Methanotrophic activity in Carboniferous coalbed rocks

International Journal of Coal Geology 106 (2013) 1–10

Contents lists available at SciVerse ScienceDirect

International Journal of Coal Geology journal homepage: www.elsevier.com/locate/ijcoalgeo

Methanotrophic activity in Carboniferous coalbed rocks Zofia Stępniewska 1, Anna Pytlak ⁎, Agnieszka Kuźniar The John Paul II Catholic University of Lublin, Institute of Biotechnology, Department of Chemistry and Environmental Chemistry, Poland

a r t i c l e

i n f o

Article history: Received 10 September 2012 Received in revised form 5 January 2013 Accepted 6 January 2013 Available online 12 January 2013 Keywords: Methanotrophic bacteria Methanotroph Methane Coalbed rocks Coal Methane oxidation

a b s t r a c t Carboniferous coalbed rocks originating from the Lublin Coal Basin (South-East Poland) were investigated for the presence and activity of aerobic methanotrophic bacteria. Laboratory studies of samples collected from 914 to 1004 m below earth's surface and performed at 30 °C, 100% water capacity (WHC) and 10% v/v headspace CH4 revealed microbial methane oxidation which ranged from 0.13 to 0.75 μM CH4 g−1 day −1. Methanotrophic activity (MA) was also investigated as a function of temperature (5–30 °C), moisture content (25–200% WHC) and substrate concentration (1–30% v/v CH4). The highest MA was recorded at 30 °C, 100% WHC and 20% CH4 v/v, indicating the mesophilic and microaerophilic character of methanotrophic bacteria (MB) present in the coalbed. Lack of detectable MA at 5 and 10 °C shows narrow temperature tolerance of MB, which may result from a long-term isolation of the bacterial habitat and stability of thermal conditions in the coalbed. Cryo-SEM revealed presence in the investigated rocks of bacteria (c.a. 2–2.5 μm long and 0.5–1 μm wide) and spore-like structures (0.5–1 μm in diameter). These observations were confirmed by fluorescence in situ hybridization with probes Mg705 (5′fluoresceine), Mg84 (5′Cy3) and Ma450 (5′Cy5), which showed that enrichments in NMS medium contain types I and II MB of similar size. Identification performed with the use of DNA amplification of 16S rRNA targeted group specific primers confirmed the presence of bacteria belonging to Methylosinus, Methylomicrobium, Methylocystis and Methylocaldum. Here we show that coalbed rocks constitute a habitat for diverse MB. © 2013 Elsevier B.V. All rights reserved.

1. Introduction The global energy market is undergoing unprecedented changes. The main trend is power demand growth which has resulted from the rapid increase in energy consumption in the developing world. World energy consumption is projected to increase by 45% from 2006 to 2030 (International Energy Agency, 2008). In some countries, the demand for energy will be satisfied by its production from renewable sources, albeit it is clear that a substantial part of the world will still generate conventional, coal-derived energy. Within the next decades, exploitation of coal will be carried out from deeper seams and will be even more problematic than today due to higher lithostatic pressure, temperature and methane danger. Along with safety issues, economic reasons will push the coal mining industry towards new technologies that will allow for the release of energy stored in coalified organic matter. One of the more promising technologies is recovery of natural gas through secondary biogenic methane generation (Midgley et al., 2010).

⁎ Corresponding author. Tel.: +48 81 445 46 23; fax: +48 81 445 46 11. E-mail address: [email protected] (A. Pytlak). 1 Present address: The John Paul II Catholic University of Lublin, Institute of Biotechnology, Department of Chemistry and Environmental Chemistry, Ul. Konstantynów 1i, 20-708 Lublin, Poland. 0166-5162/$ – see front matter © 2013 Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.coal.2013.01.003

A diversity of microbes involved in methane generation and different factors that may influence methanogenesis in subsurface coal beds were recently a subject of investigations carried out on various rank coals originating from North American and Australian coal basins (Flores, 2008; Jones et al., 2008; Midgley et al., 2010). The 16S rRNA sequences amplified from DNA extracted from various coals indicate that the subsurface is inhabited by a wide range of bacterial and archeal species putatively building a consortium that acts synthropically to degrade coal (Green et al., 2008; Midgley et al., 2010). Methane produced from coal may be stored inside the seam (adsorbed or trapped in pores) or transported to the surrounding rock formations. Geological and hydrological factors influencing migration of gases in coal deposits were extensively described by Scott (2002); however, little attention was paid to the fact that certain microorganisms, namely methanotrophic bacteria, may have an adverse effect on the recovery of coalbed methane. This is because methane is one of the principal energy sources available for bacteria in underground environments. Microbiological research of deep and ultra-deep subsurface oil-field groundwaters, basaltic and granitic aquifers as well as dolomite formations has confirmed the presence of phylogenetically diverse methanotrophic populations (Kotelnikova, 2002). In spite of these reports the recognition of methanotrophs associated with coal-bearing environments is very limited. Besides being an important energy source, methane is also a potent greenhouse gas; therefore, its cycling in surface environments

2

Z. Stępniewska et al. / International Journal of Coal Geology 106 (2013) 1–10

has been studied in detail in recent years (e.g., Blazewicz et al., 2012; Yue et al., 2007). These studies, carried out in various terrestrial and aquatic environments, suggest that there is a close relationship between methanogenic and methanotrophic communities and that a substantial proportion of methane produced by anaerobes in wetlands, paddy soils or anoxic sediments does not reach the atmosphere, because it is consumed in situ by overlying methanotrophic consortia. Furthermore, it was found that also emissions of thermogenic methane e.g., from mud volcanoes and hydrothermal vents are reduced by methanotrophic bacteria (Schubert et al., 2006). Biological methane oxidation can take place in both oxic and anoxic conditions. Preferably, molecular oxygen is utilized as a terminal electron acceptor and thus in surface terrestrial and aerated aquatic environments, methane is oxidized aerobically by a wide range of bacterial species belonging to α-, γ- Proteobacteria or Verrucomicrobia (Pol et al., 2007). Anaerobic oxidation of methane (AOM), coupled with sulfate, manganese and iron reduction, is known to regulate methane flux from anoxic marine sediments and is used by microbial consortia consisting of cooperating bacterial and archaeal species (Beal et al., 2009). On the other hand, eutrophic freshwaters were found to be a habitat of a novel microorganism — “Candidatus Methylomirabilis oxyfera”, capable of denitrificationdependent methane oxidation (Ettwig et al., 2010). Unlike in aquatic environments, identification of the factors that determine microbial activity in terrestrial subsurface is much more difficult, mainly due to inaccessibility of these habitats (Kotelnikova, 2002); however, research carried previously the on the coalbed rock revealed that the LCB Carboniferous stratum is characterized by high redox potential, implying availability of molecular oxygen as terminal electron acceptor for methane oxidation (Stępniewska and Pytlak, 2008a). These measurements are in agreement with publications on the presence of aerobic methane-oxidizing bacteria in formation waters of the Donets Coal Basin (Ivanov et al., 1978; Nazarenko et al., 1974) and lignite-bearing formations of the central Japan (Mills et al., 2010); however, information about methanotrophic microorganisms inhabiting coal-surrounding rocks is scarce. Some of our previous studies (Stępniewska and Pytlak, 2008a, 2008b) showed methane oxidation by coalbed rocks in different parts of the Lublin Coal Basin (LCB), one of the major coal basins in Poland, which is characterized by very low methane content. It is important to extend our knowledge of this phenomenon due to the fact that methanotrophic bacteria may exert a negative influence on the accumulation of coalbed methane and thus affect its recovery if drilling allows oxygen to enter into the coal-bearing formations. The general aim of the study was to gather new information about microbial activity in the LCB Carboniferous stratum through specific research goals which included: - Derivation of the distribution of the methanotrophic activity in rocks surrounding two deep coal seams (382 and 390), - Determination of optimum environmental conditions for bacterial methane oxidation in coalbed rocks, and - Identification of methane-oxidizing bacteria inhabiting coalbed rocks using microscopic (cryo-SEM) and molecular biology methods (FISH, PCR).

LCB is an epi-platform, molasse basin, developed as a pericratonic depression within the East-European Platform. The coal-bearing lithostratigraphic sequence of the LCB is of polygenetic origin: the lower part (Mississippian) is marine-paralic, the middle part (Bashkirian) is paralic, and the upper part (Moscovian) is continental (limnic) (Fig. 1) (Kotarba, 2001; Kotarba and Clayton, 2003). In the investigated part of the LCB, Carboniferous (Late Bashkirian– Early Moscovian) stratum is located at the depth of about 700 m.b.s (meters below surface) below thick and water-saturated Jurassic Cretaceous sediments. There are some 50 coal seams with thickness ranging from 0.05 to 3.8 m and accompanied by claystones and mudstones. Coalbed gas in the area is present in very small amounts and consists mainly of CH4 (14.4–76.9%), CO2 (3.9–7.4%) and N2 (18.7–76.2%) (Kotarba, 2001). 2.2. Sample collection and processing Coalbed rock samples were obtained courtesy of the Lubelski Węgiel “Bogdanka” SA from formations surrounding seam nos. 382 (912 m below surface) and 390 (999 m below surface). Seam no. 382 is one of currently exploited levels; therefore, the pieces of rocks were hammered manually from the bottom, roof and parting of the seam, directly after their excavation by mining operations. Samples of the rocks surrounding seam no. 390 originated from the cores drilled from the level of the seam no. 385/2 using a standard water-cooled device. After excavation, rocks were put into polyethylene bags, transferred to the laboratory, and subdivided into smaller samples for analysis. 2.3. Experiment design The experiments were designed to enable investigation of the combined effects of moisture (25–200% water capacity — WHC), temperature (5–30 °C) and methane concentration (1–30% v/v) on methanotrophic activity (MA) in the coalbed rocks. Samples (15 g) assigned for the determination of MA were crushed to less than 2 mm in diameter and placed in dark bottles (60 cm3), 15 g of each. Adequate moisture was obtained by addition of an appropriate volume of deionized water. Samples were then closed with rubber septa, capped with an aluminum cap and sealed with paraffin. An initial concentration of CH4 was obtained by replacing an appropriate volume of air with high purity (99.99%) methane (Praxair, Poland) using a gastight syringe (5 ml, SGE, Australia). Incubations were launched in a thermostatic chamber (PolEko, Poland) within 5 days of collecting the samples (PolEko, Poland). Before microbiological analysis, large pieces of rock (approximately 10 cm in each dimension) were irradiated by a UV lamp on each side for 20 min, then immersed in ethanol and immediately ignited by a gas burner. The last step was repeated twice. Afterwards, the holes were drilled by a sterile drilling machine and the resulting powder was placed inside sterile bottles. To achieve adequate moisture (100% WHC) and CH4 concentrations in the headspace (10% v/v), sterile water and CH4 were added as described above. Rocks, aseptically incubated for 30 days were then used for DNA isolation and to set up an enrichment culture on nitrate minimal salt (NMS) medium (Whittenbury et al., 1970).

2. Material and method

2.4. Coalbed rocks characteristics

2.1. Site description

Before physical and chemical analyses, rock samples were crushed to less than 2 mm. Moisture of the rocks was determined gravimetrically by drying at 105 °C to constant weight directly after collecting the samples. The water capacity (WHC) of each rock was determined in plastic cylinders by saturating the ground rock material with deionized water up to a constant weight.

LCB is located in the East of Poland and is one of the three major coal basins in the country covering an area of approximately 9100 km2. LCB is in the very early stage of exploration with only one active coal mine (Lubelski Węgiel “Bogdanka” SA).

NW Europe

SILESIAN

WESTPHALIAN

D C B

C

A

MARINE-PARALIC

NAMURIAN

SERPUKHOVIAN

B

MISSISIPIANIAN

LITHOSTRATIGRAPHIC UNITS

THICKNESS (M)

MAGNUSZEW FORMATION

TO 800

LUBLIN BEADS

A PARALIC

MOSCOVIAN BASHKIRIAN

PENNSYLVANIAN

ICS

CONTINENTAL (LIMNIC-FLUVIAL)

STRATIGRAPHIC SCALE

COAL-BEARING FORMATIONS

Z. Stępniewska et al. / International Journal of Coal Geology 106 (2013) 1–10

KUMÓW BEADS

OCCURENCE OF COAL SEAM (NUMBER SYSTEM OF CLASSIFICATION-SYNONYMY OF SEAMS)

BUG BEADS

FROM 30 (NW PART OF BASIN) TO 260 (S PART OF BASIN)

KOMARÓW BEADS

FROM 25 (N PART OF BASIN) TO 530 (S PART OF BASIN)

SAMPLED COAL SEAM

A FEW THIN COAL SEAMS

(300) FROM 90 (MARGINAL 50 COAL SEAMS PARTS OF BASIN) THICKNESS RANGES TO 900 (CENTRAL FROM 0,1 TO 3,8 m PART OF BASIN)

FROM 86 (N PART OF BASIN) TO 360 (CENTRAL PART OF BASIN)

3

382 390

(200) 14 COAL SEAMS THICKNESS RANGES FROM 0,05 TO 1,5 m

(100) 15 COAL SEAMS THICKNESS RANGES FROM 0,2 TO 0,4 m

A FEW THIN COAL SEAMS

Fig. 1. Lithostratigraphic profile of the Lublin Coal Basin showing location of the sampled coal seams (after: Kotarba and Clayton, 2003, Heckel and Clayton, 2006).

Eh and pH values were determined after full saturation of the ground rock material with water using a pIONeer 65 multichannel analyzer (Radiometer Analytical, France) equipped with a combined electrode for pH and a swell platinum electrode for redox potential measurements (Radiometer Analytical, France). Total carbon, organic carbon and inorganic carbon amounts were determined using TOC-VCSH equipped with a solid sample analysis kit SSM-5000A (Shimadzu, Japan) in rock materials that were fine ground, homogenized and dried for several days at ambient temperature in a desiccator. The total carbon (TC) content was determined by dry combustion method at 900 °C with V2O5 as an additional oxidizing factor. Inorganic carbon (IC) was detected following the treatment of rock with acid (25% H3PO4) and high temperature (200 °C). Total organic carbon (TOC) content was calculated from the difference between TC and IC. Concentrations of biogenic nitrogen and phosphorus were determined using an AutoAnalyzer3 (Bran & Luebbe, Germany). Samples of rocks, representative for particular levels of Carboniferous coalbearing strata, were fine milled to a maximum grain diameter of 0.1 mm (Retsch, Germany). Each extraction was performed with the use of 5 g (dry weight) of rock (randomly collected from 1 kg of the homogenized sample) and 50 ml of extractant solution. Nitrate (NO3−) and nitrite (NO2−) were extracted with deionized water in a rotary shaker for 0.5 h and the extracts filtered through a Munktell filter (84 g/m 2). Determination of nitrites was accomplished using the reaction with sulphanilamide and N-(1-naphtyl) ethylenediamine dihydrochloride, and the product was measured at 550 nm. Phosphoric acid was added at the reduction stage to lower the pH, in order to avoid the precipitation of calcium and magnesium hydroxide. The addition of zinc to the reducing agent suppressed the complexation of copper by organic material. Nitrates were analyzed

after previous reduction to nitrites by hydrazine in alkaline solution with a copper catalyst. Ammonium (NH4+) was extracted with 0.2 M NaCl, shaken, filtered as previously described, and determined by reacting the sample with salicylate and dichloroisocyanuric acid to produce a blue compound measured at 660 nm. Nitroprusside was used as a catalyst. Ortho-phosphates (PO43−) were extracted in a rotary shaker for 1 h with 0.5 M NaHCO3, filtered as previously, and detected through reaction with molybdate and ascorbic acid to form a blue compound measured at 660 nm. Antimony potassium titrate was used as a catalyst. 2.5. Chromatographic analyses The headspace concentrations of gases (CH4, CO2, O2) were determined using a gas chromatograph (3800 GC Varian, USA) equipped with flame ionization (FID) and thermal conductivity (TCD) detectors. Gases were separated on Molecular Sieve 5A, 0.53 mm ID, 30 m in length and Poraplot Q, 0.53 mm ID, 25 m length columns (Varian, USA) using helium as the carrier gas. The analyses were carried out under the following conditions: injector temperature 120 °C, oven temperature 40 °C, temperature of detectors: 120 °C and 200 °C for TCD and FID, respectively. Oxygen levels during incubation were controlled and periodically readjusted to saturating conditions, depending on the current methane mixing ratio. Incubation times varied depending on the activity of the sample and included 8 to 10 measurement points. Linear, multipoint (5–9 points) calibration curves were constructed for each assayed gas using mixtures containing increasing amounts of high quality standards. The gases used for the experimental were obtained from AirProducts Sp.z.o.o. (Poland) or Praxair (USA). Accuracy of the calibration curves was checked routinely with each series of samples.

4

Z. Stępniewska et al. / International Journal of Coal Geology 106 (2013) 1–10

Methanotrophic activity (MA) (μM CH4 g−1 day−1) was calculated from the slope of the regression line of the measured CH4 molar amounts vs. time. Adjustment factors of the curves were ≥0.95.

2.6. Scanning electron microscopy Samples were prepared for cryo-SEM by mounting them onto copper holders and plunging into liquid nitrogen slush at − 207 °C. Frozen specimens were transferred under vacuum into an attached preparation chamber where they were fractured with a cold scalpel blade. The specimens were then etched at 80 °C for 5 min, coated with 300 Å of sputtered gold, transferred under vacuum onto the cold stage, maintained at –140 °C and imaged using SEM (Zeiss Ultra Plus, Germany) at 3 kV.

2.7. Fluorescence in situ hybridization (FISH) FISH was performed according to Eller et al. (2001) with minor modifications using enriched rocks and cells originating from 10-day enrichment cultures on NMS (10% CH4, 30 °C, 200 rpm). As the hybridization signal in rock samples could not be easily distinguished from the non-specific autofluorescence of rock particles and detritus fragments, probably due to high binding of the probes, only the results obtained from the enrichment cultures are presented. The cultured cells were harvested by centrifugation at 13,000 ×g for 5 min and resuspended in 100 μl of phosphate-buffered saline (PBS, pH 7.0). Fixation was performed at room temperature for 3 h after addition of 300 of μl 4% paraformaldehyde (in PBS). Until hybridization, the rock materials and cells were stored at − 20 °C in 50% ethanol in PBS. The hybridization was carried out on 10-well coated slides where 1–2 μl of fixed rocks or cell suspensions were transferred and left to dry at room temperature for 2 h. Before dehydration which was performed by washing slides in 50, 80, and 96% ethanol for 3 min each, autofluorescence of the rocks was quenched with 10 μl of 0.01% toluidine blue in PBS. Wells were covered with 10 μl of hybridization buffer (Tris 2.4 g l −1, SDS 2.0 g l −1, EDTA 2.0 g l −1, NaCl 0.9 M, pH 7.4, 20% formamide) and 1 μl of the probe solution (50 ng μl−1) was added to each well. Hybridization in a water saturated atmosphere chamber (Memmert, Germany) was carried out for 3 h at 46 °C. Specificity of the probes applied was presented in Table 1. Unbound oligonucleotides were removed by rinsing the slides with 20 ml washing buffer (Tris 2.4 g l−1, SDS 2.0 g l−1, EDTA 2.0 g l−1, NaCl 26.3 g l−1, pH 7.4) prewarmed to 48 °C. Subsequently, the slides were incubated in the remaining washing buffer for another 20 min at 48 °C, air-dried and mounted with Vectashield Mounting medium containing DNA-staining DAPI (4′,6-diamidino-2-phenylindole) (Vector Laboratories, USA). The slides were analyzed using fluorescence with a Nikon Eclipse 80i research microscope. The pictures were taken with Digital Sight camera (Nikon) and processed with the software provided by the manufacturer. The images were captured in three channels (blue — nuclear counterstain, bright red (shown as green) — Cy3 and red — Cy5) and superimposed using camera software.

2.8. DNA isolation and PCR Prior to DNA isolation, aseptically collected rocks were incubated for 30 days at 10% CH4. Approximately 5 g of the rock collected was mixed with 10 ml of extraction buffer (100 mM Tris HCl, pH 8.0, 100 mM EDTA, pH 8.0, and 1.5 M NaCl) and 2 g of 0.1 mm glass beads (Sigma-Aldrich) in a 25 ml stainless steel grinding jar. The samples were milled for 1 min at 25 Hz in the Mixer Mill MM200 (Retsch, Germany). The ground rock was removed and cells in the supernatant pelleted and subjected to lysis using GES solution (5 M guanidine thiocyanate, 100 mM EDTA, 0.5% sarcosyl (pH 8)). DNA was purified using an ice-cold solution of ammonium acetate (7.5 M) and subsequently chloroform:isoamyl (24:1) mixture and cell debris removed by centrifugation. DNA was precipitated at −20 °C with isopropanol for 2 h, pelleted by centrifugation at 17,500 ×g for 30 min, rinsed 5 times with 70% v/v ethanol and resuspended in 30 ml of ultrapure, DNAse free water. Excluding the mechanical disruption step, the same protocol was adopted for cells harvested from 10-day old enrichment cultures in NMS. Identification of the methane-oxidizing bacteria was performed based on 16S rRNA sequences amplified with the use of a wide range of group-specific genetic probes for detecting methanotrophic bacteria: Ms1020, Mm1007, Mc1005, Mb1007 (Holmes et al., 1999), Mh996, MbII884, Type2b (Kalyuzhnaya et al., 2002) and Mm835 (Costello and Lidstrom, 1999) used in conjunction with f27 (Murrell et al., 1998). These primers cover the majority of methanotrophic diversity and were used in various studies to screen diversity of methanotrophic bacteria. The amplification program consisted of a 2 min melt preceding 10 cycles of 95 °C for 40 s, 53 °C for 40 s, 72 °C for 40 s, followed by 20 cycles of 95 °C for 40 s, 58 °C for 40 s, 72 °C for 40 s and a final 5 min extension at 72 °C. Negative controls were included in all experiments by replacing the DNA template with 2 μl of sterile water. PCR products were analyzed by 1% agarose gel electrophoresis, purified with a QIAquick PCR Purification Kit (Qiagen, USA) and sequenced at Genomed sp. Z.o.o. (Warsaw, Poland). DNA sequences were used as queries to search for homologous sequences in GenBank with the program BLASTn. 2.9. Statistical analysis Statistical analyses were performed using Statistica 9 (STATSOFT, USA). The significance of differences between bottom and roof rocks as well as CH4 concentrations at various stages of the experiment were tested at the level of p b 0.05. Homogeneity of variances and distributions was assessed using Brown–Forsyth and Shapiro–Wilk tests, respectively. Parametric data were further analyzed with oneway ANOVA, whereas non-parametric with Kruskal–Wallis test. 3. Results 3.1. Coalbed rock characteristics The investigated material consisted of fine grained sedimentary rocks. Samples collected from the bottom and roof parts of the coal seams were massive clay and mudstones containing siderite

Table 1 Fluorescent-labelled probes targeting type I and type II methanotrophs applied in this study. Probe

Mg705

Mg84

Ma450

Specifity towards methanotrophic bacteria Sequence 5′-3′ Target gen Fluorescent dye 5′

Type I CTGGTGTTCCTTCAGATC 16S rRNA Fluoresceine

Type I CCACTCGTCAGCGCCCGA 16S rRNA Cy3

Type II ATCCAGGTACCGTCATTATC 16S rRNA Cy5

Z. Stępniewska et al. / International Journal of Coal Geology 106 (2013) 1–10

Table 2 Fresh coalbed rock characteristics (the values in parentheses represent the standard deviation among three replicates). Sample

Seam location 382

Lithology Depth (m b.s.) Depth (m b.s.l.) Moisture (%) WHC (g/100 g) pH Eh (mV) IC (%) TOC (%) N-NO3 (mg/kg) N-NO2 (mg/kg) N-NH4 (mg/kg) P-PO4 (mg/kg)

390

BT

PR

RF

RF

BT

Claystone −914.4 −708.00 0.74 (0.16) 28.58 (0.48) 8.93 (0.11) 417.77 (17.90) nd – 1.11 (0.00) 0.78 (0.01) 0.39 (0.02) 39.45 (4.47) 6.61 (0.23)

Coal shale −913.8 −707.40 2.65 (0.57) 47.24 (1.31) 7.75 (0.02) 484.43 (5.87) nd – 16.38 (0.03) 1.14 (0.04) 0.57 (0.01) 43.69 (4.59) 0.87 (0.04)

Claystone −911.4 −705.00 0.74 (0.16) 29.53 (1.61) 8.47 (0.16) 404.42 (16.02) 0.55 (0.00) 1.46 (0.03) 0.96 (0.01) 0.30 (0.01) 43.56 (5.04) 1.53 (0.10)

Claystone −996.9 −790.55 0.61 (0.34) 26.79 (1.22) 8.56 (0.45) 425.73 (26.15) 1.60 (0.00) 2.00 (0.08) 0.37 (0.04) 0.46 (0.11) 28.57 (0.14) 2.15 (0.28)

Mudstone −1000.4 −794.00 0.65 (0.36) 29.77 (0.86) 8.57 (0.25) 414.72 (44.03) nd – 1.58 (0.02) 0.67 (0.06) 0.30 (0.04) 96.61 (0.24) 3.66 (0.08)

BT — bottom, RF — roof, PR — parting, nd — not detected, m.b.s — meters below surface, m.b.s.l. — meters below sea level.

3.3. Temperature and moisture effect on methane oxidation Environmental requirements of the methanotrophic bacteria inhabiting coalbed rock, in relation to temperature and moisture, were investigated in the rock 382-SP. The highest methane oxidation was found at 30 °C (Fig. 4). Decreases in temperature to 20 °C resulted in only minor reduction of the methane oxidation in the coalbed rock; however, further cooling to 10 °C completely inhibited activity of the methanotrophs, which suggests that the coalbed rocks are inhabited by methanotrophs with a narrow temperature tolerance, unable to oxidize methane below 10 °C. The stenotopic character of the methanotrophic populations in the coalbed may be explained by their long-term isolation and the stability of thermal conditions, dependent mostly on the geothermal gradient of the earth's crust. Moisture content proved to be a dominant factor impacting aerobic microbial activity of the coalbed rocks. The highest methane oxidation rates were found at 100% WHC, both at 20 and 30 °C.

RF 382

Methane oxidation activity was found in all of the five investigated rocks and ranged from 0.13 to 0.75 μM CH4 g −1 day −1 at 10% CH4, 100% WHC and 30 °C (Fig. 2). There was no statistical difference between methanotrophic activity of the rocks surrounding the two investigated coal seams (p = 0.385); however, rates of methane oxidation were measured under laboratory conditions over the incubation time. Initially, there was a lag phase lasting 5 to 10 days, after which, a decrease in the concentration of CH4 and O2, followed by

Sample location

3.2. Methane oxidation

an increase in CO2 mixing ratio, was observed. Methane oxidation rates then grew exponentially reaching their maximum at 10–30 days when substrate limitation occurred (Fig. 3). On day 30, in each sample of fresh rock, CH4 concentrations were significantly (pb 0.05) lower than in the beginning of the experiment. Parallel incubations performed with the autoclaved rock samples did not show significant consumption of methane, which infers the biological character of the process. Complete methane depletion (MD), in case of the rocks collected from both seams, occurred first in the roof samples (after about 30 days). The time required for MD by the floor and parting rocks was almost twice as long (50–60 days) (Fig. 3). This phenomenon may be explained by the fact that the majority of methane, which is a two times lighter gas than air, migrates from coal seams to the surface. As a consequence, methanotrophs present in the formations covering coal seams might have received a considerably higher proportion of their substrate, which enabled development of more active species or more dense populations of the methane-oxidizing bacteria compared to the rocks found under the coal seam. Differences between methanotrophic activity of the tested bottom and roof rocks, especially in surrounding of the seam 390 (Fig. 2), could not be attributed to the influence of physical and chemical factors such as pH or nutrient availability. These parameters were not affected significantly (p>0.05) by sample location. According to the statistical analysis, only the rock 382-PR collected from the parting of the seam differed significantly from the other samples and was characterized by the higher TOC content. Organic matter modified the rock structure which resulted in its elevated porosity and, as a consequence, higher humidity and water capacity than those for the other samples.

PR BT

390

concretions and coalified plant fragments. TOC and IC concentrations in these formations were low, reaching from 1.1% to 2% in 382-BT and 390-RF, respectively. In contrast, parting of the seam 382 (382-PR), was built of a coal-shale containing a substantial proportion of vinitrite and characterized by high fissility. TOC concentrations in this rock were almost 10 times higher than in the other samples. Another parameter differentiating 382-PR, was high redox potential, which was high, exceeding by 60–80 mV the values in the remaining samples. All rocks were characterized by very low moisture which ranged between 0.61 and 2.65%. Moisture content remained in tight relationship with lithology and TOC concentration, and was 3–4 times higher in parting of the coal seam 382 than in the bottom and roof samples. Nutrients (concentration of available N and P) and pH of the rocks were not affected by rock location and type. Values characterizing the described parameters are summarized in Table 2. Availability of molecular oxygen as terminal electron acceptor in the coalbed rocks, seems to be confirmed by redox potentials of the samples, which were always above 400 mV (Table 2). Such values are considered to be characteristic of environments where O2/H2O redox couple functions (Schlesinger, 1997). Concentrations of the oxidized nitrogen (Table 2) and sulfur forms (b 0.005%) (Stępniewska and Pytlak, 2008a) are considered to be too low to effectively support growth of the AOM; however, their past activity cannot be excluded. This hypothesis should be validated using, isotopic measurements of the carbonates present in the coalbed rocks.

5

RF

BT 0,0

0,5

- coal body

1,0

1,5

MA [μM

2,0

2,5

CH4g-1day-1]

Fig. 2. MA of coalbed rocks collected from the bottom (BT), roof (RF) and parting (PR) of the seam 382 and 389. Error bars represent standard deviation from 3 replicates.

6

Z. Stępniewska et al. / International Journal of Coal Geology 106 (2013) 1–10

Fig. 3. Dynamics of CH4, O2 and CO2 during incubation of the coalbed rocks at 30 °C and 100% WHC. Each point represents the mean of three independent replicates. Bars indicate standard deviations (n = 3).

Oxygen solubility in water is very low, and thus the optimum moisture indicates that the methanotrophic bacteria present in coalbed rocks, are microaerophillic, which is characteristic of low affinity

methanotrophs. These types of bacteria are commonly found at oxic/anoxic interfaces and are capable of utilizing methane at high concentrations, even with limited oxygen supplies (Amaral and

Fig. 4. A-methanotrophic activity (MA) and B-time required to recover activity by the bacteria after desiccation (TA) during incubation of rock samples at different temperature and moisture.

Z. Stępniewska et al. / International Journal of Coal Geology 106 (2013) 1–10

Knowles, 1995; Brune et al., 2000). Typical habitats occupied by low affinity methanotrophs are freshwater and marine sediments. On the contrary, high affinity is characteristic to soil methanotrophs exposed to methane at low, atmospheric concentration (about 2 ppm) which find their optimum at much lower moisture (20–30% WHC) (Schnell and King, 1996). Requirements for moisture determined for the methanotrophic bacteria inhabiting coalbed rocks differed greatly from the conditions found in situ (Table 2). Water content of the investigated rocks did not exceed 2.65%, and in the BT-382 rock it was only 0.74%, which was less than 3% of the moisture determined as optimum (Fig. 4). The microaerophilic character of the coalbed bacteria is further supported by the fact that the effect of addition of excess water (200% WHC) decreased MA less than reduction of the moisture content to 50% WHC. The investigated parameters also affected the time required by methanotrophs to recover full activity after desiccation (TA). At optimum moisture (100% WHC) and temperature (30 °C), methane consumption reached a maximum within 15–20 days. Decreases in temperature or moisture resulted in an extension of this time up to 160 days at 25% WHC and 20 °C. At lower temperatures, activity of the methanotrophic bacteria was not observed (Fig. 4). 3.4. Cryo-SEM Following incubation, rocks BT-382 and RF-390 were subjected to cryo-SEM observations which revealed in both samples a rod-shaped bacteria (~ 2–2.5 μm long and 0.5–1 μm wide) present as single cells in loosely organized colonies. The bacteria found in fractures had highly degenerated and irregular appearance and did not possess any adhesion-threads mediating surface and cell-to-cell attachment. Another biological formations found in both rocks during SEM observations were spore-like structures of 0.5–1 μm in diameter. Resting stages (cysts or exospores) are common among methanotrophs and are well documented for the species belonging to type I (Methylomonas, Methylobacter, Methylococcus) as well as type II methanotrophs (Methylosinus, Methylocystis). It is, therefore, possible, that the visualized structures represented resting stages of the bacteria responsible for methane oxidation in the coalbed. 3.5. Fluorescence in situ hybridization Further microscopic observations were made of microorganisms isolated from the coalbed rocks and grown on liquid NMS medium. The combination of oligonucleotide probes Mγ84 and Mγ705 (coupled to Cy3) with Mα450 (marked with Cy5) allowed parallel detection of type I and type II methanotrophs in 382-SP and 390-RF enrichment cultures. Type I cells (shown as green) were short rods, 1–2 μm long and 0.7–1 μm wide, quite uniform in shape and size. Type II methanotrophs were more diverse. The bacterial cells that

7

hybridized with Mα450 represented at least two distinct morphologies: straight (1 μm × 2 μm) and irregular, curved bacilli (0.5× 2 μm) (Fig. 5). During simultaneous observations after DAPI staining, we found that methanotrophic bacteria are accompanied by a number of nonmethanotrophic cells with relative abundances almost equal to the methanotrophic cells. The presence of non-methanotrophic cells in enrichment cultures grown on carbon-deprived NMS medium suggests that if oxygen is available in the coalbed environment, the methanotrophs may also serve as primary producers. It has already been shown that some metabolic substrates of methane oxidation are produced and excreted by methanotrophs and may serve as carbon sources for aerobic or anaerobic, denitrifying bacteria (Costa et al., 2000; Lee et al., 2001). It is also possible that some methanotrophic species that are present in the coalbed are unique and escape detection by the currently available set of oligonucleotide probes, which are designed on the basis of the DNA sequences usually obtained from surface (e.g., soil) and aquatic (e.g., lake water) environments. Size and shape of the specimens visualized by FISH and cryo-SEM were similar; however the bacteria grown in artificial culture were more regularly shaped compared to the specimen observed in cryo-SEM preparations of the coalbed rocks. These differences may result from the pleomorphic character of the observed bacteria. Pleomorphism is a common feature of many methanotrophic species, e.g., belonging to genera Methylocaldum and Methylocystis (Trotsenko et al., 2009) or may result from the environment in which the bacteria are grown. 3.6. Identification Unfortunately isolation directly from the coalbed rocks did not give satisfactory DNA yields. Nucleic acid amounts were too small for UV detection and in PCR amplifications gave negative results. The reason of failure in DNA isolation might be mineralogical composition of the coalbed rock, which are build in about 70% of kaolinite and illite (Wiśniewska et al., 2008), minerals with high binding affinity to nucleic acids, over 700-times higher than quartz (Lorenz and Wackernagel, 1994). Positive PCR results were obtained with the use of Ms1020, Mm1007, MbII884 and Type2b oligonucleotides coupled to 27f standard primer. Sequences retrieved from the cultures inoculated with the investigated rocks 382-BT and 390-ST showed high levels of identity with 16S rRNA gene of the methanotrophs as well as some unculturable delta and gamma Proteobacteria. As expected, sequences of PCR products obtained with the use of primers Mm1007 and MbII884 were highly similar to type I methanotrophic bacteria, namely genera: Methylocaldum and Methylomicrobium, whereas amplicons obtained with primers Ms1020 and Type2b were revealed similarity to type II methane oxidizers. The latter group was represented by various

Fig. 5. Fluorescence in situ hybrydisation of type I and II methanotrophs enriched on NMS medium (30 °C, 10% CH4 v/v, 200 rpm) from: A - 382-BT and B - 390-ST. Bar: 10 μm.

8

Z. Stępniewska et al. / International Journal of Coal Geology 106 (2013) 1–10

Table 3 The closest matches and origin of these matches, from BLASTn queries between 16S rDNA sequences and the GenBank Nucleotide Database for each PCR product. Primer 382-BT MbII884r

Mm1007r

Typer2r

Ms1020r

390-SP MbII884r

Mm1007r

Typer2r

Ms1020 a

Accession

Taxonomic identity

Origin of closest match

% identity

EU275146.1 JQ929024.1 EF446821.1 DQ069211.1 AJ868426.1 EU131042.1 AJ299979.1 AF150783.1 AB504639.1 EU144026.1 AJ458492.1 AJ458491.1 AJ458474.1 AY203751.1 AF150781.1 AJ458492.1 AJ458491.1 AJ458474.1 AY682734.1 AF150781.1

Methylocaldum sp. 05 J-I-7 Methylocaldum sp. Arz-AM-1 Uncultured gamma proteobacterium clone Ev219h1bfT3b36 Uncultured delta proteobacterium clone MAB5 Methylocaldum sp. E10a partial Uncultured bacterium clone SIP CM44 Uncultured gamma proteobacterium M90-D1 Uncultured Methylomicrobium pAMC466 Uncultured bacterium gene for clone: K29C2-5 Methylomicrobium agile strain ATCC 35068 Methylosinus trichosporium strain M23 Methylosinus trichosporium strain O19/1 Methylosinus trichosporium strain IMET 10561 Uncultured Methylocystaceae bacterium clone 9E-T2P17 Uncultured Methylosinus pAMC459 Methylosinus trichosporium strain M23 Methylosinus trichosporium strain O19/1 Methylosinus trichosporium strain IMET 10561 Uncultured proteobacterium clone MLT2-31 Uncultured Methylosinus pAMC459

Landfill upland soil Hot spring Borehole in a deep gold mine Mafic sill-gold mine Soil Alkaline soil from a Chinese coal mine Rice roots of a flooded microcosm Lake sediment Methane oxidizing DHS reactor Freshwater Mangrove roots Marine sediments Liquid manure Basaltic aquifer Groundwater Lake sediment Mangrove roots Marine surface sediment Liquid manure Lake water Lake sediment

99% 99% 99% 99% 98% 99% 99% 98% 98% 98% 100% 100% 100% 99% 99% 99% 99% 99% 99% 99%

EU275146.1 EF446821.1 DQ069211.1 AJ868426.1 EF621539.1 EU131042.1 AJ299979.1 AF150783.1 EU144026.1 EU144025.1 AY682737.1 AJ458474.1 AJ458492.1 AJ458491.1 AF150802.1 –a

Methylocaldum sp. 05 J-I-7 Uncultured gamma proteobacterium clone Ev219h1bfT3b36 Uncultured delta proteobacterium clone MAB5 Methylocaldum sp. E10a Uncultured gamma proteobacterium clone Cl25 Uncultured bacterium clone SIP CM44 Uncultured gamma proteobacterium M90-D1 Uncultured Methylomicrobium pAMC466 Methylomicrobium agile strain ATCC 35068 Methylomicrobium album strain BG8 Uncultured proteobacterium clone MLT2-36 Methylosinus trichosporium strain IMET 10561 Methylosinus trichosporium strain M23 Methylosinus trichosporium strain O19/1 Methylosinus sp. PW1 –

Landfill upland soil Borehole in a deep gold mine Mafic sill-gold mine Soil Biowaste compost Alkaline soil from a Chinese coal mine Rice roots of a flooded microcosm Lake sediment Freshwater Freshwater Lake water Liquid manure Mangrove root Marine surface sediment Lake sediment –

99% 99% 99% 98% 97% 99% 99% 98% 98% 98% 100% 100% 100% 100% 99% –

– sequences could not be retrieved.

culturable and unculturable Methylosinus and Methylocystis species. Reactions carried with the use of Mc1005r, Mh996r, Mb1007, and Mm835 were negative indicating lack of Methylococcus, Methylosphaera and Methylomonas-related species in the culturable part of microbial community inhabiting coalbed rocks. Composition of the methanotrophic community, revealed by similarity between their closest matches in

GenBank (Table 3), was similar in both investigated bacterial cultures. These results are in agreement with the FISH observations described above. Interestingly, some of the related species occupy similar environments to those of coalbed methanotrophic bacteria (e.g., in gold mine) or other kinds of deep subsurface (e.g., basaltic aquifers). 4. Discussion

ε =90

20

40 30

Carbonate reduction (marine, saline)

10

δ13C -carbon dioxide (‰)

55

70

80

C

0

20 Methyl fermentation (freshwater)

-10

Bo-1 Bo-2

-20

Mi

5

-30 Methane oxidation

-40 -50 -100

-90

-80

-70

δ13C 13

-60

-50

-40

-30

-20

-methane (‰)

Fig. 6. Combination plot of δ C-CH4 and δ13 C-CO2 with isotope fractionation lines (εC) (from Whiticar, 1999). Carbon and methane isotopic measures after Kotarba and Clayton (2003). Bo- Bogdanka, Mi- Miechowice.

Methanotrophic bacteria are ubiquitous and present wherever stable methane emissions take place (Hanson and Hanson, 1996); it should come as no surprise that such microorganisms were detected in the coalbed rocks. Results presented in the current work indicate that subsurface environments should receive much more attention since their microbial inhabitants may play an important role in biogeochemical carbon cycling. Methane-oxidizing bacteria present in the coalbed rocks may be one of the factors responsible for CH4 removal from Carboniferous formations. Although their present-day activity in the part of the LCB investigation seems to be limited by insufficient water and oxygen availability, it is possible that environmental conditions in the past were more conductive to biological methane oxidation. The question about the age of the microorganisms, which emerges at this point, cannot be easily answered. The geological age of the coal seams and surrounding rock formations was estimated to be c.a. 300 million years. This age could be considered as the upper age limit for the bacteria present in LCB Carboniferous stratum. Methanotrophs might have already had been present in paleo-swamps that gave rise to the coal seams. Such moist and methane-rich habitats are

Z. Stępniewska et al. / International Journal of Coal Geology 106 (2013) 1–10

nowadays found worldwide and are inhabited by dense methanotrophic populations (Raghoebarsing et al., 2005). Those “native” microorganisms might have survived carbonification as well as long-term burial and still be present in diagenetic rocks that evolved from Carboniferous paleosoils and sediments. Methanotrophs are known from their ability to form persistent resting stages; in fact, most of the bacteria identified in the current study are known to possess such survival skills. Methanotrophic spores/cysts are resistant to heat, desiccation, methane and oxygen deprivation. Their ability to remain viable, even after decades of dormancy, is well documented (Roslev and King, 1995). The key for prokaryotic viability is slow drying that enables cells to produce a spore (Barton, 2005). This condition seems to be fulfilled in the LCB formation as geologic history of the region does not include violent magmatic episodes (Botor, 2007). It has been suggested that in the burial history, the temperatures of the sediments never reached the value irreversibly damaging to microorganisms (Botor, 2007). The survival of bacterial species for such a long time should not come as a surprise as there are known examples of viable bacteria and fungi excavated from 7–8 Ma lignite (Pokorný et al., 2005), 25–40 Ma amber (Greenblatt et al., 1999) and even 250 Ma halite (Vreeland et al., 2000). The lowest age limit of coalbed microorganisms remains uncertain, although it should also lie in geological time scales. Microorganisms could be brought to coal-surrounding formations along with meteoric infiltration, which is believed to be of the most important transport routes for the microorganisms in the subsurface. Such secondary microbial colonization could take place during inversion of the Carboniferous formations at the beginning of the Permian, some 280 Ma and later. Isotope and hydrochemical investigations suggest that waters occurring within Carboniferous strata of the LCB are of paleometeoric origin, therefore theoretically the microbial migration might continue up to 2.5 Ma ago (Kotarba, 2001). It is also likely that during that extended period of time, methanotrophs present in LCB coalbed rocks might have been supplied with nutrients, water and dissolved oxygen from overlying water-rich Jurassic and Cretaceous sediments enabling them utilization of the methane generated from underlying coal seams. This hypothesis seems to be confirmed by the redox potential measurements of the coalbed rocks. Significantly higher Eh of the sample PR-382 compared to less moist rocks indicates that in the coalbed environment water may serve as a carrier of electron acceptors required by aerobic microbiota (Table 2). It was already described by Kotelnikova (2002) that although many subterrain environments seem anoxic, oxygen supplied by water, even at very low concentration supports the growth of aerobic (including methanotrophic) microorganisms. Therefore, it is probable that to some extent the current, very low methane content in LCB Carboniferous stratum results from the prolonged activity of aerobic, methanotrophic bacteria. Another supporting argument for this hypothesis may be deduced from the composition of a coalbed gas. It was shown that gas samples collected in LWB “Bogdanka” SA coal mine contained 14.4–76.9% CH4 with 3.9–7.4% of accompanying CO2 whereas average CH4 concentration in formation of gases collected in USCB coal mines was more than 90%, with 1% CO2. Among USCB coal mine gases, only those collected in the Miechowice coal mine, characterized by close location to the abandoned mine workings (Kotarba, 2001) and infiltration of meteoric waters, had lower CH4 levels (62.9%) and with significantly higher concentration of CO2 (16.7%), which could result from biological methane oxidation. Certain information about the origin of Carboniferous gases may be derived from isotopic composition of carbon dioxide and methane (Whiticar, 1999). Gases collected from LWB Bogdanka (namely Bo-1 and Bo-2) and Miechowice (Mi) were already analyzed by Kotarba and Clayton (2003). Bo-1 and Bo-2 samples had δ13 C-CH4 values of −67.3 and −52.5‰ and δ13 C-CO2 values of −13.7 and −11.9‰ respectively. Compilation of those values with a diagram elaborated by Whiticar (1999) shows that the observed CO2–CH4 carbon isotope partitioning in LCB gas may

9

also partly result from bacterial methane oxidation (Fig. 6). Isotopic CO2–CH4 carbon partitioning also confirms the active role of the methanotrophic bacteria in carbon cycling in the subsurface; however, these analyses should be further confirmed by isotopic analysis of carbonates present in the discussed formations. The presence of methanotrophic bacteria in LCB coal-bearing stratum, as well as isotopic indices from Miechowice coal mine (USCB), suggest that methanotrophic bacteria may be more frequent constituents of the Carboniferous formations than previously thought and that hydrogeological conditions play a crucial role in maintaining their activity. Methanotrophic presence should, therefore, also be considered when planning a drilling for coal bed methane recovery. Acknowledgments The authors acknowledge the Lubelski Węgiel “Bogdanka” SA coal mine for financial support, allowing access to coalbed rock samples and providing information about geological settings of the sampled area. This work was also partially supported by research grants (N N305 111336 and N N305 326939) funded by Polish Ministry of Science and Higher Education. References Amaral, J.A., Knowles, R., 1995. Growth of methanotrophs in methane and oxygen counter gradients. FEMS Microbiology Letters 126, 215–220. Barton, L.L., 2005. Structural and Functional Relationships in Prokaryotes. Springer, New York, p. 820. Beal, E.J., House, C.H., Orphan, V.J., 2009. Manganese- and iron-dependent marine methane oxidation. Science 325, 184–187. Blazewicz, S.J., Petersen, D.G., Waldrop, M.P., Firestone, M.K., 2012. Anaerobic oxidation of methane in tropical and boreal soils: ecological significance in terrestrial methane cycling. Journal of Geophysical Research 117. Botor, D., 2007. Thermal history of the Carboniferous strata in the Lublin Trough (Lublin Coal Basin) constrained by numerical maturity modelling approach. Górnictwo i Geologia 2 (3), 5–15. Brune, A., Frenzel, P., Cypionka, H., 2000. Life at the oxic–anoxic interface: microbial activities and adaptations. FEMS Microbiology Reviews 24, 691–710. Costa, C., Dijkema, C., Fredrich, M., Garcia-Encina, P., Fernandez-Polanco, F., Stams, A.J.M., 2000. Denitrification with methane as electron donor in oxygen limited bioreactors. Applied Microbiology and Biotechnology 53, 754–762. Costello, A.M., Lidstrom, M.E., 1999. Molecular characterization of functional and phylogenetic genes from natural populations of methanotrophs in lake sediments. Applied and Environmental Microbiology 65, 5066–5074. Eller, G., Stubner, S., Frenzel, P., 2001. Group-specific 16S rRNA targeted probes for the detection of type I and type II methanotrophs by fluorescence in situ hybridisation. FEMS Microbiology Letters 198, 91–97. Ettwig, K.F., Butler, M.K., Le Paslier, D., Pelletier, E., Mangenot, S., Kuypers, M.M.M., Schreiber, F., Dutilh, B.E., Zedelius, J., De Beer, D., Gloerich, J., Wessels, H.J.C.T., Van Alen, T., Luesken, F., Wu, M.L., Van De Pas-Schoonen, K.T., Op Den Camp, H.J.M., Janssen-Megens, E.M., Francoijs, K.J., Stunnenberg, H., Weissenbach, J., Jetten, M.S.M., Strous, M., 2010. Nitrite-driven anaerobic methane oxidation by oxygenic bacteria. Nature 464, 543–548. Flores, R.M., 2008. Coalbed methane: from hazard to resource. International Journal of Coal Geology 35, 3–26. Green, M.S., Flanegan, K.C., Gilcrease, P.C., 2008. Characterization of a methanogenic consortium enriched from a coalbed methane well in the Powder River Basin, U.S.A. International Journal of Coal Geology 76, 34–45. Greenblatt, C.L., Davis, A., Clement, B.G., Kitts, C.L., Cox, T., Cano, R.J., 1999. Diversity of microorganisms isolated from amber. Microbiology Ecology 38, 58–68. Hanson, R.S., Hanson, T.E., 1996. Methanotrophic bacteria. Microbiological Reviews 60, 439–471. Heckel, P.H., Clayton, G., 2006. The Carboniferous system. Use of the new official names for the subsystems, series, and stages. Geologica Acta 4 (3), 403–407. Holmes, A.J., Roslev, P., McDonald, I.R., Iversen, N., Henriksen, K., Murrell, J.C., 1999. Characterization of methanotrophic bacterial populations in soils showing atmospheric methane uptake. Applied and Environmental Microbiology 65, 3312–3318. International Energy Agency, 2008. World energy outlook. http://www.iea.org/work/ 2008/cop/WEO.pdf (last access 2012.09.07). Ivanov, M.V., Nesterov, A.I., Namsaraev, B.B., Gal'chenko, V.F., Nazarenko, A.V., 1978. Distribution and geochemical activity of methanotrophic bacteria in the waters of coal mines. Mikrobiologicheskiĭ Zhurnal 42, 420–427 (in Russian). Jones, E.J.P., Voytek, M.A., Warwick, P.D., Corum, M.D., Cohn, A., Bunnell, J.E., Clark, A.C., Orem, W.H., 2008. Bioassay for estimating the biogenic methane-generating potential of coal samples. International Journal of Coal Geology 76 (1–2), 138–150. Kalyuzhnaya, M.G., Makutina, V.A., Rusakova, T.G., Nikitin, D.V., Khmelenina, V.N., Dmitriev, V.V., Trotsenko, Yu.A., 2002. Methanotrophic communities in the soils of the Russian Northern Taiga and Subarctic Tundra. Microbiology 71, 227–233 (Translated from Mikrobiologiya 71, 264–271).

10

Z. Stępniewska et al. / International Journal of Coal Geology 106 (2013) 1–10

Kotarba, M.J., 2001. Composition and origin of coalbed gases in the Upper Silesian and Lublin Basins, Poland. Organic Geochemistry 32, 163–180. Kotarba, M.J., Clayton, I.R., 2003. A stable carbon isotope and biological marker study of Polish bituminous coals and carbonaceous shales. International Journal of Coal Geology 55, 73–94. Kotelnikova, S., 2002. Microbial production and oxidation of methane in the deep subsurface. Earth Science Reviews 58 (3), 367–395. Lee, H.J., Bae, J.H., Cho, K.M., 2001. Simultaneous nitrification and denitrification in a mixed methanotrophic culture. Biotechnology Letters 23, 935–941. Lorenz, M.G., Wackernagel, W., 1994. Bacterial gene-transfer by natural genetictransformation In The Environment. Microbiological Reviews 58 (3), 563–602. Midgley, D.J., Hendry, P., Pinetown, K.L., Fuentes, D., Gong, S., Mitchell, D.L., Faiz, M., 2010. Characterisation of a microbial community associated with a deep, coal seam methane reservoir in the Gippsland Basin, Australia. International Journal of Coal Geology 82 (3–4), 232–239. Mills, C.T., Amano, Y., Slater, G.F., Dias, R.F., Iwatsuki, T., Mandernack, K.W., 2010. Microbial carbon cycling in oligotrophic regional aquifers near the Tono Uranium Mine, Japan as inferred from (14C values of in situ phospholipid fatty acids and carbon sources. Geochimica et Cosmochimica Acta 74, 3785–3805. Murrell, J.C., McDonald, I.R., Bourne, D.G., 1998. Molecular methods for the study of methanotroph ecology. FEMS Microbiology Ecology 27, 103–114. Nazarenko, A.W., Nesterov, A.I., Wolkov, A.I., Suslenkov, B.D., 1974. Methane uptake by microorganisms contacting black coal. Prikladnaya Biochimia i Mikrobiologia 10 (5), 741–744 (in Russisan). Pokorný, R., Ojejnikowa, P., Balog, M., Zifeak, M., Holker, U., Jansen, M., Bend, J., Hofer, M., Holencin, R., Hudecova, D., Varecka, I., 2005. Characterisation of organisms isolated from lignite excavated from the Zahorie coal mine (southwestern Slovakia). Research in Microbiology 156, 932–943. Pol, A., Heijmans, K., Harhangi, H.R., Tedesco, D., Jetten, M.S.M., Op den Camp, H.J.M., 2007. Methanotrophy below pH 1 by a new Verrucomicrobia species. Nature 450, 874–879. Raghoebarsing, A.A., Smolders, A.J.P., Schmid, M.C., Rijpstra, W.I.C., Wolters-Arts, M., Derksen, J., Jetten, M.S.M., Schouten, S., Damste, J.S.S., Lamers, L.P.M., Roelofs, J.G.M., Op den Camp, H.J.M., Strous, M., 2005. Methanotrophic symbionts provide carbon for photosynthesis in peat bogs. Nature 436, 1153–1156.

Roslev, P., King, G.M., 1995. Aerobic and anaerobic starvation metabolism in methanotrophic bacteria. Applied and Environmental Microbiology 61, 1563–1570. Schlesinger, W.H., 1997. Biogeochemistry: An Analysis of Global Change, second ed. Academic Press, San Diego. Schnell, S., King, G.M., 1996. Responses of methanotrophic activity in soils and cultures to water stress. Applied and Environmental Microbiology 62 (9), 3203–3209. Schubert, C.J., Coolen, M.J.L., Neretin, L.N., Schippers, A., Abbas, B., Durisch-Kaiser, E., Wehrli, B., Hopmans, E.C., Damsté, J.S., Wakeham, S., Kuypers, M.M.M., 2006. Aerobic and anaerobic methanotrophs in the Black Sea water column. Environmental Microbiology 8, 1844–1856. Scott, A.R., 2002. Hydrogeologic factors affecting gas content distribution in coal beds. International Journal of Coal Geology 50, 363–387. Stępniewska, Z., Pytlak, A., 2008a. Methanotrophic activity of coalbed rocks from “Bogdanka” coal mine south-east Poland. Archives of Environmental Protection 34 (3), 183–191. Stępniewska, Z., Pytlak, A., 2008b. Distribution of methanotrophic activity of carbonaceous rocks from different seams of Bogdanka” coal mine. Polish Journal of Environmental Studies 17 (3A), 550–554. Trotsenko, Y.A., Medvedkova, K.A., Khmelenina, V.K., Eshinimayev, B.Ts., 2009. Thermophilic and thermotolerant aerobic methanotrophs. Microbiology 78 (4), 387–401. Vreeland, R.H., Rosenzweig, W.D., Powers, D.W., 2000. Isolation of a 250-million-year-old halotolerant bacterium from a primary salt crystal. Nature 407, 897–900. Whiticar, M.J., 1999. Carbon and hydrogen isotope systematics of bacterial formation and oxidation of methane. Chemical Geology 161, 291–314. Whittenbury, R., Phillips, K.C., Wilkinson, J.F., 1970. Enrichment isolation and some properties of methane-utilizing bacteria. Journal of General Microbiology 61, 205–218. Wiśniewska, M., Stępniewski, W., Horn, R., 2008. Effect of mineralogical composition and compaction properties of selected minerale likely to be used for landfill construction. In: Pawłowska, M., Pawłowski, L. (Eds.), Management of Pollutant Emission from Landfills and Sludge. Taylor and Francis Group, London, pp. 159–167. Yue, J., Shi, Y., Zheng, X., Huang, G., Zhu, J., 2007. The influence of free-air CO2 enrichment on microorganisms of a paddy soil in the rice-growing season. Applied Soil Ecology 35, 154–162.