age of 5 days with severe dehydration, hyponatremia, and hyperkalemia. Laboratory examination showed high levels of plasma aldosterone and renin (Table I). The hyperkalemia led to cardiac arrest, and he required resuscitation. In the next few days, he was treated with dialysis and electroconversions for ventricular fibrillation, but he finally died at the age of 7 weeks during cardiac arrhythmia caused by hyperkalemia.
Patient 3 is the 8-year-old brother of patient 2. His clinical picture has previously been described.13 Briefly, he fell ill at the age of 4 days with renal salt wasting, resulting in severe hyponatremia and hyperkalemia. Plasma aldosterone, plasma renin, and sweat chloride concentrations were elevated (Table I). He was successfully treated with sodium supplements and an ion-binding resin. Since the age of 4 months, he has had frequent respiratory tract infections, requiring treatment with intravenous antibiotics 21 times, 13 times in the hospital and otherwise at home. Chest x-ray films have demonstrated infiltrates mostly in the lower lobes, or in the middle lobe, but they have always resolved with appropriate treatment (Table II). 741
SCHAEDEL ET AL
THE JOURNAL OF PEDIATRICS DECEMBER 1999
A
Fig 1. Pedigrees of 3 families with autosomal recessive PHA1. Arrows indicate probands. Homozygosity for the 1449delC mutation is indicated by a black filled symbol. Heterozygosity for 1449delC is indicated by black half-filled symbols. Spotted half-filled symbols denote heterozygosity for the 729delA mutation. Hatched half-filled symbols denote heterozygosity for the S562L mutation.
B The sputum cultures have repeatedly shown Pseudomonas aeruginosa and have also grown Staphylococcus aureus, H influenzae, Streptococcus pneumoniae, and Serratia liquefaciens. Pulmonary function studies, performed between relapses, demonstrated normal values for forced expiratory volume in 1 second and forced vital capacity (101%-107% and 95%105%, respectively, of predicted values for sex, age, and height). Bronchoscopy between the episodes showed normal findings. The resting nasal mucosa potential difference was normal (–9 mV; normal values, –5 mV to –30 mV). Patient 4 is a 9-year-old boy who became ill at the age of 11 days and who was diagnosed with PHA1 on the basis of findings of severe hyponatremia, hyperkalemia, and increased plasma aldosterone, plasma renin, and sweat chloride concentrations (Table I). He has had several episodes of disturbance of salt and water balance and often experiences constipation. Gastroscopy revealed a chronic gastric 742
Fig 2. Demonstration of 1449delC mutation in patient 1, family 1. A, Sequence from nucleotide 1446 to 1452 in exon 10, showing a homozygous deletion of C1449 (arrow). B, Normal sequence. ulcer. He has been treated with sodium supplements, an ion-binding resin, and recently, carbenoxolone, which has reduced the need for sodium supplements. He has had 2 episodes of bronchopneumonia, both requiring hospitalization and intravenous antibiotics. X-ray films showed an infiltrate in the left lower lobe on the first occasion and infiltrates in the left lower lobe and the middle lobe on the other (Table II). No cultures were done. Besides these episodes, he has had few respiratory symptoms.
RESULTS Pedigrees of the 3 families are shown in Fig 1. All analyses for CFTR mutations were negative. Determination of polymorphic markers supposed
to be linked to the α gene of ENaC on chromosomes 12 and the β and γ genes on chromosome 16 did not suggest linkage of the disease to any one of these. In spite of that, we performed SSCP analysis and sequencing, starting with the α gene because the case histories strongly suggested a deficiency of ENaC. Patient 1, the propositus (II:2) in family 1, was homozygous for a deletion of cytosine 1449 located in exon 10 (Fig 2). The mutation could be confirmed with restriction enzyme cleavage, because it creates a new RsaI site (not shown). It predicts an abnormal amino acid sequence after codon 482 and chain termination after amino acid 495 of the 669 amino acid residue αENaC protein. Both parents were heterozygous for the deletion, as was the elder sister (II:1).
SCHAEDEL ET AL
THE JOURNAL OF PEDIATRICS VOLUME 135, NUMBER 6 Patient 3, the propositus (II:4) in family 2, was found to be a compound heterozygote for the 1449delC mutation and a second deletion, 729delA, located in exon 4 on the other allele. The latter was identified by SSCP and confirmed by sequencing of the cloned alleles (Fig 3). It could also be confirmed by restriction enzyme cleavage because it creates a new MslI site (not shown). It predicts a truncated translation product of 247 amino acid residues with an abnormal sequence from amino acid 243. The deceased brother (II:2) had the same mutations. A healthy elder brother (II:1) was heterozygous for 1449delC, inherited from the father. Patient 4, the propositus (II:1) in family 3, was heterozygous for 1449delC. On the other allele he had a C1685→T transition in exon 13 substituting leucine for serine (S562L) (Fig 4). It could be confirmed by restriction enzyme cleavage because it eliminates an Mnl1 site (data not shown). It was not present in 92 normal alleles. Furthermore, a second aberration, T1477→C, in exon 10, predicting conversion of tryptophan 493 to arginine (W493R), was found. Both deviations were present in the father. The W493R polymorphism was confirmed by restriction cleavage of a PCR product because it eliminates an MscI site introduced in the wild-type sequence when the primer described above is used (not shown). The T1477→C transition was found once in 62 normal alleles. The positive allele did not have the C1685→T transition. All 1449delC alleles in the 3 families had the same intragenic dimorphism GCC at codon 663.
A
B Fig 3. Demonstration of 729delA mutation in patient 3, family 2. A, Sequence of the cloned mutant allele from nucleotide 724 to 733 (located in exon 4), showing deletion of A729 (arrow). B, Normal allele.
Fig 4. Demonstration of C1685→T transition in patient 4, family 3. Sequence from nucleotide 1682 to 1688 in exon 13, demonstrating both C and T at position 1685 (arrow).
DISCUSSION Besides recurrent episodes of electrolyte disturbances and gastrointestinal symptoms, all of our 3 living patients with PHA1 have had, to a variable extent, respiratory problems.
Fig 5. Diagram of 669 amino acid residue α subunit of ENaC, showing positions of mutations.The 729delA mutation corresponds to the beginning of the extracellular loop and introduces a premature termination at codon 248.The 1449delC mutation affects the end of the extracellular loop and introduces a premature termination at codon 496.The C1685→T transition converts serine 562 in the second transmembrane domain to leucine.The putative polymorphism W493R is located in the C-terminal portion of the extracellular domain.
743
SCHAEDEL ET AL
Patient 1 has had frequent periods of cough and wheezing and 3 episodes of bronchopneumonia caused by Staphylococcus aureus, H influenzae, and Streptococcus pneumoniae. Patient 3 has had recurrent P aeruginosa pulmonary infections. Cultures from sputa have also grown Staphylococcus aureus, H influenzae, and Serratia species. Patient 4 had less prominent lung symptoms. Recurrent lower respiratory tract infections have previously been reported in patients with the multi-organ form of PHA112-14 and compared with those in CF, which is also caused by a defect in electrolyte transport. The patients described here demonstrate that the bacterial findings are similar in the 2 diseases. Two frameshift mutations, 729delA and 1449delC, found in our patients, are both predicted to lead to nonfunctional proteins. The protein product of the 729delA allele would contain only the beginning of the extracellular loop and that of the 1449delC allele would lack both the second transmembrane domain and the intracellular COOH terminus (Fig 5). In patient 4, one of the αENaC alleles coded for a substitution mutation, S562L. It is located in the second transmembrane domain and can be assumed to interfere with membrane insertion. A second aberration on the same allele, the substitution of arginine for tryptophan 493, is probably a rare polymorphism, because it was present once among 62 normal alleles. However, in the absence of expression studies, it cannot be excluded that the 2 substitutions act in conjunction. Patient 4 had fewer lung symptoms than the other patients, which suggests the presence of a sodium channel with reduced but not totally absent activity. His response to an inhibitor of 11β-hydroxysteroid dehydrogenase, carbenoxolone, which increases intracellular cortisol concentration,21 supports this theory. A high concentration of cortisol may upregulate ENaC via the mineralocorticoid receptor in cases in which the channel has some func744
THE JOURNAL OF PEDIATRICS DECEMBER 1999 tional capacity,2,22 although we have no direct evidence for this. The fact that the S562L mutation was absent in 92 alleles from healthy subjects increases the likelihood of its being a new disease-causing mutation. The 1449delC mutation was found in all our patients, suggesting it to be the predominant cause of the recessive form of PHA1 in Sweden. The microsatellite polymorphism markers D12S93 and D12S314 showed different genotypes in all 3 families. However, these markers are located 12 and 13 centiMorgan, respectively, from the αENaC gene (NCBI). The fact that the intragenic polymorphism GCC was found in all 1449delC alleles seems to indicate a common origin, probably several generations ago. However, inquiry into the kindred histories has not disclosed any connections. In all our patients, mutations or candidate mutations were found in the α subunit. We suggest that inactivating mutations of αENaC are typical of patients with PHA1 and pulmonary involvement. This is consistent with the findings of recurrent respiratory tract infections in a patient reported to have a R508stop mutation of the α gene.3 Mutations affecting the β and γ subunits can also lead to the PHA1 phenotype, but clinical data on those few patients’ lung status have not been presented.3,4 PHA1 mutations resulting in deficiency of the α subunit can be expected to be more severe because αENaC is indispensable for the sodium channel activity.8,23 Isolated defects in either the β or γ subunit could be expected to give rise to a milder multi-organ disease, because studies by McDonald et al10 demonstrated that co-expression of αγENaC or αβENaC generates an amiloride-sensitive sodium channel current, although much reduced compared with the complete channel αβγENaC. Furthermore, homologous mutations introduced into α, β, or γ subunits and expressed in Xenopus laevis oocytes all decreased the ENaC activity, but mutation of the α subunit showed the most
dramatic effect.24 Finally, inactivation of the α genes in a transgenic animal model resulted in neonatal death caused by defective lung liquid clearance,25 but disruption of the β or γ genes did not have such a consequence.26,27 Obviously, β and γ subunits are not as vital for pulmonary ENaC as the α subunit. The reason for lung infections in PHA1 is not clear. In CF the activity of ENaC is upregulated as a result of relaxation of the inhibition by CFTR. This results in increased sodium absorption.5,28-30 The concurrent flow of water probably contributes to dehydration of mucus and altered mucociliary clearance in CF. In PHA1, the situation is the reverse, that is, decreased sodium absorption. This would tend to greatly increase the volume of exudate in the airways25 but not necessarily the salt concentration. The relationship between salt concentration in airway surface liquid and airway defense mechanisms has been debated during the last few years. Smith et al31 found an increased concentration of chloride in CF airway liquid and demonstrated that high salt concentration inhibited the defense against P aeruginosa. However, the high salt hypothesis has been questioned by Knowles et al,32 who found no difference in ion composition of airway liquid between patients with CF and healthy individuals or patients with other pulmonary diseases. No difference in osmolarity of the airway liquid was found between patients with PHA1 and patients with CF or healthy individuals (Kerem et al, personal communication). Although the lung disease in PHA1 superficially resembles CF with respect to recurrent lower respiratory tract infections from an early age and findings of similar bacteria, it differs with respect to the development of bronchiectasis or chronic lung disease, which are conspicuously absent in PHA1. The obvious sensitivity of the airways to disturbances in water and salt homeostasis might explain how 2 diametrically opposed pathogenic mechanisms could give rise to similar symptoms.
SCHAEDEL ET AL
THE JOURNAL OF PEDIATRICS VOLUME 135, NUMBER 6 In conclusion, this study demonstrates that inactivation of ENaC by mutations of the αENaC gene is associated with a clinical picture of pseudohypoaldosteronism that includes pulmonary disease, resembling but definitely not identical to that of CF. We thank Dr Ulf Westgren for sharing patient data with us and Christina Isaksson for technical assistance.
REFERENCES 1. Cheek D, Perry J. A salt-wasting syndrome in infancy. Arch Dis Child 1958;33:252-6. 2. Geller D, Rodriguez-Soriano J, Vallo Boado A, Schifter S, Bayer M, Chang S, et al. Mutations in the mineralocorticoid receptor gene cause autosomal dominant pseudohypoaldosteronism type 1. Nature Genet 1998;19:279-81. 3. Chang S, Grunder S, Hanukoglu A, Rösler A, Mathew P, Hanukoglu I, et al. Mutations in subunits of the epithelial sodium channel cause salt wasting with hyperkalaemic acidosis, pseudohypoaldosteronism type 1. Nature Genet 1996;12:248-53. 4. Strautnieks S, Thompson R, Gardiner M, Chung E. A novel splice-site mutation in the γ subunit of the epithelial sodium channel gene in three pseudohypoaldosteronism type 1 families. Nature Genet 1996;13:248-50. 5. Boucher R, Stutts M, Knowles M, Cantley L, Gatzy J. Na+ transport in cystic fibrosis respiratory epithelia. Abnormal basal rate and response to adenylate cyclase activation. J Clin Invest 1986;78:1245-52. 6. Voilley N, Lingueglia E, Champigny G, Mattei MG, Waldmann R, Lazdunski M, et al. The lung amiloride-sensitive Na+ channel: biophysical properties, pharmacology, ontogenesis, and molecular cloning. Proc Natl Acad Sci USA 1994;91:247-51. 7. Firsov D, Gautschi I, Merillat AM, Rossier BC, Schild L. The heterotetrameric architecture of the epithelial sodium channel (ENaC). EMBO J 1998;17:344-52 8. Canessa C, Schild L, Buell G, Thorens B, Gautschi I, Horisberger J-D, et al. Amiloride-sensitive epithelial Na+ channel is made of three homologous subunits. Nature 1994;367:463-7. 9. McDonald F, Snyder P, McCray J, Welsh M. Cloning, expression, and tissue distribution of a human amiloridesensitive Na+ channel. Am J Physiol 1994;266:L728-34.
10. McDonald F, Price M, Snyder P, Welsh M. Cloning and expression of the β- and γ-subunits of the human epithelial sodium channel. Am J Physiol 1995;268:C1157-63. 11. Strautnieks S, Thompson R, Hanukoglu A, Dillon M, Hanukoglu I, Kuhnle U, et al. Localisation of pseudohypoaldosteronism genes to chromosome 16p12.2-13.11 and12p13.1-pter by homozygosity mapping. Hum Mol Genet 1996;5:293-9. 12. Hanukoglu A, Bistritzer T, Rakover Y, Mandelberg A. Pseudohypoaldosteronism with increased sweat and saliva electrolyte values and frequent lower respiratory tract infections mimicking cystic fibrosis. J Pediatr 1994;125:752-5. 13. MacLaughlin E. Pseudohypoaldosteronism and sodium transport. Pediatr Pulmonol 1996;13:181-2. 14. Marthinsen L, Kornfält R, Aili M, Andersson D, Westgren U, Schaedel C. Recurrent Pseudomonas bronchopneumonia and other symptoms as in cystic fibrosis in a child with type 1 pseudohypoaldosteronism. Acta Paediatr 1998;87:472-4. 15. Blin N, Stafford D. A general method for isolation of high molecular weight DNA from eukaryotes. Nucleic Acids Res 1976;3:2303-8. 16. Gyapay G, Morissette J, Vignal A, Dib C, Fizames C, Millasseau P, et al. The 1993-94 Genethon human genetic linkage map. Nature Genet 1994;7:246-339. 17. Ludwig M, Bolkenius U, Wickert L, Bidlingmaier F. Common polymorphisms in genes encoding the human mineralocorticoid receptor and the human amiloride-sensitive sodium channel. J Steroid Biochem Molec Biol 1998;64:227-30. 18. Ludwig M, Bolkenius U, Wickert L, Marynen P, Bidlingmaier F. Structural organisation of the gene encoding the α-subunit of the human amiloride-sensitive epithelial sodium channel. Hum Genet 1998;102:576-81. 19. Alton EW, Hay JG, Munro C, Geddes DM. Measurement of nasal potential difference in adult cystic fibrosis, Young’s syndrome, and bronchiectasis. Thorax 1987;2:815-7. 20. Gibson LE, Cooke RE. A test for concentration of electrolytes in sweat in cystic fibrosis of the pancreas utilizing pilocarpine by iontophoresis. Pediatrics 1959;23:545-9. 21. Arai K, Tsigows C, Suzuki Y, Irony I, Karl M, Listwak S, et al. Physiological and molecular aspects of mineralocorticoid receptor action in pseudohypoaldosteronism: a responsiveness test and therapy. J Clin Endocrinol Metab 1994;79:1019-23.
22. May A, Puoti A, Gaeggeler HP, Horisberger JD, Rossier BC. Early effect of aldosterone on the rate of synthesis of the epithelial sodium channel α subunit in A6 renal cells. J Am Soc Nephrol 1997;8:1813-22. 23. Awayda M, Tousson A, Benos D. Regulation of a cloned epithelial Na+ channel by its b- and g-subunits. Am J Physiol 1997;363:C1889-99. 24. Grunder S, Firsov D, Chang S, Fowler Jaeger N, Gautschi I, Schild L, et al. A mutation causing pseudohypoaldosteronism type 1 identifies a conserved glycine that is involved in the gating of the epithelial sodium channel. EMBO J 1997;16:899-907. 25. Hummler E, Barker P, Gatzy J, Beermann F, Verdumo C, Schmidt A, et al. Early death due to defective neonatal lung liquid clearance in αENaC-deficient mice. Nature Genet 1996;12:325-8. 26. McDonald F, Yang B, Hrstka RF, Drummond HA, Tarr DE, McCray PB, et al. Disruption of the β subunit of the epithelial Na+ channel in mice: hyperkalemia and neonatal death associated with a pseudohypoaldosteronism phenotype. Proc Natl Acad Sci USA 1999;96:1727-31. 27. Barker PM, Nguyen MS, Gatzy JT, Grubb B, Norman H, Hummler E, et al. Role of γENaC subunit in lung liquid clearance and electrolyte balance in newborn mice. Insights into perinatal adaption and pseudohypoaldosteronism. J Clin Invest 1998;102:1634-40. 28. Ismailov I, Awayda M, Jovov B, Berdiev B, Fuller C, Dedman J, et al. Regulation of epithelial sodium channels by the cystic fibrosis transmembrane conductance regulator. J Biol Chem 1996;271:4725-32. 29. Kunzelman K, Kiser G, Schreiber R, Riordan J. Inhibition of epithelial Na+ currents by intracellular domains of the cystic fibrosis transmembrane conductance regulator. FEBS Lett 1997; 400:341-4. 30. Stutts J, Rossier B, Boucher R. Cystic fibrosis transmembrane conductance regulator inverts protein kinase A-mediated regulation of epithelial sodium channel single channel kinetics. J Biol Chem 1997;272:14037-40. 31. Smith J, Travis S, Greenberg E, Welsh M. Cystic fibrosis airway epithelia fail to kill bacteria because of abnormal airway surface fluid. Cell 1996;85:229-36. 32. Knowles M, Robinson J, Wood R, Pue C, Mentz W, Wager G, et al. Ion composition of airway surface liquid of patients with cystic fibrosis as compared with normal and disease-control subjects. J Clin Invest 1997;100:2588-95. 745
Lung symptoms in pseudohypoaldosteronism type 1
are associated with deficiency of the α-subunit of the epithelial sodium channel
Charlotta Schaedel, MD, Lars Marthinsen, MD, Ann-Charlotte Kristoffersson, BS, Ragnhild Kornfält, MD, PhD, Karl Olof Nilsson, MD, PhD, Bo Orlenius, MD, and Lars Holmberg, MD, PhD
Objective: To study patients with autosomal recessive pseudohypoaldosteronism type 1 and to relate pulmonary disease to gene mutations of the epithelial sodium channel (ENaC). Study design: Clinical and laboratory data were collected from 4 Swedish patients with pseudohypoaldosteronism type 1. The genes for ENaC and cystic fibrosis transmembrane conductance regulator were analyzed for mutations with methods including DNA sequencing. Results: Three novel mutations were found in the α-gene of ENaC, 2 frameshifts (1449delC and 729delA) and 1 missense mutation resulting in the substitution of leucine for serine 562 in the α-chain (S562L). The 1449delC mutation was found in all patients in either homozygous or heterozygous form and seems to be the predominant cause of pseudohypoaldosteronism in Sweden. The allele coding for S562L also contained a transition converting tryptophan 493 to arginine (W493R), which seems to be a rare polymorphism. All patients had pulmonary symptoms to various degrees. The bacterial findings resembled, to some extent, those in cystic fibrosis, but development of chronic lung disease and progressive decline in lung function were not observed. Conclusions: Genetic deficiencies of the α subunit of the ENaC are associated with prominent lung symptoms, which are, however, clearly different from those in cystic fibrosis. (J Pediatr 1999;135:739-45)
recently found to be caused by mutations in the mineralocorticoid receptor2 and seems to improve with age. The autosomal recessive form affects multiple organs such as the kidneys, colon, See related article, p. 786. sweat and salivary glands, and the lungs and has been associated with mutations in the genes encoding the amiloridesensitive epithelial sodium channel.3,4 The channel is located in the apical membrane and controls sodium reabsorption in the kidneys and colon and regulates fluid secretion in the lungs.5,6 It is composed of 3 homologous subunits α, β, and γ, which assemble in a heterotetrameric structure containing 2 α, 1 β, and 1 γ.7 Each subunit comprises a large hydrophilic extracellular loop, 2 hydrophobic transmembrane domains, and short intracellular NH2- and CFTR
Pseudohypoaldosteronism type 1 is characterized by severe neonatal salt wasting, which results in hyponatremia, hyperkalemia, dehydration, and
metabolic acidosis despite high levels of plasma aldosterone.1 There are 2 forms of PHA1. The autosomal dominant form, affecting only the kidneys, was
From the Department of Pediatrics, University Hospitals in Lund and Malmö, Lund University, Lund and Malmö, Sweden; Department of Pediatrics, Linköping, Sweden; and the Department of Pediatrics, Halmstad, Sweden.
Supported by grants from the Swedish Medical Research Council (4997), the Thelma Zoega Foundation, the Royal Physiographic Society, Kock’s Foundation, and Slättens Ideella Barnhjälp. Submitted for publication Dec 14, 1998; revision received May 7, 1999; accepted Aug 9, 1999. Reprint requests: Charlotta Schaedel, MD, Department of Pediatrics, University Hospital, S-221 85 Lund, Sweden. Copyright © 1999 by Mosby, Inc. 0022-3476/99/$8.00 + 0 9/21/102349
Cystic fibrosis transmembrane conductance regulator ENaC Epithelial sodium channel PCR Polymerase chain reaction PHA1 Pseudohypoaldosteronism type 1 SSCP Single-stranded conformation polymorphism
COOH termini.8-10 The gene for αENaC is located on chromosome 12, and those for βENaC and γENaC are on chromosome 16.11 Only very few PHA1-causing mutations have been found until now. A frameshift and a stop mutation (I68fr, R508X) in the α gene and a missense mutation, G37S, in 739
SCHAEDEL ET AL
the β gene were described by Chang et al.3 A splice site mutation (318-1 G→A) in the γ gene was reported by Strautnieks et al.4 In the lungs, ENaC regulates the quantity and composition of respiratory tract fluid. Interestingly, a few patients with the recessive form of PHA1 have been described as having recurrent pulmonary infections similar to those in cystic fibrosis,12-14 which is also a disorder of disturbed electrolyte transport. In this study we examined 4 children, from 3 unrelated families, with the recessive form of PHA1. We found 3 novel mutations and provide evidence that lung symptoms are prominent in patients with mutations involving the α subunit of ENaC.
METHODS Patients Four patients (2 from 1 family; the elder patient is deceased) with the recessive form of PHA1 and their families were analyzed for mutations in the ENaC genes. The 3 families were all from Sweden and are unrelated as far as we have been able to determine. The parents in each family were also unrelated. Informed consent was obtained from the patients and their families.
DNA Extraction Genomic DNA was isolated from EDTA blood according to standard methods15 or with the use of QIAamp blood kits (Qiagen). DNA from the deceased patient was extracted from a dried blood spot on a filter paper (obtained for phenylketonuria testing of the newborn and stored by SBL, Stockholm, Sweden, for 14 years).
THE JOURNAL OF PEDIATRICS DECEMBER 1999 primers,16 one in each pair labeled with fluorescence. The polymerase chain reaction products were analyzed with the Applied Biosystem 373 Sequencer GeneScan (Cybergene AB, Stockholm, Sweden). An intragenic polymorphism ACC/GCC in exon 13 of the α subunit17 was investigated with AciI cleavage of the amplified exon.
Sequencing All coding exons of αENaC and exons 4, 7, 8, 10, 11, and 12 of βENaC were amplified with previously described primers,3 except for 2 changes: (A3F GGCACAGATGAGGACCCTGAC and A8F GAGGCACTTCCTCTGTCCTCTG, R. P. Lifton, personal communication). A1F and A2R were used for amplification of exon 2.18 In general, the conditions were 35 cycles of denaturation for 30 seconds at 94°C, annealing for 15 seconds at 55°C, and extension for 1 minute at 72°C. The products were purified with PCR Purification Kit QIAquick (Qiagen). Automatic sequencing was performed by using the ABI PRISM Big Dye Terminator Cycle Sequencing Ready Reaction Kit (Perkin Elmer) on an ABI 310 sequencer (PE Applied Biosystems). The primers used for sequencing were the same as those for amplification. To resolve an ambiguous double sequence in exon 4 of patient 3, we cloned the alleles in the pCR2.1-TOPO vector, using the TOPO TA cloning system (Invitrogen). Normal clones and clones containing the mutation were sequenced as described above. Nucleotide and amino acid positions are given relative to the translation start according to the method of McDonald et al.9 Exons are denoted according to the method of Chang et al.3
Microsatellite Polymorphism Genotyping and Determination of an Intragenic Polymorphism
Single-Stranded Conformation Polymorphism
The genotypes of polymorphic marker loci linked to αENaC, D12S314, and D12S93 and to βγENaC, D16S412, and D16S403 were determined with published oligonucleotide
SSCP was performed in 12.5% polyacrylamide gels with the GenePhor system (Pharmacia, Uppsala, Sweden). The electrophoreses were run at various temperatures between 5°C and
740
20°C. The gels were silver-stained with the GenePhor kit according to the manufacturer’s instructions.
Restriction Enzyme Cleavages Exons 4, 10, and 13 of the αENaC gene were amplified in patients, parents, and siblings by primers described3 and cleaved by AciI, MnlI, MscI, MslI, and RsaI (New England BioLabs), respectively, as indicated below. Restriction fragments were analyzed by electrophoresis in 12.5% polyacrylamide with the same system as for SSCP but without denaturation. Forty-six healthy control individuals were studied by MnlI digestion of exon 13. Thirty-one healthy subjects were studied by MscI cleavage of a fragment of exon 10, obtained by PCR amplification with the forward primer A11F (5´AACACTGAGCACCTTTCTCCATC) and the reverse primer (5´ACCTGGGATGTCACCGATGGCC). The latter contains a mismatch (indicated in bold) 5 nucleotides from the 3´ end, which creates an MscI site (TGGCCA) in the wild type, but not in alleles in which T1477 is mutated (see Results).
CF Analysis In patient 3, the whole coding portion of the CFTR gene was sequenced. The other patients were studied for the 3 most common mutations in Sweden: ∆F508, 394delTT, and 3659delC. Measurement of the potential difference over the nasal mucosa was done according to the method of Alton et al.19 Sweat chloride concentrations were measured by using the quantitative pilocarpine iontophoretic method.20
Cultures Cultures from blood, nasopharynx, and sputum were done by standard bacteriologic techniques.
CASE HISTORIES Patient 1 is a 2-year-old girl who had symptoms of PHA1 at the age of 9
SCHAEDEL ET AL
THE JOURNAL OF PEDIATRICS VOLUME 135, NUMBER 6 Table I. Laboratory data at diagnosis in 4 patients with recessive PHA1
Patient No. 1 2 3 4 Normal values
Mutation
Age at diagnosis (d)
1449delC/1449delC 729delA/1449delC 729delA/1449delC S562L/1449delC
9 5 4 11
Serum sodium conc (mmol/L) 116 124 129 106 136-146
Serum Plasma potassium aldosterone conc conc (mmol/L) (nmol/L) 10.4 10.4 8.4 11.4 3.5-5.0
33 30.9 13.3 6 0.15-0.9
Plasma renin conc (µg/L/h)
Sweat chloride conc (mmol/L)
4125* 60 27.4 60.3 0.2-2
131 — 110 155 < 60
conc, Concentration. *Plasma renin concentration in patient 1 was measured as nanograms per liter (normal value <250 ng/L).
Table II. Clinical characteristics of 3 children with PHA1 caused by mutations of the αENaC gene
Patient No.
No. of bronchopneumonia episodes
1
3
3
21
Mostly lower right and left lung and middle lobe
4
2
Left lower lobe and middle lobe
Chest x-ray infiltrates
Bacterial findings Sputum
Middle lobe and lower right lung
Nasopharynx Staphylococcus aureus, H influenzae, Streptococcus pneumoniae
P aeruginosa, Staphylococcus aureus, H influenzae
No. of IV antibiotic treatments 3
21
2
IV, Intravenous.
days. Hyponatremia, hyperkalemia, elevated plasma renin and aldosterone levels, and a high sweat chloride concentration were found (Table I). She was treated with sodium supplements. The patient has had several periods of fever with coughing, wheezing, and excessive mucus in the respiratory tract since the age of 8 months and has been hospitalized 3 times for bronchopneumonia requiring intravenous antibiotics. Chest x-ray films have demonstrated infiltrates in the middle lobe and other parts of the right lung (Table II), but the infiltrates always respond to appropriate treatment. Bronchoscopy was not performed. Nasopharyngeal cultures have grown Staphylococcus aureus, Haemophilus influenzae, Streptococcus
pneumoniae, and Moraxella catarrhalis on various occasions; and blood cultures have been positive for Staphylococcus aureus (in association with a central venous line). Patient 2, born in 1984, is the deceased brother of patient 3. He was admitted to the hospital at the age of 5 days with severe dehydration, hyponatremia, and hyperkalemia. Laboratory examination showed high levels of plasma aldosterone and renin (Table I). The hyperkalemia led to cardiac arrest, and he required resuscitation. In the next few days, he was treated with dialysis and electroconversions for ventricular fibrillation, but he finally died at the age of 7 weeks during cardiac arrhythmia caused by hyperkalemia.
Patient 3 is the 8-year-old brother of patient 2. His clinical picture has previously been described.13 Briefly, he fell ill at the age of 4 days with renal salt wasting, resulting in severe hyponatremia and hyperkalemia. Plasma aldosterone, plasma renin, and sweat chloride concentrations were elevated (Table I). He was successfully treated with sodium supplements and an ion-binding resin. Since the age of 4 months, he has had frequent respiratory tract infections, requiring treatment with intravenous antibiotics 21 times, 13 times in the hospital and otherwise at home. Chest x-ray films have demonstrated infiltrates mostly in the lower lobes, or in the middle lobe, but they have always resolved with appropriate treatment (Table II). 741
SCHAEDEL ET AL
THE JOURNAL OF PEDIATRICS DECEMBER 1999
A
Fig 1. Pedigrees of 3 families with autosomal recessive PHA1. Arrows indicate probands. Homozygosity for the 1449delC mutation is indicated by a black filled symbol. Heterozygosity for 1449delC is indicated by black half-filled symbols. Spotted half-filled symbols denote heterozygosity for the 729delA mutation. Hatched half-filled symbols denote heterozygosity for the S562L mutation.
B The sputum cultures have repeatedly shown Pseudomonas aeruginosa and have also grown Staphylococcus aureus, H influenzae, Streptococcus pneumoniae, and Serratia liquefaciens. Pulmonary function studies, performed between relapses, demonstrated normal values for forced expiratory volume in 1 second and forced vital capacity (101%-107% and 95%105%, respectively, of predicted values for sex, age, and height). Bronchoscopy between the episodes showed normal findings. The resting nasal mucosa potential difference was normal (–9 mV; normal values, –5 mV to –30 mV). Patient 4 is a 9-year-old boy who became ill at the age of 11 days and who was diagnosed with PHA1 on the basis of findings of severe hyponatremia, hyperkalemia, and increased plasma aldosterone, plasma renin, and sweat chloride concentrations (Table I). He has had several episodes of disturbance of salt and water balance and often experiences constipation. Gastroscopy revealed a chronic gastric 742
Fig 2. Demonstration of 1449delC mutation in patient 1, family 1. A, Sequence from nucleotide 1446 to 1452 in exon 10, showing a homozygous deletion of C1449 (arrow). B, Normal sequence. ulcer. He has been treated with sodium supplements, an ion-binding resin, and recently, carbenoxolone, which has reduced the need for sodium supplements. He has had 2 episodes of bronchopneumonia, both requiring hospitalization and intravenous antibiotics. X-ray films showed an infiltrate in the left lower lobe on the first occasion and infiltrates in the left lower lobe and the middle lobe on the other (Table II). No cultures were done. Besides these episodes, he has had few respiratory symptoms.
RESULTS Pedigrees of the 3 families are shown in Fig 1. All analyses for CFTR mutations were negative. Determination of polymorphic markers supposed
to be linked to the α gene of ENaC on chromosomes 12 and the β and γ genes on chromosome 16 did not suggest linkage of the disease to any one of these. In spite of that, we performed SSCP analysis and sequencing, starting with the α gene because the case histories strongly suggested a deficiency of ENaC. Patient 1, the propositus (II:2) in family 1, was homozygous for a deletion of cytosine 1449 located in exon 10 (Fig 2). The mutation could be confirmed with restriction enzyme cleavage, because it creates a new RsaI site (not shown). It predicts an abnormal amino acid sequence after codon 482 and chain termination after amino acid 495 of the 669 amino acid residue αENaC protein. Both parents were heterozygous for the deletion, as was the elder sister (II:1).
SCHAEDEL ET AL
THE JOURNAL OF PEDIATRICS VOLUME 135, NUMBER 6 Patient 3, the propositus (II:4) in family 2, was found to be a compound heterozygote for the 1449delC mutation and a second deletion, 729delA, located in exon 4 on the other allele. The latter was identified by SSCP and confirmed by sequencing of the cloned alleles (Fig 3). It could also be confirmed by restriction enzyme cleavage because it creates a new MslI site (not shown). It predicts a truncated translation product of 247 amino acid residues with an abnormal sequence from amino acid 243. The deceased brother (II:2) had the same mutations. A healthy elder brother (II:1) was heterozygous for 1449delC, inherited from the father. Patient 4, the propositus (II:1) in family 3, was heterozygous for 1449delC. On the other allele he had a C1685→T transition in exon 13 substituting leucine for serine (S562L) (Fig 4). It could be confirmed by restriction enzyme cleavage because it eliminates an Mnl1 site (data not shown). It was not present in 92 normal alleles. Furthermore, a second aberration, T1477→C, in exon 10, predicting conversion of tryptophan 493 to arginine (W493R), was found. Both deviations were present in the father. The W493R polymorphism was confirmed by restriction cleavage of a PCR product because it eliminates an MscI site introduced in the wild-type sequence when the primer described above is used (not shown). The T1477→C transition was found once in 62 normal alleles. The positive allele did not have the C1685→T transition. All 1449delC alleles in the 3 families had the same intragenic dimorphism GCC at codon 663.
A
B Fig 3. Demonstration of 729delA mutation in patient 3, family 2. A, Sequence of the cloned mutant allele from nucleotide 724 to 733 (located in exon 4), showing deletion of A729 (arrow). B, Normal allele.
Fig 4. Demonstration of C1685→T transition in patient 4, family 3. Sequence from nucleotide 1682 to 1688 in exon 13, demonstrating both C and T at position 1685 (arrow).
DISCUSSION Besides recurrent episodes of electrolyte disturbances and gastrointestinal symptoms, all of our 3 living patients with PHA1 have had, to a variable extent, respiratory problems.
Fig 5. Diagram of 669 amino acid residue α subunit of ENaC, showing positions of mutations.The 729delA mutation corresponds to the beginning of the extracellular loop and introduces a premature termination at codon 248.The 1449delC mutation affects the end of the extracellular loop and introduces a premature termination at codon 496.The C1685→T transition converts serine 562 in the second transmembrane domain to leucine.The putative polymorphism W493R is located in the C-terminal portion of the extracellular domain.
743
SCHAEDEL ET AL
Patient 1 has had frequent periods of cough and wheezing and 3 episodes of bronchopneumonia caused by Staphylococcus aureus, H influenzae, and Streptococcus pneumoniae. Patient 3 has had recurrent P aeruginosa pulmonary infections. Cultures from sputa have also grown Staphylococcus aureus, H influenzae, and Serratia species. Patient 4 had less prominent lung symptoms. Recurrent lower respiratory tract infections have previously been reported in patients with the multi-organ form of PHA112-14 and compared with those in CF, which is also caused by a defect in electrolyte transport. The patients described here demonstrate that the bacterial findings are similar in the 2 diseases. Two frameshift mutations, 729delA and 1449delC, found in our patients, are both predicted to lead to nonfunctional proteins. The protein product of the 729delA allele would contain only the beginning of the extracellular loop and that of the 1449delC allele would lack both the second transmembrane domain and the intracellular COOH terminus (Fig 5). In patient 4, one of the αENaC alleles coded for a substitution mutation, S562L. It is located in the second transmembrane domain and can be assumed to interfere with membrane insertion. A second aberration on the same allele, the substitution of arginine for tryptophan 493, is probably a rare polymorphism, because it was present once among 62 normal alleles. However, in the absence of expression studies, it cannot be excluded that the 2 substitutions act in conjunction. Patient 4 had fewer lung symptoms than the other patients, which suggests the presence of a sodium channel with reduced but not totally absent activity. His response to an inhibitor of 11β-hydroxysteroid dehydrogenase, carbenoxolone, which increases intracellular cortisol concentration,21 supports this theory. A high concentration of cortisol may upregulate ENaC via the mineralocorticoid receptor in cases in which the channel has some func744
THE JOURNAL OF PEDIATRICS DECEMBER 1999 tional capacity,2,22 although we have no direct evidence for this. The fact that the S562L mutation was absent in 92 alleles from healthy subjects increases the likelihood of its being a new disease-causing mutation. The 1449delC mutation was found in all our patients, suggesting it to be the predominant cause of the recessive form of PHA1 in Sweden. The microsatellite polymorphism markers D12S93 and D12S314 showed different genotypes in all 3 families. However, these markers are located 12 and 13 centiMorgan, respectively, from the αENaC gene (NCBI). The fact that the intragenic polymorphism GCC was found in all 1449delC alleles seems to indicate a common origin, probably several generations ago. However, inquiry into the kindred histories has not disclosed any connections. In all our patients, mutations or candidate mutations were found in the α subunit. We suggest that inactivating mutations of αENaC are typical of patients with PHA1 and pulmonary involvement. This is consistent with the findings of recurrent respiratory tract infections in a patient reported to have a R508stop mutation of the α gene.3 Mutations affecting the β and γ subunits can also lead to the PHA1 phenotype, but clinical data on those few patients’ lung status have not been presented.3,4 PHA1 mutations resulting in deficiency of the α subunit can be expected to be more severe because αENaC is indispensable for the sodium channel activity.8,23 Isolated defects in either the β or γ subunit could be expected to give rise to a milder multi-organ disease, because studies by McDonald et al10 demonstrated that co-expression of αγENaC or αβENaC generates an amiloride-sensitive sodium channel current, although much reduced compared with the complete channel αβγENaC. Furthermore, homologous mutations introduced into α, β, or γ subunits and expressed in Xenopus laevis oocytes all decreased the ENaC activity, but mutation of the α subunit showed the most
dramatic effect.24 Finally, inactivation of the α genes in a transgenic animal model resulted in neonatal death caused by defective lung liquid clearance,25 but disruption of the β or γ genes did not have such a consequence.26,27 Obviously, β and γ subunits are not as vital for pulmonary ENaC as the α subunit. The reason for lung infections in PHA1 is not clear. In CF the activity of ENaC is upregulated as a result of relaxation of the inhibition by CFTR. This results in increased sodium absorption.5,28-30 The concurrent flow of water probably contributes to dehydration of mucus and altered mucociliary clearance in CF. In PHA1, the situation is the reverse, that is, decreased sodium absorption. This would tend to greatly increase the volume of exudate in the airways25 but not necessarily the salt concentration. The relationship between salt concentration in airway surface liquid and airway defense mechanisms has been debated during the last few years. Smith et al31 found an increased concentration of chloride in CF airway liquid and demonstrated that high salt concentration inhibited the defense against P aeruginosa. However, the high salt hypothesis has been questioned by Knowles et al,32 who found no difference in ion composition of airway liquid between patients with CF and healthy individuals or patients with other pulmonary diseases. No difference in osmolarity of the airway liquid was found between patients with PHA1 and patients with CF or healthy individuals (Kerem et al, personal communication). Although the lung disease in PHA1 superficially resembles CF with respect to recurrent lower respiratory tract infections from an early age and findings of similar bacteria, it differs with respect to the development of bronchiectasis or chronic lung disease, which are conspicuously absent in PHA1. The obvious sensitivity of the airways to disturbances in water and salt homeostasis might explain how 2 diametrically opposed pathogenic mechanisms could give rise to similar symptoms.
SCHAEDEL ET AL
THE JOURNAL OF PEDIATRICS VOLUME 135, NUMBER 6 In conclusion, this study demonstrates that inactivation of ENaC by mutations of the αENaC gene is associated with a clinical picture of pseudohypoaldosteronism that includes pulmonary disease, resembling but definitely not identical to that of CF. We thank Dr Ulf Westgren for sharing patient data with us and Christina Isaksson for technical assistance.
REFERENCES 1. Cheek D, Perry J. A salt-wasting syndrome in infancy. Arch Dis Child 1958;33:252-6. 2. Geller D, Rodriguez-Soriano J, Vallo Boado A, Schifter S, Bayer M, Chang S, et al. Mutations in the mineralocorticoid receptor gene cause autosomal dominant pseudohypoaldosteronism type 1. Nature Genet 1998;19:279-81. 3. Chang S, Grunder S, Hanukoglu A, Rösler A, Mathew P, Hanukoglu I, et al. Mutations in subunits of the epithelial sodium channel cause salt wasting with hyperkalaemic acidosis, pseudohypoaldosteronism type 1. Nature Genet 1996;12:248-53. 4. Strautnieks S, Thompson R, Gardiner M, Chung E. A novel splice-site mutation in the γ subunit of the epithelial sodium channel gene in three pseudohypoaldosteronism type 1 families. Nature Genet 1996;13:248-50. 5. Boucher R, Stutts M, Knowles M, Cantley L, Gatzy J. Na+ transport in cystic fibrosis respiratory epithelia. Abnormal basal rate and response to adenylate cyclase activation. J Clin Invest 1986;78:1245-52. 6. Voilley N, Lingueglia E, Champigny G, Mattei MG, Waldmann R, Lazdunski M, et al. The lung amiloride-sensitive Na+ channel: biophysical properties, pharmacology, ontogenesis, and molecular cloning. Proc Natl Acad Sci USA 1994;91:247-51. 7. Firsov D, Gautschi I, Merillat AM, Rossier BC, Schild L. The heterotetrameric architecture of the epithelial sodium channel (ENaC). EMBO J 1998;17:344-52 8. Canessa C, Schild L, Buell G, Thorens B, Gautschi I, Horisberger J-D, et al. Amiloride-sensitive epithelial Na+ channel is made of three homologous subunits. Nature 1994;367:463-7. 9. McDonald F, Snyder P, McCray J, Welsh M. Cloning, expression, and tissue distribution of a human amiloridesensitive Na+ channel. Am J Physiol 1994;266:L728-34.
10. McDonald F, Price M, Snyder P, Welsh M. Cloning and expression of the β- and γ-subunits of the human epithelial sodium channel. Am J Physiol 1995;268:C1157-63. 11. Strautnieks S, Thompson R, Hanukoglu A, Dillon M, Hanukoglu I, Kuhnle U, et al. Localisation of pseudohypoaldosteronism genes to chromosome 16p12.2-13.11 and12p13.1-pter by homozygosity mapping. Hum Mol Genet 1996;5:293-9. 12. Hanukoglu A, Bistritzer T, Rakover Y, Mandelberg A. Pseudohypoaldosteronism with increased sweat and saliva electrolyte values and frequent lower respiratory tract infections mimicking cystic fibrosis. J Pediatr 1994;125:752-5. 13. MacLaughlin E. Pseudohypoaldosteronism and sodium transport. Pediatr Pulmonol 1996;13:181-2. 14. Marthinsen L, Kornfält R, Aili M, Andersson D, Westgren U, Schaedel C. Recurrent Pseudomonas bronchopneumonia and other symptoms as in cystic fibrosis in a child with type 1 pseudohypoaldosteronism. Acta Paediatr 1998;87:472-4. 15. Blin N, Stafford D. A general method for isolation of high molecular weight DNA from eukaryotes. Nucleic Acids Res 1976;3:2303-8. 16. Gyapay G, Morissette J, Vignal A, Dib C, Fizames C, Millasseau P, et al. The 1993-94 Genethon human genetic linkage map. Nature Genet 1994;7:246-339. 17. Ludwig M, Bolkenius U, Wickert L, Bidlingmaier F. Common polymorphisms in genes encoding the human mineralocorticoid receptor and the human amiloride-sensitive sodium channel. J Steroid Biochem Molec Biol 1998;64:227-30. 18. Ludwig M, Bolkenius U, Wickert L, Marynen P, Bidlingmaier F. Structural organisation of the gene encoding the α-subunit of the human amiloride-sensitive epithelial sodium channel. Hum Genet 1998;102:576-81. 19. Alton EW, Hay JG, Munro C, Geddes DM. Measurement of nasal potential difference in adult cystic fibrosis, Young’s syndrome, and bronchiectasis. Thorax 1987;2:815-7. 20. Gibson LE, Cooke RE. A test for concentration of electrolytes in sweat in cystic fibrosis of the pancreas utilizing pilocarpine by iontophoresis. Pediatrics 1959;23:545-9. 21. Arai K, Tsigows C, Suzuki Y, Irony I, Karl M, Listwak S, et al. Physiological and molecular aspects of mineralocorticoid receptor action in pseudohypoaldosteronism: a responsiveness test and therapy. J Clin Endocrinol Metab 1994;79:1019-23.
22. May A, Puoti A, Gaeggeler HP, Horisberger JD, Rossier BC. Early effect of aldosterone on the rate of synthesis of the epithelial sodium channel α subunit in A6 renal cells. J Am Soc Nephrol 1997;8:1813-22. 23. Awayda M, Tousson A, Benos D. Regulation of a cloned epithelial Na+ channel by its b- and g-subunits. Am J Physiol 1997;363:C1889-99. 24. Grunder S, Firsov D, Chang S, Fowler Jaeger N, Gautschi I, Schild L, et al. A mutation causing pseudohypoaldosteronism type 1 identifies a conserved glycine that is involved in the gating of the epithelial sodium channel. EMBO J 1997;16:899-907. 25. Hummler E, Barker P, Gatzy J, Beermann F, Verdumo C, Schmidt A, et al. Early death due to defective neonatal lung liquid clearance in αENaC-deficient mice. Nature Genet 1996;12:325-8. 26. McDonald F, Yang B, Hrstka RF, Drummond HA, Tarr DE, McCray PB, et al. Disruption of the β subunit of the epithelial Na+ channel in mice: hyperkalemia and neonatal death associated with a pseudohypoaldosteronism phenotype. Proc Natl Acad Sci USA 1999;96:1727-31. 27. Barker PM, Nguyen MS, Gatzy JT, Grubb B, Norman H, Hummler E, et al. Role of γENaC subunit in lung liquid clearance and electrolyte balance in newborn mice. Insights into perinatal adaption and pseudohypoaldosteronism. J Clin Invest 1998;102:1634-40. 28. Ismailov I, Awayda M, Jovov B, Berdiev B, Fuller C, Dedman J, et al. Regulation of epithelial sodium channels by the cystic fibrosis transmembrane conductance regulator. J Biol Chem 1996;271:4725-32. 29. Kunzelman K, Kiser G, Schreiber R, Riordan J. Inhibition of epithelial Na+ currents by intracellular domains of the cystic fibrosis transmembrane conductance regulator. FEBS Lett 1997; 400:341-4. 30. Stutts J, Rossier B, Boucher R. Cystic fibrosis transmembrane conductance regulator inverts protein kinase A-mediated regulation of epithelial sodium channel single channel kinetics. J Biol Chem 1997;272:14037-40. 31. Smith J, Travis S, Greenberg E, Welsh M. Cystic fibrosis airway epithelia fail to kill bacteria because of abnormal airway surface fluid. Cell 1996;85:229-36. 32. Knowles M, Robinson J, Wood R, Pue C, Mentz W, Wager G, et al. Ion composition of airway surface liquid of patients with cystic fibrosis as compared with normal and disease-control subjects. J Clin Invest 1997;100:2588-95. 745