Mesh incisional herniorrhaphy increases abdominal wall elastic properties: A mechanism for decreased hernia recurrences in comparison with suture repair

Mesh incisional herniorrhaphy increases abdominal wall elastic properties: A mechanism for decreased hernia recurrences in comparison with suture repair Derek A. DuBay, MD,a Xue Wang, MD, PhD,a Belinda Adamson, MSc,a William M. Kuzon, Jr, MD, PhD,b Robert G. Dennis, PhD,b,c and Michael G. Franz, MD,a Ann Arbor, Mich

Background. An improved understanding of load-bearing soft tissue repair suggests that the mechanism for the improved outcomes after alloplastic incisional herniorrhaphy involves more than simple tissue replacement or material strength. We test the hypothesis that postrepair abdominal wall elastic properties are most predictive of successful abdominal wall reconstruction. Methods. A rodent model of chronic incisional hernia formation was used. Midline incisional hernias were repaired primarily with suture (n ⫽ 24) or polypropylene mesh (n ⫽ 24). Rodents were sacrificed at serial postoperative time points over 60 days. Intact abdominal wall strips were cut perpendicular to the wound for tensiometric analysis. Biopsies of wound provisional matrix were obtained for biochemical analysis. Results. Recurrent incisional hernia formation was significantly decreased in the mesh-repair group, compared with the suture-repair group (5/24 vs 14/24, P ⫽ .02). Mesh-repaired abdominal walls demonstrated significantly more elongation (P ⬍ .01) and less stiffness (P ⬍ .01). Toughness was equal between wounds, although the suture-repaired wounds had increased recovery of tensile strength (P ⬍ .01). There were no significant differences in collagen deposition after postoperative day 7. Conclusions. Mesh incisional herniorrhaphy increases abdominal wall elastic properties as measured by increased elongation and reduced stiffness. Increased abdominal wall elasticity after incisional hernia repair in turn results in lower recurrence rates. (Surgery 2006;140:14-24.) From the Department of Surgery, Division of General Surgery,a the Division of Plastic and Reconstructive Surgery,b and the Departments of Biomedical and Mechanical Engineering,c University of Michigan Medical Center, Tissue Repair and Regeneration Laboratory, VA Ann Arbor Health Care System

Incisional hernia formation is among the most common complications after abdominal surgery, effecting 11% of all midline abdominal wall closures.1-3 Approximately 200,000 incisional hernia repairs are performed each year in the United

Supported by a Department of Veterans Affairs Merit Review Grant (M.G.F.) Accepted for publication January 20, 2006. Reprint requests: Michael G. Franz, MD, University of Michigan Health System, Division of Gastrointestinal Surgery, 1500 E Medical Center Dr, 2922 H. Taubman Center, Ann Arbor, MI 48109-0331. E-mail: [email protected]. 0039-6060/$ - see front matter © 2006 Mosby, Inc. All rights reserved. doi:10.1016/j.surg.2006.01.007

14 SURGERY

States,4 making incisional hernia formation the most common indication for reoperation after laparotomy. A recent retrospective review of bowel resections from the Cleveland Clinic5 confirmed that incisional hernia formation is the most common major complication after laparotomy, by a 2:1 margin over bowel obstruction, and is the most common indication for reoperation after laparotomy by a 3:1 margin over adhesive small-bowel obstruction. Multiple controlled clinical studies document an unacceptably high recurrence rate after primary suture (fascia to fascia) incisional hernia repair. Modern series report a 45%,6 54%,7 53%,8 54%,9 and 46%10 incidence of recurrent incisional hernia formation after standard suture repair, prompting the development and utilization of alloplastic and

Surgery Volume 140, Number 1

biologic prostheses. This action was based on a presumption that some sort of soft tissue implant would improve outcomes. To date, no prospective, design element– based engineering has been applied to deal with the problem of recurrent hernias or to justify the increased application of implant material. The only prospective randomized study that directly compared suture and polypropylene mesh incisional herniorrhaphy reported a 43% recurrence after suture repair, compared with a 23% recurrence rate after alloplastic repair.10 A separate population-based study performed in the United States also reported that 23% of all patients undergoing an incisional hernia repair will undergo at least 1 further repair.11 Many studies now conclude that the major risk factor for failed incisional herniorrhaphy is a repair without the use of an abdominal wall prosthesis.3,8,11 The clinical use of prostheses for incisional hernia repair has increased dramatically from 35% in 1987 to 66% in 1999.11 Despite the widespread application of abdominal wall prostheses among general surgeons, little is known regarding the mechanism of improved clinical outcome with mesh herniorrhaphy. The decreased recurrence rate with mesh is traditionally attributed to “tension free repair” or soft tissue replacement. A more detailed mechanism for the behavior of meshes implanted into the abdominal wall is not available. The landmark study by Luijendijik et al10 found that the area of the incisional hernia defect was not an independent predictor of wound failure and recurrence after suture or alloplastic repairs. It was assumed that larger hernia defects are repaired under a greater load. These results suggested that controlling the mechanical load forces alone placed across the wound do not provide the mechanism for improved hernia repair outcomes using a prosthesis. Instead, there appears to be a more complex change in the phenotype of herniated abdominal wall wounds that effects the success of any type of repair attempted.12 The aim of the current study was to determine which biomechanical parameter is most important in preventing recurrent incisional hernias. The model used accurately mimics the biology and mechanics of human incisional hernias.13 We tested the hypothesis that a prosthetic implant increases abdominal wall elastic properties resulting in less myofascial wound failure and a lower incisional hernia recurrence rate. MATERIAL AND METHODS Animal model. Adult, male Sprague-Dawley rats (Harlan Sprague-Dawley Inc, Indianapolis, Ind)

DuBay et al 15

weighing 250 to 300 g were acclimated and housed under standard conditions. Animals were allowed ad libitum intake of standard rat chow and water throughout the study. All animal care and operative procedures were performed in accordance with the United States Public Health Service Guide for the Care of Laboratory Animals (National Institutes of Health Publication Number 85-23, 1985) and were performed with the prior approval of the Ann Arbor Veterans Affairs Medical Center Institutional Animal Care and Use Committee. A modification of a rat abdominal wall dehiscence model14 was used to generate large chronic incisional hernias.13 After anesthetizing the rats with ketamine 90 mg/kg and xylazine 10 mg/kg intraperitoneally, the ventral abdominal wall hair was shaved with electric clippers, and the field was prepped with 70% alcohol. A 6 cm ⫻ 3 cm, rectangular, fullthickness skin flap based 2 cm lateral to the ventral midline was then raised through the avascular prefascial plane, thereby separating the skin incision from the underlying fascial wound-healing environment. A 5-cm full-thickness laparotomy incision was then made through the fascia of the midline linea alba. The fascial incision was closed with 2 interrupted 5-0 plain catgut sutures placed 3 mm from the cut fascial edges and 1.25 cm from either end of the laparotomy incision. The skin flap was then replaced and closed with a running 4-0 Vicryl suture to prevent intestinal evisceration. After 30 minutes of recovery under heat lamps, the rats were returned to fresh individual cages. The rats developed midline abdominal wall hernias. All rodents had large bulging ventral defects by postoperative (POD) 7 (Fig 1, A and B). The fascial defects were allowed to mature for 28 days until they expressed the dormant wound biology that characterizes ventral hernias.13 The rats were then anesthetized as described above and the hernia defects repaired. The same rectangular skin flap was re-elevated through the avascular prefascial plane laterally, and between the skin and intimately apposed hernia sac in the midline. The hernia sac was incised and the fascial defect defined by identifying the hyperplastic ridge of the fascial wound edge (ie, hernia ring). Half of the incisional hernia defects were then suture repaired by re-apposing the fascial edges with interrupted 5-0 Prolene sutures placed 4 to 5 mm from the cut edges and spaced 1 cm apart (Fig 2, A). In the remaining rats, the incisional hernia defects were repaired with the use of a standard underlay technique with PROLITE polypropylene mesh (Atrium Medical Corporation, Norwalk, Conn). The underlay technique and polypropylene mesh were utilized, because

16 DuBay et al

Surgery July 2006

Fig 1. A, Example of the large, midline bulging ventral abdominal wall hernia defect that develops with this rodent model of chronic incisional hernia. B, View of the peritoneal surface of the explanted anterior abdominal wall. Note the well-defined incisional hernia ring, laterally displaced recti muscles, and hernia sac.

they are the most common herniorrhaphy technique and prosthesis utilized clinically. The mesh was fashioned to the shape of the fascial defect allowing for a 4- to 5-mm underlay. The mesh was sutured to the fascia via a standard underlay technique with the use of transfascial 5-0 Prolene sutures spaced 1 cm apart (Fig 2, B). The skin flap was then replaced and sutured close with a running 4-0 Vicryl suture. Rodents were killed at serial time points after hernia repair with an overdose of Nembutal (100 mg/kg intraperitoneally). Six animals were selected randomly from both the suture-repair and the mesh-repair groups and sacrificed on postoperative days 7, 14, 28, and 60. The entire ventral abdominal wall was excised and the skin separated from the musculofascial layer. The wound-healing interface was examined closely for evidence of recurrent incisional hernia formation, defined as a

Fig 2. Photograph demonstrating (A) suture and (B) mesh herniorrhaphy 28 days after initial incisional hernia modeling procedure. Note the excessive abdominal wall tension present in the suture repair. Mesh repairs were performed with the use of a standard underlay technique.

fascial defect greater than 2 mm. Fascial sutures were then removed. Myofascial strips were harvested only from rodents without recurrent incisional hernias. Two fascial strips in the shape of the

Surgery Volume 140, Number 1

uppercase letter “I” were taken perpendicular to the wound-healing interface from each abdominal wall. A cutting template was used to mark the abdominal wall to minimize size variability between specimens. The abdominal wall strips were labeled and stored in phosphate-buffered saline until tensiometric mechanical analysis was performed. Biopsies were taken of the fascia-fascia or mesh-fascia interface and immediately snap-frozen in liquid nitrogen for biochemical analysis. Tensiometric analysis. Mechanical testing of the abdominal wall fascial strips was performed within 6 hours of necropsy. The sample width and thickness were measured with Digimatic calipers (Mitutoyo American Corp, Chicago, Ill). The samples were each loaded in tension to failure, during which time the force-extension data were collected. Force-extension curves were generated with the use of an Instron Tensiometer (model 5542; Instron Corp, Canton, Mass) equipped with a 50 Newton static load cell set at a crosshead speed of 10 mm per minute. Samples were mounted into the load frame with the use of pneumatic graspers, preloaded to 0.1 Newtons, and the gauge length was measured between the grips. The load frame applied tensile loads perpendicular to the suturerepaired and mesh-repaired hernia wounds until mechanical tissue disruption occurred. The anatomic location of the break was noted for each specimen. Force and tissue deformation data were recorded simultaneously and captured on a computer connected to the load frame via a digital interface card. Data analysis was performed with the use of the Merlin materials testing software package (Instron Corp). Data from the stretch loading was used to determine the following clinically important biomechanical properties15: breaking strength—the maximum load (Fmax) at mechanical failure (Newtons); tensile strength—the maximum stress developed in the specimen per unit area, calculated as Fmax/cross-sectional area (N/mm2); toughness—the energy absorbed by the specimen under tension, calculated as the entire area under the force-extension curve from the origin to mechanical rupture (Joules); elongation—the increase in length of the tissue under a load, defined as the length of the specimen at mechanical disruption minus the original length (mm); stiffness—the slope of the linear elastic region of the force-extension curve (N/mm). Biochemical analysis. A standard semiquantitative reverse transcriptase-polymerase chain reaction was performed for collagen I and III messenger RNA levels as described previously.16 Band intensity was imaged digitally and normalized to glyceraldehyde-

DuBay et al 17

3-phosphate dehydrogenase (GAPDH) expression. Primers were designed from conserved sequences published in GENEBANK and produced by Sigma (St Louis, Mo). Collagen I primer: 5= CTGGGAACTTTGCTGCTC, 3= GCCAACACTGCCATCACT. Collagen III primer: 5=GGCTCCTGGTGAGCGAGGAC, 3= CCCATTTGCACCAGGTTCTCC. Collagen assay. Tissue collagen levels were measured with the use of the Sircol collagen assay method (Accurate Chemical and Scientific Corp, Westbury, New York, NY). Biopsies of the woundhealing interface were weighed and mechanically dissolved with a tissue homogenizer and sonicator in 1000 ␮L of Complete protease inhibitor cocktail (Roche Applied Science, Indianapolis, Ind). After centrifugation at 18,000⫻g for 15 minutes, 10 microliters of supernatant was added to 1000 ␮L of Sircol dye reagent and incubated at room temperature for 30 minutes. The specimen was then centrifuged at 18,000⫻g for 15 minutes, and the supernatant was drained off completely and discarded. One thousand microliters of 0.5 mol/L sodium hydroxide was added to the collagenbound dye pellet to release the bound dye into solution. The optical density of each sample was determined with a microplate reader at 560 nm. Results were recorded and normalized as milligrams of collagen per gram of wet tissue. Statistical analysis. Data were analyzed with the use of SigmaStat software (Jandel Scientific, Corte Madera, Calif). The Fisher exact test was used to determine differences in the incidence of recurrent incisional hernias. Univariate analysis was performed with analysis of variance to determine differences in tensiometric mechanical measurements, collagen messenger RNA band intensity, and collagen protein deposition. Multivariate analysis was performed via logistic regression with recurrent incisional hernia formation as the dependent variable and those mechanical variables that were significant in univariate analysis as independent variables. All the postoperative values for each given mechanical variable were added together for the analysis. Values were reported as the mean ⫾ SD of measurement. P values of less than .05 were considered significant. RESULTS The average size of the fascial defects that developed in this rodent model of chronic incisional hernia formation was 34.3 mm craniocaudally, and 19.7 mm transversely. The fascial defect areas were equivalent between the mesh-repair and suturerepair groups (671 mm2 ⫾ 297 vs 717 mm2 ⫾ 249, P ⬎ .05). During the 28-day hernia maturation

18 DuBay et al

Surgery July 2006

Table I. Comparison of hernia size in meshrepair and suture-repair groups*

All Mesh repair Suture repair

Healed (mm2)

Recurrent hernia (mm2)

P value

668 ⫾ 285 694 ⫾ 357 673 ⫾ 298

795 ⫾ 252 695 ⫾ 290 838 ⫾ 298

.13 .84 .14

*There is no statistically significant increase in recurrent incisional hernia formation in the rats with a larger fascial defect before incisional hernia repair. Subgroup analysis of both the mesh-repair and suturerepair groups also failed to demonstrate a statistically significant association between initial fascial defect and recurrent incisional hernia formation.

Fig 3. There were significantly more total recurrent incisional hernias that developed after suture repair (*) compared with mesh repair (P ⫽ .02; Fisher exact test). Note that the percentage of hernia recurrences did not chance appreciably from postoperative (POD) 7 to POD 60, suggesting that recurrent incisional hernia formation is an early postoperative occurrence.

process, 5 rodents died from acute intestinal evisceration caused by chewing through the skin suture. After incisional hernia repair, there were no deaths or evidence of evisceration, intestinal incarceration, obstruction, or strangulation. Recurrent incisional hernia formation. Recurrent incisional hernia formation was significantly increased in the suture-repair group (Fig 3). Only 21% of the mesh-repaired hernias failed, compared with 58% of the suture-repaired hernias (5/24 vs 14/24, P ⫽ .02). All recurrences occurred at the wound-healing interface. The mesh recurrences involved only a small portion of the mesh, the fascial interface, whereas the recurrences of suture repair typically were large. The size of the recurrent incisional hernia fascial defect progressively increased during the course of the study. Incisional hernia recurrences were detectable only at necropsy in the animals killed at early postoperative time points, whereas the recurrences were grossly obvious in the animals killed at later time points. There were nearuniversal omental and visceral adhesions to the polypropylene mesh in contrast to minimal wound adhesions in the suture-repair groups. The size of the fascial defects (measured at the time of repair) was identical between mesh wounds that were repaired successfully or that developed recurrent incisional hernias (Table I). There is no statistically significant increase in recurrent incisional hernia formation in the rodents with a larger fascial defect before incisional hernia repair when

considering size as a continuous variable (Table I). Subgroup analysis of both the mesh and suture groups also failed to demonstrate a statistically significant association between initial fascial defect and recurrent incisional hernia formation. Recurrent incisional hernias appeared to occur early in the postoperative period in both meshrepair and suture-repair groups. At the earliest time point, POD 7, 16% of the mesh-repaired and 50% of the suture-repaired hernias already had failed, approaching the final total percentage of failures in each group, 21% mesh and 58% suture (Fig 3). The incidence of recurrence was either equal or differed only by 1 animal at each postoperative time point, suggesting that recurrent incisional hernia formation is a very early postoperative phenomenon. If recurrent hernia formation increased slowly over time, the number of recurrences at the later postoperative time points should be more than those at the initial time points. The number of recurrences, however, remained remarkably constant, suggesting that the hernia recurrences likely started by POD 7. Tensiometric study. Recovery of wound tensile strength was delayed in the mesh-repair group, compared with the suture-repair group. Differences in the recovery of wound tensile strength were significant beginning on POD 14 and appeared to become more marked with time (Fig 4). There was no statistical difference in wound tensile strength at POD 7, however, when incisional hernia recurrences appeared to develop. Similarly, wound toughness was identical in the early postoperative wound with suture repair gaining significantly more wound toughness only at POD 60 (Fig 5). The apparent discrepancy between the recovery of wound tensile strength and toughness on POD 14 and POD 28 can be clarified by comparing representative POD 28 wound force-extension curves (Fig 6, Top). Although suture-repair wounds clearly

Surgery Volume 140, Number 1

DuBay et al 19

Fig 4. Wound tensile strength. Suture-repaired wounds had significantly increased ability to recover wound tensile strength, compared with mesh-repaired wounds beginning on postoperative (POD) 14. Analysis of variance; *P ⬍ .05, **P ⬍ .01, ¶P ⬍ .001.

Fig 5. Wound toughness. Both repair modalities had equivalent wound toughness in the early postoperative wounds with suture repair gaining significantly more wound toughness only on postoperative (POD) 60. Analysis of variance; ¶P ⬍ .001.

gain superior tensile strength (y axis) at this time point, the wound toughness (area under the curves) is identical. Stated another way, an increased amount of force (tensile strength) was required to mechanically disrupt the suture-repaired wounds, although both mesh- and suture-repaired wounds were able to absorb an equivalent amount of energy (toughness) before mechanical disruption on POD 28. Representative force-extension curves for uninjured abdominal wall, sham laparotomy POD 28 wounds, and polypropylene mesh are depicted along with POD 28 mesh and suture repair, for comparison (Fig 6, Bottom). Chronic incisional hernia wound repairs heal with significantly

Fig 6. Top, Representative postoperative day (POD) 28 force-extension curves for suture (black line) and mesh herniorrhaphy (grey line) illustrating the different tissue repair mechanical properties. Bottom, Same POD 28 suture and mesh herniorrhaphy force-extension curves along with representative in vitro polypropylene mesh (dashed grey line), POD 28 sham laparotomy (thin solid black line), and uninjured abdominal wall (dashed black line) force-extension curves for comparison. Note that the herniorrhaphy wounds disrupt at a much lower tensile strength and do not elongate to the extent of the sham laparotomy groups. The tensile strength of the in vitro polypropylene mesh is more than 6 times that of the mesh herniorrhaphy groups.

less tensile strength and elongation, compared with uninjured and sham laparotomy controls. The tensile strength of isolated, in vitro polypropylene mesh is 6 times greater than that of the mesh incisional herniorrhaphy wounds, suggesting material over-engineering. Fascial repair wounds demonstrate a lag phase before recovery of wound tensile strength and toughness. Tensile strength was static on POD 7 and POD 14 in the suture-repaired wounds after which a robust recovery is demonstrated on POD 28 and POD 60 (Fig 4). In contrast, wound strength decreases in the mesh-repaired wound from 0.125 N/mm2 on POD 7 to a value of 0.07 N/mm2 on POD 14 (P ⬍ .01), after which a delayed recovery of

20 DuBay et al

Fig 7. Wound elongation. Mesh-repaired wounds had a markedly increased ability to elongate before mechanical disruption, compared with suture-repaired wounds at all postoperative time points. Analysis of variance; **P ⬍ .01, ¶P ⬍ .001.

tensile strength is demonstrated in the mesh repair (Fig 4). Mesh-repaired wounds had a markedly greater ability to elongate before disruption, compared with suture-repaired wounds. Elongation was highly statistically significant at all postoperative time points, including the very early postoperative time points when the differences were most pronounced. In general, mesh-repaired wounds elongated at least 2-fold more than the suture-repaired groups (Fig 7). The maximal elongation for both groups was achieved by POD 28 and appeared to level off with no changes at POD 60. There were significant decreases in wound stiffness in the mesh-repair group, compared with the suture-repair group. Suture-repair wound stiffness was significantly greater than mesh-repair stiffness at all time points (Fig 8). Maximal stiffness occurred at POD 28 in the suture-repaired wounds and then decreased thereafter. In contrast, wound stiffness slowly increased throughout the entire study period in the mesh-repaired wounds. The only mechanical factor that was statistically significant on multivariate analysis was wound elongation with an odds ratio of 0.78 (Table II). The odds ratio is an estimate of the risk of hernia formation associated with 1 unit increase of the independent variable. Stated another way, for every 1 mm increase in wound elongation, the risk of mechanical disruption decreased by 22%. The meshrepaired wounds were able to elongate 2-fold more than the suture-repaired wounds, providing a significant mechanical advantage. All other variables were not significant in the multivariate analysis. Total wound collagen protein levels were increased in the POD 7 suture-repaired wounds, com-

Surgery July 2006

Fig 8. Wound stiffness. Mesh-repaired wounds had significantly less wound stiffness, compared with suturerepaired wounds. Suture-repair peak stiffness developed on POD 28 and then decreased, whereas mesh-repair stiffness slowly increased throughout the study period. Analysis of variance; *P ⬍ .05, **P ⬍ .01, ¶P ⬍ .001.

Table II. Multivariate analysis performed via logistic regression with hernia formation as the dependent variable and those mechanical variables that were significant in univariate analysis as independent variables Variable

Odds ratio

P value

Tensile strength Stiffness Elongation

0.93 1.96 0.78

.99 .53 .05

pared with the mesh wounds (Fig 9). There were no significant differences in wound total collagen levels after this early postoperative time point. Similarly, type I (0.73 ⫾ 0.14 vs 0.54 ⫾ 0.18, P ⬍ .05) and III (0.96 ⫾ 0.12 vs 0.72 ⫾ 0.19, P ⬍ .05) collagen gene expression were significantly increased in the POD 7 suture-repaired wounds only. DISCUSSION This study demonstrates that mesh incisional herniorrhaphy resulted in a more elastic early postoperative abdominal wall, compared with primary suture repairs. Remarkably, a compliant abdominal wall after repair was more predictive of a lower hernia recurrence than the rate of recovery of wound-breaking strength. This concept is analogous to comparing the mechanical properties of a clothes hanger with that of a rubber band—the strong but stiff clothes hanger can only be bent a few times before disruption occurs, whereas the highly elastic (but much less strong) rubber band

Surgery Volume 140, Number 1

Fig 9. Incisional hernia repair wound collagen deposition. Total wound collagen (protein) deposition, expressed as ␮g col/ mg wet tissue, was significantly increased in the suture-repaired wounds on POD 7 only. Analysis of variance; *P ⬍ .05.

can load and recoil numerous times without disruption. Wound elasticity is an important property for the postoperative mechanical loading that occurs during normal daily activities. Many important mechanical loading patterns involve fixed displacements, rather than fixed loads. Abdominal flexion, torsion, or other movement over a predetermined range of motion would apply a fixed mechanical strain on the surrounding soft tissues. Stiffer tissues generate higher resistive forces when subjected to the same mechanical strain. The more elastic wound tissues observed in mesh herniorrhaphy would thus be expected to experience lower peak loading during many normal postoperative activities than the stiffer suture herniorrhaphy tissues. For example, if the wound tissues in Figure 6, A were both subjected to a mechanical extension of 4 mm attributable to abdominal movement, the mesh-repaired tissue would resist with a force of only ⬃2 N, whereas the sutured-repaired tissue would resist with a force of ⬃8 N, a 4-fold difference in peak load. This finding is undoubtedly an important factor in the superior clinical outcome of the more elastic mesh wound tissues, because the force-extension curves typically used to determine the mechanical properties of tissues are generated for a single loading cycle to failure. In reality, biologic tissues typically fail under repeated submaximal loads, a mechanism directly analogous to mechanical fatigue failure.17 Although first described for structural metals nearly a century ago, fatigue failure is a leading cause of mechanical failure for most structural materials. Fatigue failures are characterized by pro-

DuBay et al 21

gressive loss of structural integrity when a material is subjected to repeated submaximal loads, typically resulting in catastrophic failure even when the peak stress remains well below the ultimate strength, and sometimes well below the yield strength, of the material.15 The rate at which this process occurs is driven by both the type of loading and the peak repetitive loads. All other things being equal, higher peak loads increase both the probability of fatigue failure and the rate at which this type of failure will progress. In the above example, the 2N of resistance force in the mesh repairs was only ⬃30% of the breaking strength, whereas the 8N of resistance force in the suture repairs was ⬎60% of the breaking strength. Thus, with similar activities, the suture repairs are subjected to a higher percentage of maximal loading, which predisposes to mechanical fatigue failure. The more-elastic, mesh-repaired hernia wound tissues experience lower peak loads during repetitive normal daily activities and therefore are less subject to mechanical fatigue failure. The incisional hernia recurrence rate after mesh and suture herniorrhaphy in this study was remarkably similar to the level 1 data reported for humans. Twenty-one percent of the mesh repairs and 58% of the suture repairs failed, compared with the 23% mesh and 43% suture failure-rate reported in prospective randomized human trials.10 In addition, the size of the fascial defect was not a significant independent risk factor for incisional hernia recurrence in this rodent study, similar to prospective human clinical results,10 but contrary to large retrospective reports.18 Interestingly, the percentage of hernia recurrences was nearly equal at each time point, implying that the mechanism of recurrent incisional hernia formation may be very early postoperative fascial-fascial or mesh-fascial dehiscence (Fig 3). In this scenario, the wounds disrupt as a function of tensile failure (in contrast to fatigue failure described above) secondary to the application of a single mechanical load event that exceeds the strength of the wound. This mechanism involves either suture pulling through the fascia or primary failure of mesh to incorporate. The concept of occult, early, postoperative fascial dehiscence followed by the delayed development of a clinically detectable hernia has been well described in primary incisional hernia development.19-20 This phenomenon occurs during the trajectory of acute wound healing at a time when wound tensile strength is very low (PODs 0-30).21 It is during the earliest period of wound healing that the wound depends entirely on suture integrity to maintain

22 DuBay et al

abdominal wall closure. Simultaneously, most patients are recovering from their procedures and returning to increased levels of activity and placing increasing loads across the acute wound during its weakest phase. As expected, wound collagen deposition peaked on POD 7 and then plateaued, while, after an initial lag-phase, wound-breaking strength progressively increased throughout the study period. The lag in recovery of wound-breaking strength observed in abdominal wall fascia is similar to that observed during dermal wound healing, suggesting collagen maturation and cross-linking, as opposed to total collagen deposition, establishes ultimate wound strength.22 Collagen deposition was significantly increased in the suture-repaired, early, postoperative wounds only. However, half of these wounds failed, suggesting that total collagen deposition, although necessary for wound repair, may not be a good marker of successful herniorrhaphy. The increased collagen content in the early suturerepaired wounds may directly increase the wound stiffness. Studies of the viscoelastic properties of pericardium have demonstrated that high levels of type III collagen resulted in a stiffer mechanical profile.23 Early wound healing is marked by robust, immature or type III collagen deposition, which may result paradoxically in a mechanical disadvantage for load-bearing mesenchymal tissues. Interestingly, human patients with recurrent hernias expressed significantly higher total collagen with excessive amounts of type III collagen, compared with patients with stable scar; this outcome was coined as an imbalance of type I and type III collagen.24 Mesh abdominal wall reconstruction appears to retard the wound collagen deposition, leading to increased elastic properties. The delayed fibrotic response observed in mesh repairs may provide a mechanical advantage by blunting wound stiffness and enhancing the ability of the wound to elongate. The elasticity of the abdominal wall progressively decreases in the following order: uninjured abdominal wall ⬎ normally healed laparotomy ⬎ mesh incisional herniorrhaphy ⬎ suture herniorrhaphy (Fig 6, Bottom). Previous reports have documented the robust recovery of fascial wound tensile strength after normally healed laparotomy,25 and document an enhanced overall wound elongation after sham laparotomy, compared with chronic incisional hernia repair.13 However, the mechanisms by which the postwounded (ie, herniated) abdominal wall becomes progressively noncompliant have yet to be defined. Preliminary work in our laboratory suggests that abdominal wall mus-

Surgery July 2006

cle atrophy, fibrosis, and muscle fiber shortening after laparotomies may contribute to the decreased elasticity observed in this study.26 It is technically difficult to measure the contribution of mesh material properties and behavior once it is implanted and becomes incorporated into a new composite material in vivo. The mechanical properties of isolated polypropylene mesh vary tremendously from the in vivo mesh: abdominal wall unit. Figure 6, B demonstrates graphically that the isolated, in vitro polypropylene mesh possesses significantly more tensile strength, stiffness, and elongation, compared with the in vivo mesh: abdominal wall and wound-healing interface as composite structure. However, all of the abdominal walls tested disrupted at the mesh: wound interface during biomaterial analysis, occurring at tensile strengths less than one sixth that of the isolated polypropylene mesh, suggesting that the majority of force is concentrated at the wound-healing interface and that the wound disrupts before any significant loading of the mesh itself. There were several limitations of this study design. The mechanical forces placed across a quadruped rodent probably differ from those of a biped human and may contribute to the very high recurrence rate after suture repair. However, that effect is predicted to be equal in the rodent meshrepaired animals, in which recurrences were observed and the mesh recurrence rates were surprisingly similar to the rates measured in humans. It is possible that radial intraperitoneal forces work to secure mesh against the peritoneal surface of the abdominal wall, and that this mechanism contributes to the lower incisional hernia recurrence rates observed. This does not, however, explain why an abdominal wall with a normally healed laparotomy wound is less compliant than an uninjured abdominal wall, as was measured in this study. It may be true that intra-abdominal forces act to stent mesh prostheses against the abdominal wall while wound healing occurs, but the results of this study suggest that it is the composite compliance of the repair that is most important in preventing recurrences, even more important than the rate of recovery of tensile strength. There also are significant structural differences in the wounds present at the interface between autologous tissues in the suture-repair group, compared with wounds biopsied at autologous tissue-to-mesh prosthesis interfaces. For example, although the size and shape of the abdominal wall fascial specimens were standardized, there was 1 wound-healing interface in the suture-repair group and 2 in the mesh-repair group. The 2-wound specimen was bridged by polypropylene mesh, whereas

DuBay et al 23

Surgery Volume 140, Number 1

the suture-repaired wounds were entirely autologous abdominal wall. Long myofascial strips were harvested to measure the composite mechanical properties of the repaired anterior abdominal wall. Direct comparisons of the absolute mechanical properties of similarly sized specimens are likely to relate to clinical outcome more directly than arbitrarily normalized values. Finally, a partial underlay technique was studied, in part since it is the most common procedure used clinically. Techniques such as the mesh sandwich (underlay and overlay) or the Stoppa repair (larger surface area mesh underlay) increase the surface area of alloplastic mesh exposed to the abdominal wall. It is possible that these approaches may further reduce recurrence rates after mesh repairs. This outcome, however, comes with the risks associated with the increased volumes of implanted alloplastic materials. As the next generation of materials is being designed to improve the outcomes of incisional hernia repairs, it will be important to incorporate the observations of studies like this one into the design elements of the newer implants. Currently, surgical techniques and the materials used are mostly empiric, each with its exuberant proponents and opponents. The primary aim of studies like this is to prospectively engineer an approach based on the mechanisms of abdominal wall function and repair to improve laparotomy wound closures and incisional hernia repairs. The results of this study suggest that elasticity or compliance of an abdominal wall after the implant of a prosthesis is the most important mechanical property for predicting a low incisional hernia recurrence rate. Surprisingly, this property was found to be even more important than the rate of recovery of wound tensile strength. The increased compliance of the reconstructed abdominal wall was able to absorb more energy (increased toughness) before wound failure. This composite structural feature apparently is more important than the mechanical properties of the mesh alone. Unfortunately, the use of alloplastic materials to reconstruct the abdominal wall has unique comorbidities such as increased infection rates, visceral adhesions leading to small bowel obstruction, intestinal fistulization, foreign body reaction, and patient complaints of abdominal wall stiffness late after the repair.27-28 One randomized controlled study was terminated early because of an unacceptable rate of wound complications (20%) and a 2-fold risk for chronic pain after polypropylene mesh implantation.29 It is possible that a biologic matrix that allows cell ingrowth and remodeling or

regeneration will improve the results of plastic polymer implants. This study suggests that the main advantages of prosthetic repair are in the immediate postoperative period; thus, bioengineered materials that have the capacity to be completely replaced may prove particularly effective. Future generations of abdominal wall prostheses that maximize wound elastic healing properties, as opposed to absolute breaking strength, may decrease the clinical problem of recurrent incisional hernia formation. REFERENCES 1. Santora TA, Rosylyn JJ. Incisional hernia: hernia surgery. Surg Clin North Am 1993;73:557-70. 2. Mudge M, Hughes LE. Incisional hernia: a 10 year prospective study. Brit J Surg 1985;72:70-1. 3. Cassar K, Munro A. Surgical treatment of incisional hernia. Brit J Surg 2002;89:534-45. 4. National Health Statistics Center. Detailed diagnose & procedures. National hospital discharge survey. Atlanta: Centers for Disease Control and Prevention; 1995. Available at: www.cdc.gov/nchs/products/pubs/pubd/series/sr12/ ser12.htm. 5. Duepree, HJ Senagore, AJ Delaney, CP Fazio. VW Does means of access affect the incidence of small bowel obstruction and ventral hernia after bowel resection? Laparoscopy vs. laparotomy. Am Coll Surg 2003;197:177-81. 6. Gecim IE, Kocak S, Ersoz S, Bumin C, Aribal D. Recurrence after incisional hernia repair: Results and risk factors. Surg Today 1996;26:607-9. 7. Luijendijik RW, Lemmen MH, Hop WC, Wereldsma JC. Incisional hernia recurrence following “vest-over-pants” or vertical Mayo repair of primary hernias of the midline. World J Surg 1997;21:62-6. 8. Paul A, Korenkow M, Peters S, Kohler L, Fisher S, Troidl H. Unacceptable results of the Mayo procedure for repair of abdominal incisional hernias. Eur J Surg 1998;164:361-7. 9. Anthony T, Bergen PC, Kim LT, et al. Factors affecting recurrence following incisional herniorrhaphy. World J Surg 2000;24:95-101. 10. Luijendijik RW, Hop WCJ, van den Tol MP, et al. A comparison of suture repair with mesh repair for incisional hernia. N Eng J Med 2000;343:392-8. 11. Flum DR, Horvath K, Keppel T. Have outcomes of incisional hernia repair improved with time? Ann Surg 2003; 237:129-35. 12. DuBay DA, Franz MG. The biology of acute wound healing failure. Surg Clin North Am 2002;83:463-81. 13. DuBay DA, Wang X, Adamson B, Kuzon WM, Dennis RG, Franz MG. Progressive fascial wound failure impairs subsequent abdominal wall repairs: A new model of incisional hernia formation. Surgery 2005;137(4):463-71. 14. Franz MG, Kuhn MA, Nguyen K, Wang X, Ko F, Wright TE, Robson MC. Transforming growth factor beta-2 lowers the incidence of incisional hernias. J Surg Res 2001;97:109-16. 15. Shigley JE, Mischke CR. Mechanical engineering design. 5th ed. McGraw-Hill series in mechanical engineering. New York: McGraw-Hill; 1989. p. 269 –71. 16. Wang X, Franz MG, Siegler KM, et al. Quantitative analysis of TGF-␤ 1, 2, 3, and TGF-␤ receptor II mRNAs in keloid scars and normal skin. Int J Surg Invest 2000;3(3):205-12.

24 DuBay et al

17. Bairstow, L. The elastic limits of iron and steel under cyclic variations of stress. In: Philosophical transactions. Series A. Vol. 210. London: Royal Society of London; 1910. p. 35-55. 18. Hesselink VJ, Luijendijk RW, de Wilt JH, Heide R, Jeekel J. An evaluation of risk factors in incisional hernia recurrence. Surg Gynecol Obstet 1993;176:228-34. 19. Franz MG, Kuhn MA, Nguyen K, et al. Early biomechanical wound failure: a mechanism for ventral incisional hernia formation. Wound Rep Reg 2001;9:140-1. 20. Pollock AV, Evans M. Early prediction of late incisional hernias. Brit J Surg 1989;76:953-4. 21. Franz MG, Robson MC: The use of the wound healing trajectory as an outcome determinant for acute wound healing. Wound Repair Regen 2001;8(6):511-6. 22. Levenson SM, Geve EF, Crowley LV, et al. The healing of rat skin wounds. Ann Surg 1965;161:293. 23. Niamark WA, Lee JM, Limeback H, Cheung DT. Correlation of structure and viscoelastic properties in the pericardia of four mammalian species. Am J Physiol 1992; 263(32):1095-106. 24. Si Z, Rhanjit B, Rosch R, Rene PM, Klosterhalfen B, Klinge

Surgery July 2006

25.

26.

27.

28.

29.

U. Impaired balance of type I and type III procollagen mRNA in cultured fibroblasts of patients with incisional hernia. Surgery 2002;131(3):324-31. Franz MG, Smith PD, Wachtel TL, et al. Fascial incisions heal faster than skin: a new model of fascial repair. Surgery 2001;129(2):203-8. Choi W, DuBay D, Urbanchek MG, Kuzon WM, Franz MG. Abdominal wall incisional herniation induces muscle fiber disuse atrophy in a chronically unloaded setting. Plastic Surgery Research Council 49th Annual Meeting, June 2004, Ann Arbor, Michigan. Kumar S, Wilson RG, Nixon SJ, Macintyre IM. Chronic pain after laparoscopic and open mesh repair of groin hernia. Br J Surg 2002;89(11):1476-9. Leber GE, Garb JL, Alexander AI, Reed WB. Long-term complications associated with prosthetic repair of incisional hernia. Arch Surg 1998;133(4):378-82. Korenkow M, Sauerland S, Arndt M, Bograd L, Neugebauer EA, Troidl H. Randomized clinical trial of suture repair, polypropylene mesh, or autodermal hernioplasty for incisional hernia. Brit J Surg 2002;89:50-6.