- Email: [email protected]
Manipulation of hemoglobin expression affects Arabidopsis shoot organogenesis
Plant Physiology and Biochemistry 49 (2011) 1108e1116
Contents lists available at ScienceDirect
Plant Physiology and Biochemistry journal homepage: www.elsevier.com/locate/plaphy
Research article
Manipulation of hemoglobin expression affects Arabidopsis shoot organogenesis Yaping Wang a,1, Mohamed Elhiti a,1, 2, Kim H. Hebelstrup b, Robert D. Hill a, Claudio Stasolla a, b, * a b
Department of Plant Science, University of Manitoba, Winnipeg, R3T2N2, Canada Department of Genetics and Biotechnology, University of Aarhus, Forsogsvej 1 420, Denmark
a r t i c l e i n f o
a b s t r a c t
Article history: Received 1 June 2011 Accepted 16 June 2011 Available online 24 June 2011
Over the past few years non-symbiotic plant hemoglobins have been described in a variety of plant species where they fulfill several functions ranging from detoxification processes to basic aspects of plant growth and post-embryonic development. To date no information is available on the role of hemoglobins during in vitro morphogenesis. Shoot organogenesis was induced in Arabidopsis lines constitutively expressing class 1, 2 and 3 hemoglobins (GLB1, 2 and 3) and lines in which the respective genes were either downregulated by RNAi (GLB1) or knocked out (GLB2 and GLB3). The process was executed by culturing root explants on an initial auxin-rich callus induction medium (CIM) followed by a transfer onto a cytokinin-containing shoot induction medium (SIM). While the repression of GLB2 inhibited organogenesis the over-expression of GLB1 or GLB2 enhanced the number of shoots produced in culture, and altered the transcript levels of genes participating in cytokinin perception and signalling. The upregulation of GLB1 or GLB2 activated CKI1 and AHK3, genes encoding cytokinin receptors and affected the transcript levels of cytokinin responsive regulators (ARRs). The expression of Type-A ARRs (ARR4, 5, 7, 15, and 16), feed-back repressors of the cytokinin pathway, was repressed in both hemoglobin overexpressors whereas that of several Type-B ARRs (ARR2, 12, and 13), transcription activators of cytokinin-responsive genes, was induced. Such changes enhanced the sensitivity of the root explants to cytokinin allowing the 35S::GLB1 and 35S::GLB2 lines to produce shoots at low cytokinin concentrations which did not promote organogenesis in the WT line. These results show that manipulation of hemoglobin can modify shoot organogenesis in Arabidopsis and possibly in those systems partially or completely unresponsive to applications of exogenous cytokinins. Ó 2011 Elsevier Masson SAS. All rights reserved.
Keywords: Cytokinin Hemoglobin Shoot organogenesis
1. Introduction Hemoglobins are oxygen-binding proteins occurring in most living organisms. Plant hemoglobins, first described in soybean nodules, were originally associated with species capable of symbiontic relationship in relation to their ability to bind and transport molecular oxygens (reviewed in [2]). The subsequent recognition of
Abbreviations: 2,4-D, 2,4-dichlorophenoxyacetic acid; 2iP, 6-(a,a-dimethylallylamino)-purine; AAR, Arabidopsis responsive element; AHK, Arabidopsis histidine kinase; ARR, Arabidopsis response regulator; CIM, callus induction medium; CIK1, cytokinin independent kinase; GLB1, Arabidopsis class 1 hemoglobin; GLB2, Arabidopsis class 2 hemoglobin; GLB3, Arabidopsis class 3 hemoglobin; SIM, shoot induction medium; IAA, indole acetic acid; IPT, isopentenyltransferase; NO, nitric oxide. * Corresponding author. Department of Plant Science, University of Manitoba, Winnipeg, R3T2N2, Canada. Tel.: þ1 204 474 6098; fax: þ1 204 474 7528. E-mail address: [email protected] (C. Stasolla). 1 These authors contributed equally to the work. 2 Permanent address: Department of Botany, Faculty of Science, Tanta University, Tanta 31527, Egypt. 0981-9428/$ e see front matter Ó 2011 Elsevier Masson SAS. All rights reserved. doi:10.1016/j.plaphy.2011.06.005
novel hemoglobins expressed in non-symbiontic plant species, including barley and Arabidopsis [13,31] suggested additional roles beyond nitrogen fixation and symbiotic processes. Chemical and functional characteristics of non-symbiotic hemoglobins indicate that one of their major functions is to scavenge nitric oxide (NO) during a variety of events related to hypoxia (primarily in roots), development, and hormone response (reviewed in [10]). Plant hemoglobins can be classified into three functional classes with distinct structural characteristics. While class 1 and 2 share features with vertebrate globins characterized by a 3-on-3 a-helical loop surrounding the hemoglobin group [8], class 3 hemoglobins are similar to the truncated bacterial globins [38]. The Arabidopsis genome contains three hemoglobin genes: GLB1, GLB2 and GLB3, each belonging to the respective classes, and with distinct functions. Independent studies suggest that GLB1, like other class 1 hemoglobins, exercises a protective role during hypoxia possibly by scavenging NO via a dioxygenase reaction utilizing NADPH [15]. Hunt et al. [13] observed a sudden increase in GLB1 expression in Arabidopsis roots grown under severe hypoxia, and enhanced hypoxia survival rate in 35S::GLB1 plants. These characteristics are
Y. Wang et al. / Plant Physiology and Biochemistry 49 (2011) 1108e1116
also shared by other class 1 hemoglobins. While the over-expression of a class 1 barley hemoglobin in hypoxic alfalfa roots improved growth and reduced NO levels, its down-regulation had opposite effects [16]. A similar protective role against hypoxia was also ascribed to GLB2 when over-expressed in Arabidopsis, although its down-regulation had no profound effects on growth [9]. The observation that non-symbiotic hemoglobins are also expressed under normoxic conditions suggests a potential role during “normal” development. Apart from roots, both GLB1 and GLB2 are expressed in hydathodes, inflorescences and shoot apical meristems [9]. Furthermore, altered expression of both genes causes profound phenotypic deviations during post-embryonic growth. The formation of aerial rosettes at lateral meristems and the delay in bolting observed in lines with suppressed expression of GLB1 [11] suggest a potential involvement of hemoglobins in shoot development and function. Shoot organogenesis, the de novo formation of shoots in culture from non meristematic tissues, is a two phase process involving an “induction step” required for cellular de-differentiation, and a “canalization step” in which the un-differentiated cells embark on a new developmental pathway culminating with the production of shoots (reviewed in [30]). Arabidopsis shoots can be regenerated from root explants after an initial pre-incubation on an auxin-rich callus induction medium (CIM) followed by a transfer onto a cytokinin-containing shoot induction medium (SIM) [35]. Initiation and continuation of shoot formation in the SIM relies upon profound changes in cytokinin perception and signalling [5]. Over the past few years several components of the cytokinin pathway have been identified and they include sensor histidine kinases (AHKs), histidinephosphotransmitters (AHPs) and response regulators (ARRs). Of the 30 ARRs genes identified in Arabidopsis some (Type-A) are characterized by a receiver domain and a short C-terminal extension, while others (Type-B) have a longer C-terminal extension and domains acting as transcription regulators [29]. Genetic work demonstrated that Type-B ARRs are transcription activators of cytokinin-induced genes, whereas Type-A ARRs are feed-back repressors of the cytokinin pathway [14]. Of interest, the overexpression of several Type-B ARRs induces shoot formation in the absence of exogenously supplied cytokinin [26]. The objective of this work is to assess the effect of altered hemoglobin expression during shoot organogenesis in Arabidopsis. This was achieved by inducing shoot organogenesis in Arabidopsis lines ectopically expressing the three hemoglobin genes (line 35S::GLB1, 35S::GLB2, and 35S::GLB3) and in homozygous lines in which the genes were either downregulated by RNAi(line GLB1RNAi) or knocked out (line GLB2 / and GLB3 /) Transcription
1109
studies on genes involved in cytokinin perception and signalling were also performed and correlated to the differential response of the lines in culture. 2. Materials and methods 2.1. Plant materials Arabidopsis (ecotype Col-0) seeds in which the hemoglobin genes were either over-expressed (line 35S::GLB1, 35S::GLB2, and 35S::GLB3), downregulated by RNAi(line GLB1-RNAi) or knocked out (GLB2 /) were generated and characterized previously [9,11]. The line (GLB3 /) in which gene expression of GLB3 is knocked out was obtained from the SALK collection of T-DNA insertional mutants [1]. The line SALK_060213 was identified to carry a homozygous insertion in the third exon of GLB3 by PCR using the gene specific primers LP: 50 -TTGTTTTTGAAATGGGTATTAGGG-30 , RP: 50 -CTGCTGGTTTATTGGCTGCGT-30 and the T-DNA specific primer LBb1: 50 -GCGTGGACCGCTTGCTGCAACT-30 as recommended by using the online algorithm for identification of specific gene knock-outs in the SALK collection (http://signal.salk.edu/cgi-bin/ tdnaexpress) (Supplementary Fig. 1). Induction of shoot organogenesis was carried out as reported by Valvekens et al. [35]. Briefly, Arabidopsis seeds were sterilized for 30 s in 70% ethanol, 10 min in 0.67% NaOCl, rinsed three times in sterile water and plated on solid germination medium (1/2 strength MS salts with 10 g/L sucrose and 6 g/L agar) for 1 week. Seedlings were transferred into liquid germination medium and incubated on a shaker at 100 rpm in the dark for another week. Roots were dissected from the seedlings and placed on a solid callus induction medium (CIM) containing MS salts and vitamins [24], 20 g/L glucose, 0.05 mg/L kinetin, and 0.5 mg/L 2,4D (2,4-dichlorophenoxyacetic acid), and incubated under continuous light at 22 C. After 4 days the roots were transferred on a solid shoot induction medium (SIM) containing MS salts and vitamins, 20 g/L glucose, 0.15 mg/L IAA (indole acetic acid) and 5 mg/L 2iP [6-(a,a-dimethylallylamino)-purine)]. After 18 days in culture (corresponding to 14 days in SIM) under continuous light at 22 C shoots emerging from root tissue were counted (Fig. 1). Roots were also harvested at days 0, 4, 10, 14, and 18 for gene expression studies. Shoot counting was performed at day 18. 2.2. Cytokinin requirement during shoot organogenesis Cytokinin requirement during shoot organogenesis was tested in the WT line and lines over-expressing GLB1 and GLB2 (line 35S::GLB1 and 35S::GLB2) by culturing root explants on regular
Fig. 1. Diagram showing the process of shoot organogenesis in Arabidopsis and time points utilized for the experiments. Root explants were cultured for 4 days on a callus induction medium (CIM) supplemented with 0.05 mg/L kinetin (Kin), and 0.5 mg/L 2,4-dichlorophenoxyacetic acid (2,4-D), followed by a transfer onto a shoot induction medium (SIM) supplemented with 0.15 mg/L indole acetic acid (IAA) and 5 mg/L 6-((a,a-dimethylallylamino)-purine) (2iP). Micrographs show the morphology of the explants at day 0, 4, and 18. Scale bars ¼ 1 mm.
1110
Y. Wang et al. / Plant Physiology and Biochemistry 49 (2011) 1108e1116
Table 1 List of primers used for real time PCR experiments during Arabidopsis shoot organogenesis. GLB1 GLB2 GLB3 IPT4 IPT8 CKI1 AHK3 AHK4 ARR1 ARR2 ARR4 ARR5 ARR7 ARR10 ARR12 ARR13 ARR15 ARR16 Ubiquitin
AT2G16060 AT3G10520 AT4G32690 AT4G24650 AT3G19160 AT2G47430 AT1G27320 AT2G01830 AT3G16857 AT4G16110 AT1G10470 AT3G48100 AT1G19050 AT4G31920 AT2G25180 AT2G27070 AT1G74890 AT2G40670 AT4G05320
AAATCCAAAGCTCAAGCCTCACGC TAGTGGCTGACACAACCCTCCAAT TGCTCTGGACGATTCGGTTGACAT AAAGGAGGCTTATGAGAAGGCGGT TGCTCGTGGAAACCTCCCGATTAT AAGTTTCGGGCGTTCCTCTGAGAT TGCAAAGTCACAGTTCCTTGCCAC AGGATCACCCGCAACTCTCAA GCAGCCGATGTTATCAAACCGCAT AAAGAGTGGCGGAGACAGTGACTT TGGAACTATTCTGGGATGCCGTGT TGATCGGAAGTTCATCGAGCGGTT GTTGACTGTTCTTGCCGTCGATGA TTGACGGCGATGACTATGGAGCAA ACGGATGCTATGGCTCTGTTGAGT ATATAACCCTCAGCCACCTGCCAA CCGGAGTTACATGTTCTTGCCGTT CAGTTCAGGAGGTTCTTGTTCGTC GATCTTTGCGGAAAACAATTGGAGGATGG
CIM for 4 days followed by a transfer on SIM supplemented with different levels of 2iP. The number of shoots was counted after 18 days in culture. 2.3. Histological analyses For structural studies developing shoots were fixed, dehydrated and infiltrated as described previously [39]. A Leica RM 2145 rotary microtome was used to produce semi thin (3 mm) serial sections which were then stained with toluidine blue O.
AGAATGGCTGGCTCCAAGTCTCTT TGAGACCAAGCACCTTCCACTTCT TTCTGCTGGTTTATTGGCTGCGTG TGCCCTAATTGCCTCTCGAAACGA TGAGACATCCACCCAAAGGAAGCA TGCACGCATATGCATCTCTCTCCT ACTTGCCTGTGCGGTCCTAACATA TGACCACTCTCTGCACAAACCACT TCACGGGAAGTTCTGGTTGGAAGT GCCTTCCTGTTTGAGAAATGCGCT AGGCGCGAGAGATTAAAGGGACAT TCCCAGGCATAGAGTAATCCGTCA ACTGCAAAGCCCTAGTTCCACTCT TATTGGCAGCGCTGAAGCAAAGTC ACAAATCTCCCTGGCTCTGTTCCT ATGTTCACGAAGGTCCAGTCACCA TCCCACTCTCAACAGTCGTCACTT GCGCATTCTCTGCTGTTGTCACTT CGACTTGTCATTAGAAAGAAAGAGATAACAGG
either downregulated by RNAi (GLB1-RNAi) or knocked out (GLB2/ and GLB3 /). The up-regulation of GLB1 and GLB2 significantly increased the number of shoots produced by the root explants relative to control values (Fig. 3A). This was in contrast to the GLB2 / line in which shoot formation was reduced. No differences in shoot number were observed in the remaining lines. In the WT line shoot organogenesis followed a precise sequence of structural events initiated in the CIM by the proliferation of isolated clusters of cells which emerged from the root explants (Fig. 3B1). Upon transfer onto SIM these cells organized themselves
2.4. Gene expression studies 1. 2
Gene expression studies were conducted by real time (RT-PCR) following the procedure described in Elhiti et al. [6] using primers listed in Table 1. The relative level of gene expression was analyzed with the 2ΔΔCT method described by Livak and Schmittgen [21], using uquibuitin(AT4G05320) as a reference.
GLB1
1 0.8 0.6 0.4
2.5. Statistical analysis
3. Results 3.1. Hemoglobin expression during Arabidopsis shoot organogenesis
Expression level
Unless specified, all experiments were performed using at least three biological replicates and the Tukey’s Post-Hoc test for multiple variance [40] was used to compare differences among samples.
0.2 0 35
GLB2
30 25 20 15 10 5 0
The expression levels of GLB1, 2 and 3 were measured at different stages of shoot organogenesis in the WT Arabidopsis line. The expression of GLB1 decreased rapidly on CIM and during the first days on SIM, before levelling off later in culture (Fig. 2). GLB2expressionwas induced in the first 10 days in culture and declined during the last days on SIM. No major changes in transcript levels were measured for GLB3(Fig. 2). 3.2. Altered levels of hemoglobins affect shoot organogenesis in Arabidopsis To test the effects of altered levels of hemoglobin on organogenesis, shoot formation was induced in lines ectopically expressing the hemoglobin genes (line 35S::GLB1, 35S::GLB2, and 35S::GLB3) and in homozygous lines in which the genes were
GLB3
2 1.5 1 0.5 0
Day 0
Day 4
CIM
Day 10
Day 14
Day 18
SIM
Fig. 2. Expression levels of GLB1, 2 and 3 during shoot organogenesis in the WT line. Measurements were performed by real time (RT) PCR and values represent the mean SE of three independent experiments. Relative expressions were normalized to the value of day 0 set at 1.
Fig. 3. Effects of altered hemoglobin (GLB1, 2, and 3) expression on shoot organogenesis.(A) Number of shoots produced by lines over-expressing the hemoglobin genes (line 35S::GLB1, 35S::GLB2, and 35S::GLB3), in homozygous insertional knockout lines (line GLB2 /, GLB3 /) in which the genes were silenced, and in the line GLB1-RNAi where the expression of the gene was downregulated by RNAi. Values SE are mean of at least three independent experiments. *Stars indicate values which are significantly different from the WT value (P 0.05). (B) Histological examination of the explants during shoot organogenesis. In the WT line cells within the root explants proliferated (1) and produced small clusters of meristematic cells (arrow, 2) which then developed into functional shoots (3). In the 35S::GLB1 line cell proliferation (arrowheads) covered the whole surface of the root (4) producing a large mass of meristematic cells (5) from which many shoots (arrows) differentiated (6). A similar pattern was also observed in the 35S::GLB2 line (data not shown). Scale bars ¼ 30 mm. (C) Expression levels of GLB1, 2, and 3 in the 35S::GLB2 and WT lines. Values, which represent the mean SE of three independent experiments, were normalized to the values of the three genes in the WT set at 1. * Stars indicate values which are significantly different from the WT value (P 0.05).
Y. Wang et al. / Plant Physiology and Biochemistry 49 (2011) 1108e1116
3.3. Cytokinin response and signalling during Arabidopsis shoot organogenesis The requirement for exogenous cytokinin during shoot organogenesis was measured by applying different levels of 2iP in the SIM. Decreasing concentrations of 2iP inhibited the shoot forming capacity of the WT line and no shoots were formed at 0.65 mg/L 2iP (Fig. 4). The number of shoots produced by the two 35S::GLB1 and 35S::GLB2 lines was always higher compared to WT. In all three lines shoot formation was completely abolished in the absence of exogenous 2iP (Fig. 4). Cytokinin signalling was further examined by measuring the expression of genes involved in cytokinin biosynthesis, reception and transduction. No major differences among lines occurred in the transcript levels of ISOPENTENYLTRANSFERASES(IPT) 4, 6, 8, which support the synthesis of biologically active cytokinins [5]. The only exceptions were observed during the first days in culture when the expression of IPT4was induced at day 0 and 4 in the 35S::GLB2 line (Fig.5). In root explants (day 0) a down-regulation of IPT6 was observed in the 35S::GLB1 line, whereas the transcript levels of IPT8 were lower in both transgenic lines (Fig. 5). Of the three putative cytokinin receptors both CYTOKININ INDEPENDENT KINASE (CKI1)and ARABIDOPSIS HISTIDINE KINASE (AHK3) were induced throughout the culture period in all three
Shoots / cm root
*
WT
* 4
*
35S::GLB1
*
35S::GLB2
**
2
0
Relative expression
7
IPT4
6
*
5
*
4 3 2 1 0
Day 0
Day 4
* 5
2.5
1.25
*
0.65
0
2iP concentration (mg/L) Fig. 4. Number of shoots produced by the WT line and lines over-expressing GLB1 and GLB2 (35S::GLB1, 35S::GLB2) with different levels of the cytokinin6-((a,a-dimethylallylamino)-purine) (2iP) in the shoot induction medium (SIM). Values are the mean SE of three independent experiments.* Stars indicate values which are significantly different from the WT value (P 0.05).
Day 10
CIM 3.5 3
Day 14
Day 18
SIM
IPT6
2. 5 2 1.5 1 0.5 0
* Day 0
Day 4
Day 10
CIM 7
Day 14
Day 18
SIM
IPT8
6 5 4 3 2 1 0
**
Day 0
Day 4
CIM
8 6
WT 35S::GLB1 35S::GLB2
Relative expression
into young shoots characterized by densely meristematic apical and subapical cells (Fig. 3B2). During the following days in culture the shoots increased in size and established a vascular connection with the root explant (Fig. 3B3). Increased cell proliferation covering the whole surface of the root explant (Fig. 3B4) was observed in the 35S::GLB1 line which was able to form the highest number of shoots (Fig. 3A). Cell proliferation continued on the SIM resulting in the formation of larger masses of meristematic cells (Fig. 3B5) from which several shoots generated (Fig. 3B6). Similar developmental events were also observed in the 35S::GLB2 line (data not shown). Subsequent studies were conducted only with the WT line and the two transgenic lines (35S::GLB1 and 35S::GLB2) characterized by the highest production of shoots (Fig. 3A). Given the redundant role of hemoglobins during plant growth [10] the expression levels of GLB1, 2 and 3 were measured in the roots (stage 0) of the transgenic lines. While the ectopic expression of GLB1in the 35S::GLB1 line did not affect the relative abundance of other GLB genes, the introduction of GLB2 in the 35S::GLB2 line repressed the expression of GLB1below detectable levels (Fig. 3C).
Relative expression
1112
Day 10
Day 14
Day 18
SIM
Fig. 5. Expression levels of ISOPENTENYLTRANSFERASES (IPT) 4, 6, and 8 during shoot organogenesis in the WT line and lines over-expressing GLB1 and GLB2 (35S::GLB1, 35S::GLB2). Values, which represent the mean SE of three independent experiments, were normalized to the values of WT (day 0) set at 1. * Stars indicate values which are significantly different from the WT value (P 0.05).
lines and reached their maximum expression on the SIM (Fig. 6). Compared to the WT line, elevated transcript levels of both genes were observed in the GLB1 and GLB2 over-expressors. An increase in the expression level of AHK4, the third cytokinin receptor, was measured in the last 4 days in culture, especially in the 35S::GLB2 line. During these days the 35S::GLB1 line exhibited the lowest accumulation of AHK4 transcripts (Fig. 6). Transduction of cytokinin signalling in Arabidopsis relies upon the action of responsive regulators (ARRs) which act as feed-back repressors (Type-A ARRs) or activators of downstream genes (Type-B ARRs). In the WT line all Type-A ARRs measured in this
Y. Wang et al. / Plant Physiology and Biochemistry 49 (2011) 1108e1116
Root explants (day 0) dissected from the two transformed lines showed a higher expression level of ARR1 and 10(Fig. 8).
WT 35S::GLB1
Relative expression
35S::GLB2 9
CKI1 6
3
*
*
*
*
*
4. Discussion
*
*
*
0 Day 0
Day 4
Day 10
CIM
Day 14
Relative expression
Day 18
SIM
9
**
AHK3 6
*
*
* *
3
0 Day 0
Day 4
Day 10
CIM
Day 14
Day 18
SIM
Relative expression
10
*
AHK4 8
*
6 4 2 0 Day 0
Day 4
CIM
Day 10
Day 14
1113
Day 18
SIM
Fig. 6. Expression levels of CYTOKININ INDEPENDENT KINASE (CKI1) and ARABIDIOPSIS HISTIDINE KINASE (AHK) 3 and 4 during shoot organogenesis in the WT line and lines over-expressing GLB1 and GLB2 (35S::GLB1, 35S::GLB2). Values, which represent the mean SE of three independent experiments, were normalized to the values of WT (day 0) set at 1. * Stars indicate values which are significantly different from the WT value (P 0.05).
study were up-regulated once the tissue was transferred onto the cytokinin-containing SIM (Fig. 7). A preferential induction during the last days in culture was observed for ARR5 and ARR7. This profile was not observed in the two transgenic lines where the expression of many Type-A ARRs did not increase on the SIM. In root explants (day 0) the up-regulation of both GLB1 and GLB2 induced the accumulation of ARR7 transcripts (Fig. 7). Compared to the WT line, the expression levels of the Type-B ARR2, 12, and 13 were generally higher in the 35S::GLB1 and 35S::GLB2 lines at any day in culture (Fig. 8). A peak in the accumulation of ARR13 transcripts was observed at day 10 in culture.
Shoot formation in Arabidopsis is a process of indirect organogenesis in which dissected root explants are first cultured in an auxin-rich environment (CIM) for four days and subsequently transferred onto a cytokinin-containing medium (SIM). The short pre-incubation on CIM enables the root explants to acquire a “competent state” which allows them to produce shoots if exposed to the inductive cytokinin signal. The omission of the CIM preincubation period precludes shoot formation on the SIM [4]. Evidence suggests that shoot formation in vitro is regulated by similar mechanisms governing shoot organogenesis in vivo, and involves precise changes in hormone levels and a complex reprogramming of gene expression [7]. This work demonstrates that hemoglobin genes are expressed during shoot organogenesis and that alteration in their expression patterns affects the number of shoots produced. The reasons for the changes in hemoglobin expression over the course of the treatments are complex and not easily interpreted. Cytokinin upregulates class 2 non-symbiotic hemoglobin expression [12], while the cytokinin-regulated transcription factor, ARR1, upregulates class 2 non-symbiotic hemoglobin [28]. Cytokinin also causes rapid NO increases in plant cell cultures [34], which can induce class 1 non-symbiotic hemoglobin expression [3,25,27]. The enhanced shoot formation capacity observed in the 35S::GLB1 and 35S::GLB2 lines in vitro is in line with previous work documenting the involvement of both genes during shoot development in vivo. Hebelstrup and Jensen [11] showed that elevated levels of GLB1 or GLB2 affect meristem function by inducing the transition of vegetative meristems into inflorescence meristems. The authors also demonstrated that ectopic expression of either gene promotes bolting, whereas silencing of GLB1 causes the formation of aerial rosettes at lateral meristems. If similar mechanisms regulate shoot formation in vivo and in vitro it can be assumed that the enhanced number of shoots produced by the 35S::GLB1 and 35S::GLB2 roots can be related to the ability of GLB1 and to a lesser extent GLB2 to scavenge NO, a signal molecule participating in the regulation of the meristems, as suggested previously [11]. An additional effect of both hemoglobins might be related to their ability to raise the energy state (ATP/ADP), as demonstrated for GLB2 in developing Arabidopsis seeds [36]. A high energy level is required to sustain the active cell proliferation associated with the formation of meristematic tissue from which shoots originate. Activation of cell division from root explants and production meristematic tissue, as estimated by histological observations, is encouraged in the 35S::GLB1 and 35S::GLB2 lines(Fig. 3B).Studies of hormone requirement for shoot regeneration have identified cytokinin as the most important inductive signal, and explants acquire competence to respond to this hormone in the CIM pre-incubation period. The rate limiting steps of cytokinin biosynthesis in plants are the isopentenylation reactions of ADT and ATP catalysed by isopentenyltansferases (IPTs [23],). Cytokinin signal is then transduced in a two-component signalling system which includes receptor histidine kinases (AHKs), histidinephosphotransmitters (AHPs) and response regulators (ARRs, reviewed by To and Kieber [33]). Despite differences in root explants (day 0) the expression of IPT4, 6, and 8, are not altered during shoot organogenesis in the 35S::GLB1 and 35S::GLB2 lines. Given the role assigned to these IPT genes [22], it is suggested that the over-expression of hemoglobin 1 and 2 does not affect cytokinin biosynthesis on either CIM or SIM. Differences in gene expression patterns among lines were observed for two of the three genes encoding cytokinin receptors.
Y. Wang et al. / Plant Physiology and Biochemistry 49 (2011) 1108e1116
Relative expression
1114
2.5
16
ARR 4
2 1.5
8
1
*
0.5 0
Day 0
Day 4
**
**
Day 10
Day 14
Relative expression
CIM 8 6
*
*
Day 18
*
0
* Day 0
Day 4
Day 10
CIM 15
ARR 7
*
*
4
SIM
Day 14
Day 18
SIM
ARR 15
12 9
4 2 0
*
6
*
**
Day 14
Day 18
* Day 0
Day 4
Day 10
CIM Relative expression
ARR 5
12
SIM
*
3 0
Day 0
Day 4
*
Day 10
CIM
*
*
Day 14
** Day 18
SIM
3 ARR 16 WT
2
35S::GLB1
* 1
0
* Day 0
CIM
*
Day 4
** Day 10
35S::GLB2
* Day 14
** Day 18
SIM
Fig. 7. Expression levels of Type-A ARABIDOPSIS RESPONSE REGULATORS (ARRs) during shoot organogenesis in the WT line and lines over-expressing GLB1 and GLB2 (35S::GLB1, 35S::GLB2). Values, which represent the mean SE of three independent experiments, were normalized to the values of WT (day 0) set at 1. * Stars indicate values which are significantly different from the WT value (P 0.05).
AHK3 and CKI1 were both induced in lines over-expressing the hemoglobin genes. AHK3 encodes a hybrid histidine kinase, analogous to the two bacterial component systems, composed of an extracellular cytokinin-binding region and two cytoplasmic domains, denoted as the transmitters and receiver domains [33]. The direct involvement of AHK3 in cytokinin perception is apparent by the reduced sensitivity to cytokinin and a cytokinin-dependent delay of senescence observed in ahk3 mutants. These effects were reverted if AHK3 was over-expressed in the mutant plants [19]. The other gene up-regulated in both 35S::GLB1 and 35S::GLB2 lines is CKI1 which, like AHK3, encodes a histidine kinase although its role in cytokinin perception needs to be resolved [5]. Despite the fact that CKI1 fails to confer cytokinin responsiveness in several systems, its over-expression induced the formation of in vitro shoots in a cytokinin independent manner [17]. This raises the possibility that the function of this putative receptor is restricted to specific phases of development including shoot organogenesis and that its up-regulation in the GLB1 and GLB2 over-expressors increases cytokinin perception in the explants, thereby making the tissue more responsive to this growth regulator. This notion is indirectly supported by the ability of 35S::GLB1 and 35S::GLB2 roots to produce shoots in a low cytokinin environment (Fig. 4). Downstream phosphorelay elements of cytokinin transduction pathway include several ARABIDOPSIS RESPONSE REGULATORS (ARRs) some of which (Type-A) are negative regulators of cytokinin
signalling, whereas others (Type-B) act as transcriptional activators [14]. The expression of all Type-A ARRs analysed in this study (ARR 4, 5, 7, 15, and 16) is inhibited in lines over-expressing GLB1 and GLB2 during culture on the SIM (Fig. 7). To et al. [32] showed that both root elongation and lateral root formation in arr4 or 5 mutant plants are more sensitive to cytokinin inhibition and these effects are reverted by the introduction of the functional gene. Furthermore the authors also showed that lines with reduced levels of ARR4 and ARR5 were able to generate shoots in culture at low cytokinin levels which were not sufficient to induce shoot organogenesis in the WT line. A similar repressive effect on cytokinin response was also documented for ARR 7 and 15. While the ectopic introduction of ARR7 repressed the expression of many cytokinininduced genes [20], the over-expression of ARR15 inhibited the production of shoots in culture and reduced sensitivity to exogenusly supplied cytokinin during root elongation [18]. Based on these results it is suggested that an inhibition of Type-A ARRs in lines over-expressing GLB1 and GLB2 might contribute to the enhanced ability to generate shoots in culture. Among the transcription activators of cytokinin-induced genes (Type-B ARRs), ARR2, 12 and 13 were up-regulated in the 35S::GLB1 and 35S::GLB2 lines whereas no clear expression pattern was observed for ARR1 and 10 (Fig. 8). Sakai et al. [29] showed that the up-regulation of ARR2 induced several cytokinin responses in the absence of this growth regulator, and was sufficient to promote the
Y. Wang et al. / Plant Physiology and Biochemistry 49 (2011) 1108e1116
Relative expression
12 10
15
ARR 1
12
8 6 4
6
*
2 0
Day 0
3
Day 4
Day 10
CIM
Day 14
Day 18
Relative expression
15
8
*
Day 0
Day 4
*
*
*
Day 10
*
Day 14
Day 18
SIM
*
ARR 12
12
*
*
9
*
3 Day 0
*
6
2 0
*
*
*
CIM
ARR 10
4
0
SIM
10
6
ARR 2
9
**
1115
Day 4
Day 10
CIM
Day 14
Day 18
0
*
*
*
**
Day 0
Day 4
Day 10
CIM
SIM
**
Day 14
Day 18
SIM
Relative expression
8 ARR 13
*
6
*
4
*
*
WT
**
35S::GLB1 35S::GLB2
2 0
Day 0
CIM
Day 4
Day 10
Day 14
Day 18
SIM
Fig. 8. Expression levels of Type-B ARABIDOPSIS RESPONSE ELEMENTS (ARRs) during shoot organogenesis in the WT line and lines over-expressing GLB1 and GLB2 (35S::GLB1, 35S::GLB2). Values, which represent the mean þ SE of three independent experiments, were normalized to the values of WT (day 0) set at 1.* Stars indicate values which are significantly different from the WT value (P 0.05).
formation of shoots in a medium devoid of cytokinin [14]. In the same line roots of ARR12 plants were less sensitive to cytokinin treatments during elongation assays [37]. These observations are consistent with the suggestion that high expression of Type-B ARRs enhances cytokinin response and ultimately encourages the production of shoots from cultured plant explants. In conclusion, this work demonstrates the novel and relevant role played by hemoglobins during shoot organogenesis. The overexpression of both GLB1 (type 1 hemoglobin) and GLB2 (type 2 hemoglobin) favours the production of shoots from Arabidopsis explants while the silencing of GLB2 has an inhibitory effect. Besides their well know role as NO scavengers, which might contribute to the observed results, it is demonstrated that the ectopic induction of GLB1 and GLB2 affects the expression of genes involved in cytokinin perception and signalling. These transcriptional changes increase the tissue sensitivity to cytokinin thereby enhancing the production of shoots. It is therefore suggested that beside their participation in stress responses, hemoglobins might fulfill specific functions in plant development and modulate morphogenesis through cell fate acquisition. This concept is novel and can be exploited not only in tissue culture to enhance organ formation in those systems partially or completely unresponsive to cytokinins, but also in other processes requiring a redirection of developmental fate.
Acknowledgements This work was supported by an NSERC Discovery Grant to RDH and CS. The authors thank Allen Liu for his help and contribution in some of the experiments. Appendix. Supplementary material Supplementary data associated with this article can be found, in the online version, at doi:10.1016/j.plaphy.2011.06.005. References [1] J.M. Alonso, A.N. Stepanova, T.J. Leisse, C.J. Kim, H. Chen, P. Shinn, D.K. Stevenson, J. Zimmerman, P. Barajas, R. Cheuk, C. Gadrinab, C. Heller, A. Jeske, E. Koesema, C.C. Meyers, H. Parker, L. Prednis, Y. Ansari, N. Choy, H. Deen, M. Geralt, N. Hazari, E. Hom, M. Karnes, C. Mulholland, R. Ndubaku, I. Schmidt, P. Guzman, L. Aguilar-Henonin, M. Schmid, D. Weigel, D.E. Carter, T. Marchand, E. Risseeuw, D. Brogden, A. Zeko, W.L. Crosby, C.C. Berry, J.R. Ecker, Genome-wide insertional mutagenesis of Arabidopsis thaliana, Science 301 (2003) 653e657. [2] C.A. Appleby, The origins and functions of haemoglobin in plants, Sci.Prog 76 (1992) 365e398. [3] P. Bustos-Sanmamed, A. Tovar-Mendez, M. Crespi, S. Sato, S. Tabata, M. Becana, Regulation of nonsymbiotic and truncated hemoglobin genes of Lotus japonicus in plant organs and in response to nitric oxide and hormones, New Phytol. 189 (2011) 765e776.
1116
Y. Wang et al. / Plant Physiology and Biochemistry 49 (2011) 1108e1116
[4] A.J. Cary, P. Che, S.H. Howell, Development events and shoot meristem gene expression patterns during shoot development in Arabidopsis thaliana, Plant J. 32 (2002) 867e876. [5] P. Che, D. Gingerich, S. Lall, S. Howell, Global and hormone-induced gene expression changes during shoot development in Arabidopsis, Plant Cell 14 (2002) 2271e2279. [6] M. Elhiti, M. Tahir, R. Gulden, K. Khamiss, C. Stasolla, Modulation of embryoforming capacity in culture through the expression of Brassica genes involved in the regulation of the shoot apical meristem, J. Exp. Bot. 61 (2010) 4069e4085. [7] S.P. Gordon, M.G. Heisler, R. Venogopala, C. Ohno, P. Das, E.M. Meyerowitz, Pattern formation during de novo assembly of the Arabidopsis shoot meristem, Dev 134 (2007) 3539e3548. [8] M.S. Hargrove, E.A. Brucker, B. Stec, G. Sarath, R. Arredondoi-Peter, R.V. Klucas, J.S. Olson, G.N. Phillips, Crystal structure of a nonsymbiotic plant haemoglobin, Struct. Fold. Des 8 (2000) 1005e1014. [9] K.H. Hebelstrup, P. Peter-Hunt, E. Dennis, S.B. Jensen, E.O. Jensen, Hemoglobin is essential for normal growth of Arabidopsis organs, Physiol. Plant 127 (2006) 157e166. [10] K.H. Hebelstrup, A.U. Igamberdiev, R.D. Hill, Metabolic effects of haemoglobin gene expression in plants, Gene 398 (2007) 86e93. [11] K.H. Hebelstrup, E.O. Jensen, Expression of NO scavenging haemoglobin is involved in the timing of bolting in Arabidopsis thaliana, Planta 227 (2008) 917e927. [12] P.W. Hunt, R.A. Watts, B. Trevaskis, D.J. Llewelyn, J. Burnell, E.S. Dennis, W.J. Peacock, Expression and evolution of functionally distinct haemoglobin genes in plants, Plant Mol. Biol. 47 (2001) 677e692. [13] P.W. Hunt, E.J. Klok, B. Trevaskis, R.A. Watts, M.H. Ellis, W.J. Peacock, E.S. Dennis, Increased level of haemoglobin 1 enhances survival of hypoxic stress and promotes early growth in Arabidopsis thaliana, Proc. Natl. Acad. Sci. USA 99 (2002) 17197e17202. [14] I. Hwang, J. Sheen, Two-component circuitry in Arabidopsis cytokinin signal transduction, Nature 413 (2001) 383e389. [15] A.U. Igamberdiev, R.D. Hill, Nitrate, NO and haemoglobin in plant adaptation to hypoxia: an alternative to classic fermentation pathways, J. Exp. Bot. 55 (2004) 2473e2482. [16] A.U. Igamberdiev, C. Seregelyes, N. Manac’h, R.D. Hill, NADH-dependent metabolism of nitric oxide in alfalfa root cultures expressing barley haemoglobin, Planta 219 (2004) 95e102. [17] T. Kakimoto, CKI1, a histidine kinase homolog implicated in cytokinin signal transduction, Science 274 (1996) 982e985. [18] T. Kiba, H. Yamada, S. Sato, T. Kato, S. Tabata, T. Yamashino, T. Mizuno, The Type-A response regulator ARR15 acts as a negative regulator in the cytokinin-mediated signal transduction in Arabidopsis thanliana, Plant Cell Physiol. 44 (2003) 868e874. [19] H.J. Kim, H. Ryo, S.H. Hong, H.R. Woo, P.O. Lim, I.C. Lee, J. Sheen, H.G. Nam, I. Hwang, Cytokinin-mediated control of leaf longevity by AHK3 through phosphorylation of ARR2 in Arabidopsis, Proc. Natl. Acad. Sci. USA 103 (2006) 814e820. [20] D. Lee, S. Kim, Y.M. Ha, J. Kim, Phosphorylation of Arabidopsis response regulator 7 (ARR7) at the putative phospho-accepting site is required for ARR7 to act as a negative regulator of cytokinin signalling, Planta 227 (2007) 577e583. [21] K. Livak, T. Schmittgen, Analysis of relative gene expression data using real time quantitative PCR and the 2-(delta)(delta) CT method, Methods 25 (2001) 402e408.
[22] K. Miyawaki, M. Matsumoto-Kitano, T. Kakimoto, Expression of cytokinin isopentenyltransferase genes in Arabidopsis: tissue specificity and regulation by auxin, cytokinin and nitrate, Plant J. 37 (2004) 128e138. [23] D.W. Mok, M.C. Mok, Cytokinin metabolism and action, Annu. Rev. Plant Physiol. Mol. Biol. 52 (2001) 118 89. [24] T. Murashige, F. Skoog, A revised medium for rapid growth and bioassays with tobacco tissue culture, Physiol. Plant 15 (1962) 473e497. [25] Y. Ohwaki, M. Kawagishi-Kobayashi, K. Wakasa, S. Fujihara, T. Yoneyama, Induction of class-1 non-symbiotic hemoglobin genes by nitrate, nitrite and nitric oxide in cultured rice cells, Plant Cell Physiol. 46 (2005) 324e331. [26] Y. Osakabe, S. Miyata, T. Urao, M. Seki, K. Shinozaki, K. Yamaguchi-Shinozaki, Over-expression of Arabidopsis response regulators ARR4/ATRR1/IBC7 and ARR8/ATRR3, alters cytokinin responses differentially in the shoot and callus formation, Biochem. Biophys. Res. Com 293 (2002) 806e815. [27] Z.L. Qu, N.Q. Zhong, H.Y. Wang, A.P. Chen, G.L. Jian, G.X. Xia, Ectopic expression of the cotton non-symbiotic hemoglobin gene GhHbd1 triggers defense responses and increases disease tolerance in Arabidopsis, Plant Cell Physiol. 47 (2006) 1058e1068. [28] E.J. Ross, J.M. Stone, C.G. Elowsky, R. Arredondo-Peter, R.V. Klucas, G. Sarath, Activation of the Oryzasativa non-symbiotic haemoglobin-2 promoter by the cytokinin-regulated transcription factor, ARR1, J. Exp. Bot. 55 (2004) 1721e1731. [29] H. Sakai, T. Aoyama, A. Oka, Arabidopsis ARR1 and ARR2 response regulators operate as transcriptional activators, Plant J. 24 (2000) 703e711. [30] M. Sugiyama, Genetic analysis of plant morphogenesis in vitro, Intern.Rev.Cytol 196 (2002) 67e84. [31] E.R. Taylor, X.Z. Nie, A.W. MacGregor, R.D. Hill, A cereal haemoglobin gene is expressed in seed and root tissues under anaerobic conditions, Plant Mol. Biol. 24 (1994) 853e862. [32] J.P.C. To, G. Haberer, F.J. Ferreira, J. Deruere, M.G. Mason, G.E. Schaller, J.M. Alonso, J.R. Ecker, J.J. Kieber, Type-A ARRs are partially redundant negative regulators of cytokinin signalling in Arabidopsis, Plant Cell 16 (2004) 658e671. [33] J.P.C. To, J.J. Kieber, Cytokinin signalling: two components and more, Trends Plant Sci. 13 (2008) 8591e8594. [34] N.N. Tun, A. Holk, G.F. Scherer, Rapid increase of NO release in plant cell cultures induced by cytokinin, FEBS Lett. 509 (2001) 174e176. [35] D. Valvekens, M. Montagu, M. Lijsebettebs, Agrobacterium tumefaciens mediated transformation of Arabidopsis thaliana root explants by using kanamycin selection, Proc. Natl. Acad. Sci. USA 85 (1988) 5536e5540. [36] H. Vigeolas, D. Huhn, P. Geigenberger, Nonsymbiontic haemoglobin-2 leads to an elevated energy state and to a combined increase in polyunsaturated fatty acids and total oil content when over-expressed in developing seeds of transgenic Arabidopsis plants, Plant Physiol. 155 (2011) 1435e1444. [37] A. Yokoyama, T. Yamashino, Y.-I. Amano, Y. Tajima, A. Imamura, H. Sakakibara, T. Mizuno, Type-B ARR transcription factors, ARR10 and ARR12 are implicated in cytokinin-mediated regulation of protoxylem differentiation in roots of Arabidopsis thaliana, Plant Cell Physiol. 48 (2007) 84e96. [38] R.A. Watts, P.W. Hunt, A.N. Hvitved, M.S. Hargrove, W.J. Peacock, E.S. Dessis, A hemoglobin from plants homologous to truncated hemoglobins of microorganisms, Proc. Natl. Acad. Sci. USA 98 (2001) 10119e10124. [39] E.C. Yeung, The use of histology in the study of plant tissue culture systems some practical comments, In Vitro Cell. Dev. Biol-Plant 35 (1999) 137e143. [40] J.H. Zar, Biostatistical Analysis, fourth ed. Prentice-Hall, Englewood Cliff, 1999, pp. 208e228.
Contents lists available at ScienceDirect
Plant Physiology and Biochemistry journal homepage: www.elsevier.com/locate/plaphy
Research article
Manipulation of hemoglobin expression affects Arabidopsis shoot organogenesis Yaping Wang a,1, Mohamed Elhiti a,1, 2, Kim H. Hebelstrup b, Robert D. Hill a, Claudio Stasolla a, b, * a b
Department of Plant Science, University of Manitoba, Winnipeg, R3T2N2, Canada Department of Genetics and Biotechnology, University of Aarhus, Forsogsvej 1 420, Denmark
a r t i c l e i n f o
a b s t r a c t
Article history: Received 1 June 2011 Accepted 16 June 2011 Available online 24 June 2011
Over the past few years non-symbiotic plant hemoglobins have been described in a variety of plant species where they fulfill several functions ranging from detoxification processes to basic aspects of plant growth and post-embryonic development. To date no information is available on the role of hemoglobins during in vitro morphogenesis. Shoot organogenesis was induced in Arabidopsis lines constitutively expressing class 1, 2 and 3 hemoglobins (GLB1, 2 and 3) and lines in which the respective genes were either downregulated by RNAi (GLB1) or knocked out (GLB2 and GLB3). The process was executed by culturing root explants on an initial auxin-rich callus induction medium (CIM) followed by a transfer onto a cytokinin-containing shoot induction medium (SIM). While the repression of GLB2 inhibited organogenesis the over-expression of GLB1 or GLB2 enhanced the number of shoots produced in culture, and altered the transcript levels of genes participating in cytokinin perception and signalling. The upregulation of GLB1 or GLB2 activated CKI1 and AHK3, genes encoding cytokinin receptors and affected the transcript levels of cytokinin responsive regulators (ARRs). The expression of Type-A ARRs (ARR4, 5, 7, 15, and 16), feed-back repressors of the cytokinin pathway, was repressed in both hemoglobin overexpressors whereas that of several Type-B ARRs (ARR2, 12, and 13), transcription activators of cytokinin-responsive genes, was induced. Such changes enhanced the sensitivity of the root explants to cytokinin allowing the 35S::GLB1 and 35S::GLB2 lines to produce shoots at low cytokinin concentrations which did not promote organogenesis in the WT line. These results show that manipulation of hemoglobin can modify shoot organogenesis in Arabidopsis and possibly in those systems partially or completely unresponsive to applications of exogenous cytokinins. Ó 2011 Elsevier Masson SAS. All rights reserved.
Keywords: Cytokinin Hemoglobin Shoot organogenesis
1. Introduction Hemoglobins are oxygen-binding proteins occurring in most living organisms. Plant hemoglobins, first described in soybean nodules, were originally associated with species capable of symbiontic relationship in relation to their ability to bind and transport molecular oxygens (reviewed in [2]). The subsequent recognition of
Abbreviations: 2,4-D, 2,4-dichlorophenoxyacetic acid; 2iP, 6-(a,a-dimethylallylamino)-purine; AAR, Arabidopsis responsive element; AHK, Arabidopsis histidine kinase; ARR, Arabidopsis response regulator; CIM, callus induction medium; CIK1, cytokinin independent kinase; GLB1, Arabidopsis class 1 hemoglobin; GLB2, Arabidopsis class 2 hemoglobin; GLB3, Arabidopsis class 3 hemoglobin; SIM, shoot induction medium; IAA, indole acetic acid; IPT, isopentenyltransferase; NO, nitric oxide. * Corresponding author. Department of Plant Science, University of Manitoba, Winnipeg, R3T2N2, Canada. Tel.: þ1 204 474 6098; fax: þ1 204 474 7528. E-mail address: [email protected] (C. Stasolla). 1 These authors contributed equally to the work. 2 Permanent address: Department of Botany, Faculty of Science, Tanta University, Tanta 31527, Egypt. 0981-9428/$ e see front matter Ó 2011 Elsevier Masson SAS. All rights reserved. doi:10.1016/j.plaphy.2011.06.005
novel hemoglobins expressed in non-symbiontic plant species, including barley and Arabidopsis [13,31] suggested additional roles beyond nitrogen fixation and symbiotic processes. Chemical and functional characteristics of non-symbiotic hemoglobins indicate that one of their major functions is to scavenge nitric oxide (NO) during a variety of events related to hypoxia (primarily in roots), development, and hormone response (reviewed in [10]). Plant hemoglobins can be classified into three functional classes with distinct structural characteristics. While class 1 and 2 share features with vertebrate globins characterized by a 3-on-3 a-helical loop surrounding the hemoglobin group [8], class 3 hemoglobins are similar to the truncated bacterial globins [38]. The Arabidopsis genome contains three hemoglobin genes: GLB1, GLB2 and GLB3, each belonging to the respective classes, and with distinct functions. Independent studies suggest that GLB1, like other class 1 hemoglobins, exercises a protective role during hypoxia possibly by scavenging NO via a dioxygenase reaction utilizing NADPH [15]. Hunt et al. [13] observed a sudden increase in GLB1 expression in Arabidopsis roots grown under severe hypoxia, and enhanced hypoxia survival rate in 35S::GLB1 plants. These characteristics are
Y. Wang et al. / Plant Physiology and Biochemistry 49 (2011) 1108e1116
also shared by other class 1 hemoglobins. While the over-expression of a class 1 barley hemoglobin in hypoxic alfalfa roots improved growth and reduced NO levels, its down-regulation had opposite effects [16]. A similar protective role against hypoxia was also ascribed to GLB2 when over-expressed in Arabidopsis, although its down-regulation had no profound effects on growth [9]. The observation that non-symbiotic hemoglobins are also expressed under normoxic conditions suggests a potential role during “normal” development. Apart from roots, both GLB1 and GLB2 are expressed in hydathodes, inflorescences and shoot apical meristems [9]. Furthermore, altered expression of both genes causes profound phenotypic deviations during post-embryonic growth. The formation of aerial rosettes at lateral meristems and the delay in bolting observed in lines with suppressed expression of GLB1 [11] suggest a potential involvement of hemoglobins in shoot development and function. Shoot organogenesis, the de novo formation of shoots in culture from non meristematic tissues, is a two phase process involving an “induction step” required for cellular de-differentiation, and a “canalization step” in which the un-differentiated cells embark on a new developmental pathway culminating with the production of shoots (reviewed in [30]). Arabidopsis shoots can be regenerated from root explants after an initial pre-incubation on an auxin-rich callus induction medium (CIM) followed by a transfer onto a cytokinin-containing shoot induction medium (SIM) [35]. Initiation and continuation of shoot formation in the SIM relies upon profound changes in cytokinin perception and signalling [5]. Over the past few years several components of the cytokinin pathway have been identified and they include sensor histidine kinases (AHKs), histidinephosphotransmitters (AHPs) and response regulators (ARRs). Of the 30 ARRs genes identified in Arabidopsis some (Type-A) are characterized by a receiver domain and a short C-terminal extension, while others (Type-B) have a longer C-terminal extension and domains acting as transcription regulators [29]. Genetic work demonstrated that Type-B ARRs are transcription activators of cytokinin-induced genes, whereas Type-A ARRs are feed-back repressors of the cytokinin pathway [14]. Of interest, the overexpression of several Type-B ARRs induces shoot formation in the absence of exogenously supplied cytokinin [26]. The objective of this work is to assess the effect of altered hemoglobin expression during shoot organogenesis in Arabidopsis. This was achieved by inducing shoot organogenesis in Arabidopsis lines ectopically expressing the three hemoglobin genes (line 35S::GLB1, 35S::GLB2, and 35S::GLB3) and in homozygous lines in which the genes were either downregulated by RNAi(line GLB1RNAi) or knocked out (line GLB2 / and GLB3 /) Transcription
1109
studies on genes involved in cytokinin perception and signalling were also performed and correlated to the differential response of the lines in culture. 2. Materials and methods 2.1. Plant materials Arabidopsis (ecotype Col-0) seeds in which the hemoglobin genes were either over-expressed (line 35S::GLB1, 35S::GLB2, and 35S::GLB3), downregulated by RNAi(line GLB1-RNAi) or knocked out (GLB2 /) were generated and characterized previously [9,11]. The line (GLB3 /) in which gene expression of GLB3 is knocked out was obtained from the SALK collection of T-DNA insertional mutants [1]. The line SALK_060213 was identified to carry a homozygous insertion in the third exon of GLB3 by PCR using the gene specific primers LP: 50 -TTGTTTTTGAAATGGGTATTAGGG-30 , RP: 50 -CTGCTGGTTTATTGGCTGCGT-30 and the T-DNA specific primer LBb1: 50 -GCGTGGACCGCTTGCTGCAACT-30 as recommended by using the online algorithm for identification of specific gene knock-outs in the SALK collection (http://signal.salk.edu/cgi-bin/ tdnaexpress) (Supplementary Fig. 1). Induction of shoot organogenesis was carried out as reported by Valvekens et al. [35]. Briefly, Arabidopsis seeds were sterilized for 30 s in 70% ethanol, 10 min in 0.67% NaOCl, rinsed three times in sterile water and plated on solid germination medium (1/2 strength MS salts with 10 g/L sucrose and 6 g/L agar) for 1 week. Seedlings were transferred into liquid germination medium and incubated on a shaker at 100 rpm in the dark for another week. Roots were dissected from the seedlings and placed on a solid callus induction medium (CIM) containing MS salts and vitamins [24], 20 g/L glucose, 0.05 mg/L kinetin, and 0.5 mg/L 2,4D (2,4-dichlorophenoxyacetic acid), and incubated under continuous light at 22 C. After 4 days the roots were transferred on a solid shoot induction medium (SIM) containing MS salts and vitamins, 20 g/L glucose, 0.15 mg/L IAA (indole acetic acid) and 5 mg/L 2iP [6-(a,a-dimethylallylamino)-purine)]. After 18 days in culture (corresponding to 14 days in SIM) under continuous light at 22 C shoots emerging from root tissue were counted (Fig. 1). Roots were also harvested at days 0, 4, 10, 14, and 18 for gene expression studies. Shoot counting was performed at day 18. 2.2. Cytokinin requirement during shoot organogenesis Cytokinin requirement during shoot organogenesis was tested in the WT line and lines over-expressing GLB1 and GLB2 (line 35S::GLB1 and 35S::GLB2) by culturing root explants on regular
Fig. 1. Diagram showing the process of shoot organogenesis in Arabidopsis and time points utilized for the experiments. Root explants were cultured for 4 days on a callus induction medium (CIM) supplemented with 0.05 mg/L kinetin (Kin), and 0.5 mg/L 2,4-dichlorophenoxyacetic acid (2,4-D), followed by a transfer onto a shoot induction medium (SIM) supplemented with 0.15 mg/L indole acetic acid (IAA) and 5 mg/L 6-((a,a-dimethylallylamino)-purine) (2iP). Micrographs show the morphology of the explants at day 0, 4, and 18. Scale bars ¼ 1 mm.
1110
Y. Wang et al. / Plant Physiology and Biochemistry 49 (2011) 1108e1116
Table 1 List of primers used for real time PCR experiments during Arabidopsis shoot organogenesis. GLB1 GLB2 GLB3 IPT4 IPT8 CKI1 AHK3 AHK4 ARR1 ARR2 ARR4 ARR5 ARR7 ARR10 ARR12 ARR13 ARR15 ARR16 Ubiquitin
AT2G16060 AT3G10520 AT4G32690 AT4G24650 AT3G19160 AT2G47430 AT1G27320 AT2G01830 AT3G16857 AT4G16110 AT1G10470 AT3G48100 AT1G19050 AT4G31920 AT2G25180 AT2G27070 AT1G74890 AT2G40670 AT4G05320
AAATCCAAAGCTCAAGCCTCACGC TAGTGGCTGACACAACCCTCCAAT TGCTCTGGACGATTCGGTTGACAT AAAGGAGGCTTATGAGAAGGCGGT TGCTCGTGGAAACCTCCCGATTAT AAGTTTCGGGCGTTCCTCTGAGAT TGCAAAGTCACAGTTCCTTGCCAC AGGATCACCCGCAACTCTCAA GCAGCCGATGTTATCAAACCGCAT AAAGAGTGGCGGAGACAGTGACTT TGGAACTATTCTGGGATGCCGTGT TGATCGGAAGTTCATCGAGCGGTT GTTGACTGTTCTTGCCGTCGATGA TTGACGGCGATGACTATGGAGCAA ACGGATGCTATGGCTCTGTTGAGT ATATAACCCTCAGCCACCTGCCAA CCGGAGTTACATGTTCTTGCCGTT CAGTTCAGGAGGTTCTTGTTCGTC GATCTTTGCGGAAAACAATTGGAGGATGG
CIM for 4 days followed by a transfer on SIM supplemented with different levels of 2iP. The number of shoots was counted after 18 days in culture. 2.3. Histological analyses For structural studies developing shoots were fixed, dehydrated and infiltrated as described previously [39]. A Leica RM 2145 rotary microtome was used to produce semi thin (3 mm) serial sections which were then stained with toluidine blue O.
AGAATGGCTGGCTCCAAGTCTCTT TGAGACCAAGCACCTTCCACTTCT TTCTGCTGGTTTATTGGCTGCGTG TGCCCTAATTGCCTCTCGAAACGA TGAGACATCCACCCAAAGGAAGCA TGCACGCATATGCATCTCTCTCCT ACTTGCCTGTGCGGTCCTAACATA TGACCACTCTCTGCACAAACCACT TCACGGGAAGTTCTGGTTGGAAGT GCCTTCCTGTTTGAGAAATGCGCT AGGCGCGAGAGATTAAAGGGACAT TCCCAGGCATAGAGTAATCCGTCA ACTGCAAAGCCCTAGTTCCACTCT TATTGGCAGCGCTGAAGCAAAGTC ACAAATCTCCCTGGCTCTGTTCCT ATGTTCACGAAGGTCCAGTCACCA TCCCACTCTCAACAGTCGTCACTT GCGCATTCTCTGCTGTTGTCACTT CGACTTGTCATTAGAAAGAAAGAGATAACAGG
either downregulated by RNAi (GLB1-RNAi) or knocked out (GLB2/ and GLB3 /). The up-regulation of GLB1 and GLB2 significantly increased the number of shoots produced by the root explants relative to control values (Fig. 3A). This was in contrast to the GLB2 / line in which shoot formation was reduced. No differences in shoot number were observed in the remaining lines. In the WT line shoot organogenesis followed a precise sequence of structural events initiated in the CIM by the proliferation of isolated clusters of cells which emerged from the root explants (Fig. 3B1). Upon transfer onto SIM these cells organized themselves
2.4. Gene expression studies 1. 2
Gene expression studies were conducted by real time (RT-PCR) following the procedure described in Elhiti et al. [6] using primers listed in Table 1. The relative level of gene expression was analyzed with the 2ΔΔCT method described by Livak and Schmittgen [21], using uquibuitin(AT4G05320) as a reference.
GLB1
1 0.8 0.6 0.4
2.5. Statistical analysis
3. Results 3.1. Hemoglobin expression during Arabidopsis shoot organogenesis
Expression level
Unless specified, all experiments were performed using at least three biological replicates and the Tukey’s Post-Hoc test for multiple variance [40] was used to compare differences among samples.
0.2 0 35
GLB2
30 25 20 15 10 5 0
The expression levels of GLB1, 2 and 3 were measured at different stages of shoot organogenesis in the WT Arabidopsis line. The expression of GLB1 decreased rapidly on CIM and during the first days on SIM, before levelling off later in culture (Fig. 2). GLB2expressionwas induced in the first 10 days in culture and declined during the last days on SIM. No major changes in transcript levels were measured for GLB3(Fig. 2). 3.2. Altered levels of hemoglobins affect shoot organogenesis in Arabidopsis To test the effects of altered levels of hemoglobin on organogenesis, shoot formation was induced in lines ectopically expressing the hemoglobin genes (line 35S::GLB1, 35S::GLB2, and 35S::GLB3) and in homozygous lines in which the genes were
GLB3
2 1.5 1 0.5 0
Day 0
Day 4
CIM
Day 10
Day 14
Day 18
SIM
Fig. 2. Expression levels of GLB1, 2 and 3 during shoot organogenesis in the WT line. Measurements were performed by real time (RT) PCR and values represent the mean SE of three independent experiments. Relative expressions were normalized to the value of day 0 set at 1.
Fig. 3. Effects of altered hemoglobin (GLB1, 2, and 3) expression on shoot organogenesis.(A) Number of shoots produced by lines over-expressing the hemoglobin genes (line 35S::GLB1, 35S::GLB2, and 35S::GLB3), in homozygous insertional knockout lines (line GLB2 /, GLB3 /) in which the genes were silenced, and in the line GLB1-RNAi where the expression of the gene was downregulated by RNAi. Values SE are mean of at least three independent experiments. *Stars indicate values which are significantly different from the WT value (P 0.05). (B) Histological examination of the explants during shoot organogenesis. In the WT line cells within the root explants proliferated (1) and produced small clusters of meristematic cells (arrow, 2) which then developed into functional shoots (3). In the 35S::GLB1 line cell proliferation (arrowheads) covered the whole surface of the root (4) producing a large mass of meristematic cells (5) from which many shoots (arrows) differentiated (6). A similar pattern was also observed in the 35S::GLB2 line (data not shown). Scale bars ¼ 30 mm. (C) Expression levels of GLB1, 2, and 3 in the 35S::GLB2 and WT lines. Values, which represent the mean SE of three independent experiments, were normalized to the values of the three genes in the WT set at 1. * Stars indicate values which are significantly different from the WT value (P 0.05).
Y. Wang et al. / Plant Physiology and Biochemistry 49 (2011) 1108e1116
3.3. Cytokinin response and signalling during Arabidopsis shoot organogenesis The requirement for exogenous cytokinin during shoot organogenesis was measured by applying different levels of 2iP in the SIM. Decreasing concentrations of 2iP inhibited the shoot forming capacity of the WT line and no shoots were formed at 0.65 mg/L 2iP (Fig. 4). The number of shoots produced by the two 35S::GLB1 and 35S::GLB2 lines was always higher compared to WT. In all three lines shoot formation was completely abolished in the absence of exogenous 2iP (Fig. 4). Cytokinin signalling was further examined by measuring the expression of genes involved in cytokinin biosynthesis, reception and transduction. No major differences among lines occurred in the transcript levels of ISOPENTENYLTRANSFERASES(IPT) 4, 6, 8, which support the synthesis of biologically active cytokinins [5]. The only exceptions were observed during the first days in culture when the expression of IPT4was induced at day 0 and 4 in the 35S::GLB2 line (Fig.5). In root explants (day 0) a down-regulation of IPT6 was observed in the 35S::GLB1 line, whereas the transcript levels of IPT8 were lower in both transgenic lines (Fig. 5). Of the three putative cytokinin receptors both CYTOKININ INDEPENDENT KINASE (CKI1)and ARABIDOPSIS HISTIDINE KINASE (AHK3) were induced throughout the culture period in all three
Shoots / cm root
*
WT
* 4
*
35S::GLB1
*
35S::GLB2
**
2
0
Relative expression
7
IPT4
6
*
5
*
4 3 2 1 0
Day 0
Day 4
* 5
2.5
1.25
*
0.65
0
2iP concentration (mg/L) Fig. 4. Number of shoots produced by the WT line and lines over-expressing GLB1 and GLB2 (35S::GLB1, 35S::GLB2) with different levels of the cytokinin6-((a,a-dimethylallylamino)-purine) (2iP) in the shoot induction medium (SIM). Values are the mean SE of three independent experiments.* Stars indicate values which are significantly different from the WT value (P 0.05).
Day 10
CIM 3.5 3
Day 14
Day 18
SIM
IPT6
2. 5 2 1.5 1 0.5 0
* Day 0
Day 4
Day 10
CIM 7
Day 14
Day 18
SIM
IPT8
6 5 4 3 2 1 0
**
Day 0
Day 4
CIM
8 6
WT 35S::GLB1 35S::GLB2
Relative expression
into young shoots characterized by densely meristematic apical and subapical cells (Fig. 3B2). During the following days in culture the shoots increased in size and established a vascular connection with the root explant (Fig. 3B3). Increased cell proliferation covering the whole surface of the root explant (Fig. 3B4) was observed in the 35S::GLB1 line which was able to form the highest number of shoots (Fig. 3A). Cell proliferation continued on the SIM resulting in the formation of larger masses of meristematic cells (Fig. 3B5) from which several shoots generated (Fig. 3B6). Similar developmental events were also observed in the 35S::GLB2 line (data not shown). Subsequent studies were conducted only with the WT line and the two transgenic lines (35S::GLB1 and 35S::GLB2) characterized by the highest production of shoots (Fig. 3A). Given the redundant role of hemoglobins during plant growth [10] the expression levels of GLB1, 2 and 3 were measured in the roots (stage 0) of the transgenic lines. While the ectopic expression of GLB1in the 35S::GLB1 line did not affect the relative abundance of other GLB genes, the introduction of GLB2 in the 35S::GLB2 line repressed the expression of GLB1below detectable levels (Fig. 3C).
Relative expression
1112
Day 10
Day 14
Day 18
SIM
Fig. 5. Expression levels of ISOPENTENYLTRANSFERASES (IPT) 4, 6, and 8 during shoot organogenesis in the WT line and lines over-expressing GLB1 and GLB2 (35S::GLB1, 35S::GLB2). Values, which represent the mean SE of three independent experiments, were normalized to the values of WT (day 0) set at 1. * Stars indicate values which are significantly different from the WT value (P 0.05).
lines and reached their maximum expression on the SIM (Fig. 6). Compared to the WT line, elevated transcript levels of both genes were observed in the GLB1 and GLB2 over-expressors. An increase in the expression level of AHK4, the third cytokinin receptor, was measured in the last 4 days in culture, especially in the 35S::GLB2 line. During these days the 35S::GLB1 line exhibited the lowest accumulation of AHK4 transcripts (Fig. 6). Transduction of cytokinin signalling in Arabidopsis relies upon the action of responsive regulators (ARRs) which act as feed-back repressors (Type-A ARRs) or activators of downstream genes (Type-B ARRs). In the WT line all Type-A ARRs measured in this
Y. Wang et al. / Plant Physiology and Biochemistry 49 (2011) 1108e1116
Root explants (day 0) dissected from the two transformed lines showed a higher expression level of ARR1 and 10(Fig. 8).
WT 35S::GLB1
Relative expression
35S::GLB2 9
CKI1 6
3
*
*
*
*
*
4. Discussion
*
*
*
0 Day 0
Day 4
Day 10
CIM
Day 14
Relative expression
Day 18
SIM
9
**
AHK3 6
*
*
* *
3
0 Day 0
Day 4
Day 10
CIM
Day 14
Day 18
SIM
Relative expression
10
*
AHK4 8
*
6 4 2 0 Day 0
Day 4
CIM
Day 10
Day 14
1113
Day 18
SIM
Fig. 6. Expression levels of CYTOKININ INDEPENDENT KINASE (CKI1) and ARABIDIOPSIS HISTIDINE KINASE (AHK) 3 and 4 during shoot organogenesis in the WT line and lines over-expressing GLB1 and GLB2 (35S::GLB1, 35S::GLB2). Values, which represent the mean SE of three independent experiments, were normalized to the values of WT (day 0) set at 1. * Stars indicate values which are significantly different from the WT value (P 0.05).
study were up-regulated once the tissue was transferred onto the cytokinin-containing SIM (Fig. 7). A preferential induction during the last days in culture was observed for ARR5 and ARR7. This profile was not observed in the two transgenic lines where the expression of many Type-A ARRs did not increase on the SIM. In root explants (day 0) the up-regulation of both GLB1 and GLB2 induced the accumulation of ARR7 transcripts (Fig. 7). Compared to the WT line, the expression levels of the Type-B ARR2, 12, and 13 were generally higher in the 35S::GLB1 and 35S::GLB2 lines at any day in culture (Fig. 8). A peak in the accumulation of ARR13 transcripts was observed at day 10 in culture.
Shoot formation in Arabidopsis is a process of indirect organogenesis in which dissected root explants are first cultured in an auxin-rich environment (CIM) for four days and subsequently transferred onto a cytokinin-containing medium (SIM). The short pre-incubation on CIM enables the root explants to acquire a “competent state” which allows them to produce shoots if exposed to the inductive cytokinin signal. The omission of the CIM preincubation period precludes shoot formation on the SIM [4]. Evidence suggests that shoot formation in vitro is regulated by similar mechanisms governing shoot organogenesis in vivo, and involves precise changes in hormone levels and a complex reprogramming of gene expression [7]. This work demonstrates that hemoglobin genes are expressed during shoot organogenesis and that alteration in their expression patterns affects the number of shoots produced. The reasons for the changes in hemoglobin expression over the course of the treatments are complex and not easily interpreted. Cytokinin upregulates class 2 non-symbiotic hemoglobin expression [12], while the cytokinin-regulated transcription factor, ARR1, upregulates class 2 non-symbiotic hemoglobin [28]. Cytokinin also causes rapid NO increases in plant cell cultures [34], which can induce class 1 non-symbiotic hemoglobin expression [3,25,27]. The enhanced shoot formation capacity observed in the 35S::GLB1 and 35S::GLB2 lines in vitro is in line with previous work documenting the involvement of both genes during shoot development in vivo. Hebelstrup and Jensen [11] showed that elevated levels of GLB1 or GLB2 affect meristem function by inducing the transition of vegetative meristems into inflorescence meristems. The authors also demonstrated that ectopic expression of either gene promotes bolting, whereas silencing of GLB1 causes the formation of aerial rosettes at lateral meristems. If similar mechanisms regulate shoot formation in vivo and in vitro it can be assumed that the enhanced number of shoots produced by the 35S::GLB1 and 35S::GLB2 roots can be related to the ability of GLB1 and to a lesser extent GLB2 to scavenge NO, a signal molecule participating in the regulation of the meristems, as suggested previously [11]. An additional effect of both hemoglobins might be related to their ability to raise the energy state (ATP/ADP), as demonstrated for GLB2 in developing Arabidopsis seeds [36]. A high energy level is required to sustain the active cell proliferation associated with the formation of meristematic tissue from which shoots originate. Activation of cell division from root explants and production meristematic tissue, as estimated by histological observations, is encouraged in the 35S::GLB1 and 35S::GLB2 lines(Fig. 3B).Studies of hormone requirement for shoot regeneration have identified cytokinin as the most important inductive signal, and explants acquire competence to respond to this hormone in the CIM pre-incubation period. The rate limiting steps of cytokinin biosynthesis in plants are the isopentenylation reactions of ADT and ATP catalysed by isopentenyltansferases (IPTs [23],). Cytokinin signal is then transduced in a two-component signalling system which includes receptor histidine kinases (AHKs), histidinephosphotransmitters (AHPs) and response regulators (ARRs, reviewed by To and Kieber [33]). Despite differences in root explants (day 0) the expression of IPT4, 6, and 8, are not altered during shoot organogenesis in the 35S::GLB1 and 35S::GLB2 lines. Given the role assigned to these IPT genes [22], it is suggested that the over-expression of hemoglobin 1 and 2 does not affect cytokinin biosynthesis on either CIM or SIM. Differences in gene expression patterns among lines were observed for two of the three genes encoding cytokinin receptors.
Y. Wang et al. / Plant Physiology and Biochemistry 49 (2011) 1108e1116
Relative expression
1114
2.5
16
ARR 4
2 1.5
8
1
*
0.5 0
Day 0
Day 4
**
**
Day 10
Day 14
Relative expression
CIM 8 6
*
*
Day 18
*
0
* Day 0
Day 4
Day 10
CIM 15
ARR 7
*
*
4
SIM
Day 14
Day 18
SIM
ARR 15
12 9
4 2 0
*
6
*
**
Day 14
Day 18
* Day 0
Day 4
Day 10
CIM Relative expression
ARR 5
12
SIM
*
3 0
Day 0
Day 4
*
Day 10
CIM
*
*
Day 14
** Day 18
SIM
3 ARR 16 WT
2
35S::GLB1
* 1
0
* Day 0
CIM
*
Day 4
** Day 10
35S::GLB2
* Day 14
** Day 18
SIM
Fig. 7. Expression levels of Type-A ARABIDOPSIS RESPONSE REGULATORS (ARRs) during shoot organogenesis in the WT line and lines over-expressing GLB1 and GLB2 (35S::GLB1, 35S::GLB2). Values, which represent the mean SE of three independent experiments, were normalized to the values of WT (day 0) set at 1. * Stars indicate values which are significantly different from the WT value (P 0.05).
AHK3 and CKI1 were both induced in lines over-expressing the hemoglobin genes. AHK3 encodes a hybrid histidine kinase, analogous to the two bacterial component systems, composed of an extracellular cytokinin-binding region and two cytoplasmic domains, denoted as the transmitters and receiver domains [33]. The direct involvement of AHK3 in cytokinin perception is apparent by the reduced sensitivity to cytokinin and a cytokinin-dependent delay of senescence observed in ahk3 mutants. These effects were reverted if AHK3 was over-expressed in the mutant plants [19]. The other gene up-regulated in both 35S::GLB1 and 35S::GLB2 lines is CKI1 which, like AHK3, encodes a histidine kinase although its role in cytokinin perception needs to be resolved [5]. Despite the fact that CKI1 fails to confer cytokinin responsiveness in several systems, its over-expression induced the formation of in vitro shoots in a cytokinin independent manner [17]. This raises the possibility that the function of this putative receptor is restricted to specific phases of development including shoot organogenesis and that its up-regulation in the GLB1 and GLB2 over-expressors increases cytokinin perception in the explants, thereby making the tissue more responsive to this growth regulator. This notion is indirectly supported by the ability of 35S::GLB1 and 35S::GLB2 roots to produce shoots in a low cytokinin environment (Fig. 4). Downstream phosphorelay elements of cytokinin transduction pathway include several ARABIDOPSIS RESPONSE REGULATORS (ARRs) some of which (Type-A) are negative regulators of cytokinin
signalling, whereas others (Type-B) act as transcriptional activators [14]. The expression of all Type-A ARRs analysed in this study (ARR 4, 5, 7, 15, and 16) is inhibited in lines over-expressing GLB1 and GLB2 during culture on the SIM (Fig. 7). To et al. [32] showed that both root elongation and lateral root formation in arr4 or 5 mutant plants are more sensitive to cytokinin inhibition and these effects are reverted by the introduction of the functional gene. Furthermore the authors also showed that lines with reduced levels of ARR4 and ARR5 were able to generate shoots in culture at low cytokinin levels which were not sufficient to induce shoot organogenesis in the WT line. A similar repressive effect on cytokinin response was also documented for ARR 7 and 15. While the ectopic introduction of ARR7 repressed the expression of many cytokinininduced genes [20], the over-expression of ARR15 inhibited the production of shoots in culture and reduced sensitivity to exogenusly supplied cytokinin during root elongation [18]. Based on these results it is suggested that an inhibition of Type-A ARRs in lines over-expressing GLB1 and GLB2 might contribute to the enhanced ability to generate shoots in culture. Among the transcription activators of cytokinin-induced genes (Type-B ARRs), ARR2, 12 and 13 were up-regulated in the 35S::GLB1 and 35S::GLB2 lines whereas no clear expression pattern was observed for ARR1 and 10 (Fig. 8). Sakai et al. [29] showed that the up-regulation of ARR2 induced several cytokinin responses in the absence of this growth regulator, and was sufficient to promote the
Y. Wang et al. / Plant Physiology and Biochemistry 49 (2011) 1108e1116
Relative expression
12 10
15
ARR 1
12
8 6 4
6
*
2 0
Day 0
3
Day 4
Day 10
CIM
Day 14
Day 18
Relative expression
15
8
*
Day 0
Day 4
*
*
*
Day 10
*
Day 14
Day 18
SIM
*
ARR 12
12
*
*
9
*
3 Day 0
*
6
2 0
*
*
*
CIM
ARR 10
4
0
SIM
10
6
ARR 2
9
**
1115
Day 4
Day 10
CIM
Day 14
Day 18
0
*
*
*
**
Day 0
Day 4
Day 10
CIM
SIM
**
Day 14
Day 18
SIM
Relative expression
8 ARR 13
*
6
*
4
*
*
WT
**
35S::GLB1 35S::GLB2
2 0
Day 0
CIM
Day 4
Day 10
Day 14
Day 18
SIM
Fig. 8. Expression levels of Type-B ARABIDOPSIS RESPONSE ELEMENTS (ARRs) during shoot organogenesis in the WT line and lines over-expressing GLB1 and GLB2 (35S::GLB1, 35S::GLB2). Values, which represent the mean þ SE of three independent experiments, were normalized to the values of WT (day 0) set at 1.* Stars indicate values which are significantly different from the WT value (P 0.05).
formation of shoots in a medium devoid of cytokinin [14]. In the same line roots of ARR12 plants were less sensitive to cytokinin treatments during elongation assays [37]. These observations are consistent with the suggestion that high expression of Type-B ARRs enhances cytokinin response and ultimately encourages the production of shoots from cultured plant explants. In conclusion, this work demonstrates the novel and relevant role played by hemoglobins during shoot organogenesis. The overexpression of both GLB1 (type 1 hemoglobin) and GLB2 (type 2 hemoglobin) favours the production of shoots from Arabidopsis explants while the silencing of GLB2 has an inhibitory effect. Besides their well know role as NO scavengers, which might contribute to the observed results, it is demonstrated that the ectopic induction of GLB1 and GLB2 affects the expression of genes involved in cytokinin perception and signalling. These transcriptional changes increase the tissue sensitivity to cytokinin thereby enhancing the production of shoots. It is therefore suggested that beside their participation in stress responses, hemoglobins might fulfill specific functions in plant development and modulate morphogenesis through cell fate acquisition. This concept is novel and can be exploited not only in tissue culture to enhance organ formation in those systems partially or completely unresponsive to cytokinins, but also in other processes requiring a redirection of developmental fate.
Acknowledgements This work was supported by an NSERC Discovery Grant to RDH and CS. The authors thank Allen Liu for his help and contribution in some of the experiments. Appendix. Supplementary material Supplementary data associated with this article can be found, in the online version, at doi:10.1016/j.plaphy.2011.06.005. References [1] J.M. Alonso, A.N. Stepanova, T.J. Leisse, C.J. Kim, H. Chen, P. Shinn, D.K. Stevenson, J. Zimmerman, P. Barajas, R. Cheuk, C. Gadrinab, C. Heller, A. Jeske, E. Koesema, C.C. Meyers, H. Parker, L. Prednis, Y. Ansari, N. Choy, H. Deen, M. Geralt, N. Hazari, E. Hom, M. Karnes, C. Mulholland, R. Ndubaku, I. Schmidt, P. Guzman, L. Aguilar-Henonin, M. Schmid, D. Weigel, D.E. Carter, T. Marchand, E. Risseeuw, D. Brogden, A. Zeko, W.L. Crosby, C.C. Berry, J.R. Ecker, Genome-wide insertional mutagenesis of Arabidopsis thaliana, Science 301 (2003) 653e657. [2] C.A. Appleby, The origins and functions of haemoglobin in plants, Sci.Prog 76 (1992) 365e398. [3] P. Bustos-Sanmamed, A. Tovar-Mendez, M. Crespi, S. Sato, S. Tabata, M. Becana, Regulation of nonsymbiotic and truncated hemoglobin genes of Lotus japonicus in plant organs and in response to nitric oxide and hormones, New Phytol. 189 (2011) 765e776.
1116
Y. Wang et al. / Plant Physiology and Biochemistry 49 (2011) 1108e1116
[4] A.J. Cary, P. Che, S.H. Howell, Development events and shoot meristem gene expression patterns during shoot development in Arabidopsis thaliana, Plant J. 32 (2002) 867e876. [5] P. Che, D. Gingerich, S. Lall, S. Howell, Global and hormone-induced gene expression changes during shoot development in Arabidopsis, Plant Cell 14 (2002) 2271e2279. [6] M. Elhiti, M. Tahir, R. Gulden, K. Khamiss, C. Stasolla, Modulation of embryoforming capacity in culture through the expression of Brassica genes involved in the regulation of the shoot apical meristem, J. Exp. Bot. 61 (2010) 4069e4085. [7] S.P. Gordon, M.G. Heisler, R. Venogopala, C. Ohno, P. Das, E.M. Meyerowitz, Pattern formation during de novo assembly of the Arabidopsis shoot meristem, Dev 134 (2007) 3539e3548. [8] M.S. Hargrove, E.A. Brucker, B. Stec, G. Sarath, R. Arredondoi-Peter, R.V. Klucas, J.S. Olson, G.N. Phillips, Crystal structure of a nonsymbiotic plant haemoglobin, Struct. Fold. Des 8 (2000) 1005e1014. [9] K.H. Hebelstrup, P. Peter-Hunt, E. Dennis, S.B. Jensen, E.O. Jensen, Hemoglobin is essential for normal growth of Arabidopsis organs, Physiol. Plant 127 (2006) 157e166. [10] K.H. Hebelstrup, A.U. Igamberdiev, R.D. Hill, Metabolic effects of haemoglobin gene expression in plants, Gene 398 (2007) 86e93. [11] K.H. Hebelstrup, E.O. Jensen, Expression of NO scavenging haemoglobin is involved in the timing of bolting in Arabidopsis thaliana, Planta 227 (2008) 917e927. [12] P.W. Hunt, R.A. Watts, B. Trevaskis, D.J. Llewelyn, J. Burnell, E.S. Dennis, W.J. Peacock, Expression and evolution of functionally distinct haemoglobin genes in plants, Plant Mol. Biol. 47 (2001) 677e692. [13] P.W. Hunt, E.J. Klok, B. Trevaskis, R.A. Watts, M.H. Ellis, W.J. Peacock, E.S. Dennis, Increased level of haemoglobin 1 enhances survival of hypoxic stress and promotes early growth in Arabidopsis thaliana, Proc. Natl. Acad. Sci. USA 99 (2002) 17197e17202. [14] I. Hwang, J. Sheen, Two-component circuitry in Arabidopsis cytokinin signal transduction, Nature 413 (2001) 383e389. [15] A.U. Igamberdiev, R.D. Hill, Nitrate, NO and haemoglobin in plant adaptation to hypoxia: an alternative to classic fermentation pathways, J. Exp. Bot. 55 (2004) 2473e2482. [16] A.U. Igamberdiev, C. Seregelyes, N. Manac’h, R.D. Hill, NADH-dependent metabolism of nitric oxide in alfalfa root cultures expressing barley haemoglobin, Planta 219 (2004) 95e102. [17] T. Kakimoto, CKI1, a histidine kinase homolog implicated in cytokinin signal transduction, Science 274 (1996) 982e985. [18] T. Kiba, H. Yamada, S. Sato, T. Kato, S. Tabata, T. Yamashino, T. Mizuno, The Type-A response regulator ARR15 acts as a negative regulator in the cytokinin-mediated signal transduction in Arabidopsis thanliana, Plant Cell Physiol. 44 (2003) 868e874. [19] H.J. Kim, H. Ryo, S.H. Hong, H.R. Woo, P.O. Lim, I.C. Lee, J. Sheen, H.G. Nam, I. Hwang, Cytokinin-mediated control of leaf longevity by AHK3 through phosphorylation of ARR2 in Arabidopsis, Proc. Natl. Acad. Sci. USA 103 (2006) 814e820. [20] D. Lee, S. Kim, Y.M. Ha, J. Kim, Phosphorylation of Arabidopsis response regulator 7 (ARR7) at the putative phospho-accepting site is required for ARR7 to act as a negative regulator of cytokinin signalling, Planta 227 (2007) 577e583. [21] K. Livak, T. Schmittgen, Analysis of relative gene expression data using real time quantitative PCR and the 2-(delta)(delta) CT method, Methods 25 (2001) 402e408.
[22] K. Miyawaki, M. Matsumoto-Kitano, T. Kakimoto, Expression of cytokinin isopentenyltransferase genes in Arabidopsis: tissue specificity and regulation by auxin, cytokinin and nitrate, Plant J. 37 (2004) 128e138. [23] D.W. Mok, M.C. Mok, Cytokinin metabolism and action, Annu. Rev. Plant Physiol. Mol. Biol. 52 (2001) 118 89. [24] T. Murashige, F. Skoog, A revised medium for rapid growth and bioassays with tobacco tissue culture, Physiol. Plant 15 (1962) 473e497. [25] Y. Ohwaki, M. Kawagishi-Kobayashi, K. Wakasa, S. Fujihara, T. Yoneyama, Induction of class-1 non-symbiotic hemoglobin genes by nitrate, nitrite and nitric oxide in cultured rice cells, Plant Cell Physiol. 46 (2005) 324e331. [26] Y. Osakabe, S. Miyata, T. Urao, M. Seki, K. Shinozaki, K. Yamaguchi-Shinozaki, Over-expression of Arabidopsis response regulators ARR4/ATRR1/IBC7 and ARR8/ATRR3, alters cytokinin responses differentially in the shoot and callus formation, Biochem. Biophys. Res. Com 293 (2002) 806e815. [27] Z.L. Qu, N.Q. Zhong, H.Y. Wang, A.P. Chen, G.L. Jian, G.X. Xia, Ectopic expression of the cotton non-symbiotic hemoglobin gene GhHbd1 triggers defense responses and increases disease tolerance in Arabidopsis, Plant Cell Physiol. 47 (2006) 1058e1068. [28] E.J. Ross, J.M. Stone, C.G. Elowsky, R. Arredondo-Peter, R.V. Klucas, G. Sarath, Activation of the Oryzasativa non-symbiotic haemoglobin-2 promoter by the cytokinin-regulated transcription factor, ARR1, J. Exp. Bot. 55 (2004) 1721e1731. [29] H. Sakai, T. Aoyama, A. Oka, Arabidopsis ARR1 and ARR2 response regulators operate as transcriptional activators, Plant J. 24 (2000) 703e711. [30] M. Sugiyama, Genetic analysis of plant morphogenesis in vitro, Intern.Rev.Cytol 196 (2002) 67e84. [31] E.R. Taylor, X.Z. Nie, A.W. MacGregor, R.D. Hill, A cereal haemoglobin gene is expressed in seed and root tissues under anaerobic conditions, Plant Mol. Biol. 24 (1994) 853e862. [32] J.P.C. To, G. Haberer, F.J. Ferreira, J. Deruere, M.G. Mason, G.E. Schaller, J.M. Alonso, J.R. Ecker, J.J. Kieber, Type-A ARRs are partially redundant negative regulators of cytokinin signalling in Arabidopsis, Plant Cell 16 (2004) 658e671. [33] J.P.C. To, J.J. Kieber, Cytokinin signalling: two components and more, Trends Plant Sci. 13 (2008) 8591e8594. [34] N.N. Tun, A. Holk, G.F. Scherer, Rapid increase of NO release in plant cell cultures induced by cytokinin, FEBS Lett. 509 (2001) 174e176. [35] D. Valvekens, M. Montagu, M. Lijsebettebs, Agrobacterium tumefaciens mediated transformation of Arabidopsis thaliana root explants by using kanamycin selection, Proc. Natl. Acad. Sci. USA 85 (1988) 5536e5540. [36] H. Vigeolas, D. Huhn, P. Geigenberger, Nonsymbiontic haemoglobin-2 leads to an elevated energy state and to a combined increase in polyunsaturated fatty acids and total oil content when over-expressed in developing seeds of transgenic Arabidopsis plants, Plant Physiol. 155 (2011) 1435e1444. [37] A. Yokoyama, T. Yamashino, Y.-I. Amano, Y. Tajima, A. Imamura, H. Sakakibara, T. Mizuno, Type-B ARR transcription factors, ARR10 and ARR12 are implicated in cytokinin-mediated regulation of protoxylem differentiation in roots of Arabidopsis thaliana, Plant Cell Physiol. 48 (2007) 84e96. [38] R.A. Watts, P.W. Hunt, A.N. Hvitved, M.S. Hargrove, W.J. Peacock, E.S. Dessis, A hemoglobin from plants homologous to truncated hemoglobins of microorganisms, Proc. Natl. Acad. Sci. USA 98 (2001) 10119e10124. [39] E.C. Yeung, The use of histology in the study of plant tissue culture systems some practical comments, In Vitro Cell. Dev. Biol-Plant 35 (1999) 137e143. [40] J.H. Zar, Biostatistical Analysis, fourth ed. Prentice-Hall, Englewood Cliff, 1999, pp. 208e228.