MEC1 and MEC2: two new cell lines derived from B-chronic lymphocytic leukaemia in prolymphocytoid transformation

Leukemia Research 23 (1999) 127 – 136

MEC1 and MEC2: two new cell lines derived from B-chronic lymphocytic leukaemia in prolymphocytoid transformation Alessandra Stacchini a, Michela Aragno a, Antonella Vallario a, Alda Alfarano a, Paola Circosta a, Daniela Gottardi a, Alessandra Faldella a, Giovanna Rege-Cambrin a, Ulf Thunberg b, Kenneth Nilsson b, Federico Caligaris-Cappio a,* a

Dipartimento di Scienze Biomediche e Oncologia Umana, Uni6ersita` di Torino, Ospedale Mauriziano Umberto I°, Torino e Istituto per la Ricerca e la Cura del Cancro (IRCC), Candiolo, Italy b Laboratory of Tumor Biology, Department of Pathology, Uni6ersity Hospital, Uppsala, Sweden Received 27 April 1998; accepted 29 August 1998

Abstract We report the establishment and characterization of two cell lines, MEC1 and MEC2, that grew spontaneously on two subsequent occasions from the peripheral blood (PB) of a patient with B-chronic lymphocytic leukemia (B-CLL) in prolymphocytoid transformation. The patient was EBV-seropositive, his leukemic cells were EBNA negative, but the spontaneously grown cell lines are EBNA-2 positive. In liquid culture MEC1 cells grow adherent to the vessel wall and as tiny clumps; MEC2 cells do not adhere and form large clumps. The doubling time of MEC1 is 40h and of MEC2 is 31h. Both cell lines express the same light (k) and heavy chains (m, d) as the fresh parental B-CLL cells at the same high intensity, share the expression of mature B cell markers (CD19,CD20, CD21, CD22), differ in the expression of CD23 and FMC7, are CD11a + , CD18 + , CD44 + , CD49d + , CD54 + and express at high levels both CD80 and CD86. CD5 is negative on MEC1 cells (as on the vast majority of parental cells) and it has been lost by MEC2 cells after several months of culture. The cells have a complex karyotype. The tumour origin of MEC1 and MEC2 has been demonstrated by Southern blot analysis of the IgH loci and by Ig gene DNA sequencing. They use the VH4 Ig family and have not undergone somatic mutations (94.8% homology with germline Ig gene 4-59). Cytofluorographic analysis and RT-PCR reveal that MEC1 and MEC2 overexpress Bc1-2 together with Bax, express large amounts of Bcl-xL and trace amounts of Bcl-xS. © 1999 Elsevier Science Ltd. All rights reserved. Keywords: Apoptosis; B-chronic lymphocytic leukemia; Prolymphocytic leukemia; Bc1-2; cell lines; Epstein-Barr virus

1. Introduction

Abbre6iations: ASO, allele specific oligonucleotide; B-CLL, Bchronic lymphocytic leukemia; B-PLL, B-prolymphocytic leukemia; b2M, b2 microglobulin; BSA, bovine serum albumin; CDR, complementarily determining region; EBV, Epstein Barr virus; FCS, fetal calf serum; FH, Ficoll-Hypaque; FITC, fluorescein-isothiocyanate; G, goat; h, human; IF, immunofluorescence; IMDM, Iscove’s Modified Dulbecco medium; Mab, monoclonal antibody; MC, mononuclear cells; MCL, mantle cell lymphoma; MGG, May-Grunwald Giemsa; PBL, peripheral blood lymphocytes; PBS, phosphate buffered saline; PE, phycoerythrin; R, rabbit; RT-PCR, reverse transcriptase polymerase chain reaction; S, saponin; s, swine; sIg, surface immunoglobulins. * Corresponding author. Tel.: + 39-11-508-0650; fax: +39-11-5682588; e-mail: [email protected].

Cell lines have been invaluable tools for studying the biology of B cell malignancies. B-chronic lymphoid leukemias are a notable exception to this rule. Authentic B-chronic lymphocytic leukemia (B-CLL) tumor cell lines have never been obtained unless infected in vitro or in vivo by Epstein-Barr virus (EBV) [1], with the possible exception of a cell line derived from a rare IgG positive B-CLL patient [2]. EBV-induced B-CLL cell lines are also exceedingly rare. A large number of B-CLL patients are EBV + ; B-CLL cells express the EBV receptor CD21 and are neither defective in the EBV-receptor binding activity nor in the EBV uptake. However, B-CLL cells show a characteristic resistance to immortalization [3] and the experimental infection of

0145-2126/99/$ - see front matter © 1999 Elsevier Science Ltd. All rights reserved. PII: S 0 1 4 5 - 2 1 2 6 ( 9 8 ) 0 0 1 5 4 - 4

128

A. Stacchini et al. / Leukemia Research 23 (1999) 127–136

B-CLL cells with the transforming EBV strain B95-8 has led only exceptionally to the establishment of truly malignant cell lines [4 – 6]. Actually, very few B-CLL cell lines have been described that fulfil the criteria necessary to demonstrate that they originate from the neoplastic B cell clone and not from non-malignant residual normal B lymphocytes. An exceptional B-CLL patient showed a very small (B 0.1%) fraction of leukemic B cells that were EBNA + and allowed the repeated establishment of EBV + truly leukemic cell lines both at the onset and during the progression of the disease [7]. So far, the experimental attempts demonstrate that B-CLL cells are refractory to EBV immortalization, unless they are made susceptible through in vitro activation by cytokines [8]. No spontaneously established cell lines have been reported for B-prolymphocytic leukemia (B-PLL). However, PLL cells are more permissive than CLL to EBV infection and several EBV + PLL cell lines have been documented [1,9–11]. In this paper we report the establishment and characterization of two cell lines that grew spontaneously on two subsequent occasions from the peripheral blood (PB) of a patient with a B-CLL in prolymphocytoid transformation.

2. Patient The patient was a 58-year-old caucasian male whose diagnosis of B-CLL stage II [12] was established in March 1990 according to the morphology, that included numerous smudge cells, and the phenotype, that included the coexpression of CD5 by\ 90% monoclonal B cells and the negativity of FMC7. The patient’s cell phenotype differed from the classical B-CLL phenotype because of the strong intensity of surface immunoglobulins (sIg) and the absence of CD23. Patient’s cells were reanalysed in the following years and revealed a number of changes. In 1992 the cells became FMC7 + and were in the vast majority also CD25 + . In 1993 CD5 was undetectable on the surface of \ 80% of the strongly sIg + , FMC7 + cells which were CD25 − and CD23 − . The morphology was consistent with a prolymphocytoid transformation in 50% of circulating cells. The t(11;14) translocation as well as the rearrangement of Bcl-1 which causes the overexpression of the PRAD-1/Cyclin D1 protein and are a distinctive feature of mantle cell lymphoma (MCL) were consistently absent. Taking into account the patient’s clinical presentation and course and the morphology, phenotype and molecular features of malignant cells, the diagnosis of B-CLL in prolymphocytoid transformation was made [13]. Over time the disease progressed and became characterized by constitutional symptoms, enlarging lymph nodes and a prominent splenomegaly which relentlessly increased in size.

In December 1993 the first cell line (MEC1) was spontaneously grown from peripheral blood lymphocytes (PBL): the white cell count was 39× 103/ml and the sample was drawn before starting treatment with fludarabine and prednisone. In November 1994, the second cell line (MEC2) was again spontaneously grown from PBL; the white cell count was 131 × 103/ml and the sample was drawn before starting treatment.

Table 1 Monoclonal (M) Abs used to characterize MEC1 and MEC2 cell linesa CD No.

Catalogue No.

B-cell associated: HLA-DR-PE 7367 CD5-FITC D10-PE CDl9-PE CD20-FITC CD21-FITC CD22-FITC CD23-PE CD25-PE CD38-PE CD40 FMC7-FITC

7303 R848 9209 7673 F7016 347573 7797 R0811 347687 635BD MCA792F

Manufacturer

Becton Dickinson (BD), Mountain View, CA BD Dako, Glostrup, Denmark BD BD Dako BD BD Dako BD Labometrix, Milano, Italy Serotec, Oxford, UK

T-cell associated: CD2-FITC 347593 CD3-FITC 920001 CD4-FITC 340133 CD7-FITC 347483 CD8-PE 340046

BD BD BD BD BD

Myeloid associated: CD13-PE 347837 CD14-PE 347497 CD15-FITC F830 CD33-PE 347787 CD34-FITC 348053

BD BD Dako BD BD

Adhesion molecules: CD11a M782 CD11b-PE 347557 CD11c-PE 347637 CD18 M783 CD28-PE 348047 CD44 550007 CD49c MCA698 CD49d 550019 CD54 M7063 CD56-PE 347447 CD57-FITC 347393

Dako BD BD Dako BD BD Serotec BD Dako BD BD

Miscellaneous: CD30-FITC CD45-FITC CD80-FITC CD86-PE CD95-FITC

Dako BD Pharmingen, San Diego, CA Pharmingen Immunotech, Marseille, France

a

F0849 347463 35514x 33435x 1506

PE, phycoerythrin; FITC, fluorescein isothiocyanate.

A. Stacchini et al. / Leukemia Research 23 (1999) 127–136

The patient died from progressive refractory disease in January 1995.

3. Material and methods

3.1. Cell cultures and establishment of cell lines Mononuclear cells (MC), obtained from patient’s peripheral blood (PB) by Ficoll-Hypaque (FH) centrifugation, were washed twice in RPMI-1640 medium and seeded in Iscove’s Modified Dulbecco medium (IMDM, Gibco, NY, USA) supplemented with 10% heat-inactivated fetal calf serum (FCS) at a concentration of 2× 106/ml in 25-cm2 culture flasks (Costar, The Netherlands) at 37°C in a humidified atmosphere containing 5% CO2. After 4 weeks of culture, persistent proliferation was observed. Cells grew in suspension, forming small and large clumps with round shape. The morphology of growing cells was evaluated on cytocentrifuge smears stained with May-Grunwald Giemsa (MGG).

3.2. Tumour origin To demonstrate that the in vitro growing cells were indeed derived from neoplastic B lymphocytes Ig gene rearrangement studies were initially performed. High molecular weight DNA was extracted from 20× 106 cells, digested with HindIII and EcoRI restriction endonucleases, size fractionated through 0.8% agarose gel electrophoresis and hybridized, following Southern blot, to nicktranslated [32P] DNA probes. The next step was to sequence the Ig genes from both patient’s fresh cells and the MEC1 and MEC2 cell lines. VH gene analysis was performed using total RNA (2 mg) isolated with RNA Fast (Promega, WI, USA) and retro-transcribed with AMV-RT-ReverseTranscriptase (Promega). cDNA was amplified by polymerase chain reaction (PCR) using a mixture of 5% oligonucleotide primers specific for each of the VH sequences of VH1-6 families (VHI: CCTCAGTGAAGGTCTCCTGCAAG; VH2: TCCTGCGCTGGTGAAAGCCACAC; VH3: GGTCCCTGAGACTCTCCTGTGCA; VH4a: TCGGAGACCCTGTCCCTCACCTGC; VH5: GAAAAAGCCCGGGGAGTCTCTGAA; VH6: CCTGTGCCATCTCCGGGGACAGTG) together with 3% primer specific for the constant region JH (ACCTGAGGAGACGGTGACCAGGGT) [14]. Amplification started with an initial denaturation step at 95° for 1 min, followed by 30 cycles at 90° for 1 min, 62° for 1 min and 72° for 1 min (1 U Taq Perkin-Elmer, NJ, USA) Amplification products were purified with Centricon 100 (Amicon, MA, USA), blunt ligated into the pMOSBlue T vector (pMOSBlue T-vector kit RPN1719 Amer-

129

sham, Cleveland, USA) and transformed into MOSBlue Competent Cells. Transformed cells were selected in culture medium containing ampicillin. Recombinant plasmids were purified from transformed bacteria and selected by restriction analysis with EcoRI and SalI (Boehringer Mannheim, Germany) and electrophoresis on agarose gel. The sequencing was performed according to the dideoxy chain termination method with the ‘Taq Track’ kit (Promega), using as reverse primer the Reverse Sequencing Primer M13/pUC (Boehringer Manneheim). All inserts were sequenced in two directions and from independent clones. Domain complementarily determining region (CDR) three analysis was performed on DNA obtained from patient’s PBMC taken out in two different dates (1992, 1994), from MECland MEC2 cell lines. DNA (250 ng), extracted with ProteinaseE/RNase treatment and phenol–chloroform, was amplified with 5% primer for the constant region FR3 (ACACGGCGGTGTATTACTG) and 3% primer for the constant region JH. A nested PCR with the 3% primer VLJH (GTGACCAGGGTAcUTrGGCCCCAG) was then performed on 1 ml of the amplification product. PCR conditions were: for the first amplification 96° for 2 min followed by 20 cycles at 94° for 45 s, 54° for 45 s and 72° for 45 s; for the second amplification 96° for 2 min followed by 30 cycles at 94° for 30 s, 68° for 30 s and 72° for 30 s (1 U Taq Perkin-Elmer). PCR products were directly sequenced using Sequenase 2.0 Version (Amersham) with VLJH primer.

3.3. Chromosome analysis MEC1 and MEC2 cells were investigated after 1 year of continuous growth in vitro using standard cytogenetic procedures. Chromosomes were G-banded using a modification of Seabright’s technique [15].

3.4. Detection of EBNA-2 EBNA-2 genes were amplified from 200 ng DNA using oligonucleotide primers specific for the EBNA-2 gene [16]. The amplification was carried out in a 30 ml volume containing 100 mM Tris–HCl pH 8.3, enzyme diluent with 0.5 mg/ml BSA, 1.5 mM MgC12, 200 mM each of dATP, dCTP, dGTP and dTTP, 0.5 mM of E5 primer, 0.5 mM of E3 primer, 0.2 U of Taq polymerase (Perkin Elmer-Cetus, CT, USA), 0.55 mg TaqStart Antibody (CLONTECH Laboratories, Palo Alto, CA, USA). The mixtures were subjected to 30 cycles of denaturation (94°C for 30 s), annealing (58°C for 60 s), and extension (72°C for 2 min) were performed. The amplification was ended within 10 min at 72°C. The positive control was the EBV-positive B-CLL cell line I83E95.

A. Stacchini et al. / Leukemia Research 23 (1999) 127–136

130

Table 2 Major phenotypic features of the cells studied MEC1 (%) k l sIgM sIgD HLADR

95* 0 99* 97* 99

MEC2 (%) 95* 0 94* 99* 97

Patient’s cells (&) 73 0 91 92 58

CD5 CD10 CD19 CD20 CD21 CD22 CD23 CD25 CD30 CD38 CD40 CD45 CD95 FMC7

B1 B1 99 96 58 76 89 9 83 90 99 99 90 8

B1 B1 99 96 59 67 36 3 30 99 98 92 63 72

4.5 B1 66 n.t. n.t. n.t. 11.5

CD11a CD11b CD11c CD18 CD28 CD29 CD44 CD49c CD49d CD54 CD56 CD80 CD86

97 5 13 91 B1 48 97 B1 99 98 3 98 98

99 2 11 99 36 96 87 B1 99 98 B1 91 96

27 30 27 52 4 n.t. 96 13 76 3 2 5.5 50

11.5 n.t. n.t. n.t. n.t. 81

* Strong expression; n.t., not tested.

3.5. Phenotype Cells were washed twice and resuspended in phosphate buffered saline (PBS) containing 1% bovine serum albumin (BSA) and 0.02% sodium azide (staining medium) at the concentration of 10× 106/ml. An appropriate amount of fluorochrome-labelled antibody (Ab), at optimal concentration, was added to 100 ml cell suspension. Negative controls were incubated with isotype irrelevant Abs. After 30 min incubation at 4°C, cells were washed twice with 2 ml of staining medium and resuspended for flow cytometric analysis. The phenotype of the cells studied was defined by different combinations of Abs in direct or indirect immunofluorescence (IF). Goat (G) antisera to human (h) IgM, IgD, k and l chains, directly conjugated with fluorescein-isothiocyanate (FITC, Tago, Burlingame, CA, cat. no. 4202, 4205, 4206, 4208), were used. The monoclonal (M) Abs used are listed in Table 1. Most MAbs were directly conjugated. For non-conjugated Abs, a goat anti-mouse F(ab%)2-FITC (Technogenetics,

Trezzano sul Naviglio, Italy) was used as a second step reagent.

3.5.1. Permeabilization and cytoplasmic staining For the detection of cytoplasmic Bc1-2, Bax and Bak proteins, cells were fixed and permeabilized. Briefly, the cell pellet containing 106 cells, was resuspended in 400 ml of 2% paraformaldehyde (Sigma Chemical Co, St. Louis, MO, USA) and placed in ice for 10 min. A 1.0% solution of saponin in PBS (50 ml) (Sigma) was added to the cells which were vortexed and placed in ice for another 5 min. Fixed cells were washed once in PBS containing 0.1% saponin (PBS-S), resuspended in PBSS and preincubated for 10 min with 10% heat inactivated human AB serum to prevent non-specific binding to Fc receptors. The direct staining for Bc1-2 was performed by incubating permeabilized cells with 10 ml of anti-Bcl-2 MAb FITC (Dakopatts, cat. no. F053) or anti-IgG1 (isotypic control, Dako cat. N. X0927) for 30 min at 4°C. For indirect Bax and Bak staining the permeabilized cells were first incubated with 20 ml of prediluted (1:10) anti-Bak polyclonal rabbit (R) Ab (SantaCruz Biotechnology, Santa Cruz, CA, cat. no. sc526) or 5 ml of prediluted (1:20) anti-Bak polyclonal R Ab (SantaCruz Biotechnology, cat. no. sc832) for 30 min at 4°C, followed by washing and further incubation with swine anti-R-Ig-FITC (saR-Ig-FITC, Dako, cat no. F205, 1:100 dilution) for 30 min at 4°C. Negative controls were performed by incubating cells with normal R serum. All Abs were used at pretitrated near saturating amounts. 3.5.2. Flow cytometric analysis All samples were analysed using a FACScan Research cytometer (Becton-Dickinson) equipped with a 488 nm argon ion laser (BDIS). Data acquisition was performed using the FACScan Research Software (BDIS). Forward light scattering, orthogonal light scattering, and two fluorescence signals were determined for each cell and stored in listmode data files. Each measurement contained at least 5000 cells. In all samples a gate was used on both light scattering parameters to obtain more events of lymphocyte populations. 3.6. Re6erse transcriptase-polymerase chain reaction (RT-PCR) analysis Total cellular RNA (2 mg) has been reverse-transcribed using 15 U of AMV-RT (Promega) and 1 mg of (oligo)dT as primer for 30 min at 42°C. The PCR was performed in a 100 ml reaction mixture containing 10 ml of the obtained cDNA fragments, 50 pmol of each Bax mRNA sequence-specific synthetic primers, 200 mmol of each deoxynucleotide triphosphate and 1 U of Thermus aquaticus (Taq) polymerase (AmpliTaq-DNA polymerase, Perkin Elmer).

A. Stacchini et al. / Leukemia Research 23 (1999) 127–136

Bax amplification was performed for 35 cycles (2 min denaturing at 94°C, 90 s annealing at 65°C and 90 s extension at 72°C) in DNA thermal cycler (Perkin Elmer Cetus), and the amplification product specificity was confirmed by hybridization with an allele specific oligonucleotide (ASO). As a control the b2 microglobulin (b2M) amplification was performed under the same conditions for 35 cycles. Bcl-x amplification was performed for 40 cycles (1 min denaturing at 94°C, 1 min annealing at 58°C and 1 min extension at 72°C) in DNA thermal cycler. The sequences of Bax specific primers were: 5%-TITATGGACGGGTCCGGGGA-; 3%TGTCCAGCCCATGATGGTTCT- [17]. The sequences of b2M specific primers were: 5%-CTCGCGCTACTCTCTCTTTCTGG-; 3%-GCTTACATGTCTCGATCCCACTTAA-. The sequences of Bcl-x specific primers were: 5’-TTGGACAATGGACTGGTTGA-; 3%GTAGAGTGGATGGTCAGTG- [18]. These two primers identify both forms of Bcl-x, the short (S) and the long (L) one. As positive controls for the two forms of Bcl-x we used the amplification product obtained from two different plasmids carrying the two cDNA, respectively Bcl-xL and Bcl-xS (kind gift of Dr C.B. Thompson, Chicago, IL). Amplified products were analysed by 1.5% agarose electrophoresis gel and visualized under UV rays after ethidium bromide staining.

4. Results

4.1. MEC1 and MEC2 general features MEC1 has been continuously grown for more than 50

131

Fig. 1. PCR detection of EBNA-genes. Lane 1, patient’s cells frozen in 1992; lane 2, patient’s cells frozen in 1994; lane 3, MEC1 cells; lane 4, MEC2 cells; lane 5, positive control (EBV-positive B-CLL cell line I83E95); lane 6, negative control (water); M, size marker yxHaeIII digest.

months and MEC2 for more than 40 months. Mycoplasma infection has been regularly checked and ruled out. For both cell lines the phenotypic characteristics have been repeatedly determined by flow cytometry and proved to be consistent. The data reported in Table 2 are representative of tests performed at monthly intervals. As shown in Fig. 1, EBNA-2 genes were present in both MEC1 and MEC2 DNA samples, while they were undetectable in DNA samples obtained in two subesequent occasions (1992 and 1994) from patient’s fresh PBL. The growth pattern of MEC1 and MEC2 in liquid culture differs markedly. MEC1 cells grow adherent to the vessel wall and give rise only to very tiny clumps,

Fig. 2. MGG staining of cytocentrifuge smears of MEC1 and MEC2 cells.

132

A. Stacchini et al. / Leukemia Research 23 (1999) 127–136

Fig. 3. Ig gene DNA sequencing demonstrated that the amplification products expressed the VH4 family rearrangement; the nucleotide sequence of the VH4 segment (B-CLL) resulted to share 94.8% identity with the human Ig gene 4-59 (a). Both for 4-59 and for B-CLL the first line corresponds to the nucleotide sequence and the second line to the encoded aminoacids (AA): nucleotide mutations and the changed AA are in bold characters. CDR3 from the complete sequence was compared to the CDR3 obtained from FR3-JH amplification from each sample: all sequences were identical (b).

A. Stacchini et al. / Leukemia Research 23 (1999) 127–136

while MEC2 cells do not adhere to the plastic wall but form very large clumps. Cytospins stained with MGG show large cells with plasmacytoid appearance, a basophilic cytoplasm and one or two prominent nucleoli (Fig. 2). The doubling time of MEC1 is 40 h and of MEC2 31 h. The phenotypic analysis (Table 2) reveals that both cell lines have the same light (k) and heavy chains (m, d) expressed by fresh parental cells and with the same strong intensity. MEC1 and MEC2 share the expression of mature B cell markers (CD19, CD20, CD21, CD22), but differ in the expression of CD23 and FMC7. MEC1 has a higher percentage of CD23 + cells as compared to MEC2 (89 vs 36%) and is FMC7 − ( B10%), while MEC2 is FMC7 + ( \ 70%). CD5 has always been negative on MEC1 cells, and it has been lost by MEC2 elements after having been expressed on the surface of a proportion (30%) of cells for a number of months. All the myeloid markers and the T cell markers tested are negative on both lines. As for the adhesion molecules, both cell lines are CD11a + , CD18 + , CD44 + , CD49d + , CD54 + and express at high levels both CD80 and CD86, while patient’s fresh cells were CD80 and CD86 negative (Table 2). CD28 is expressed on a proportion of MEC2 cells (35%), while it is negative on the surface of MEC1 cells.

4.2. Demonstration of tumour origin of MEC1 and MEC2 cells The tumour origin of MEC1 and MEC2 is demonstrated on the bases of Southern blot analysis and Ig gene DNA sequencing. Southern blot analysis revealed that both the patient’s malignant cells and the corresponding MEC1 and MEC2 cell lines share identical patterns of DNA rearrangement at the IgH loci (data not shown). Ig gene DNA sequencing demonstrated that the amplification products expressed the VH4 family rearrangement. The nucleotide sequence of the VH4 segment was determined and compared with the corresponding germline sequence using the GCG software package and the GenBank/EMBL/DDBJ database to determine the homology with its closest germline counterpart. Our sequence resulted to share 94.8% identity with the human Ig gene 4-59 (also known as 58P2 or DP71) [14] (Fig. 3a). Protein and nucleotide sequence domain were determined and CDR 3 was identified [19]. CDR3 from Table 3 Chromosome analysis of MEC1 and MEC2 cell lines MEC1 46, XY, t(1; 6) (q23; p23), −2, der(7), −10, +der(10), t(2; ?; 10) (q23; ?; q22.1), del(12) (p12p13) (q13q15), del(17) (p11.2pter), +mar1 MEC2 46, XY, inv(12) (p13.1q13.3), del(17) (p11.2pter)

133

the complete sequence was then compared to the CDR3 obtained from FR3-JH amplification from each sample. All sequences were identical (Fig. 3b).

4.3. Cytogenetics The karyotype of both MEC1 and MEC2 was abnormal with cell to cell variations. Numerous cytogenetic abnormalities were detected (Table 3). Both cells lines had a deletion of the short arm of chromosome 17 and an abnormality of chromosome 12, which was structurally different but involved the same breakpoints 12p13 and 12q13. Cytogenetic studies of parental cells were largely unsuccessful, thus preventing a proper comparison.

4.4. Apoptosis-related gene expression by MEC1 and MEC2 High levels of Bc1-2 protein were detected by cytofluorograph analysis with a specific Ab (Fig. 4). The mean fluorescence intensity (MFI) of Bc1-2, expressed in terms of molecules of soluble fluorochrome equivalent (MESF), proved to be 189 114911 713 for MEC1 and 178 283931688 for MEC2. Patient’s cell MESF was 35 671 95724 and the MESF of eight different normal control PBMC was 32 184 9 6203. The high levels of Bc1-2 remained stable both during the rapid cell expansion and in the plateau phase of culture, indicating that the relationship between Bc1-2 expression and the cell cycle [20] was lost in MEC1 and MEC2 cell lines. Strong Bax expression was detected by RT-PCR, and the presence of Bax protein was confirmed by cytofluorograph analysis (Fig. 4). MESF was 96 6499 21 856 for MEC1, 108 611 9 33 259 for MEC2 and 33 560 9 11 250 on thawed patient’s cells. MESF of 8 different normal control PBMC was 18 0709 3280. The cytofluorographic analysis of BAK protein (Fig. 4) revealed that MESF was 13 2219 1314 for MEC1 and 11 20191836 for MEC2. BAK MESF was not tested on patients cells and was 3388 9 417 in eight different normal control PBMC. RT-PCR revealed high levels of Bcl-xL and low amounts of Bcl-xS.

5. Discussion This paper reports the establishment and characterization of two new cell lines, MEC1 and MEC2, which have been obtained from the same patient, a BCLL in prolymphocytoid transformation, in two subsequent occasions. The patient was EBV-seropositive, his leukemic cells were EBNA − , but the spontaneously established cell lines proved to be EBNA-2 + . Two

134

A. Stacchini et al. / Leukemia Research 23 (1999) 127–136

Fig. 4. Fluorescence intensity profiles of Bc1-2, Bax and Bak protein on MEC1 and MEC2 cell lines ( – – ) negative controls.

possibilities may reasonably account for this discrepancy between the parental cells and the derived cell lines. A minimal fraction of patient’s malignant cells were already EBV + as reported [7] and these were the ones which underwent the in vitro immortalization. This possibility appears unlikely as PCR investigation of EBNA-2 genes in fresh cells obtained in two different occasions was consistently negative (Fig. 1). Alternatively, in two distinct occasions, a neoplastic B cell

was transformed in vitro by EBV released from normal EBV infected B cells upon explantation in vitro. The patient clinical situation of prolymphocytoid transformation may have been of importance for the successful EBV immortalization since cytokine-mediated lymphocyte preactivation facilitates EBV immortalization in conventional B-CLL cells [8] and PLL cells are more permissive to EBV infection than CLL cells [1,9– 11].

A. Stacchini et al. / Leukemia Research 23 (1999) 127–136

The phenotypic properties of MEC1 and MEC2 cells may help understanding the type of cell from which they derive. The cells are CD5 − and were obtained from a patient whose malignant cells had become CD5 − during the progression of the disease over several years. Of interest, CD5 is lost by both normal and malignant B-CLL cells upon activation [21]. Also, the only EBV − CLL cell line described, though obtained from a CD5 + fresh sample, was CD5 − [2], and the exceptional B-CLL clone that allowed the repeated establishment of EBV positive truly leukemic cell lines [7] was likewise CD5 − . The cell lines, as well as the original fresh parental cells, have a rather strong expression of sIg and are FMC7 + , as typically observed in PLL cells. MEC1 and MEC2 cells have also an intense membrane expression of CD80 and CD86, the co-stimulatory molecules typically absent on the surface of fresh CLL cells [22]. The CD80, CD86 positivity likely reflects the state of B cell activation induced by EBV transformation [23]. Taken together, these data suggest that the phenotype of parental cells is unusual, though not unique, and that the cell lines derive from an activated CLL cell in prolymphocytoid transformation. The question is whether MEC1 and MEC2 cell lines may provide an adequate in vitro model for the study of some biological events that occur in chronic lymphoid leukemias. To this end, we have analyzed the expression of apoptosis related molecules encoded by the Bc1-2 family of genes. The Bc1-2 protein, that protects cells from apoptosis [6,24], is overexpressed in the vast majority of B-CLL cells [20,25,26] and has been considered an explanation for their progressive accumulation [27,28]. MEC1 and MEC2 cells overexpress Bc1-2 together with Bax and express fairly large amounts of Bcl-xL and low to trace amounts of Bcl-xS. The functional role of Bc1-2, Bcl-xL, Bcl-xS and Bax [17,18,24] indicates that the pattern of Bc1-2 family gene expression in MEC1 and MEC2 cell lines is shifted toward prevention of apoptosis, as reported in both fresh leukemic CD5 + B cells [29] and CLL cell lines [30]. The mechanisms accounting for Bc1-2 overexpression in B-CLL are unknown. Bc1-2 levels in B-CLL do not usually reflect a rearrangement of Bc1-2 gene, which is a rare event in CLL cells [31], but may be dependent upon the Bc1-2 gene hypomethylation that leads to increased transcription [26]. Another possible explanation is that Bc1-2 upregulation may be promoted by activated T cells through the production of cytokines [32]. MEC1 and MEC2 cell lines do not have any translocation that involves the Bc1-2 gene on chromosome 18; also, the absence of T cells rules out the interference of the T cell interrelationships that occur in vivo. Further, it has to be considered that most lymphohemopoietic cell lines express high levels of Bc1-

135

2, irrespective of their lineage derivation and the lack of t(14; 18) translocation [33]. MEC1 and MEC2 cells are EBV + and it has been shown that the EBV-induced membrane protein LMP-1 induces the expression of Bc1-2 [34] thus possibly protecting the infected cells from apoptosis. The possibility that the EBV infection may be responsible for the significant Bc1-2 upregulation in MEC1 and MEC2 cells is even more reasonable, since Bc1-2 high levels are stable irrespective of the proliferative activity, while the inverse relationship between Bc1-2 expression and the cell cycle is retained in EBV − CLL cells [20]. Taking into account all the discussed caveats, the availability of MEC1 and MEC2 B cell lines may offer new opportunities to investigate the biology of Bchronic lymphoid leukaemias. Note: the cell lines will be made available to all investigators upon request.

Acknowledgements This work was supported by A.I.R.C., Milano; PF Biotecnologie, CNR; MURST 40% and by the Swedish Cancer Society. The secretarial assistance of Mrs G. Tessa, Fondazione R. Favretto, and the help of Professor G. Dighiero, Institut Pasteur, Paris are gratefully acknowledged.

References [1] Nilsson K. Human B-lymphoid cell lines. Human Cell 1992;5(1):25. [2] Mohammad RM, Mohamed AN, Hamdan MY, Vo T, Chen B, Katato K, et al. Establishment of a human BCLL xenograft model: utility as a preclinical therapeutic. Leukemia 1996;10:130. [3] Rickinson AB, Finerty S, Epstein MA. Interaction of EpsteinBarr virus with leukaemic B cells in vitro. I. Abortive infection and rare cell line establishment from chronic lymphocytic leukemic cells. Clin Exp Immunol 1982;50:347. [4] Karande A, Fialkow PJ, Nilsson K, Povey S, Klein G, Najfeld V, et al. Establishment of a lymphoid cell line from leukemic cells of a patient with chronic lymphocytic leukemia. Int J Cancer 1980;26:551. [5] Najfeld V, Fialkow PJ, Karande A, Nilsson K, Klein G, Penfold G. Chromosome analyses of lymphoid cell lines derived from patients with chronic lymphocytic leukemia. Int J Cancer 1980;26:543. [6] Crescenzi M, Napolitano M, Carbonari M, Antonelli A, Petrinelli P, Gaetano C, et al. Establishment of a new EpsteinBarr virusimmortalized cell line from chronic lymphocytic leukemia with trisomy of chromosome 12 that produces monoclonal IgM against sheep RBC antigen. Blood 1988;71:9. [7] Lewin N, Avila-Carino J, Minarovits J, Lennette E, Brautbar C, Mellstedt H, et al. Detection of two Epstein-Barr virus (EBV) carrying leukemic cell clones in a patient with chronic lymphocytic. Int J Cancer 1995;61:159. [8] Wendel-Hansen V, Sallstrom J, De Campos-Lima PO, Kjellstrom G, Sandlund A, Siegbahn A, et al. Epstein-Barr virus (EBV) can immortalize B-CLL cells activated by cytokines. Leukemia 1994;8:476.

136

A. Stacchini et al. / Leukemia Research 23 (1999) 127–136

[9] Tatsumi E, Harada S, Bechtold T, Lipscomb H, Davis J, Kuszynski C, et al. In vitro infection of chronic lymphocytic leukemia cells by Epstein-Barr virus (EBV). Leuk Res 1986;10:167. [10] Melo JV, Foroni L, Brito-Babapulle V, Luzzatto L, Catowsky D. The establishment of cell lines from chronic B cell leukaemias: Evidence of leukaemic origin by karyotypic abnormalities and Ig gene rearrangement. Clin Exp Immunol 1988;73:23. [11] Walls EV, Doyle MG, Patel KK, Allday MJ, Catowsky D, Crawford DH. Activation and immortalization of leukaemic B cells by Epstein-Barr virus. Int J Cancer 1989;44:846. [12] Rai KR, Sawitsky A, Cronkite EP, Chanana AD, Levy RN, Pasternack BS. Clinical staging of chronic lymphocytic leukaemia. Blood 1975;46:219. [13] Rozman C, Montserrat E. Chronic lymphocytic leukemia. New Engl J Med 1995;333:1052. [14] Tomlinson IM, Walte G, Marks JD, Llewelyn MB, Winter G. The repertoire of human germline VH sequences reveals groups of VH segments with different hipervariable loops. J Mol Biol 1992;227:776. [15] Seabright M. A rapid banding technique for human chromosomes. Lancet ii;1971:971. [16] Lin JC, Lin SC, De BK, Chan Wc, Evatt BL. Precision of genotyping of Epstain-Barr virus by polymerase chain reaction using three gene loci (EBNA-2, EBNA-3C, and EBER): predominance of type A virus associated with Hodgkin’s disease. Blood 1993;81:3372. [17] Oltvai ZN, Milliman CL, Korsmeyer SJ. Bc1-2 heterodimerizes in vivo with a conserved homolog, Bax, that accelerates programmed cell death. Cell 1993;74:609. [18] Boise LH, Gonzales-Garc a M, Postema CE, Ding L, Lindstein T, Turka LA, et al. Bcl-X, a bc1-2 related gene that functions as a dominant regulator of apoptotic cell death. Cell 1993;74:597. [19] Kabat EA, Wu TT, Perry HM, Gottesmann KS, Foeller C. Sequences of proteins of immunological interest (ed 5). Washington DC, US Department of Health and Human Services, National Institute of Health, 1991. [20] Schena M, Larsson LG, Gottardi D, Gaidano GL, Carlsson M, Nilsson K, et al. Growth and differentiation-associated expression of bc1-2 in B-chronic lymphocytic leukemia cells. Blood 1992;79:2981. [21] Casali P, Notkins AL. Probing the human B-cell repertoire with EBV: polyreactive antibodies and CD5 + B lymphocytes. A Revi Immunol 1989;7:513.

.

[22] Dazzi F, D’Andrea E, Biasi G, De Silvestro G, Gaidano G, Schena M, et al. Failure of B cells of chronic lymphocytic leukemia in presenting soluble and alloantigens. Clin Immunol Immunopathol 1995;75:26. [23] Freedman AS, Freeman G, Horowitz JC, Daley J, Nadler LM. B7, a B-cell-restricted antigen that identifies preaactivated B cells. J Immunol 1987;139:3260. [24] Yang E, Korsmeyer SJ. Molecular thanatopsis: a discourse on the Bc12 family and cell death. Blood 1996;88:386. [25] Pezzella F, Tse AGD, Cordell JL, Pulford KAF, Gatter KC, Mason DY. Expression of the bc1-2 oncogene protein is not specific for the 14;18 chromosomal translocation. Am J Pathol 1990;137:225. [26] Hanada M, Delia D, Aiello A, Stadtmauer E, Reed JC. Bc1-2 gene hypomethylation and high-level expression in B-cell chronic lymphocytic leukemia. Blood 1993;82:1820. [27] Caligaris-Cappio F, Ghia P, Gottardi D, Parvis G, Gregoretti MG, Nilsson K, et al. The role of BCL-2 in the natural history of B-chronic lymphocyticleukemia. Current Topics Microbiol 1992;182:279. [28] Robertson LE, Plunkett W, McConnell K, Keating MJ, McDonnell TJ. Bc1-2 expression in chronic lymphocytic leukemia and its correlation with the induction of apoptosis and clinical outcome. Leukemia 1996;10:456. [29] Gottardi D, Alfarano A, De Leo AM, Stacchini A, Aragno M, Rigo A, et al. In leukemic CD5 + B cells the expression of BCL-2 gene family is shifted toward protection from apoptosis. Br J Haematol 1996;94:612. [30] Konig A, Menzel T, Lynen S, Wrazel L, Rosen A, Al-Katib A, et al. basic fibroblast growth factor (bFGF) upregulates the expression of bc1-2 in B cell chronic lymphocytic leukemia cell liens resulting in delaying apoptosis. Leukemia 1997;11:258. [31] Dyer MJS, Zani VJ, Lu WZ, O’Byrne A, Mould S, Chapman R, et al. BCL2 translocations in leukemias of mature B cells. Blood 1994;83:3682. [32] Mainou-Fowler T, Prentice AG. Modulation of apoptosis by cytokines in B-cell chronic Iymphocytic leukemia. Leuk Lymphoma 1996;21:369. [33] Steube KG, Jadau A, Teepe D, Drexler HG. Expressione of bc1-2 mRNA and protein in leukemia-lymphoma cell lines. Leukemia 1995;9:1841. [34] Henderson S, Rowe M, Gregory C, Croom-Carter D, Wang F, Longnecker R, Kieff E, Rickinson A. Induction of bc1-2 expression by Epstein-Barr virus latent membrane protein 1 protects infected B cells from programmed cell death. Cell 1991;65:1107.