Methylation patterns in 5′ terminal regions of pluripotency-related genes in bovine in vitro fertilized and cloned embryos

JOURNAL OF

GENETICS AND GENOMICS J. Genet. Genomics 37 (2010) 297304

www.jgenetgenomics.org

Methylation patterns in 5ƍ terminal regions of pluripotency-related genes in bovine in vitro fertilized and cloned embryos Jie Lan, Song Hua, Hailin Zhang, Yongli Song, Jun Liu, Yong Zhang * Key Laboratory of Animal Reproductive Physiology & Embryo Technology, Institution of biotechnology, College of Veterinary Medicine, Northwest A & F University, Yangling 712100, China Received for publication 5 November 2009; revised 20 January 2010; accepted 10 February 2010

Abstract In order to investigate DNA methylation profiles of five pluripotency-related genes (Oct4, Sox2, Nanog, Rex1 and Fgf4) during bovine maternal to zygotic transition (MZT) in both in vitro fertilized (IVF) and nuclear transfer (NT) embryos, sodium bisulfite sequencing method was used to detect DNA methylation levels, accompanied by the statistical analysis of embryo developmental rates. The results showed that Oct4, Nanog, Rex1 and Fgf4 were respectively demethylated by 25.22% (P < 0.01), 3.84% (P > 0.05), 31.82% (P < 0.01) and 10% (P > 0.05) while Sox2 retained unmethylation during MZT in IVF embryos. By contrast, Oct4 and Rex1 respectively underwent demethylation by 23.04% (P < 0.01) and 6.02% (P > 0.05), and, reversely, Sox2, Nanog and Fgf4 respectively experienced remethylation by 0.84% (P > 0.05), 5.39% (P > 0.05) and 5.46% (P > 0.05) during MZT in NT embryos. Interestingly, the CpG 14 site of Sox2 was specifically methylated in both 8-cell and morula NT embryos. In addition, the development of blastocysts between IVF and NT embryos showed no significant difference. DNA methylation analysis showed that only Oct4 and Sox2 underwent the correct methylation reprogramming process, which may be responsible for the development of blastocysts of NT embryos to a certain extent. In conclusion, the five genes respectively experienced demethylation to different extents and incomplete DNA methylation reprogramming during bovine MZT in both IVF and NT embryos, suggesting that they may be used as indicators for bovine embryo developmental competence. Keywords: bovine; DNA methylation; Fgf4; Nanog; Oct4; Rex1; Sox2

Introduction For embryogenesis, it has close association with DNA methylation. There appears a wave of genome-wide demethylation after fertilization and another wave of global remethylation approximately after morula or blastocyst stage depending on species (Reik et al., 2001; Dean et al., 2003). Moreover, it involves a complicated and delicate gene regulation network, in which stem cell marker genes * Corresponding author. Tel: +86-29-8708 0092; Fax: +86-29-8708 0085. E-mail address: [email protected] DOI: 10.1016/S1673-8527(09)60047-3

harboring CpG islands in the neighborhood of transcriptional start sites play critical roles (Pesce and Scholer, 2001; Kim et al., 2008; Kosaka et al., 2009; Tachibana et al., 2009). According to the previous report that overall methylation level at 2-cell stage could serve as an indicator to assess embryo developmental competence in mouse and that 2-cell stage is regarded as the timing of maternal to zygotic transition (MZT) for mouse (Shi and Haaf, 2002), we inferred that methylation patterns of the stem cell marker genes during MZT may be used as precise indicators of developmental potential for both in vitro fertilized (IVF) and nuclear transfer (NT) embryos on the molecular

298

Jie Lan et al. / Journal of Genetics and Genomics 37 (2010) 297304

level. During bovine embryogenesis, the timing of MZT is considered to be between 8-cell and morula stage. Hence, 8-cell stage in bovine could serve as a prelude to MZT and its failure in reprogramming could lead to developmental arrest to a large extent (Meirelles et al., 2004). It is noteworthy that it is also an inflexion for overall DNA methylation alteration (Dean et al., 2003). Furthermore, it must be pointed out that the fate of bovine embryo is dominated by components of the oocyte cytoplasm prior to 8-cell stage (Meirelles et al., 2004), during which aberrant DNA methylation can hardly affect the embryo development if it could be reprogrammed back to normal at 8-cell stage, suggesting that the 8-cell stage may be the last ‘checkpoint’ before bovine MZT. Up to date, however, there is little data available on methylation patterns of pluripotency-related genes during bovine MZT in both IVF and NT embryos. In the present study, the nearest CpG islands around transcription start site in 5ƍ terminal regions of five ES-cell marker genes (Oct4, Sox2, Nanog, Rex1 and Fgf4) were investigated in IVF 8-cell embryos (IVF8), IVF morulae (IVFm), 8-cell NT embryos (NT8), NT morulae (NTm) as well as donor cells (fetal fibroblast cells, FF) of bovine so as to exhibit their methylation profiles during MZT in both IVF and NT embryos.

Materials and methods Culture of fetal fibroblasts The primary fibroblast culture was established from a 60-day-old Holstein cow fetus obtained from a local abattoir. The method was previously described (Giraldo et al., 2008). Fetal fibroblast cells were frozen and thawed at population doublings (PDs) 4, which later were used for nuclear transfer and DNA extraction.

In vitro maturation of oocytes, IVF and NT Holstein cow ovaries were collected from a local abattoir. The procedure of in vitro maturation of oocytes was carried out according to the previous methods in our laboratory (Hua et al., 2008). For IVF, the procedure was previously described (Wrenzycki et al., 2001). The fresh semen from 12 bulls was provided by KEYUAN Co., Ltd. (Yangling, China). For NT, the traditional method in our

laboratory was followed (Hua et al., 2008). Both the IVF and NT embryos developing to 8-cell and morula were respectively collected and the pooled (25) embryos were prepared for future use. All the collected embryos were of high quality in morphology and obtained from the same production line to eliminate the potential interference factors.

Sodium bisulfite genomic sequencing Extraction of genomic DNA from IVF8, IVFm, NT8 as well as NTm and sodium bisulfite treatment were combined by using EZ DNA Methylation-DirectTM Kit (ZYMO RESEARCH, Los Angeles, USA). Genomic DNA from FF was extracted with TIANamp Genomic DNA Kit (TIANGEN, Beijing, China), followed by quantitation using NanoDropTM ND-1000 spectrophotometer (Thermo Finnigan, America), and finally by sodium bisulfite treatment with EZ DNA Methylation-GoldTM Kit (ZYMO RESEARCH). All the procedures above were carried out strictly following the manufacture’s instructions. The amplification of bisulfite-modified DNA was performed with Zymo TaqTM DNA Polymerase (ZYMO RESEARCH) in a reaction volume of 50 ȝL. Cycling conditions were 95°C for 10 min followed by 40 cycles of 94°C for 30 s, annealing temperature for 40 s and 72°C for 30 s and a final extension of 7 min at 72°C. The primer sets for the five genes were designed according to online software (http://www. urogene.org/methprimer/) with the exception of Oct4 primers described previously (Lin et al., 2008). The details on primer sequences were listed in Table 1. The locations of the CpG islands were indicated in Fig. 1. Given the sampling bias of PCR, three independent PCR reactions were performed. The PCR products were purified using ZymocleanTM Gel DNA Recovery Kit (ZYMO RESEARCH). Then PCR products of three reactions were mixed together and cloned into a pMD18-T vector (TaKaRa, China), followed by verification using PCR. Finally, ten colonies for each sample were sequenced. Each experiment was repeated three times.

Statistic analysis Methylation levels in IVF8, IVFm, NT8, NTm and FF were calculated. Developmental rates to the different stages were respectively determined from the numbers of

Jie Lan et al. / Journal of Genetics and Genomics 37 (2010) 297304

299

Table 1 Primer sequences Gene

Primer sequence (5c ĺ 3c)

Tm (°C)

Fragment size (bp)

GenBank accession No.

Oct4

F: GATTTGGATGAGTTTTTAAGGGTT R: ACTCCAACTTCTCCTTATCCAACTT

54.5

293

NC_007324

Sox2

F: TATTAAAAGAGTAAATTTAAGATTAAGTT R: CAAATTAATAAACAACCATCCATATAAC

55.6

361

NW_001493904

Nanog

F: TTTTTTAATTATAATTTGATGGGGT R: CTAACACACCTTAAATAAACAAACC

52.4

288

NC_007303

Rex1

F: AGTAGTTTGAGGATAGAGGTTAGGG R: ACATACACCTAATAATCTAAAAAATCC

52.4

299

NW_001495362

Fgf4

F: TTTATTTGAAGAAAGTGTATTAAGGGG R: AATACAAATTCAAAAAAATCCTCCTC

52.4

223

NW_001494547

Fig. 1. The locations of the CpG islands and amplified regions in the neighbourhood of transcription start sites (TSS) of five pluripotency-related genes (Oct4, Sox2, Nanog, Rex1 and Fgf4). The black line represents the sequence surrounding TSS and spanning from–1 kb to +1 kb. The black box and the grey box indicate the CpG islands and the amplified regions for bisulfite analysis, respectively. The CpG island features at least 200 bp in length and a G + C content of 50% as well as a CpG frequency (observed/expected) [o/e]) of 0.6 (Illingworth and Bird, 2009). The amplified regions of Oct4, Sox2, Nanog, Rex1 and Fgf4 are +399 to +691, –22 to –382, +450 to +737, +560 to +858 and –62 to +161, respectively.

in vitro fertilized and nuclear transfer embryos. Significant differences were determined by using Chi-square test.

were respectively cultured and their developmental rates were shown in Table 2.

Results

Methylation profiles of the five genes in IVF8, IVFm, NT8, NTm and FF

In vitro development of IVF and NT embryos 264 IVF and 248 NT embryos in good morphology

DNA methylation levels of Oct4, Sox2, Nanog, Rex1 and Fgf4 were shown in Fig. 2. In IVF embryos, Oct4,

300

Jie Lan et al. / Journal of Genetics and Genomics 37 (2010) 297304

Nanog, Rex1 and Fgf4 were respectively demethylated by 25.22% (P < 0.01), 3.84% (P > 0.05), 31.82% (P < 0.01) and 10% (P > 0.05) while Sox2 retained unmethylation during MZT (Fig. 3). In NT8, Oct4, Sox2 and Rex1 showed relatively normal methylation levels while Nanog and Fgf4 exhibited significant hypomethylation compared with that of IVF8 (P < 0.01) (Fig. 4). In NTm, Oct4 and Sox2 also harbored the relatively normal methylation levels (P > 0.05), while the other three genes showed abnor-

malities when compared with that of IVFm, with Rex1 being significantly hypermethylated (P < 0.05) and Nanog and Fgf4 significantly hypomethylated (P < 0.01) (Fig. 4). Collectively, only Oct4 underwent significant demethylation by 23.04% (P < 0.01), while Nanog, Rex1 and Fgf4 experienced slight changes in methylation (P > 0.05) during MZT in NT embryos (Fig. 3). Interestingly, the CpG 14 site of Sox2 in NT embryos kept methylated through MZT, which was not observed in IVF embryos.

Table 2 Developmental process of bovine IVF and NT embryos Embryo

Number

Number of two-cell embryos (percentage, %)

Number of eight-cell embryos (percentage, %)

Number of morulae (percentage, %)

Number of blastocysts (percentage, %)

IVF embryos

264

215 (81.44%)

149 (56.44%)

113 (42.80%)

78 (29.55%)

NT embryos

248

191 (77.02%)

128 (51.61%)

96 (38.71%)

61 (24.60%)

Values in the same column are insignificantly different (P > 0.05).

Fig. 2. The methylation profiles of five pluripotency-related genes. A, B, C, D and E represent Oct4, Sox2, Nanog, Rex1 and Fgf4, respectively. They harbor 23, 24, 13, 22 and 11 CpG sites in the amplified CpG islands, respelfively. Methylation levels are labeled right below. Each line and circle represents a sequencing result and a CpG site, respectively. Open and closed circles indicate unmethylated and methylated CpGs, respectively.

Jie Lan et al. / Journal of Genetics and Genomics 37 (2010) 297304

301

Fig. 3. The diagram showing the differences of methylation levels of five pluripotency-related genes during MZT. The upper and the lower represent IVF and NT embryos, respectively. ** denotes extremely significant differences (P < 0.01).

Fig. 4. The diagram showing the differences of methylation levels of five pluripotency-related genes among IVF, NT and FF. The upper and the lower represent 8-cell and morula stage, respectively. For each gene, the different capital letters denote extremely significant differences (P < 0.01), the different small letters indicate significant differences (P < 0.05) and the same letter represents no significant difference (P > 0.05). There is only significant differences between D* and F* rather than extremely significant differences.

302

Jie Lan et al. / Journal of Genetics and Genomics 37 (2010) 297304

Discussion During bovine preimplantation embryo development, demethylation of both paternal and maternal genome reaches the minimum at the 8-cell stage and then de novo methylation begins to be established (Dean et al., 2001), indicating that there seems to be an increasing trend for global methylation level during MZT. Inversely, our results showed that there was a decreasing trend for methylation levels of the five pluripotency-associated genes in the analyzed regions during MZT in IVF embryos, in which Oct4 and Rex1 showed a significant demethylation, Nanog and Fgf4 exhibited a slight demethylation and Sox2 retained unmethylation. These may be explained by embryonic genome activation, because gene transcription has correlation with DNA methylation particularly in 5ƍ terminal regions (Hohn et al., 1996; Rountree and Selker, 1997; Lawrence et al., 2004). Previous studies reported that both Oct4 and Sox2 had low expressions in bovine 8-cell embryos and relatively high expressions in morulae (Kurosaka et al., 2004; Brevini et al., 2008), and suggested that other three genes may exhibit similar expression patterns due to regulation of their transcriptions by Oct4 and Sox2 (Chew et al., 2005; Rodda et al., 2005; Babaie et al., 2007). Moreover, the amplified regions, as the nearest CpG islands surrounding the transcription start sites, could serve as representatives to better reflect the relationship between DNA methylation and gene expression. Therefore, theoretically speaking, it is necessary to monitor mRNA expression in embryos. Yet, we failed to distinguish embryo-derived transcripts from maternal ones during MZT. It deserves future investigation. Taken together, it is apparent that local methylation level decreases for the five pluripotency-related genes during MZT in IVF embryos, although the global methylation level gradually increases. However, it should be taken into account that the present study was made only on in vitro produced embryos and it is well known that in vitro conditions have profound effects on the epigenetic make-up of embryos. Therefore, results of this study would have to be confirmed by analysis of in vivo derived embryos in future. Since the birth of ‘Dolly’, the fact that only a few of cloned embryos could develop to term after embryo transplantation has been puzzling us (Wilmut et al., 1997; Polejaeva et al., 2000), which to a large extent could be attributed to incomplete reprogramming, particularly DNA

methylation (Kang et al., 2001). In our study, Table 2 showed that there were no significant differences in developmental rates from 2-cell to blastocyst between IVF and NT embryos. Nonetheless, our results displayed incomplete methylation reprogramming of the five ES cell marker genes during MZT in NT embryos, providing the supporting evidence for the idea mentioned above. Since DNA methylation levels of donor cells can have great influences on reprogramming efficiency (Blelloch et al., 2006), methylation patterns of those five genes in donor cells (fetal fibroblasts) were investigated. Fig. 4 showed that Oct4 underwent the right reprogramming, whereas Nanog experienced over-demethylation, Rex1 and Fgf4 respectively failed to undergo the correct demthylation and remethylation process, and the CpG 14 site of Sox2 witnessed hypermethylation during MZT in NT embryos, suggesting that DNA methylation reprogramming prior to 8-cell stage was critical and that the NT embryos had weak reprogramming capacities at least for the other four genes except Oct4 during MZT. Taken together, 8-cell stage may serve as the checkpoint to appraise the quality of bovine NT embryos in terms of DNA methylation. During early embryo development, it showed similar developmental competence between NT and IVF embryos, which may be associated with relatively normal methylation levels of Oct4 and Sox2 in NT embryos, for they are involved in early embryo development and regulation of expressions of other key genes to a large extent (Kim et al., 2008). For late NT embryo development, it is frequently linked to the developmental abnormalities, leading to few individuals developing to term (Polejaeva et al., 2000; Kang et al., 2001). According to our study, it may be, to a certain extent, due to over-demethylation of Nanog and Fgf4 ahead of time and maintained hypermethylation of Rex1 during MZT in NT embryos, for their aberrant methylations may lead to abnormalities of placenta tissues, mesoderm and somite, which are based on the previous reports that Nanog and Rex1 were involved in differentiation of trophoblast (the main derivation of placenta) and that Fgf4 acted as the critical factor for continued generation of new mesodermal cells and regulation of somite formation during posterior development of embryos (Rogers et al., 1991; Degrelle et al., 2005; Boulet et al., 2008). Additionally, the methylation of the CpG 14 site of Sox2 may be a potential factor causing abnormal late development of NT embryos. This possibility remains to be

Jie Lan et al. / Journal of Genetics and Genomics 37 (2010) 297304

confirmed. Taken together, the five pluripotency-related genes witnessed the incomplete methylation reprogramming during MZT in bovine NT embryos, suggesting that they may be used as indicators for bovine embryo developmental competence.

303

T.D., Lynn, J.W., Godke, R.A., and Bondioli, K.R. (2008). Effect of epigenetic modifications of donor somatic cells on the subsequent chromatin remodeling of cloned bovine embryos. Biol. Reprod. 78: 832840. Hohn, T., Corsten, S., Rieke, S., Muller, M., and Rothnie, H. (1996). Methylation of coding region alone inhibits gene expression in plant protoplasts. Proc. Natl. Acad. Sci. USA 93: 83348339. Hua, S., Zhang, Y., Song, K., Song, J.M., Zhang, Z.P., Zhang, L.,

Acknowledgement

Zhang, C., Cao, J.W., and Ma, L.B. (2008). Development of bovine-ovine

This work was supported by the Key Scientific and Technological Special Program for the Culture of Disease-resistance Transgenic Cattle Species (No. 2008ZX08007-004), Government of China.

interspecies

cloned

embryos

and

mitochondria

segregation in blastomeres during preimplantation. Anim. Reprod. Sci. 105: 245257. Illingworth, R.S., and Bird, A.P. (2009). CpG islands  ‘A rough guide’. FEBS Lett. 583: 17131720. Kang, Y.K., Koo, D.B., Park, J.S., Choi, Y.H., Chung, A.S., Lee, K.K., and Han, Y.M. (2001). Aberrant methylation of donor genome in cloned bovine embryos. Nat. Genet. 28: 173177.

References Babaie, Y., Herwig, R., Greber, B., Brink, T.C., Wruck, W., Groth, D., Lehrach, H., Burdon, T., and Adjaye, J. (2007). Analysis of Oct4-dependent transcriptional networks regulating self-renewal and pluripotency in human embryonic stem cells. Stem Cells 25: 500510. Blelloch, R., Wang, Z.D., Meissner, A., Pollard, S., Smith, A., and Jaenisch, R. (2006). Reprogramming efficiency following somatic cell nuclear transfer is influenced by the differentiation and methylation state of the donor nucleus. Stem Cells 24: 20072013. Boulet, A.M., and Capecchi, M.R. (2008). The role of FGF4 and FGF8 in posterior development of the mouse embryo. Dev. Biol. 319: 509. Brevini, T.A.L., Antonini, S., Cillo, F., Pennarossa, G., Colleoni, S., Lazzari, G., Galli, C., and Gandolfi, F. (2008). Expression pattern of the Sox2 gene in bovine oocytes and in vitro-derived embryos. Reprod. Fert. Develop. 20: 165165. Chew, J.L., Loh, Y.H., Zhang, W.S., Chen, X., Tam, W.L., Yeap, L.S., Li, P., Ang, Y.S., Lim, B., Robson, P., and Ng, H.H. (2005). Reciprocal transcriptional regulation of Pou5f1 and Sox2 via the Oct4/Sox2 complex in embryonic stem cells. Mol. Cell. Biol. 25: 60316046.

Kim, J.W., Chu, J.L., Shen, X.H., Wang, J.L., and Orkin, S.H. (2008). An extended transcriptional network for pluripotency of embryonic stem cells. Cell 132: 10491061. Kosaka, N., Sakamoto, H., Terada, M., and Ochiya, T. (2009). Pleiotropic function of FGF-4: its role in development and stem cells. Dev. Dynam. 238: 265276. Kurosaka, S., Eckardt, S., and McLaughlin, K.J. (2004). Pluripotent lineage definition in bovine embryos by Oct4 transcript localization. Biol. Reprod. 71: 15781582. Lawrence, R.J., Earley, K., Pontes, O., Silva, M., Chen, Z.J., Neves, N., Viegas, W., and Pikaard, C.S. (2004). A concerted DNA methylation/histone methylation switch regulates rRNA gene dosage control and nucleolar dominance. Mol. Cell 13: 599609. Lin, L., Li, Q., Zhang, L., Zhao, D.S., Dai, Y.P., and Li, N. (2008). Aberrant epigenetic changes and gene expression in cloned cattle dying around birth. BMC Dev. Biol. 8: 110. Meirelles, F., Caetano, A.R., Watanabe, Y.F., Ripamonte, P., Carambula, S.E., Merighe, G.K., and Garcia, S.M. (2004). Genome activation and developmental block in bovine embryos. Anim. Reprod. Sci. 82-83: 1320. Pesce, M., and Scholer, H.R. (2001). Oct-4: gatekeeper in the beginnings of mammalian development. Stem Cells 19: 271278. Polejaeva, I.A., Chen, S.H., Vaught, T.D., Page, R.L., Mullins, J., Ball,

Dean, W., Santos, F., and Reik, W. (2003). Epigenetic reprogramming

S., Dai, Y.F., Boone, J., Walker, S., Ayares, D.L., Colman, A., and

in early mammalian development and following somatic nuclear

Campbell, K.H.S. (2000). Cloned pigs produced by nuclear transfer

transfer. Semin. Cell Dev. Biol. 14: 93100. Dean, W., Santos, F., Stojkovic, M., Zakhartchenko, V., Walter, J., Wolf, E., and Reik, W. (2001). Conservation of methylation reprogramming in mammalian development: aberrant reprogramming in cloned embryos. Proc. Natl. Acad. Sci. USA 98: 1373413738. Degrelle, S.A., Campion, E., Cabau, C., Piumi, F., Reinaud, P.,

from adult somatic cells. Nature 407: 8690. Reik, W., Dean, W., and Walter, J. (2001). Epigenetic reprogramming in mammalian development. Science 293: 10891093. Rodda, D.J., Chew, J.L., Lim, L.H., Loh, Y.H., Wang, B., Ng, H.H., and Robson, P. (2005). Transcriptional regulation of Nanog by Oct4 and Sox2. J. Biol. Chem. 280: 2473124737.

Richard, C., Renard, J.P., and Hue, I. (2005). Molecular evidence

Rogers, M.B., Hosler, B.A., and Gudas, L.J. (1991). Specific

for a critical period in mural trophoblast development in bovine

expression of a retinoic acid-regulated, zinc-finger gene, Rex-1, in

blastocysts. Dev. Biol. 288: 448460.

preimplantation

Giraldo, A.A., Hylan, D.A., Ballard, C.B., Purpera, M.N., Vaught,

embryos,

Development 113: 815824.

trophoblast

and

spermatocytes.

304

Jie Lan et al. / Journal of Genetics and Genomics 37 (2010) 297304

Rountree, M.R., and Selker, E.U. (1997). DNA methylation inhibits elongation but not initiation of transcription in Neurospora crassa. Gene. Dev. 11: 23832395. Shi, W., and Haaf, T. (2002). Aberrant methylation patterns at the two-cell stage as an indicator of early developmental failure. Mol. Reprod. Dev. 63: 329334. Tachibana, M., Clepper, L., Michelle, S., Ramsey, C., and Mitalipov, S. (2009). The role of NANOG during primate pre-implantation

embryo development. Bio. Reprod. 81: 248. Wilmut, I., Schnieke, A.E., McWhir, J., Kind, A.J., and Campbell, K.H.S. (1997). Viable offspring derived from fetal and adult mammalian cells. Nature 385: 810813. Wrenzycki, C., Herrmann, D., Keskintepe, L., Martins, A., Sirisathien, S., Brackett, B., and Niemann, H. (2001). Effects of culture system and protein supplementation on mRNA expression in pre-implantation bovine embryos. Hum. Reprod. 16: 893901.