- Email: [email protected]
Maslinic acid induces HO-1 and NOQ1 expression via activation of Nrf2 transcription factor
Biomedicine & Preventive Nutrition 2 (2012) 51–58
Available online at
www.sciencedirect.com
Original article
Maslinic acid induces HO-1 and NOQ1 expression via activation of Nrf2 transcription factor Wei Hsum Yap a , Kong Soo Khoo a , Anthony Siong Hock Ho b , Yang Mooi Lim c,∗ a
Faculty of Science, Universiti Tunku Abdul Rahman, Bandar Barat, 31900 Kampar, Perak, Malaysia School of Biosciences, Taylor’s University Lakeside Campus, Jalan Taylor’s, 47500 Subang Jaya, Selangor Darul Ehsan, Malaysia Department of Pre-clinical Sciences, Faculty of Medicine and Health Sciences, Universiti Tunku Abdul Rahman, Lot PT21144, Jalan Sungai Long, Bandar Sungai Long, 43000 Kajang, Malaysia b c
a r t i c l e
i n f o
Article history: Received 14 November 2011 Accepted 23 December 2011 Keywords: Maslinic acid HO-1 NQO1 Nrf2
a b s t r a c t Maslinic acid, a naturally-occurring pentacyclic triterpene, has been shown to suppress pro-inflammatory enzyme COX-2 expression and inhibit redox sensitive transcription factors NF-B and AP-1 binding activities. In this study, the effects of maslinic acid at inducing cytoprotective enzymes via the Nrf2ARE pathway in HepG2 cells were investigated. Results showed that maslinic acid significantly induced HO-1 and NQO1 expression in a concentration-dependent manner and achieves maximal expression at 100 M after six hours of treatment. The up-regulation of HO-1 and NQO1 expression might be resulted from maslinic acid-induced ARE binding activity observed from three to 12 h. Maslinic acid also enhanced nuclear Nrf2 protein accumulation up to 172% after three hours of treatment. These results suggest that maslinic acid may induce nuclear Nrf2 accumulation, binding to the ARE and transcriptionally activate HO-1 and NQO1 expression. In addition, maslinic acid significantly induced HO-1 and NQO1 expression in Con-siRNA-transfected cells but this effect was abrogated in cells transfected with Nrf2-siRNA. In conclusion, maslinic acid induces HO-1 and NQO1 enzyme expressions and the transcription factor Nrf2 is essential for the induction of these enzymes. © 2012 Elsevier Masson SAS. All rights reserved.
1. Introduction Maslinic acid (2, 3-dihydroxyolean-12-en-28-oic acid) is a naturally occurring pentacyclic triterpene found in some medicinal plants. Early studies on the isolation and characterization of triterpenes from medicinal plant extracts revealed that maslinic acid has anti-tumour [1] and cytotoxic activities [2]. The anti-tumour effect of maslinic acid was shown in studies investigating cell cycle arrest and apoptosis induction [3,4]. Besides, maslinic acid has also been reported to suppress pro-inflammatory cytokines production in murine macrophages [5] and regulate inflammatory gene expression in mouse liver [6]. Down-regulation of pro-inflammatory enzyme COX-2 expression together with inhibition of redox
Abbreviations: COX, Cyclooxygenase; BNF-, BNuclear factor-kappa; AP-1, Activator protein-1; IL, Interleukins; TNF, Tumour necrosis factor; iNOS, Inducible nitric oxide synthase; HO-1, Heme-oxygenase-1; NQO1, NAD(P)H: quinone oxidoreductase 1; 2Nrf2, Nuclear factor erythroid-2 related factor; ARE, Anti-oxidant response element; SOD, Superoxide dismutase; GCL, Glutamate cysteine ligase; GST, Glutathione S-transferase; HO-1, Heme oxygenase-1; DMEM, Dulbecco’s modified Eagle’s medium; FBS, Fetal bovine serum; SiRNA, Transient transfection with short interfering RNA; HRP, Horseradish peroxidase. ∗ Corresponding author. Tel.: +603 90194722x178; fax: +603 90191959. E-mail address: [email protected] (Y.M. Lim). 2210-5239/$ – see front matter © 2012 Elsevier Masson SAS. All rights reserved. doi:10.1016/j.bionut.2011.12.005
sensitive transcription factors NF-B and AP-1 activation by maslinic acid is likely to contribute to the anti-inflammatory effects of maslinic acid [7]. Apart from inhibiting the inflammation-cancer connection at the promotion and progression stages of carcinogenesis, reinforcing the body’s anti-oxidant defence against electrophilic stress at early stages of carcinogenesis is an important chemoprevention strategy. A wide array of antioxidant and detoxifying enzymes, such as NAD(P)H:quinone oxidoreductase-1, SOD, GST, HO-1, and GCL protect against oxidative and electrophilic stress, thereby preventing the development of cancer [8]. These genes encoding for antioxidant and phase II detoxification enzymes contain a cis-acting element, known as ARE at their promoter regions [9]. The transcriptional activation of these genes is predominantly under the control of the stress responsive transcription factor, Nrf2. Nrf2regulated enzymes have been shown to maintain cellular-reducing equivalents and to enhance antioxidant capacity, thereby protecting against the harmful effects of electrophiles and ROS [10]. Oleanolic acid, the parent compound of maslinic acid, confers protection against various hepatotoxicants including carbon tetrachloride, cadmium, acetaminophen, and bromobenzene [11]. The hepatoprotective effects of oleanolic acid result from Nrf2 activation and increased hepatic NQO1, GCLC and HO-1 expression in the mouse liver [12,13]. The capability of maslinic acid in
52
W.H. Yap et al. / Biomedicine & Preventive Nutrition 2 (2012) 51–58
activating the Nrf2 pathway may provide clues regarding its antiinflammatory defense mechanism. The effects of maslinic acid at inducing cytoprotective enzymes HO-1 and NQO1 expression, ARE binding, nuclear Nrf2 accumulation and the requirement of Nrf2 for activation of HO-1 and NQO1 expression in human hepatoblastoma HepG2 cells were determined. This study elucidates the role of maslinic acid at inducing detoxifying and anti-oxidant enzymes through activation of the Nrf2-ARE pathway.
then incubated on ice for 30 min. They were then electrophoresed in a %T = 5 native polyacrylamide gel in 0.5 × Tris–borate EDTA buffer and transferred to a nylon membrane. The biotin-labeled DNA was detected using chemiluminescent substrate and the membrane was viewed using an Alpha Innotech gel imager (Alpha Innotech, Cell Biosciences, California). Competition reactions were conducted by adding 10-fold molar excess of specific (unlabeled ARE) and nonspecific (unlabeled NF-B) competitors to the reaction mix to show that the binding was specific.
2. Materials and methods 2.1. Materials Maslinic acid was isolated from the tubers of Coleus tuberosus, Benth (Lamiaceae) [14]. The compound used is a chemically pure white powder (> 95% pure as determined by HPLC) and is stable when stored at 4 ◦ C. A stock solution of 10 mg/mL maslinic acid was stored at -20 ◦ C. Oleanolic acid (≥ 97% pure as determined by HPLC) was purchased from Sigma Chemical Co. (St. Louis, MO, USA). DMEM and FBS were purchased from GIBCO BRL (Grand Island, NY, USA). Antibodies against HO-1, NQO1, and actin were purchased from Cell Signaling Technology (Beverly, MA, USA). Antibodies against Nrf-2, Keap1, and lamin B were obtained from Santa Cruz Biotechnology (Santa Cruz, CA, USA). The ECL chemiluminescent detection reagent was purchased from Amersham Co. (Arlington Heights, IL, USA). 2.2. Cell culture and sample treatment Human hepatoblastoma HepG2 cells were obtained from American Type Cell Culture, USA. They were cultured at 37 ◦ C in a 5% CO2 atmosphere in DMEM containing 10% FBS. HepG2 cells (1.5 × 105 cells/mL) were first seeded in 60 mm dishes for 24 h. The cells were then treated with various concentrations of maslinic acid (12.5, 25, 50, and 100 M) and incubated for 12 h in the concentration-dependent studies while the cells were treated with 100 M maslinic acid and incubated for durations of 1, 3, 6, and 12 h for the time course study. The total mRNA and proteins of maslinic acid-treated cells were harvested to determine its effect on HO-1 and NQO1 enzymes gene and protein expression. For ARE binding and nuclear Nrf2 accumulation studies, the nuclear and cytoplasmic protein extracts were prepared through cell fractionation. Oleanolic acid, was used as the positive control. 2.3. Cell fractionation The nuclear and cytoplasmic extracts of maslinic acid-treated cells were prepared using the NE-PER cytoplasmic and nuclear extraction reagents (PIERCE, Rockford, USA). The protein concentrations of the cytoplasmic and nuclear extracts were then determined using the DC protein quantification kit (Biorad, Hercules, USA). 2.4. Electrophoretic mobility shift assay The effects of maslinic acid on the ARE binding activity in HepG2 cells were investigated using the LightShift Chemiluminescent EMSA kit (PIERCE, Rockford, USA). The biotin-labeled Nrf2-binding domain ARE probe (5 TTTTCTGCTGAGTCAAGGGTCCG 3 ) was obtained from Eurogentec AIT (Singapore). The Nrf2 binding reaction mixtures contained 10 g nuclear protein extract, 50 ng poly (dI–dC), 75 mM KCl, 0.3% NP-40, 7.5% glycerol, 2.5 mM DTT, and 20 fM biotinylated Nrf2-ARE probe. The binding reaction mixtures were reconstituted with ultrapure water to volumes of 20 L and
2.5. Transient transfection with short interfering RNA Predesigned siRNA against human Nrf2 and control scrambled siRNA were purchased from Qiagen, Germany. For siRNA studies, HepG2 cells seeded at a density of 3.75 × 105 cells/well in a 6-well plate were either transfected with 25 nM Nrf2-siRNA or scrambled-siRNA (Con-siRNA) using siPORT NeoFX transfection reagent (Applied Biosystem, USA). The siRNAs were introduced into the cells using the Fast Forward Transfection Protocol in which cell seeding and transfection were carried out on the same day. After 48 h transfection, medium containing the siRNA and transfection reagent were removed and replaced with fresh medium containing 100 M maslinic acid and incubated for another 8 h. Total mRNA and proteins were then extracted for real time RT-PCR and Western blot analysis, respectively. 2.6. RNA extraction and real time-Reverse Transcriptase Polymerase Chain Reaction Total RNA was prepared using the RNeasy Mini kit (Qiagen, Germany). The primer pairs for HO-1, NQO-1, Nrf2, and beta actin are designed using online tool primer3 and checked with PREMIER Biosoft for stability of the primers. The primers were obtained from 1st Base (Singapore). The oligonucleotide primers forward, 5 - TTACTATGGGATGGGGTCCA-3 , and reverse, 5 - TCTCCCATTTTTCAGGCAAC-3 , were used to amplify human NQO1; the primers forward, 5 -TCCGATGGGTCCTTACACTC-3 , and reverse, 5 -TAAGGAA GCCAGCCAAGAGA-3 , were used to amplify human HO-1; the primers forward, 5 -CGGTATGCAACAGGACATTG3 , and reverse 5 -AGAGGATGCTGCTGAAGGAA-3 were used to amplify Nrf2 gene, and the primers forward, 5 -CGACTTCG AGCAAGAGATGG-3 , and reverse, 5 - AGCACTGTGTTGGCGTACAG -3 , were used to amplify human beta actin housekeeping gene. RT-PCR was performed using the Quantifast SYBR Green RT-PCR kit (Qiagen, Germany). Results obtained from real time RT-PCR were quantified using the relative quantification method–Delta Delta Comparative Threshold (DDCT) [15]. The Ct values of the gene of interest were first normalized to beta-actin of the same sample, and the relative expression between untreated and treated groups was determined. 2.7. Western Blot analysis Whole-cell lysates were prepared using M-PER Mammalian Protein Extraction Reagent (PIERCE, Rockford, USA). Cells were lysed for 15 min at 4 ◦ C. After centrifugation at 12,000 ×g for 10 min at 4 ◦ C, the supernatant was collected. The protein concentration was determined using the BioRad DC protein quantification assay. Samples containing 50 g of protein were fractionated by %T = 12 SDS-PAGE gels and then electroblotted to PVDF membranes (0.45 m, PIERCE). Immunodetection of HO-1, NQO1, Nrf2, Keap1, beta actin and lamin B were carried out using respective primary antibodies (1:1000 in 3% BSA in PBST buffer) and HRP-conjugated secondary antibodies (1:10000 in 3% BSA in PBST
W.H. Yap et al. / Biomedicine & Preventive Nutrition 2 (2012) 51–58
53
buffer). Protein bands were visualized and quantified using an Alpha Innotech system gel imager (Alpha Innotech, Cell Biosciences, California).
3. Results
2.8. Statistical analysis
Maslinic acid significantly enhanced HO-1 expression in a concentration-dependent manner and the expression reached a maximum response after 6 h of treatment. As shown in Fig. 1A, HO-1 mRNA and protein expression were increased up to 2.5 fold and 92%, respectively, at the highest concentration of maslinic acid
Statistical analyses were performed using SPSS 15.0 software. Treatment effects were analyzed using one way ANOVA. P < 0.05 was used to indicate significance.
3.1. Maslinic acid induces HO-1 and NQO1 enzyme expression in HepG2 cells
Fig. 1. Maslinic acid induces anti-oxidant enzyme HO-1 gene and protein expression. HepG2 cells were exposed to (A) 12.5, 25, 50, and 100 M of MA and OA for 12 h, and (B) 100 M of MA and OA for 1, 3, 6, and 12 h. The HO-1 mRNA expression was determined by real time RT-PCR. Values represent mean ± SD of at least three separate experiments, each performed in triplicate. Asterisk (*) represents p< 0.05 when compared to the untreated control (0 M for concentration studies/0 h for time course studies). The HO-1 protein expression was analyzed by Western blotting. HO-1 protein levels were normalized to beta actin followed by analysis of the relative intensity. The values shown were representative of fold change compared to untreated control (0 M for concentration studies/0 h for time course studies). MA, maslinic acid; OA, oleanolic acid.
54
W.H. Yap et al. / Biomedicine & Preventive Nutrition 2 (2012) 51–58
Fig. 2. Maslinic acid induces detoxifying enzyme NQO1 gene and protein expression. HepG2 cells were exposed to (A) 12.5, 25, 50, and 100 M of MA and OA for 12 h, and (B) 100 M of MA and OA for 1, 3, 6, and 12 h. The NQO1 mRNA expression was determined by real time RT-PCR. Values represent mean ± SD of at least three separate experiments, each performed in triplicate. Asterisk (*) represents p< 0.05 when compared to the untreated control (0 M for concentration studies/0 h for time course studies). The NQO1 protein expression was analyzed by Western blotting. NQO1 protein levels were normalized to beta actin followed by analysis of the relative intensity. The values shown were representative of fold change compared to untreated control (0 M for concentration studies/0 h for time course studies). MA, maslinic acid; OA, oleanolic acid.
used (100 M). The maximal HO-1 protein expression induced by oleanolic acid was 49% at 100 M. The HO-1 protein expression induced by oleanolic acid at 100 M was approximately 50% lesser compared to maslinic acid at the same concentration. In the time course study, maslinic acid-induced HO-1 mRNA increased from 1.7 fold (one hour) to 3.3 fold after six hours and remained induced at 2 fold expression after 12 h of maslinic acid treatment (Fig. 1B). Similarly, oleanolic acid enhanced HO-1 mRNA up to 2.9 fold at six hours and the expression remained high at 2.7 fold after 12 h of treatment. Maslinic acid significantly induced HO-1 protein
expression up to 105% after six hours while oleanolic acid only induced 52% HO-1 expression after 12 h of treatment (Fig. 1B). Maslinic acid induced NQO1 expression in a concentrationdependent manner and the maximum expression occurred at six hours (Fig. 2). NQO1 gene expression levels were enhanced up to 1.60 and 1.58 fold when treated with 50 and 100 M maslinic acid. The mRNA induction corresponded to the protein expression in which 85 and 78% of NQO1 protein were induced upon treatment with 50 and 100 M maslinic acid. The highest induction levels (4 fold mRNA and 85% protein expression) were observed after six
W.H. Yap et al. / Biomedicine & Preventive Nutrition 2 (2012) 51–58
55
Fig. 3. Maslinic acid induces Nrf2-ARE binding. HepG2 cells were treated with 100 M of (A) MA and (B) OA, respectively for 1, 3, 6, and 12 h. Nuclear extracts were prepared and analyzed for ARE binding activity using LightShift Chemiluminescent EMSA assay. The data presented are representative of three independent experiments showing similar trends. MA, maslinic acid; OA, oleanolic acid.
hours of treatment in the time course study. By contrast, the NQO1 induction effect of oleanolic acid was weaker. After six hours of treatment, the highest NQO1 gene and protein expression were 2.5 fold and 34%, respectively. 3.2. Maslinic acid induces Nrf2-ARE binding in HepG2 cells Most of the genes encoding phase II detoxifying and antioxidant enzymes have an ARE sequence in their promoter region. The effect of maslinic acid at inducing the ARE binding activity in association with the up-regulation of detoxifying and/or anti-oxidant enzymes was assessed by EMSA analysis in the time course study. In this present study, maslinic acid was shown to induce Nrf2-ARE binding activity in a time-dependent manner. The Nrf2-ARE binding activity was observed as early as three hours and remained induced until 12 h (Fig. 3A). Maximum Nrf2-ARE binding, induced at six hours, coincided with the highest expression of HO-1 and NQO1 mRNA and protein accumulation induced by maslinic acid at the same time point, suggesting that it induced transcriptional activation of HO-1 and NQO1 through binding on the ARE. The binding activity induced by oleanolic acid occurred later compared to the activity induced by maslinic acid, which was observed from six to 12 h after treatment (Fig. 3B). The observed binding activity was consistent to the time of oleanolic acid induced HO-1 and NQO1 expression. The ARE binding induced by maslinic acid is specific in which the presence of 10-fold molar excess of non-specific competitor (unlabeled NF-B probe) did not affect the binding. However, the binding was significantly reduced in the presence specific competitor (unlabeled ARE probe) (Fig. 4).
Fig. 4. Specificity of Nrf2-ARE binding activity in HepG2 cells. ARE binding was induced by treatment with 100 M of maslinic acid. Ten fold molar excess of unlabeled NF-B probe and unlabeled ARE probe were added in the competition reactions to establish the specificity of ARE binding. Data presented are representative of three independent experiments showing similar trends.
3.3. Maslinic acid induces nuclear Nrf2 accumulation Maslinic acid-induced Nrf2-ARE binding may be linked to the regulation of Nrf2-Keap1 levels. The effect of maslinic acid on the steady-state level of endogenous Nrf2 and Keap1 were analyzed. The results showed that maslinic acid significantly enhanced
nuclear Nrf2 accumulation and this effect was observed after three hours of treatment (Fig. 5A). The nuclear Nrf2 accumulation at three hours might be caused by an increased pool of stabilized cytoplasmic Nrf2 at the same time point. Cytoplasmic Nrf2 protein increased significantly (76%) after three hours of treatment and
56
W.H. Yap et al. / Biomedicine & Preventive Nutrition 2 (2012) 51–58
Fig. 5. Maslinic acid induces Nrf2 nuclear accumulation. HepG2 cells were treated with 100 M of (A) MA and (B) OA, respectively for 1, 3, 6, and 12 h. The cell lysates obtained were fractionated into cytoplasmic and nuclear extracts. Each fraction was subjected to SDS-PAGE separation and Western blotting analysis. The nuclear Nrf2 was normalized to lamin b while the cytoplasmic Nrf2 and Keap1 were normalized to beta actin. The values shown were representative of the fold change compared to the untreated control (0 h). MA, maslinic acid; OA, oleanolic acid.
this expression was enhanced up to 12 h. The stabilized cytoplasmic Nrf2 might enter the nucleus, which account for the maximal nuclear Nrf2 expression (172%) observed at three hours treatment. Keap1 expression was reduced by 30% at three hours when Nrf2 was enhanced but Keap1 expression was restored at 6 and 12 h. Oleanolic acid-induced nuclear translocation of Nrf2 occurred in a similar manner but at a slower rate. As shown in Fig. 5B, oleanolic acidinduced cytoplasmic Nrf2 increased in a time-dependent manner and Nrf2 expression was enhanced up to 124% at 12 h, which might contribute to the highest induction of nuclear Nrf2 at the same time point. The Keap1 levels were not significantly altered.
3.4. Role of Nrf2 in maslinic acid-induced HO-1 and NQO1 expression The role of Nrf2 in maslinic acid-induced HO-1 and NQO1 expression was determined through silencing using siRNA. Transient transfection with Nrf2-siRNA reduced Nrf2 expression by 60% compared to cells transfected with Con-siRNA (Supplementary data). After 48 h transfection with Nrf2-siRNA, HepG2 cells were treated with 100 M maslinic acid for another eight hours before the expression of Nrf2, NQO1 and HO-1 were determined. As shown in Fig. 6A, the Nrf2, NQO1 and HO-1 mRNA levels were enhanced by 85, 61, and 61%, respectively, upon maslinic acid treatment in cells transfected with Con-siRNA. The up-regulation of Nrf2, NQO1 and HO-1 mRNA levels by maslinic acid in Con-siRNA cells transfected were accompanied by a concomitant increase in protein expression (Fig. 6B), indicating that maslinic acid induced transcription of these genes. Upon transfection with Nrf2-siRNA, the mRNA expression of Nrf2, NQO1, and HO-1 were reduced by 62, 50, and 52%, respectively compared to cells transfected with ConsiRNA. The mRNA expressions of Nrf2, NQO1 and HO-1 in cells transfected with Nrf2-siRNA were not significantly different upon maslinic acid treatment. The induction of Nrf2, NQO1, and HO-1 protein expression by maslinic acid was abrogated in cells transfected with Nrf2-siRNA. This supports the hypothesis that maslinic
acid-induced expression of NQO1 and HO-1 is mediated by activation of Nrf2.
3.5. Discussion and conclusion This study shows that maslinic acid induces nuclear Nrf2 accumulation, binding on the ARE, as well as up-regulating antioxidant enzyme HO-1 and detoxifying enzyme NQO1 expression. Upon treatment, cytoplasmic Nrf2 expression increased in a timedependent manner and nuclear Nrf2 accumulation was observed after three hours treatment. Nuclear Nrf2 might stimulate binding on the ARE as observed from 3–12 h. The significant ARE binding activity at six hours may then result in the maximal up-regulation of HO-1 and NQO1 expression observed at the same time point. Results from the silencing studies further showed that maslinic acid-induced HO-1 and NQO1 expression was abrogated in cells transfected with Nrf2-siRNA, suggesting that Nrf2 is essential for induction of these enzymes. Oleanolic acid on the other hand also induces the Nrf2-ARE activation but at a slower rate as compared to maslinic acid. Maslinic acid-induced HO-1 and NQO1 expression might be achieved by enhancing the Nrf2 protein stability [16,17]. Nrf2 has a relatively short-half life of 10-30 min in the absence of cellular stress [18]. However, maslinic acid treatment significantly enhances cytoplasmic Nrf2 expression in a time-dependent manner and induces nuclear Nrf2 accumulation after three hours. The results suggest that upon treatment, maslinic acid stabilizes Nrf2 protein in the cytoplasm, before translocating into the nucleus and transcriptionally activating downstream genes by binding to the ARE. It appears that the steady-state level of Nrf2 is maintained by a precise balance between the rates of synthesis and degradation by the proteasome [19]. Following maslinic acid treatment, Nrf2 may continue to be synthesized at a normal rate, but the rate of degradation decreases such that the balance would now tip toward accumulation of Nrf2, ultimately leading to enhanced transcriptional activity.
W.H. Yap et al. / Biomedicine & Preventive Nutrition 2 (2012) 51–58
57
Fig. 6. Abrogation of NQO1 and HO-1 expression induced by maslinic acid in HepG2 cells transiently transfected with Nrf2-siRNA. HepG2 cells were first transfected with either Con-siRNA or Nrf2-siRNA. After 48 h, the cells were treated with 100 M maslinic acid for another eight hours before determining the expression of Nrf2, HO-1 and NQO1 at the (A) mRNA and (B) protein level by real time RT-PCR and Western blotting analysis, respectively. The mRNA levels were normalized against mRNA in cells transfected with Con-siRNA without maslinic acid treatment. Total Nrf2, NQO1, and HO-1 protein levels were normalized to actin and the values shown were representative of the fold change compared to cells transfected with Con-siRNA without maslinic acid treatment.
The effect of maslinic acid-induced nuclear Nrf2 accumulation might be explained by the ‘hinge and latch’ model proposed by McMahon and colleagues [20]. The Nrf2-Keap1 interaction (hinge and latch) model suggests that Nrf2 has two Keap1-binding sites in the Neh2 domain. Binding via the high affinity ETGE motif provides the ‘hinge’ while concomitant binding via the low-affinity DLG motif provides the ‘latch’. Under conditions of chemical/oxidative stress, Nrf2-Keap1 interaction is perturbed, possibly via loss of binding through the DLG latch. Due to the consequent improper spatial positioning, Nrf2 is no longer directed for degradation, but remains associated with Keap1, most probably via the ETGE hinge. This leads to the saturation of Keap1, and any newly synthesized Nrf2 can evade repression and accumulate within the nucleus, causing transactivateon of ARE-regulated target genes [21]. Besides enhancing the Nrf2 stability, maslinic acid may also regulate Keap1 levels. Reduced Keap1 expression at three hours coincided with significant nuclear Nrf2 expression and ARE binding activity at the same time point, indicating that maslinic acid may trigger degradation of Keap1, leading to Nrf2 nuclear accumulation and ARE gene induction. Meanwhile, phosphorylation may be an important event in both the activation and deactivation of Nrf2 [22]. Several protein kinases, including PKC, ERK, MAPK, p38, and PERK, are known to modify Nrf2 and activate its release from Keap1 [23,24]. Oleanolic acid has been shown to protect against tBHP-induced oxidative injury by enhancing Nrf2
expression and activation of MAPKs, mainly JNK and ERK [25]. In addition, oleanolic acid protects against acetaminophen hepatotoxicty in an Nrf2-dependent and Nrf2-independent cytoprotective mechanisms, which is due, in part, by the induction of metallothionein [12,13]. Hence, modulation of the upstream MAPKs and induction of metallothionein may have important roles in maslinic acid-induced anti-oxidant enzyme expression. This study shows that maslinic acid induces HO-1 and NQO1 expression by activating transcription factor Nrf2. The mode of action of maslinic acid might be due to enhancement of Nrf2 protein stability and reduction of Keap1 expression, thereby causing increased nuclear Nrf2 accumulation, ARE binding activity as well as HO-1 and NQO1 enzyme expression. Disclosure of interest The authors declare that they have no conflicts of interest concerning this article. Acknowledgement The authors would like to express their deepest gratitude to Universiti Tunku Abdul Rahman and FRGS/2/2010/SKK/UTAR/02/1 for supporting this project.
58
W.H. Yap et al. / Biomedicine & Preventive Nutrition 2 (2012) 51–58
Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at doi:10.1016/j.bionut.2011.12.005. References [1] Mooi LY, Ali AM, Norhanom AW, Mat Salleh K, Murakami A, Koshimizu K. Antitumour promoting activity of some Malaysian traditional vegetables (ulam). Nat Prod Sci 1999;5(1):33–8. [2] Kim YK, Yoon SK, Ryu SY. Cytotoxic triterpenes from stem bark of Physocarpus intermedius. Planta Med 2000;66:485–6. ˜ JMC. Maslinic acid, a natural triterpene from [3] Reyes FZ, Palomares ER, Lupiánez Olea europaea L., induces apoptosis in HT29 human colon-cancer cells via the mitochondrial pathway. Cancer Lett 2008;273:44–54. [4] Yap WH, Khoo KS, Lim SH, Yeo CC, Lim YM. Proteomic analysis of the molecular response of Raji cells to maslinic acid treatment. Phytomedicine 2012;19:183–91. [5] Martín MA, Vázquez R, Arche A, Gutiérrez A. Suppressive effect of maslinic acid from pomace olive oil on oxidative stress and cytokine production in stimulated murine macrophages. Free Radic Res 2006;40:295–302. [6] Guillen N, Acin S, Surra JC, Arnal C, Godino J, García-Granados A, et al. Apolipoprotein E determines the hepatic transcriptional profile of dietary maslinic acid in mice. J Nutr Biochem 2009;20:882–93. [7] Hsum YW, Yew WT, Lim PVH, Soo KK, Hoon LS, Chieng YC, et al. Cancer chemopreventive activity of maslinic acid: suppression of COX-2 expression and inhibition of NF-B and AP-1 activation in Raji cells. Planta Med 2011;77:152–7. [8] Kwak M-K, Kensler TW. Targeting Nrf2 signaling for cancer chemoprevention. Toxicol Appl Pharmacol 2010;244:66–76. [9] Eggler AL, Gay KA, Mesecar AD. Molecular mechanisms of natural products in chemoprevention: Induction of cytoprotective enzymes by Nrf2. Mol Nutr Food Res 2008;52:84–94. [10] Kundu JK, Surh YJ. Nrf2-Keap1 Signaling as a Potential Target for Chemoprevention of Inflammation-Associated Carcinogenesis. Pharm Res 2010;27(6):999–1013. [11] Liu J. Oleanolic acid and ursolic acid: Research prospectives. J Ethnopharmacol 2005;100:92–4. [12] Liu J, Wu Q, Lu YF, Pi J. New insights into generalized hepatoprotective effects of oleanolic acid: Key roles of metallothionein and Nrf2 induction. Biochem pharmacol 2008;76:922–8.
[13] Reisman SA, Aleksunes LM, Klaassen CD. Oleanolic acid activates Nrf2 and protects from acetaminophen hepatotoxicity via Nrf2-dependent and Nrf2independent processes. Biochem pharmacol 2009;77:1273–82. [14] Mooi LY, Wahab NA, Lajis NH, Ali AM. Chemopreventive Property of Phytosterols and Maslinic Acid in Inhibiting the Expression of EBV-early Antigen in Raji Cells. Chem Biodivers 2010;7(5):1267–75. [15] Livak KJ, Schmittgen TD. Analysis of Relative Gene Expression Data Using RealTime Quantitative PCR and the 2-CT Method. Methods 2001;25:402–8. [16] Nguyen T, Sherratt PJ, Huang HC, Yang CS, Pickett CB. Increased protein stability as a mechanism that enhances Nrf2-mediated transcriptional activation of the antioxidant response element. Degradation of Nrf2 by the 26 S proteasome. J Biol Chem 2003;278:4536–41. [17] Kobayashi A, Kang MI, Watai Y, Tong KI, Shibata T, Uchida K, et al. Oxidative and electrophilic stresses activate Nrf2 through inhibition of ubiquitination activity of Keap1. Mol Cell Biol 2006;26:221–9. [18] Itoh K, Wakabayashi N, Katoh Y, Ishii T, OConnor T, Yamamoto M. Keap1 regulates both cytoplasmic-nuclear shuttling and degradation of Nrf2 in response to electrophiles. Genes Cells 2003;8:379–91. [19] Furukawa M, Xiong Y. BTB protein Keap1 targets antioxidant transcription factor Nrf2 for ubiquitination by the Cullin 3-Roc1 ligase. Mol Cell Biol 2005;25:162–71. [20] McMahon M, Thomas N, Itoh K, Yamamoto M, Hayes JD. Dimerization of substrate adaptors can facilitate cullin-mediated ubiquitylation of proteins by a “tethering” mechanism: a two-site interaction model for the Nrf2–Keap1 complex. J Biol Chem 2006;281:24756–68. [21] Tong KI, Kobayashi A, Katsuoka F, Yamamoto M. Two-site substrate recognition model for the Keap1-Nrf2 system: a hinge and latch mechanism. Biol Chem 2006;387:1311–20. [22] Copple IM, Goldring CE, Kitteringham NR, Park BK. The Nrf2Keap1 defence pathway: Role in protection against drug-induced toxicity. Toxicology 2008;246:24–33. [23] Bloom DA, Jaiswal AK. Phosphorylation of Nrf2 at Ser(40) by protein kinase C in response to antioxidants leads to the release of Nrf2 from INrf2, but is not required for Nrf2 stabilization/accumulation in the nucleus and transcriptional activation of antioxidant response element-mediated NAD(P)H:quinone oxidoreductase-1 gene expression. J Biol Chem 2003;278(45):44675–82. [24] Yu R, Mandlekar S, Weber MJ, Der CJ, Wu J, Tony-Kong AN. Role of mitogenactivated protein kinase pathway in the induction of phase II detoxifying enzymes by chemicals. J Biol Chem 1999;274:27545–52. [25] Wang X, Ye X, Liu R, Chen HL, Bai H, Liang X, et al. Antioxidant activities of oleanolic acid in vitro: Possible role of Nrf2 and MAP kinases. Chem Biol Interact 2010;184:328–37.
Available online at
www.sciencedirect.com
Original article
Maslinic acid induces HO-1 and NOQ1 expression via activation of Nrf2 transcription factor Wei Hsum Yap a , Kong Soo Khoo a , Anthony Siong Hock Ho b , Yang Mooi Lim c,∗ a
Faculty of Science, Universiti Tunku Abdul Rahman, Bandar Barat, 31900 Kampar, Perak, Malaysia School of Biosciences, Taylor’s University Lakeside Campus, Jalan Taylor’s, 47500 Subang Jaya, Selangor Darul Ehsan, Malaysia Department of Pre-clinical Sciences, Faculty of Medicine and Health Sciences, Universiti Tunku Abdul Rahman, Lot PT21144, Jalan Sungai Long, Bandar Sungai Long, 43000 Kajang, Malaysia b c
a r t i c l e
i n f o
Article history: Received 14 November 2011 Accepted 23 December 2011 Keywords: Maslinic acid HO-1 NQO1 Nrf2
a b s t r a c t Maslinic acid, a naturally-occurring pentacyclic triterpene, has been shown to suppress pro-inflammatory enzyme COX-2 expression and inhibit redox sensitive transcription factors NF-B and AP-1 binding activities. In this study, the effects of maslinic acid at inducing cytoprotective enzymes via the Nrf2ARE pathway in HepG2 cells were investigated. Results showed that maslinic acid significantly induced HO-1 and NQO1 expression in a concentration-dependent manner and achieves maximal expression at 100 M after six hours of treatment. The up-regulation of HO-1 and NQO1 expression might be resulted from maslinic acid-induced ARE binding activity observed from three to 12 h. Maslinic acid also enhanced nuclear Nrf2 protein accumulation up to 172% after three hours of treatment. These results suggest that maslinic acid may induce nuclear Nrf2 accumulation, binding to the ARE and transcriptionally activate HO-1 and NQO1 expression. In addition, maslinic acid significantly induced HO-1 and NQO1 expression in Con-siRNA-transfected cells but this effect was abrogated in cells transfected with Nrf2-siRNA. In conclusion, maslinic acid induces HO-1 and NQO1 enzyme expressions and the transcription factor Nrf2 is essential for the induction of these enzymes. © 2012 Elsevier Masson SAS. All rights reserved.
1. Introduction Maslinic acid (2, 3-dihydroxyolean-12-en-28-oic acid) is a naturally occurring pentacyclic triterpene found in some medicinal plants. Early studies on the isolation and characterization of triterpenes from medicinal plant extracts revealed that maslinic acid has anti-tumour [1] and cytotoxic activities [2]. The anti-tumour effect of maslinic acid was shown in studies investigating cell cycle arrest and apoptosis induction [3,4]. Besides, maslinic acid has also been reported to suppress pro-inflammatory cytokines production in murine macrophages [5] and regulate inflammatory gene expression in mouse liver [6]. Down-regulation of pro-inflammatory enzyme COX-2 expression together with inhibition of redox
Abbreviations: COX, Cyclooxygenase; BNF-, BNuclear factor-kappa; AP-1, Activator protein-1; IL, Interleukins; TNF, Tumour necrosis factor; iNOS, Inducible nitric oxide synthase; HO-1, Heme-oxygenase-1; NQO1, NAD(P)H: quinone oxidoreductase 1; 2Nrf2, Nuclear factor erythroid-2 related factor; ARE, Anti-oxidant response element; SOD, Superoxide dismutase; GCL, Glutamate cysteine ligase; GST, Glutathione S-transferase; HO-1, Heme oxygenase-1; DMEM, Dulbecco’s modified Eagle’s medium; FBS, Fetal bovine serum; SiRNA, Transient transfection with short interfering RNA; HRP, Horseradish peroxidase. ∗ Corresponding author. Tel.: +603 90194722x178; fax: +603 90191959. E-mail address: [email protected] (Y.M. Lim). 2210-5239/$ – see front matter © 2012 Elsevier Masson SAS. All rights reserved. doi:10.1016/j.bionut.2011.12.005
sensitive transcription factors NF-B and AP-1 activation by maslinic acid is likely to contribute to the anti-inflammatory effects of maslinic acid [7]. Apart from inhibiting the inflammation-cancer connection at the promotion and progression stages of carcinogenesis, reinforcing the body’s anti-oxidant defence against electrophilic stress at early stages of carcinogenesis is an important chemoprevention strategy. A wide array of antioxidant and detoxifying enzymes, such as NAD(P)H:quinone oxidoreductase-1, SOD, GST, HO-1, and GCL protect against oxidative and electrophilic stress, thereby preventing the development of cancer [8]. These genes encoding for antioxidant and phase II detoxification enzymes contain a cis-acting element, known as ARE at their promoter regions [9]. The transcriptional activation of these genes is predominantly under the control of the stress responsive transcription factor, Nrf2. Nrf2regulated enzymes have been shown to maintain cellular-reducing equivalents and to enhance antioxidant capacity, thereby protecting against the harmful effects of electrophiles and ROS [10]. Oleanolic acid, the parent compound of maslinic acid, confers protection against various hepatotoxicants including carbon tetrachloride, cadmium, acetaminophen, and bromobenzene [11]. The hepatoprotective effects of oleanolic acid result from Nrf2 activation and increased hepatic NQO1, GCLC and HO-1 expression in the mouse liver [12,13]. The capability of maslinic acid in
52
W.H. Yap et al. / Biomedicine & Preventive Nutrition 2 (2012) 51–58
activating the Nrf2 pathway may provide clues regarding its antiinflammatory defense mechanism. The effects of maslinic acid at inducing cytoprotective enzymes HO-1 and NQO1 expression, ARE binding, nuclear Nrf2 accumulation and the requirement of Nrf2 for activation of HO-1 and NQO1 expression in human hepatoblastoma HepG2 cells were determined. This study elucidates the role of maslinic acid at inducing detoxifying and anti-oxidant enzymes through activation of the Nrf2-ARE pathway.
then incubated on ice for 30 min. They were then electrophoresed in a %T = 5 native polyacrylamide gel in 0.5 × Tris–borate EDTA buffer and transferred to a nylon membrane. The biotin-labeled DNA was detected using chemiluminescent substrate and the membrane was viewed using an Alpha Innotech gel imager (Alpha Innotech, Cell Biosciences, California). Competition reactions were conducted by adding 10-fold molar excess of specific (unlabeled ARE) and nonspecific (unlabeled NF-B) competitors to the reaction mix to show that the binding was specific.
2. Materials and methods 2.1. Materials Maslinic acid was isolated from the tubers of Coleus tuberosus, Benth (Lamiaceae) [14]. The compound used is a chemically pure white powder (> 95% pure as determined by HPLC) and is stable when stored at 4 ◦ C. A stock solution of 10 mg/mL maslinic acid was stored at -20 ◦ C. Oleanolic acid (≥ 97% pure as determined by HPLC) was purchased from Sigma Chemical Co. (St. Louis, MO, USA). DMEM and FBS were purchased from GIBCO BRL (Grand Island, NY, USA). Antibodies against HO-1, NQO1, and actin were purchased from Cell Signaling Technology (Beverly, MA, USA). Antibodies against Nrf-2, Keap1, and lamin B were obtained from Santa Cruz Biotechnology (Santa Cruz, CA, USA). The ECL chemiluminescent detection reagent was purchased from Amersham Co. (Arlington Heights, IL, USA). 2.2. Cell culture and sample treatment Human hepatoblastoma HepG2 cells were obtained from American Type Cell Culture, USA. They were cultured at 37 ◦ C in a 5% CO2 atmosphere in DMEM containing 10% FBS. HepG2 cells (1.5 × 105 cells/mL) were first seeded in 60 mm dishes for 24 h. The cells were then treated with various concentrations of maslinic acid (12.5, 25, 50, and 100 M) and incubated for 12 h in the concentration-dependent studies while the cells were treated with 100 M maslinic acid and incubated for durations of 1, 3, 6, and 12 h for the time course study. The total mRNA and proteins of maslinic acid-treated cells were harvested to determine its effect on HO-1 and NQO1 enzymes gene and protein expression. For ARE binding and nuclear Nrf2 accumulation studies, the nuclear and cytoplasmic protein extracts were prepared through cell fractionation. Oleanolic acid, was used as the positive control. 2.3. Cell fractionation The nuclear and cytoplasmic extracts of maslinic acid-treated cells were prepared using the NE-PER cytoplasmic and nuclear extraction reagents (PIERCE, Rockford, USA). The protein concentrations of the cytoplasmic and nuclear extracts were then determined using the DC protein quantification kit (Biorad, Hercules, USA). 2.4. Electrophoretic mobility shift assay The effects of maslinic acid on the ARE binding activity in HepG2 cells were investigated using the LightShift Chemiluminescent EMSA kit (PIERCE, Rockford, USA). The biotin-labeled Nrf2-binding domain ARE probe (5 TTTTCTGCTGAGTCAAGGGTCCG 3 ) was obtained from Eurogentec AIT (Singapore). The Nrf2 binding reaction mixtures contained 10 g nuclear protein extract, 50 ng poly (dI–dC), 75 mM KCl, 0.3% NP-40, 7.5% glycerol, 2.5 mM DTT, and 20 fM biotinylated Nrf2-ARE probe. The binding reaction mixtures were reconstituted with ultrapure water to volumes of 20 L and
2.5. Transient transfection with short interfering RNA Predesigned siRNA against human Nrf2 and control scrambled siRNA were purchased from Qiagen, Germany. For siRNA studies, HepG2 cells seeded at a density of 3.75 × 105 cells/well in a 6-well plate were either transfected with 25 nM Nrf2-siRNA or scrambled-siRNA (Con-siRNA) using siPORT NeoFX transfection reagent (Applied Biosystem, USA). The siRNAs were introduced into the cells using the Fast Forward Transfection Protocol in which cell seeding and transfection were carried out on the same day. After 48 h transfection, medium containing the siRNA and transfection reagent were removed and replaced with fresh medium containing 100 M maslinic acid and incubated for another 8 h. Total mRNA and proteins were then extracted for real time RT-PCR and Western blot analysis, respectively. 2.6. RNA extraction and real time-Reverse Transcriptase Polymerase Chain Reaction Total RNA was prepared using the RNeasy Mini kit (Qiagen, Germany). The primer pairs for HO-1, NQO-1, Nrf2, and beta actin are designed using online tool primer3 and checked with PREMIER Biosoft for stability of the primers. The primers were obtained from 1st Base (Singapore). The oligonucleotide primers forward, 5 - TTACTATGGGATGGGGTCCA-3 , and reverse, 5 - TCTCCCATTTTTCAGGCAAC-3 , were used to amplify human NQO1; the primers forward, 5 -TCCGATGGGTCCTTACACTC-3 , and reverse, 5 -TAAGGAA GCCAGCCAAGAGA-3 , were used to amplify human HO-1; the primers forward, 5 -CGGTATGCAACAGGACATTG3 , and reverse 5 -AGAGGATGCTGCTGAAGGAA-3 were used to amplify Nrf2 gene, and the primers forward, 5 -CGACTTCG AGCAAGAGATGG-3 , and reverse, 5 - AGCACTGTGTTGGCGTACAG -3 , were used to amplify human beta actin housekeeping gene. RT-PCR was performed using the Quantifast SYBR Green RT-PCR kit (Qiagen, Germany). Results obtained from real time RT-PCR were quantified using the relative quantification method–Delta Delta Comparative Threshold (DDCT) [15]. The Ct values of the gene of interest were first normalized to beta-actin of the same sample, and the relative expression between untreated and treated groups was determined. 2.7. Western Blot analysis Whole-cell lysates were prepared using M-PER Mammalian Protein Extraction Reagent (PIERCE, Rockford, USA). Cells were lysed for 15 min at 4 ◦ C. After centrifugation at 12,000 ×g for 10 min at 4 ◦ C, the supernatant was collected. The protein concentration was determined using the BioRad DC protein quantification assay. Samples containing 50 g of protein were fractionated by %T = 12 SDS-PAGE gels and then electroblotted to PVDF membranes (0.45 m, PIERCE). Immunodetection of HO-1, NQO1, Nrf2, Keap1, beta actin and lamin B were carried out using respective primary antibodies (1:1000 in 3% BSA in PBST buffer) and HRP-conjugated secondary antibodies (1:10000 in 3% BSA in PBST
W.H. Yap et al. / Biomedicine & Preventive Nutrition 2 (2012) 51–58
53
buffer). Protein bands were visualized and quantified using an Alpha Innotech system gel imager (Alpha Innotech, Cell Biosciences, California).
3. Results
2.8. Statistical analysis
Maslinic acid significantly enhanced HO-1 expression in a concentration-dependent manner and the expression reached a maximum response after 6 h of treatment. As shown in Fig. 1A, HO-1 mRNA and protein expression were increased up to 2.5 fold and 92%, respectively, at the highest concentration of maslinic acid
Statistical analyses were performed using SPSS 15.0 software. Treatment effects were analyzed using one way ANOVA. P < 0.05 was used to indicate significance.
3.1. Maslinic acid induces HO-1 and NQO1 enzyme expression in HepG2 cells
Fig. 1. Maslinic acid induces anti-oxidant enzyme HO-1 gene and protein expression. HepG2 cells were exposed to (A) 12.5, 25, 50, and 100 M of MA and OA for 12 h, and (B) 100 M of MA and OA for 1, 3, 6, and 12 h. The HO-1 mRNA expression was determined by real time RT-PCR. Values represent mean ± SD of at least three separate experiments, each performed in triplicate. Asterisk (*) represents p< 0.05 when compared to the untreated control (0 M for concentration studies/0 h for time course studies). The HO-1 protein expression was analyzed by Western blotting. HO-1 protein levels were normalized to beta actin followed by analysis of the relative intensity. The values shown were representative of fold change compared to untreated control (0 M for concentration studies/0 h for time course studies). MA, maslinic acid; OA, oleanolic acid.
54
W.H. Yap et al. / Biomedicine & Preventive Nutrition 2 (2012) 51–58
Fig. 2. Maslinic acid induces detoxifying enzyme NQO1 gene and protein expression. HepG2 cells were exposed to (A) 12.5, 25, 50, and 100 M of MA and OA for 12 h, and (B) 100 M of MA and OA for 1, 3, 6, and 12 h. The NQO1 mRNA expression was determined by real time RT-PCR. Values represent mean ± SD of at least three separate experiments, each performed in triplicate. Asterisk (*) represents p< 0.05 when compared to the untreated control (0 M for concentration studies/0 h for time course studies). The NQO1 protein expression was analyzed by Western blotting. NQO1 protein levels were normalized to beta actin followed by analysis of the relative intensity. The values shown were representative of fold change compared to untreated control (0 M for concentration studies/0 h for time course studies). MA, maslinic acid; OA, oleanolic acid.
used (100 M). The maximal HO-1 protein expression induced by oleanolic acid was 49% at 100 M. The HO-1 protein expression induced by oleanolic acid at 100 M was approximately 50% lesser compared to maslinic acid at the same concentration. In the time course study, maslinic acid-induced HO-1 mRNA increased from 1.7 fold (one hour) to 3.3 fold after six hours and remained induced at 2 fold expression after 12 h of maslinic acid treatment (Fig. 1B). Similarly, oleanolic acid enhanced HO-1 mRNA up to 2.9 fold at six hours and the expression remained high at 2.7 fold after 12 h of treatment. Maslinic acid significantly induced HO-1 protein
expression up to 105% after six hours while oleanolic acid only induced 52% HO-1 expression after 12 h of treatment (Fig. 1B). Maslinic acid induced NQO1 expression in a concentrationdependent manner and the maximum expression occurred at six hours (Fig. 2). NQO1 gene expression levels were enhanced up to 1.60 and 1.58 fold when treated with 50 and 100 M maslinic acid. The mRNA induction corresponded to the protein expression in which 85 and 78% of NQO1 protein were induced upon treatment with 50 and 100 M maslinic acid. The highest induction levels (4 fold mRNA and 85% protein expression) were observed after six
W.H. Yap et al. / Biomedicine & Preventive Nutrition 2 (2012) 51–58
55
Fig. 3. Maslinic acid induces Nrf2-ARE binding. HepG2 cells were treated with 100 M of (A) MA and (B) OA, respectively for 1, 3, 6, and 12 h. Nuclear extracts were prepared and analyzed for ARE binding activity using LightShift Chemiluminescent EMSA assay. The data presented are representative of three independent experiments showing similar trends. MA, maslinic acid; OA, oleanolic acid.
hours of treatment in the time course study. By contrast, the NQO1 induction effect of oleanolic acid was weaker. After six hours of treatment, the highest NQO1 gene and protein expression were 2.5 fold and 34%, respectively. 3.2. Maslinic acid induces Nrf2-ARE binding in HepG2 cells Most of the genes encoding phase II detoxifying and antioxidant enzymes have an ARE sequence in their promoter region. The effect of maslinic acid at inducing the ARE binding activity in association with the up-regulation of detoxifying and/or anti-oxidant enzymes was assessed by EMSA analysis in the time course study. In this present study, maslinic acid was shown to induce Nrf2-ARE binding activity in a time-dependent manner. The Nrf2-ARE binding activity was observed as early as three hours and remained induced until 12 h (Fig. 3A). Maximum Nrf2-ARE binding, induced at six hours, coincided with the highest expression of HO-1 and NQO1 mRNA and protein accumulation induced by maslinic acid at the same time point, suggesting that it induced transcriptional activation of HO-1 and NQO1 through binding on the ARE. The binding activity induced by oleanolic acid occurred later compared to the activity induced by maslinic acid, which was observed from six to 12 h after treatment (Fig. 3B). The observed binding activity was consistent to the time of oleanolic acid induced HO-1 and NQO1 expression. The ARE binding induced by maslinic acid is specific in which the presence of 10-fold molar excess of non-specific competitor (unlabeled NF-B probe) did not affect the binding. However, the binding was significantly reduced in the presence specific competitor (unlabeled ARE probe) (Fig. 4).
Fig. 4. Specificity of Nrf2-ARE binding activity in HepG2 cells. ARE binding was induced by treatment with 100 M of maslinic acid. Ten fold molar excess of unlabeled NF-B probe and unlabeled ARE probe were added in the competition reactions to establish the specificity of ARE binding. Data presented are representative of three independent experiments showing similar trends.
3.3. Maslinic acid induces nuclear Nrf2 accumulation Maslinic acid-induced Nrf2-ARE binding may be linked to the regulation of Nrf2-Keap1 levels. The effect of maslinic acid on the steady-state level of endogenous Nrf2 and Keap1 were analyzed. The results showed that maslinic acid significantly enhanced
nuclear Nrf2 accumulation and this effect was observed after three hours of treatment (Fig. 5A). The nuclear Nrf2 accumulation at three hours might be caused by an increased pool of stabilized cytoplasmic Nrf2 at the same time point. Cytoplasmic Nrf2 protein increased significantly (76%) after three hours of treatment and
56
W.H. Yap et al. / Biomedicine & Preventive Nutrition 2 (2012) 51–58
Fig. 5. Maslinic acid induces Nrf2 nuclear accumulation. HepG2 cells were treated with 100 M of (A) MA and (B) OA, respectively for 1, 3, 6, and 12 h. The cell lysates obtained were fractionated into cytoplasmic and nuclear extracts. Each fraction was subjected to SDS-PAGE separation and Western blotting analysis. The nuclear Nrf2 was normalized to lamin b while the cytoplasmic Nrf2 and Keap1 were normalized to beta actin. The values shown were representative of the fold change compared to the untreated control (0 h). MA, maslinic acid; OA, oleanolic acid.
this expression was enhanced up to 12 h. The stabilized cytoplasmic Nrf2 might enter the nucleus, which account for the maximal nuclear Nrf2 expression (172%) observed at three hours treatment. Keap1 expression was reduced by 30% at three hours when Nrf2 was enhanced but Keap1 expression was restored at 6 and 12 h. Oleanolic acid-induced nuclear translocation of Nrf2 occurred in a similar manner but at a slower rate. As shown in Fig. 5B, oleanolic acidinduced cytoplasmic Nrf2 increased in a time-dependent manner and Nrf2 expression was enhanced up to 124% at 12 h, which might contribute to the highest induction of nuclear Nrf2 at the same time point. The Keap1 levels were not significantly altered.
3.4. Role of Nrf2 in maslinic acid-induced HO-1 and NQO1 expression The role of Nrf2 in maslinic acid-induced HO-1 and NQO1 expression was determined through silencing using siRNA. Transient transfection with Nrf2-siRNA reduced Nrf2 expression by 60% compared to cells transfected with Con-siRNA (Supplementary data). After 48 h transfection with Nrf2-siRNA, HepG2 cells were treated with 100 M maslinic acid for another eight hours before the expression of Nrf2, NQO1 and HO-1 were determined. As shown in Fig. 6A, the Nrf2, NQO1 and HO-1 mRNA levels were enhanced by 85, 61, and 61%, respectively, upon maslinic acid treatment in cells transfected with Con-siRNA. The up-regulation of Nrf2, NQO1 and HO-1 mRNA levels by maslinic acid in Con-siRNA cells transfected were accompanied by a concomitant increase in protein expression (Fig. 6B), indicating that maslinic acid induced transcription of these genes. Upon transfection with Nrf2-siRNA, the mRNA expression of Nrf2, NQO1, and HO-1 were reduced by 62, 50, and 52%, respectively compared to cells transfected with ConsiRNA. The mRNA expressions of Nrf2, NQO1 and HO-1 in cells transfected with Nrf2-siRNA were not significantly different upon maslinic acid treatment. The induction of Nrf2, NQO1, and HO-1 protein expression by maslinic acid was abrogated in cells transfected with Nrf2-siRNA. This supports the hypothesis that maslinic
acid-induced expression of NQO1 and HO-1 is mediated by activation of Nrf2.
3.5. Discussion and conclusion This study shows that maslinic acid induces nuclear Nrf2 accumulation, binding on the ARE, as well as up-regulating antioxidant enzyme HO-1 and detoxifying enzyme NQO1 expression. Upon treatment, cytoplasmic Nrf2 expression increased in a timedependent manner and nuclear Nrf2 accumulation was observed after three hours treatment. Nuclear Nrf2 might stimulate binding on the ARE as observed from 3–12 h. The significant ARE binding activity at six hours may then result in the maximal up-regulation of HO-1 and NQO1 expression observed at the same time point. Results from the silencing studies further showed that maslinic acid-induced HO-1 and NQO1 expression was abrogated in cells transfected with Nrf2-siRNA, suggesting that Nrf2 is essential for induction of these enzymes. Oleanolic acid on the other hand also induces the Nrf2-ARE activation but at a slower rate as compared to maslinic acid. Maslinic acid-induced HO-1 and NQO1 expression might be achieved by enhancing the Nrf2 protein stability [16,17]. Nrf2 has a relatively short-half life of 10-30 min in the absence of cellular stress [18]. However, maslinic acid treatment significantly enhances cytoplasmic Nrf2 expression in a time-dependent manner and induces nuclear Nrf2 accumulation after three hours. The results suggest that upon treatment, maslinic acid stabilizes Nrf2 protein in the cytoplasm, before translocating into the nucleus and transcriptionally activating downstream genes by binding to the ARE. It appears that the steady-state level of Nrf2 is maintained by a precise balance between the rates of synthesis and degradation by the proteasome [19]. Following maslinic acid treatment, Nrf2 may continue to be synthesized at a normal rate, but the rate of degradation decreases such that the balance would now tip toward accumulation of Nrf2, ultimately leading to enhanced transcriptional activity.
W.H. Yap et al. / Biomedicine & Preventive Nutrition 2 (2012) 51–58
57
Fig. 6. Abrogation of NQO1 and HO-1 expression induced by maslinic acid in HepG2 cells transiently transfected with Nrf2-siRNA. HepG2 cells were first transfected with either Con-siRNA or Nrf2-siRNA. After 48 h, the cells were treated with 100 M maslinic acid for another eight hours before determining the expression of Nrf2, HO-1 and NQO1 at the (A) mRNA and (B) protein level by real time RT-PCR and Western blotting analysis, respectively. The mRNA levels were normalized against mRNA in cells transfected with Con-siRNA without maslinic acid treatment. Total Nrf2, NQO1, and HO-1 protein levels were normalized to actin and the values shown were representative of the fold change compared to cells transfected with Con-siRNA without maslinic acid treatment.
The effect of maslinic acid-induced nuclear Nrf2 accumulation might be explained by the ‘hinge and latch’ model proposed by McMahon and colleagues [20]. The Nrf2-Keap1 interaction (hinge and latch) model suggests that Nrf2 has two Keap1-binding sites in the Neh2 domain. Binding via the high affinity ETGE motif provides the ‘hinge’ while concomitant binding via the low-affinity DLG motif provides the ‘latch’. Under conditions of chemical/oxidative stress, Nrf2-Keap1 interaction is perturbed, possibly via loss of binding through the DLG latch. Due to the consequent improper spatial positioning, Nrf2 is no longer directed for degradation, but remains associated with Keap1, most probably via the ETGE hinge. This leads to the saturation of Keap1, and any newly synthesized Nrf2 can evade repression and accumulate within the nucleus, causing transactivateon of ARE-regulated target genes [21]. Besides enhancing the Nrf2 stability, maslinic acid may also regulate Keap1 levels. Reduced Keap1 expression at three hours coincided with significant nuclear Nrf2 expression and ARE binding activity at the same time point, indicating that maslinic acid may trigger degradation of Keap1, leading to Nrf2 nuclear accumulation and ARE gene induction. Meanwhile, phosphorylation may be an important event in both the activation and deactivation of Nrf2 [22]. Several protein kinases, including PKC, ERK, MAPK, p38, and PERK, are known to modify Nrf2 and activate its release from Keap1 [23,24]. Oleanolic acid has been shown to protect against tBHP-induced oxidative injury by enhancing Nrf2
expression and activation of MAPKs, mainly JNK and ERK [25]. In addition, oleanolic acid protects against acetaminophen hepatotoxicty in an Nrf2-dependent and Nrf2-independent cytoprotective mechanisms, which is due, in part, by the induction of metallothionein [12,13]. Hence, modulation of the upstream MAPKs and induction of metallothionein may have important roles in maslinic acid-induced anti-oxidant enzyme expression. This study shows that maslinic acid induces HO-1 and NQO1 expression by activating transcription factor Nrf2. The mode of action of maslinic acid might be due to enhancement of Nrf2 protein stability and reduction of Keap1 expression, thereby causing increased nuclear Nrf2 accumulation, ARE binding activity as well as HO-1 and NQO1 enzyme expression. Disclosure of interest The authors declare that they have no conflicts of interest concerning this article. Acknowledgement The authors would like to express their deepest gratitude to Universiti Tunku Abdul Rahman and FRGS/2/2010/SKK/UTAR/02/1 for supporting this project.
58
W.H. Yap et al. / Biomedicine & Preventive Nutrition 2 (2012) 51–58
Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at doi:10.1016/j.bionut.2011.12.005. References [1] Mooi LY, Ali AM, Norhanom AW, Mat Salleh K, Murakami A, Koshimizu K. Antitumour promoting activity of some Malaysian traditional vegetables (ulam). Nat Prod Sci 1999;5(1):33–8. [2] Kim YK, Yoon SK, Ryu SY. Cytotoxic triterpenes from stem bark of Physocarpus intermedius. Planta Med 2000;66:485–6. ˜ JMC. Maslinic acid, a natural triterpene from [3] Reyes FZ, Palomares ER, Lupiánez Olea europaea L., induces apoptosis in HT29 human colon-cancer cells via the mitochondrial pathway. Cancer Lett 2008;273:44–54. [4] Yap WH, Khoo KS, Lim SH, Yeo CC, Lim YM. Proteomic analysis of the molecular response of Raji cells to maslinic acid treatment. Phytomedicine 2012;19:183–91. [5] Martín MA, Vázquez R, Arche A, Gutiérrez A. Suppressive effect of maslinic acid from pomace olive oil on oxidative stress and cytokine production in stimulated murine macrophages. Free Radic Res 2006;40:295–302. [6] Guillen N, Acin S, Surra JC, Arnal C, Godino J, García-Granados A, et al. Apolipoprotein E determines the hepatic transcriptional profile of dietary maslinic acid in mice. J Nutr Biochem 2009;20:882–93. [7] Hsum YW, Yew WT, Lim PVH, Soo KK, Hoon LS, Chieng YC, et al. Cancer chemopreventive activity of maslinic acid: suppression of COX-2 expression and inhibition of NF-B and AP-1 activation in Raji cells. Planta Med 2011;77:152–7. [8] Kwak M-K, Kensler TW. Targeting Nrf2 signaling for cancer chemoprevention. Toxicol Appl Pharmacol 2010;244:66–76. [9] Eggler AL, Gay KA, Mesecar AD. Molecular mechanisms of natural products in chemoprevention: Induction of cytoprotective enzymes by Nrf2. Mol Nutr Food Res 2008;52:84–94. [10] Kundu JK, Surh YJ. Nrf2-Keap1 Signaling as a Potential Target for Chemoprevention of Inflammation-Associated Carcinogenesis. Pharm Res 2010;27(6):999–1013. [11] Liu J. Oleanolic acid and ursolic acid: Research prospectives. J Ethnopharmacol 2005;100:92–4. [12] Liu J, Wu Q, Lu YF, Pi J. New insights into generalized hepatoprotective effects of oleanolic acid: Key roles of metallothionein and Nrf2 induction. Biochem pharmacol 2008;76:922–8.
[13] Reisman SA, Aleksunes LM, Klaassen CD. Oleanolic acid activates Nrf2 and protects from acetaminophen hepatotoxicity via Nrf2-dependent and Nrf2independent processes. Biochem pharmacol 2009;77:1273–82. [14] Mooi LY, Wahab NA, Lajis NH, Ali AM. Chemopreventive Property of Phytosterols and Maslinic Acid in Inhibiting the Expression of EBV-early Antigen in Raji Cells. Chem Biodivers 2010;7(5):1267–75. [15] Livak KJ, Schmittgen TD. Analysis of Relative Gene Expression Data Using RealTime Quantitative PCR and the 2-CT Method. Methods 2001;25:402–8. [16] Nguyen T, Sherratt PJ, Huang HC, Yang CS, Pickett CB. Increased protein stability as a mechanism that enhances Nrf2-mediated transcriptional activation of the antioxidant response element. Degradation of Nrf2 by the 26 S proteasome. J Biol Chem 2003;278:4536–41. [17] Kobayashi A, Kang MI, Watai Y, Tong KI, Shibata T, Uchida K, et al. Oxidative and electrophilic stresses activate Nrf2 through inhibition of ubiquitination activity of Keap1. Mol Cell Biol 2006;26:221–9. [18] Itoh K, Wakabayashi N, Katoh Y, Ishii T, OConnor T, Yamamoto M. Keap1 regulates both cytoplasmic-nuclear shuttling and degradation of Nrf2 in response to electrophiles. Genes Cells 2003;8:379–91. [19] Furukawa M, Xiong Y. BTB protein Keap1 targets antioxidant transcription factor Nrf2 for ubiquitination by the Cullin 3-Roc1 ligase. Mol Cell Biol 2005;25:162–71. [20] McMahon M, Thomas N, Itoh K, Yamamoto M, Hayes JD. Dimerization of substrate adaptors can facilitate cullin-mediated ubiquitylation of proteins by a “tethering” mechanism: a two-site interaction model for the Nrf2–Keap1 complex. J Biol Chem 2006;281:24756–68. [21] Tong KI, Kobayashi A, Katsuoka F, Yamamoto M. Two-site substrate recognition model for the Keap1-Nrf2 system: a hinge and latch mechanism. Biol Chem 2006;387:1311–20. [22] Copple IM, Goldring CE, Kitteringham NR, Park BK. The Nrf2Keap1 defence pathway: Role in protection against drug-induced toxicity. Toxicology 2008;246:24–33. [23] Bloom DA, Jaiswal AK. Phosphorylation of Nrf2 at Ser(40) by protein kinase C in response to antioxidants leads to the release of Nrf2 from INrf2, but is not required for Nrf2 stabilization/accumulation in the nucleus and transcriptional activation of antioxidant response element-mediated NAD(P)H:quinone oxidoreductase-1 gene expression. J Biol Chem 2003;278(45):44675–82. [24] Yu R, Mandlekar S, Weber MJ, Der CJ, Wu J, Tony-Kong AN. Role of mitogenactivated protein kinase pathway in the induction of phase II detoxifying enzymes by chemicals. J Biol Chem 1999;274:27545–52. [25] Wang X, Ye X, Liu R, Chen HL, Bai H, Liang X, et al. Antioxidant activities of oleanolic acid in vitro: Possible role of Nrf2 and MAP kinases. Chem Biol Interact 2010;184:328–37.