1. Introduction Our previous reports identified a new family of metabolites that are derivatives of 4pirydone-3-carboxamide-1β-D-ribonucleoside (4PYR). 4PYR was first mentioned in 1979 regarding a patient with chronic megaloblastic leukemia (Dutta et al., 1979). This molecule is functionally and metabolically related to nicotinamide. Our group conducted several in vivo and in vitro studies which discovered that endogenous nucleoside 4PYR can be converted to triphosphates (4PYTP), diphosphates (4PYDP), monophosphates (4PYMP) and an analogue of NAD – 4PYRAD (Laurence et al., 2007; Pelikant-Małecka et al., 2014; Romaszko et al., 2011; Romaszko et al., 2014; Rutkowski et al., 2012; Rutkowski et al., 2010; Slominska et al., 2006a; Slominska et al., 2008a; Synesiou et al., 2011). 4PYR and its derivatives could be detected in healthy individuals in both plasma and urine. The concentration of 4PYR in normal human plasma is in nanomolar range (Slominska et al., 2006a). In pathological condition such as chronic renal failure (CHRF), cancer and active HIV infection, elevated blood concentration of 4PYR has been observed (Intrieri et al., 1996; Schram, 1998; Slominska et al., 2006a). At the same time, endothelial dysfunction is the primary problem of patients with CHRF (Synesiou et al., 2011). Our further in vitro studies demonstrated that 4PYR was metabolized to 4PYMP and 4PYRAD which resulted in disturbances in intracellular level of ATP and NAD in human endothelial cells (Pelikant-Małecka et al., 2014). Glycolysis and oxidative phosphorylation are the two major energy producing pathways in the cell that could be adjusted according to cell need (Eelen et al., 2015). However, potential changes in mitochondrial and glycolysis function in cells exposed to 4PYR has not been analysed yet. It has been indicated that liver is the primary organ producing 4PYR (PelikantMalecka et al., 2015). Aldehyde oxidase, the molybdenum cofactor dependent enzyme, which is expressed in liver, has been suggested to be involved in 4PYR production (Laurence et al., 2007; Synesiou et al., 2011). Studies with erythrocytes and 5-iodotubecidin (Itu) demonstrated that adenosine kinase (AK) could be responsible for 4PYMP production (Laurence et al., 2007; Slominska et al., 2006a; Slominska et al., 2008a). Research with application of snake venom, an inhibitor of cytosolic 5’-nucleotidase (cN), demonstrated its potential involvement in degradation of 4PYMP (Synesiou et al., 2011). Production of another metabolite of 4PYR, an analog of nicotinamide adenine dinucleotide - 4PYRAD - has not been described yet. Most likely option is that nicotinamide mononucleotide adenylyltransferase (NMNAT)

can be responsible for production of 4PYRAD. However, exact role of AK, cN and NMNAT in 4PYR metabolism have not been clarified yet. Nucleotides and nucleosides are known to regulate inflammation, platelet aggregation, calcium phosphate deposition and vascular damage. Deficiency of adenosine deaminase (ADA), purine nucleoside phosphorylase (PNP) and AMP deaminase (AMPD) activity results in immunodeficiency or myopathy (Grunebaum et al., 2013; Smolenski et al., 2014).Therefore, modification of these processes by 4PYR could have important implications. Influence of 4PYR on activities of enzymes involved in nucleotides metabolism has been investigated in heart homogenates, erythrocyte lysates, isolated rat cardiomyocytes and endothelial cells (Slominska et al., 2014). However, potential changes in ADA, PNP and AMPD activity in HMEC-1 treated with 4PYR has not been analysed yet. In this study we analysed whether 4PYR could be metabolized in different typesof cells, studied pathway involved in 4PYR metabolism and tested effects of endothelial cells exposure to 4PYR on activities of ADA, AMPD and PNP. Furthermore we tested effects of 4PYR on energy metabolism including specific changes in glycolysis and mitochondrial oxidation.

2. Materials and methods

2.1 Isolation, identification and culture of human adipose derived stem cells (hADSCs) Human visceral fat was collected during surgical procedures from patients of Department of General Surgery, with the approval of Independent Bioethics Commission for Research at Medical University of Gdansk. Then human visceral fat was cut into smaller pieces, washed in PBS and digested with 0.1 % collagenase (Type I, Sigma) at 370C for 1 hour. After digestion, it was filtered and centrifuged. Then the pellet was reconstituted in medium dedicated for human adipose-derived stem cells (hADSC) -Mesenchymal Stem Cell Growth Medium DXF(PromoCell). The cells were seeded in 25 cm2 flasks and incubated at 370C in atmosphere of 5% CO2. The expression of mesenchymal and hematopoietic cell markers: VE, CD 90, CD 31, CD 105, CD44, CD 45, CD73 was examined by flow cytometry at passage 2 in human adherent cells derived from adipose tissue. In isolated cells expression of CD90, CD105, CD44, CD73 and lack of CD45, VE and CD31 has been observed. Between passage 2 – 4 hADSCs were used for experiments. Cells were harvested with trypsin-versene when they were 70–90% confluent.

2.2 Cell culture Endothelial cells (human dermal microvascular endothelial cells HMEC-1), were grown in MDCB 131 (Gibco) medium supplemented with 10% fetal bovine serum, hydrocortisone(1.2µg/ml), ECGS (30µg/ml), 2mM glutamine and penicillinstreptomycin (Sigma). Human malignant melanoma cells (A375) and human embryonic kidney cells (HEK293T) were cultured in Dulbecco's Modified Eagle's Medium (DMEM, 4.5g/l glucose) supplemented with 10% fetal bovine serum, 2mM glutamine and penicillin-streptomycin (Sigma). Human neuroblastoma cells (SHSY5Y) grown in Dulbecco's Modified Eagle Medium: Nutrient Mixture F-12 (DMEM/F12, Gibco) supplemented with 10% fetal bovine serum, 2mM glutamine and penicillinstreptomycin (Sigma).Human bone marrow-derived stem cells transfected with human telomerase reverse transcriptase (hTERT BMSCs) were cultured in standard Dulbecco's Modified Eagle's medium (DMEM, Sigma) supplemented with 10% fetal bovine serum, 2mM glutamine and penicillin-streptomycin (Sigma). Cells were

cultivated in flasks (25 and 75 cm2), at 37°C, in 5% CO2 atmosphere. Cells were harvested with trypsin-versene when they were 70–90% confluent.

2.3 Metabolism of 4PYR and nucleotide level in human cells

4PYR was obtained by chemical synthesis as described previously (Slominska et al., 2006b). Our further in vitro studies shown that proper concentration of 4PYR is 100µM (Romaszko et al., 2014). For the experiments, all types of cells were plated at density of 4x10^4/well in 24-well plates. Only hADSC cells were plated at density of 1.6x10^5/well. Next day, medium was changed and cells were incubated for 0, 24, 48 and 72h with addition of 100µM 4PYR. After that, cells and incubation medium were separated. To be certain that all medium was removed, cells were washed two times with Hanks’ Balanced Salt solution (HBSS, Sigma). Next 0.3ml of 0.4M HClO4 was added to each well to extract cellular ATP, NAD, 4PYMP and 4PYRAD and plates were frozen at -80°C. After thawing on ice, cells extracts were collected to Eppendorf type tubes and brought to pH 5.5-6 by 3M K3PO4. No degradation of high energy phosphates was observed for up to 24h. Slight acidic target point helped to avoid alkaline pH where high energy phosphates are unstable. After centrifugation, supernatants were analyzed by HPLC. Protein precipitates were dissolved in 0.5ml 0.5M NaOH and analyzed with Bradford method.

2.4 Mitochondrial and glycolytic function analysis

Mitochondrial function and glycolytic function were measured in HMEC-1 cells using a Seahorse Agilent XFp metabolic flux analyzer. Cells were plated in XFp plates at 715x104 cells per well in a final volume of 200µl full medium. The next day culture medium was changed and cells were incubated for 0, 24, 48 and 72h with addition of 100µM 4PYR. After incubation medium was removed, cells were washed two times with Seahorse XF Base Medium. Next 180µl of warm to 37°C medium was added (for Sehorse XF Cell Mito Stress Test Assay Medium containing: 1mM pyruvate, 1.2mM glutamine and 5.5mM glucose; for Sehorse XF Glycolysis Stress Test Assay Medium containing 1.2mM glutamine) to each well and then incubated at 37°C for 1h. Oligomycin (inhibitor of ATP-synthase), FCCP (uncoupling agent) and mix of antimycinA (a complex III inhibitor) and rotenone (a complex I inhibitor) were serially injected to final concentration of 2µM, 1µM and 0.5µM respectively, to measure oxygen consumption rate (OCR). This allowed to measure ATP-linked Respiration, Maximal Respiration and Non-mitochondrial respiration. The Basal Respiration was measured prior to injection of oligomycin. Proton Leak and Spare Respiratory Capacity were then calculated using theses parameters. Glucose, oligomycin (to shift the energy production to glycolysis) and 2-deoxy-glucose (2-DG; inhibitor of hexokinase) were serially injected to final concentration of 10mM, 2µM and 50mM respectively, to measure extracellular acidification rate (ECAR). This allowed to measure Glycolysis Rate and Gycolytic Capacity. Glycolytic Reserve was then calculated using theses parameters. Measurement prior glucose injection was referred to as Non-glycolytic acidification. The OCR and ECAR were normalized to the protein concentration measured by Bradford method.

2.5

Contribution of adenosine kinase, cytosolic 5’-nucleotidase II and

nicotinamide nucleotide adenylyltransferase 3 to 4PYR metabolism

Target sequences of siRNA for AK, cN-II, NMNAT3 genes and non-targeting negative control (NO) that were purchased (Qiagen) are shown in Table 1. For the experiments HEK 293T cells were plated in 24-well plates at density of 40 000 cells per well in full DMEM medium. The next day, medium was removed and cells were washed with Opti-MEM® + GlutaMAX™ (Gibco). After that to each well Opti-MEM® + GlutaMAX™ was added (0.5ml clean medium). In this condition cells were transfected according to the manufacturer’s instruction using LipofectamineRNAiMAX reagent (Invitrogen). Cells were transfected with a final concentration of 6pmol siRNA for each well. After 24h medium was removed and fresh full supplemented DMEM medium with addition of 100µM 4PYR was added. Cells transfected with AK siRNA were supplemented with 100µM adenine and 2.5mM ribose, to provide alternative substrates to maintain adenine nucleotide pool. After 48h of incubation, cells and incubation medium were separated. To removed all medium cells were washed two times with Hanks’ Balanced Salt solution (HBSS, Sigma). To extracted cellular ATP, NAD, 4PYMP and 4PYRAD, to each well was added a 0.3ml of 0.4M HClO4 and plates were frozen at -80°C for at least 24h. After thawing on ice, cells extracts were collected to Eppendorf type tubes and neutralized to pH 5.5-6 by 3M K3PO4. No degradation of high energy phosphates was observed for up to 24h. Slight acidic target point helped to avoid alkaline pH where high energy phosphates are unstable. After centrifugation, supernatants were analyzed by HPLC. Protein precipitates were dissolved in 0.5ml 0.5M NaOH and analyzed with Bradford method.

2.6

The efficiency of silencing of the adenosine kinase, cytosolic 5’-

nucleotidase II and nicotinamide nucleotide adenylyltransferase 3

Total RNAwas extracted using the RNeasy Mini Kit (Qiagen) according to the manufacturer’s protocol. Concentration of the RNA was determined on the basis of absorbance at 260 nm. All samples had 260/280 nm absorbance ratio of approximately 2.0. First-strand complementary DNA (cDNA) was synthesized from 2.5μg of total RNA (RevertAidTM First Strand cDNA Synthesis Kit; Thermo Scientific). Prior to amplification of cDNA, each RNA sample was treated with RNase-free DNase I (Thermo Scientific) at 37 °C for 30 min. Real-time PCR amplification was performed in a 20μl volume using iQ SYBR Green Supermix (Bio-Rad). Primers were designed using Primer-BLAST software and synthesized at Genomed. Forward and reverse primer sequences are presented in Table 2. The samples were incubated at 95°C for 3:30min to obtain an initial denaturation and polymerase activation, followed by 45 PCR cycles of amplification (92°C for 45s, 57°C for 45s, and 72°C for 45s). Control reactions, with omission of the RT step or with no template cDNA added, were performed for each assay. All the samples were run in triplicate. To adjust for variations in the amount of added RNA and efficiency of the reverse transcription cyclophilin mRNAs were quantified in corresponding samples. The results were normalized to these values. Relative quantities of the transcripts were calculated using the 2−ΔΔCT formula.

2.7 Preparation ofcell lysates. For the experiments HMEC-1 cells were plated at a density of 3x10^5/well in 6-well plates. The next day, medium was changed and cells were incubated for 0, 24, 48 and 72h with addition of 100µM 4PYR. After incubation, cells and incubation medium were separated. To remove all medium, cells were washed two times with Phosphate-Buffered Saline (PBS, Lonza). Cells were harvested with trypsin-versene and collected to Eppendorf type tubes and centrifuge. Cell pellets were washed two times with cold PBS and then resuspended in 300µl lysis buffer (water with 0.01%TRITON X-100). Cells were freeze-thawed two times and sonicated. We used 0.01% TRITON X-100 to avoid loss in sample due to foaming after sonication in buffer that include 1% TRITON X-100 (standard concentration used in cell lysis) and to avoid high concentration of TRITON X-100 during enzyme activity assays. We conducted experiments that demonstrated lack of difference in lysis efficacy between 0.01% or 1% TRITON X-100 in lysis buffer. After centrifugation, lysates (supernatant) were used for measured activity of chosen enzymes.

2.8

Intracellular activity of adenosine deaminase, AMP deaminase and

purine nucleoside phosphorylase.

To measure intracellular activity of ADA, 25µl of cells lysates were diluted with 25µl of incubation buffer (50mM TRIS, ph=7.0). After dilution, 50µl of incubation buffer with 2mM adenosine (Sigma) was added to each sample. Then samples were incubated for 15 minutes. To measured intracellular activity of PNP, 25µl of cells lysates were diluted with 25µl of incubation buffer (50mM NaH2PO4, ph=7.0). After dilution, 50µl of incubation buffer with 2mM inosine (Sigma) was added to each sample. Then samples were incubated for 5 minutes. To measured intracellular activity of AMPD 25µl of cellslysates were diluted with 25µl of incubation buffer (20mM TRIS, 150mM KCl, 1mMdithiothreitol, 10µM erythro-9-(2-hydroxy-3-nonyl)adenine,pH=7.0). After dilution, 50µl of incubation buffer with 50mM AMP (Sigma) was added to each sample. Then samples were incubated for 15 minutes. After incubation, reactions were stopped by addition of 100µl 1.3M HClO4. The reaction mixtures were brought to pH 5.5-6 by 3M K3PO4. After centrifugation supernatants were analyzed by HPLC. Protein precipitates were dissolved in 0.1ml 0.5M NaOH and analyzed with Bradford method.

2.9 Analysis of nucleotides and enzyme activities with HPLC

Intracellular activity of enzymes, 4PYR metabolism in human cells and transient silencing were analysed by reverse phase HPLC as previously described (Smolenski et al., 2006). 2.10 Statistical analysis

Values are presented as means ± standard error of the mean (SEM). Statistical analysis was performed using one way analysis of variance (ANOVA) followed by Tukey test. Student’s t test was performed to compare the two experimental groups. p<0.05 was considered a significant difference.

3. Results

3.1 Metabolism of 4PYR and nucleotides level in human cells Intracellular concentrationsof ATP, NAD, 4PYMP and 4PYRAD after 0, 24, 48 and 72h of treatment with100µM 4PYR in different type of cells are presented on Fig. 1. The concentration of ATP in A375, hADSC, and HMEC-1 cells after treatment with 100µM 4PYR was significantly reduced. The concentration of ATP decreased after 24h and progressed with time(Fig. 1). After longer treatment (72h) with 100µM 4PYR, concentration of ATP decreased in HEK 293T cells (Fig. 1). In hTERT BMSCs and SH-SY5Y cells concentration of ATP was stable (Fig. 1).Decrease in NAD concentration in HMEC-1 and A375 cells after 24h treatment with 100µM 4PYR were observed and progressed in time (Fig. 2). The concentration of NAD was significantly reduced in HMEC-1 and A375 cells after 72h (Fig. 2). No changes were observed in concentration of NAD in hTERT BMSCs, SH-SY5Y, HEK293T and hADSC cells (Fig. 2). All type of cells were capable to metabolise 4PYR into 4PYMP and 4PYRAD (Fig. 3, Fig. 4). The total intracellular concentration of 4PYMP in HMEC-1 and A375 cellsafter 72h of treatment with 100µM 4PYR reached highest level (about 30nmol/mg protein) (Fig. 3). The concentration of 4PYMP in hTERT BMSCs, SHSY5Y, HEK293T and hADSC cells after 72h of treatment with 100µM 4PYR did not exceed 8nmol/mg protein (Fig. 3). Intracellular concentration of 4PYRAD in HMEC-1, hADSC and A375 cells after 72h of treatment with 100µM 4PYR reached from 4 to 6nmol/mg protein (Fig. 4). The concentration of 4PRAD in hTERT BMSCs, SH-SY5Y and HEK293T cells after 72h of treatment with 100µM 4PYR did not exceed 1nmol/mg protein (Fig. 4).

3.2 Mitochondrial function and glycolysis after 4PYR treatment Analyses of OCR and ECAR after 0, 24, 48 and 72h of treatment with 100µM 4PYR in HMEC-1 cells are presented on Fig. 5 and Fig. 6 respectively. Treatment with 100 µM 4PYR did not affect on mitochondrial function in HMEC-1 cells (Fig. 5 B, C, D, E, F, G). Glycolytic function measured as extracellular acidification rate (ECAR) decreased after 72h of treatment with 100µM 4PYR (Fig. 6F). Significant differences were observed in parameters such as Glycolytic Capacity, GlycolyticReserve and Non-glycolytic acidification (Fig 6G).

3.2

Contribution of adenosine kinase, cytosolic 5’-nucleotidase II and

nicotinamide nucleotide adenylyltransferase 3 to 4PYR metabolism

Analyses of intracellular concentration of ATP, NAD, 4PYMP and 4PYRAD after transient silencing of AK and 48h incubation with 100µM 4PYR are presented on Fig. 7. Concentrations of ATP and NAD were similar in all experimental groups (Fig. 7A, B). Three-fold decrease in concentration of 4PYMP and 4PYRAD was observed in cells with transient silencing of AK (Fig. 7C, D). Concentrations of ATP, NAD, 4PYMP and 4PYRAD after transient silencing of NMNAT3 and 48h incubation with 100µM 4PYR are presented in Fig. 8. The concentration of ATP was reduced in cells after

transient silencing of NMNAT3 (Fig. 8A). The concentration of NAD in all experimental groupswas similar (Fig. 8B). Fig 8C and 8D demonstrate that concentrations of 4PYMP and 4PYRAD in cells with transient silencing of NMNAT3 were significantly reduced (at least 2 fold). Analyses of intracellular concentration of ATP, NAD, 4PYMP and 4PYRAD after transient silencing of cN-II and 48h incubation with 100µM 4PYR are presented in Fig. 9. Concentrations of ATP and NAD in all experimental groups were stable (Fig. 9A,B). Transient silencing of cN—II resulted in 2 fold increase of 4PYMP concentration (Fig. 9C). However, no change in concentration of 4PYRAD was observed (Fig. 9D).

3.3

Intracellular activity of adenosine deaminase, AMP deaminase and

purine nucleoside phosphorylase.

Activities of ADA, PNP and AMPD after 0, 24, 48 and 72h of treatment with100µM 4PYR in HMEC-1 cells are presented on Fig. 10. No changes were observed in activity of ADA and PNP (Fig 10A, B). The most significant difference was observed for AMPD activity after 24h of treatment with 100µM 4PYR (half activity of control group) (Fig. 10C).

4. Discussion The major finding of this paper is demonstration that capacity to metabolize 4PYR to its intracellular nucleotide derivatives is a common feature in diverse types of normal and cancer cells, but the rate of this process and its impact on cellular energy metabolism varies. These energy metabolic abnormalities were found to be related to inhibition of glycolysis after 4PYR exposure. This report also identified specific enzymes responsible for 4PYR metabolism such as AK, cN-II and NMNAT-3. Furthermore, 4PYR and its derivatives were found to inhibit AMPD pathway. 4PYR and its metabolites such as 4PYMP, 4PYTP and 4PYRAD were first detected in plasma, erythrocytes and urine of healthy adults and patients with chronic renal failure (Rutkowski et al., 2012; Rutkowski et al., 2010; Slominska et al., 2006a; Slominska et al., 2008a). Level of ATP, that represent crucial parameter of cellular energetics, has been analyzed only in erythrocytes (Slominska et al., 2006a; Slominska et al., 2008b). In current study for the first time analysis of energetic equilibrium after exposure to 4PYR has been conducted together with 4PYR metabolism in diverse cell types. Human cells studied here include cancer cells (SHSY5Y, A375), stem cells (hADSCs, hTERT BMSCs), endothelial cells (HMEC-1) and kidney cells (HEK293T) which have been treated with 4PYR (Fig 1, 2, 3 and 4). Stable ATP and NAD concentrations together with low accumulation of 4PYMP and 4PYRAD has been observedin SH-SY5Y and hTERT BMSCs cells. Significant accumulation of 4PYMP and 4PYRAD in A375 and HMEC-1cells has been observed. Those cells under 4PYR treatment demonstrated significant decrease in concentration of ATP (more than 50% compared to control level) and NAD (about 20% decrease compared to control). In HEK293T and hADSC cells, 4PYR has been metabolized, causing changes in concentration of ATP (decrease) without changes in concentration of NAD. Our results confirm that all types of cells are capable to metabolize 4PYR. However,changes in energy balance have been found to be cell specific. Explanation of differences in 4PYR metabolism in this phase is difficult, but probably changes in metabolism of 4PYR could be related to tissue penetration (more complicated when

we consider bone marrow) and high expression of specific metabolite export mechanism (i.e. toxin elimination by kidney cells). This study shown that mitochondrial function has not been changed during incubation with 4PYR (Fig. 5). However, in endothelial cells exposure to 4PYR significant decrease in Glycolytic Capacity and Glycolytic Reserve measured as ECAR has been observed (Fig. 6). In endothelial cells main source of energy is glycolysis (Eelen et all, 2015). This suggest that disruption in glycolysis, in endothelial cells, induced by 4PYR might have negative impact on energy balance and in consequence on cells function and survival. The information about metabolism of 4PYR suggests that AK could be involved in 4PYMP production (Slominska et al., 2006a). 4PYMP and 4PYTP production in erythrocytes treated with combination of Itu and different range of 4PYR has not been observed (Slominska et al., 2008b). Another studies demonstrated that Itu is known to inhibit acetyl-CoA carboxylase and other protein kinases such as PKA, phosphorylasekinase, casein kinase I and PKC (Massillon et al., 1994).In consequence selective inhibition of AK is impossible by Itu. AK is a crucial enzyme for proper cell function and catalyze phosphorylation of adenosine in which donor of phosphorylgroup is ATP. In humans AK is presented in two isoforms AK long (AK-L) and AK short (AK-S), which are enzymatic active (Boison, 2013). Mammalian kidney, liver, lung and pancreas cells expresse both isoforms (Cui et al., 2011).HEK293T cells which according to American Type Culture Collection (ATCC) are widely used in gene expression studies, has been used. Furthermore in HEK293T cells we did not observe decrees in ATP and NAD concentration after 48h treatment with 4PYR, which suggest that production of 4PYMP and 4PYRAD may not affect on HEK293T metabolism. siRNA used in experiments was constructed for transient silencing of AK-L and AK-S(Table 2). Results demonstrated that AK is involved in production of 4PYMP. However, 4PYMP concentration on low level has been preserved, which suggest that another enzyme could be involved in 4PYMP production (Fig. 7). We are not able to distinguish which form: AK-L (located in nucleus) or AK-S (located incytoplasma) is mainly responsible for 4PYMP production. Reduction of 4PYRAD concentration confirmed that 4PYMP has been involved in its production (PelikantMalecka et al., 2015; Romaszko et al., 2014). ATP decrease in HMEC-1 could be related with two different mechanisms: competition between 4PYMP and AMP in enzymatic pathway of ATP synthesis and lower efficiency of glycolysis in endothelial cells exposure to 4PYR. Nicotinamide mononucleotide adenylyltransferease (NMNAT), an enzyme which catalyzes the biosynthesis of NAD from ATP and NMN is potentially responsible for production of 4YRAD. Three NMNAT forms has been described: NMNAT-1 in the nucleus, NMNAT-2 in the Golgi apparatus and NMNAT-3 in the mitochondria and cytoplasm (Hikosaka et al., 2014; Jayaram et al., 2011). Further studies shown that knock-down of NMNAT-2 resulted in reduction of cellular NAD(+) concentration, which in consequence protects cells from p53-dependent cell death upon DNA damage (Pan et al., 2014).I n mice model, deficiency of NMNAT-3 did not affect the NAD concentration (Hikosaka et al., 2014). According to www.genecards.org most expressed protein in kidney is NMNAT-3. siRNA used in experiments was constructed to transient silencing ofNMNAT-3 (Table 2). Results demonstrated that NMNAT-3 has been involved in 4PYRAD production. 4PYRAD concentration in cells with transient silencing of NMNAT-3 decreased and reach half concentration compared to control samples (Fig. 8). This confirmed that in production of 4PYRAD, NMNAT-3 has been involved.

Cytosolic 5’-nucleotidase is a family of six intracellular enzymes:cN-IA,cN-IB, cN-II, cNIIIA and cN-IIIB (Eriksson, 2013). Snake venom that contain potential inhibitors of cytosolic 5’-nucleotidase has been used in studies related to 4PYMP degradation (Synesiou et al., 2011). Snake venom includes three-finger toxins, serine protease inhibitors, phospholipases A2, serine proteases, and metalloproteases which could affect different types of enzymes (Całkosiński et al., 2010). In this study we analyzed cN-II involvement in 4PYMP degradation. cN-II is expressed in all organs and tissues in vertebrates (Tozzi et al., 2013). siRNA used in experiments was constructed for transient silencing of cN-II (Table 2). Results presented here demonstrated that cN-II is involved in 4PYMP degradation. The concentration of 4PYMP in cells with transient silencing of cN-II reached more than two times higher level than in control samples (Fig. 9). These results confirm involvement of cN-II in 4PYMP metabolism. Results confirmed involvement of AK and cN-II in pathway of 4PYR metabolism. Also we were able to indicate that NMNAT-3 is involved in production of 4PYRAD (Fig. 11). Further studies, with involvement of erythrocyte lysates, demonstrated lack of influence of 4PYR on ADA, PNP and AMPD activity (Slominska et al., 2014). These results demonstrated decrease in AMPD activity after 4PYMP treatment in erythrocytes lysats and heart homogenates (Romaszko et al., 2014; Slominska et al., 2014). Results demonstrated in this paper confirm similar effect on ADA, PNP and AMPD activity. We can presume that 4PYMP affects AMPD activity. Increasing concentration of 4PYMP after 24h of 4PYR treatment in HMEC-1 cells resulted in decrease of AMPD activity (Fig.10 C). After stabilization of 4PYMP concentration in HMEC-1 cells treated with 4PYR (Fig.10 C,72h of treatment) activity of AMPD returned to control level (Fig.10 C). Lower production of AMP by AK (which stimulate AMPD activity) as a effect of competition between adenosine and 4PYR could be partially responsible for this result. Moreover we cannot exclude directed effect of 4PYMP on AMPD. The major finding of this paper is that human cells (also cancer cells) are able to metabolise 4PYR. Variability in 4PYMP and 4PYRAD concentration in different types of cells is difficult to explain. 4PYR and its derivatives disrupt glycolytic pathway which significant effect on energy balance. 4PYR and its derivatives partially affect nucleotide enzymes. Involvement of AK, cN-II and NMNAT-3 in 4PYR pathway has been clarified. 4PYR has been classified as uremic toxins (The European Uremic Solutes Database; EUTox-db; http://eutoxdb.odeesoft.com) (Barreto et al., 2014). In vitro and in vivo data demonstrated that endothelium is the primary target of this toxicity. Concentrations of 4PYR and its derivatives, in pathological condition such as renal failure when it is considerably elevated become important because of contribution to endothelial dysfunction. Detailed knowledge of 4PYR metabolism in different human cells and pathway of 4PYMP and 4PYRAD synthesis could help to create methods to protect cells from toxic effects (i.e. inhibition of synthesis of derivatives). While this study clarified several key aspects of 4PYR metabolism and effects, further studies are required to clarify its importance in pathology and therapeutic possibilities.

5. Conflict of Interest The authors whose names are listed immediately below certify that they have NO affiliations with or involvement in any organization or entity with any financial interest (such as honoraria; educational grants; participation in speakers’ bureaus; membership, employment, consultancies, stock ownership, or other equity interest; and expert testimony or patent-licensing arrangements), or non-financial interest

(such as personal or professional relationships, affiliations, knowledge or beliefs) in the subject matter or materials discussed in this manuscript.

Acknowledgments This study was supported by the European Union from the resources of the European Regional Development Fund under the Innovative Economy Program (a grant coordinated by JCET-UJ, No. POIG.01.01.02-00-069/09) and National Science Centregrant 2011/01/B/NZ1/01629.

7. Author Contribution Conceived and designed the experiments: IPM RTS EMS. Performed the experiments: IPM. SS. Analyzed the data: IPM EKB AS. Contributed reagents/materials/analysis tools: MS RTS EMS. Wrote the paper: IPM RTS EMS. References Barreto, F.C., Stinghen, A.E., de Oliveira, R.B., Franco, A.T., Moreno, A.N., Barreto, D.V., Pecoits-Filho, R., Drüeke, T.B., Massy, Z.A.,;1; 2014. The quest for a better understanding of chronic kidney disease complications: an update on uremic toxins. J Bras Nefrol 36(2), 221235 Boison, D.,;1; 2013. Adenosine kinase: exploitation for therapeutic gain. Pharmacol Rev 65(3), 906-943. Całkosiński, I., Seweryn, E., Zasadowski, A., Małolepsza-Jarmołowska, K., Dzierzba, K., Bronowicka-Szydełko, A., Mierzchała, M., Ceremuga, I., Rosińczuk-Tonderys, J., Dobrzyński, M., Gamian, A.,;1; 2010. [The composition, biochemical properties and toxicity of snake venoms]. Postepy Hig Med Dosw (Online) 64, 262-272. Cui, X.A., Agarwal, T., Singh, B., Gupta, R.S.,;1; 2011. Molecular characterization of Chinese hamster cells mutants affected in adenosine kinase and showing novel genetic and biochemical characteristics. BMC Biochem 12, 22. Dutta, S.P., Crain, P.F., McCloskey, J.A., Chheda, G.B.,;1; 1979. Isolation and characterization of 1-beta-D-ribofuranosylpyridin-4-one-3-carboxamide from human urine. Life Sci 24(15), 1381-1388. Eelen, G., de Zeeuw, P., Simons, M., Carmeliet, P.,;1;2015. Endothelial cell metabolism in normal and diseased vasculature. Circ Res 116(7), 1231-1244. Eriksson, S., 2013. Is the expression of deoxynucleoside kinases and 5'-nucleotidases in animal tissues related to the biological effects of nucleoside analogs? Curr Med Chem 20(34), 4241-4248. Grunebaum, E., Cohen, A., Roifman, C.M.,;1; 2013. Recent advances in understanding and managing adenosine deaminase and purine nucleoside phosphorylase deficiencies. Curr Opin Allergy Clin Immunol 13(6), 630-638. Hikosaka, K., Ikutani, M., Shito, M., Kazuma, K., Gulshan, M., Nagai, Y., Takatsu, K., Konno, K., Tobe, K., Kanno, H., Nakagawa, T.,;1; 2014. Deficiency of nicotinamide mononucleotide adenylyltransferase 3 (nmnat3) causes hemolytic anemia by altering the glycolytic flow in mature erythrocytes. J Biol Chem 289(21), 14796-14811. Intrieri, M., Calcagno, G., Oriani, G., Pane, F., Zarrilli, F., Cataldo, P.T., Foggia, M., Piazza, M., Salvatore, F., Sacchetti, L.;1;, 1996. Pseudouridine and 1-ribosylpyridin-4-one-3carboxamide (PCNR) serum concentrations in human immunodeficiency virus type 1-infected patients are independent predictors for AIDS progression. J Infect Dis 174(1), 199-203. Jayaram, H.N., Kusumanchi, P., Yalowitz, J.A.,;1; 2011. NMNAT expression and its relation to NAD metabolism. Curr Med Chem 18(13), 1962-1972.

Laurence, A., Edbury, S.M., Marinaki, A.M., Smolenski, R.T., Goldsmith, D.J., Simmonds, H.A., Carrey, E.A.,;1; 2007. 4-pyridone-3-carboxamide ribonucleoside triphosphate accumulating in erythrocytes in end stage renal failure originates from tryptophan metabolism. Clin Exp Med 7(4), 135-141. Massillon, D., Stalmans, W., van de Werve, G., Bollen, M.,;1; 1994. Identification of the glycogenic compound 5-iodotubercidin as a general protein kinase inhibitor. Biochem J 299 ( Pt 1), 123-128. Pan, L.Z., Ahn, D.G., Sharif, T., Clements, D., Gujar, S.A., Lee, P.W.,;1; 2014. The NAD+ synthesizing enzyme nicotinamide mononucleotide adenylyltransferase 2 (NMNAT-2) is a p53 downstream target. Cell Cycle 13(6), 1041-1048. Pelikant-Malecka, I., Sielicka, A., Kaniewska, E., Smolenski, R.T., Slominska, E.M.,;1; 2015. Endothelial toxicity of unusual nucleotide metabolites. Pharmacol Rep 67(4), 818-822. Pelikant-Małecka, I., Sielicka, A., Kaniewska, E., Smoleński, R.T., Słomińska, E.M.,;1; 2014. 4-pyridone-3-carboxamide-1β-D-ribonucleoside metabolism in endothelial cells and its impact on cellular energetic balance. Nucleosides Nucleotides Nucleic Acids 33(4-6), 338341. Romaszko, P., Slominska, E.M., Orlewska, C., Lipinski, M., Smolenski, R.T.,;1; 2011. Metabolism of 4-pyridone-3-carboxamide-1-β-D-ribonucleoside (4PYR) in rodent tissues and in vivo. Mol Cell Biochem 351(1-2), 143-148. Romaszko, P., Slominska, E.M., Smolenski, R.T.,;1; 2014. Effect of 4-pyridone-3carboxamide ribonucleoside (4PYR)-potential cardiovascular toxin in perfused rat heart. Nucleosides Nucleotides Nucleic Acids 33(4-6), 333-337. Rutkowski, B., Rutkowski, P., Słomińska, E., Smolenski, R.T., Swierczyński, J.,;1; 2012. Cellular toxicity of nicotinamide metabolites. J Ren Nutr 22(1), 95-97. Rutkowski, B., Rutkowski, P., Słomińska, E., Swierczyński, J.,;1; 2010. Distribution of purine nucleotides in uremic fluids and tissues. J Ren Nutr 20(5 Suppl), S7-10. Schram, K.H.,;1; 1998. Urinary nucleosides. Mass Spectrom Rev 17(3), 131-251. Slominska, E.M., Borkowski, T., Rybakowska, I., Abramowicz-Glinka, M., Orlewska, C., Smolenski, R.T.,;1;2014. In vitro and cellular effects of 4-pyridone-3-carboxamide riboside on enzymes of nucleotide metabolism. Nucleosides Nucleotides Nucleic Acids 33(4-6), 353357. Slominska, E.M., Carrey, E.A., Foks, H., Orlewska, C., Wieczerzak, E., Sowinski, P., Yacoub, M.H., Marinaki, A.M., Simmonds, H.A., Smolenski, R.T.,;1; 2006a. A novel nucleotide found in human erythrocytes, 4-pyridone-3-carboxamide-1-beta-D-ribonucleoside triphosphate. J Biol Chem 281(43), 32057-32064. Slominska, E.M., Carrey, E.A., Foks, H., Orlewska, C., Wieczerzak, E., Sowinski, P., Yacoub, M.H., Marinaki, A.M., Simmonds, H.A., Smolenski, R.T.,;1; 2006b. A novel nucleotide found in human erythrocytes, 4-pyridone-3-carboxamide-1-beta-D-ribonucleoside triphosphate. J Biol Chem 281(43), 32057-32064. Slominska, E.M., Orlewska, C., Yuen, A., Osman, L., Romaszko, P., Sokolowska, E., Foks, H., Simmonds, H.A., Yacoub, M.H., Smolenski, R.T.,;1; 2008a. Metabolism of 4-pyridone-3carboxamide-1-beta-D-ribonucleoside triphosphate and its nucleoside precursor in the erythrocytes. Nucleosides Nucleotides Nucleic Acids 27(6), 830-834. Slominska, E.M., Orlewska, C., Yuen, A., Osman, L., Romaszko, P., Sokolowska, E., Foks, H., Simmonds, H.A., Yacoub, M.H., Smolenski, R.T.,;1; 2008b. Metabolism of 4-pyridone-3carboxamide-1-beta-D-ribonucleoside triphosphate and its nucleoside precursor in the erythrocytes. Nucleosides Nucleotides Nucleic Acids 27(6), 830-834. Smolenski, R.T., Khalpey, Z., Osborne, F.N., Yuen, A., Slominska, E.M., Lipinski, M., Lavitrano, M., Rose, M., Yacoub, M.H.,;1;2006. Species differences of endothelial

extracellular nucleotide metabolism and its implications for xenotransplantation. Pharmacol Rep 58 Suppl, 118-125. Smolenski, R.T., Rybakowska, I., Turyn, J., Romaszko, P., Zabielska, M., Taegtmeyer, A., Słomińska, E.M., Kaletha, K.K., Barton, P.J.,;1;2014. AMP deaminase 1 gene polymorphism and heart disease-a genetic association that highlights new treatment. Cardiovasc Drugs Ther 28(2), 183-189. Synesiou, E., Fairbanks, L.D., Simmonds, H.A., Slominska, E.M., Smolenski, R.T., Carrey, E.A.,;1; 2011. 4-Pyridone-3-carboxamide-1-β-D-ribonucleoside triphosphate (4PyTP), a novel NAD metabolite accumulating in erythrocytes of uremic children: a biomarker for a toxic NAD analogue in other tissues? Toxins (Basel) 3(6), 520-537. Tozzi, M.G., Pesi, R., Allegrini, S.,;1;2013. On the physiological role of cytosolic 5'nucleotidase II (cN-II): pathological and therapeutical implications. Curr Med Chem 20(34), 4285-4291.

Fig. 1. Concentrations of ATP in different type of cells after 0, 24, 48 and 72 hours of treatment with 100µM 4PYR. Values represent the mean ± SEM; n=3.

Fig. 2. Concentrations of NAD in different type of cells after 0, 24, 48 and 72 hours of treatment with 100µM 4PYR. Values represent the mean ± SEM; n=3.

Fig. 3. Concentrations of 4PYMP in different type of cells after 0, 24, 48 and 72 hours of treatment with 100µM 4PYR. Values represent the mean ± SEM; n=3.

Fig. 4. Concentrations of 4PYRAD in different type of cells after 0, 24, 48 and 72 hours of treatment with 100µM 4PYR. Values represent the mean ± SEM; n=3.

Fig. 5. Mitochondrial function analysis: A) Profile of the key parameters of mitochondrial respiration. B),D), F) Bioenergetic analysis of HMEC-1 cells after 24, 48 and 72h of treatment with 100µM 4PYR as compared to control, respectively. C), E), F) shows basal respiration, ATP-linked respiration, maximal respiration, spare respiratory capacity, Non-mitochondrial respiration and proton leak in HMEC-1 cells after 24, 48 and 72h of treatment with 100µM 4PYR as compared to control, respectively. Values represent the mean ± SEM; n=3.

Fig. 6. Glycolytic function assay: A) The fundamental parameters of cellular glycolysis. B), D), F) Extracellular acidification rate (ECAR) analysis of HMEC-1 cells after 24, 48 and 72h of treatment with 100µM 4PYR as compared to control, respectively. C), E), F) shows glycolysis, glycolytic capacity and glycolytic reservein HMEC-1 cells after 24, 48 and 72h of treatment with 100µM 4PYR as compared to control, respectively. Values represent the mean ± SEM; n=2

Fig. 7. Concentrations of: A) ATP, B) NAD, C) 4PYMP and D) 4PYRAD after transient silencing of AK and 48h incubation with 100µM 4PYR. Values represent the mean ± SEM; n=3.

Fig. 8. Concentrations of: A) ATP, B) NAD, C) 4PYMP and D) 4PYRAD after transient silencing of NMNAT3 and 48h incubation with 100µM 4PYR. Values represent the mean ± SEM; n=3.

Fig. 9. Concentrations of: A) ATP, B) NAD, C) 4PYMP and D) 4PRAD after transient silencing of NT5C2 and 48h incubation with 100µM 4PYR. Values represent the mean ± SEM; n=3.

Fig. 10. Intracellular enzyme activities of HMEC-1 cells treated with 100µM 4PYR for 0, 24, 48 and 72h: A) ADA, B) PNP and C) AMPD. Values represent the mean ± SEM; n=3.

Fig. 11. Cellular pathways of 4PYR metabolism. Table 1. Target sequences of siRNA for AK, NT5C2, NMNAT3 genes used in experiments.

Enzyme

Target sequence

NMNAT3

AGCCTTGAGTCCCGAGACCAA

ADK NT5C2

TTGGATGCATTGGGATAGATA AACCGAAGTTTAGCAATGGAA

Table 2. Primer sequences for Real-time PCR and knock-down efficiency Forward primer sequences

Reverse primer sequences

knock-down efficiency

NMNAT3

AAGGGAGCGCAAGGTCAAG

AGGTCCGAGAGGGAAACGA

40%

ADK

AGGCAGCGAATCGTGATCTT

GGCCAGCACGGATACATTCA

63%

NT5C2

CGGGTGTTTGTGAACCGAAG

AGGGACTCATACTCTGGGGAC

68%

Cyclophilin ATCTGCACTGCCAAGACTGAG

TDENDOFDOCTD

GAAGGAATGATCTGGTGGTTAAGA

×

Report "Metabolic pathway of 4-pyridone-3-carboxamide-1β-d -ribonucleoside and its effects on cellular energetics"

Your name

Email

Reason -Select Reason- Pornographic Defamatory Illegal/Unlawful Spam Other Terms Of Service Violation File a copyright complaint

Description

Close Send

Our partners will collect data and use cookies for ad personalization and measurement. Learn how we and our ad partner Google, collect and use data. Agree & close