Methylenetetrahydrofolate reductase gene C677T and A1298C polymorphisms, plasma homocysteine, folate, and vitamin B12 levels and the extent of coronary artery disease

Methylenetetrahydrofolate Reductase Gene C677T and A1298C Polymorphisms, Plasma Homocysteine, Folate, and Vitamin B12 Levels and the Extent of Coronary Artery Disease Klaus Ko ¨ lling, MD, Gjin Ndrepepa, MD, Werner Koch, PhD, Siegmund Braun, Julinda Mehilli, MD, Albert Scho ¨ mig, MD, and Adnan Kastrati, MD

MD,

The question of whether mild hyperhomocysteinemia is a risk factor for coronary artery disease (CAD) has long been debated and is still unclear. We investigated whether there is a link between methylenetetrahydrofolate reductase (MTHFR) gene C677T and A1298C polymorphisms or plasma homocysteine and CAD. This is a case-control study that included 2,121 consecutive patients (cases) with angiographically proved CAD and 617 patients without CAD (controls). MTHFR gene C677T and A1298C polymorphisms, plasma homocysteine, folate, and vitamin B12 concentrations were determined and coronary angiography was performed in all subjects. The distribution of MTHFR gene C677T genotypes in patients (or controls) was: CC-genotype in 915 cases, 43.1% (266 controls, 43.1%); CT-genotype in 955 cases, 45.0%, (283 controls, 45.9%); and TT-genotype in 251 cases, 11.9% (68 controls, 11.0%) (p ⴝ 0.84). The distribution of MTHFR gene A1298C genotypes in patients (or controls) was: AA-genotype in 973 cases, 45.9%

(281 controls, 45.5%); AC-genotype in 905 cases, 42.7% (284 controls, 46.0%); and CC-genotype in 243 cases, 11.4% (52 controls, 8.5%) (p ⴝ 0.07). Patients with CAD had higher levels of plasma homocysteine (12.9 ⴞ 5.1 vs 11.9 ⴞ 4.5 ␮mol/L, p <0.001) and lower levels of folate (9.5 ⴞ 3.1 vs 9.9 ⴞ 3.8 ng/ml, p ⴝ 0.008) than controls. After adjustment for other risk factors for CAD, plasma homocysteine (p ⴝ 0.89), MTHFR gene C677T (p ⴝ 0.38), or A1298C polymorphisms (p ⴝ 0.13) were not independent correlates of CAD. This study demonstrated that MTHFR gene C677T or A1298C polymorphisms are not associated with the presence of angiographic CAD. Although there is an apparent association between elevated levels of homocysteine and CAD, this association is not independent of conventional cardiovascular risk factors. 䊚2004 by Excerpta Medica, Inc. (Am J Cardiol 2004;93:1201–1206)

ultiple factors and conditions lead to mild increases in the plasma concentrations of homoM cysteine. It is well established that genetic poly-

Contradictory results have also been reported concerning the rate of atherosclerosis and cardiovascular risk in carriers of the TT-genotype of the MTHFR gene.1,7 Furthermore, a causal link between mild hyperhomocysteinemia and CAD has never been proved beyond reasonable doubt and continues to be a subject of debate. We undertook this study to investigate whether there is a link between MTHFR gene C677T and A1298C polymorphisms or plasma homocysteine levels and the presence and extent of CAD in a large series of patients who underwent coronary angiography.

1– 4

morphisms of the genes that encode enzymes involved in the homocysteine metabolism, particularly methylenetetrahydrofolate reductase (MTHFR), are a common cause of mild increases in the levels of circulating homocysteine.1 MTHFR gene C677T and A1298C polymorphisms are common. The C677T polymorphism in the MTHFR gene is associated with reduced enzyme activity5 and increased levels of plasma homocycteine of about 25%.1 In contrast, it appears that the A1298C polymorphism alone does not significantly affect plasma homocysteine but may do so when combined with the 677T variant (AC/CT combination).6 The relation between the MTHFR C677T and A1298C gene polymorphisms and coronary artery disease (CAD) risk has not been clearly established. From Deutsches Herzzentrum and 1. Medizinische Klinik rechts der Isar der Technischen, Universita¨t Munich, Munich, Germany. Manuscript received November 6, 2003; revised manuscript received and accepted January 30, 2004. Address for reprints: Gjin Ndrepepa, MD, Deutsches Herzzentrum, Lazarettstrasse 36, 80636 Mu¨nchen, Germany. E-mail: [email protected]. ©2004 by Excerpta Medica, Inc. All rights reserved. The American Journal of Cardiology Vol. 93 May 15, 2004

METHODS

Study population: This is a case-control study. The diagnosis of CAD was confirmed or excluded by coronary angiography. The group of cases was formed by a consecutive series of 2,121 Caucasian patients with angiographically significant CAD (coronary stenoses of ⱖ50% lumen obstruction in ⱖ1 of the 3 major coronary arteries). The group of controls included 617 consecutive Caucasian patients with normal coronary angiograms (with arterial vessel irregularities of ⬍10% lumenal narrowing, at most) and without regional left ventricular wall motion abnormalities. All participants in the study gave written 0002-9149/04/$–see front matter doi:10.1016/j.amjcard.2004.02.009

1201

informed consent for genotype determination and inclusion in the study. The study protocol was approved by the institutional ethics committee. Definition of traditional cardiovascular risk factors: Arterial hypertension was defined in the presence of active treatment with antihypertensive agents or otherwise as a systolic blood pressure of ⱖ140 mm Hg and/or diastolic blood pressure of ⱖ90 mm Hg on at least 2 separate occasions. Hypercholesterolemia was defined as a documented total cholesterol value of ⱖ240 mg/dl. Smokers were defined as those currently smoking any tobacco. Patients were considered to have diabetes mellitus if they were receiving active treatment with insulin or oral hypoglycemic agents. For patients on dietary treatment alone, documentation of abnormal fasting blood glucose or glucose tolerance tests according to World Health Organization criteria were required for the diagnosis of diabetes.8 Measurement of lipoprotein(a) concentration was performed using a latex-enhanced immunonephelometric assay (Behring Diagnostics GmbH, Marburg, Germany). Measurement of homocysteine, folate, vitamin B12, and concentrations: Blood samples were taken from

patients while in the supine position before cardiac catheterization, collected into heparinized tubes, transported to the central laboratory, and immediately centrifugated at 1,550 g for 10 minutes. The separated plasma samples were stored at a temperature of ⫹4°C and analyzed within 3 days. Homocysteine, folate, and vitamin B12 concentrations were measured using the AxSYM System (Abbott Laboratories, Abbott Park, Illinois). Plasma total homocysteine was determined by an automated fluorescence polarization immunoassay that is based on the reduction of protein-bound homocysteine and mixed disulfide forms. Free homocysteine was enzimatically converted into S-adenosil-L-homocysteine, which is then recognized by a monoclonal antibody. The analytic sensitivity of the assay is 0.8 ␮mol/L. Folate concentration was measured with an ion capture assay that utilizes a soluble affinity reagent composed of folate-binding protein coupled to monoclonal antibodies, which, in turn, are coupled to a polyanion. The analytic sensitivity of the AxSYM folate assay is 0.9 ng/ml. Vitamin B12 concentration was determined using a microparticle enzyme intrinsic factor pathway. The analytic sensitivity of the AxSYM vitamin B12 assay is 60 pg/ml. All measurements were obtained by laboratory personnel who were unaware of the results of coronary artery angiography or genotype profile. MTHFR genotype determination: Genomic DNA was extracted from peripheral blood leukocytes with the QIAamp DNA Blood Kit (Qiagen, Hilden, Germany) or the High Pure PCR Template Preparation Kit (Roche Applied Science, Mannheim, Germany). Genotype analysis was performed with allele-specific fluorogenic oligonucleotide probes in an assay combining the polymerase chain reaction and the 5⬘ nuclease reaction (TaqMan technique; Applied Biosystems, Darmstadt, Germany). Primers and probes were established with the Primer Express software (version 1202 THE AMERICAN JOURNAL OF CARDIOLOGY姞

VOL. 93

2.0.0; Applied Biosystems) after download of the DNA sequences deposited under accession numbers AF105980 (MTHFR gene, exon 4) and AF105983 (MTHFR gene, exon 7) in the GenBank or EMBL database. Primers 5⬘ GACCTGAAGCACTTGAAGGAGAAG 3⬘ and 5⬘ CTTCACAAAGCGGAAGAATGTGT 3⬘ were used to amplify a 96-bp portion of exon 4 containing SNP 677C/T, and primers 5⬘ AGGAGGAGCTGCTGAAGATGTG 3⬘ and 5⬘ GTTCTCCCGAGAGGTAAAGAACAAA 3⬘ were used to amplify a 87-bp portion of exon 7 containing SNP 1298A/C. The sequences of the allele-specific probe oligonucleotides were 5⬘ TGATGAAATCGGCTCC 3⬘ (677C), 5⬘ TGATGAAATCGACTCCC 3⬘ (677T), 5⬘ TCAAAGACACTTTCTTCACT 3⬘ (1298A), and 5⬘ AAAGACACTTGCTTCACT 3⬘ (1298C). The sequences of the probes are complementary to the sequences present in AF105980 and AF105983; allelespecific nucleotides are underlined. Oligonucleotides were synthesized by Applied Biosytems; the fluorogenic dyes FAM, i.e., 6-carboxy-fluorescein, and VIC (proprietary dye of Applied Biosystems) were attached to the 5⬘ ends of the probe molecules to accomplish allelic discrimination; minor groove binder groups were conjugated with the 3⬘ ends to facilitate formation of stable duplexes between the relatively short probes and their single-stranded DNA targets. The 2-step thermocycling procedure consisted of 35 cycles of denaturation at 92°C for 15 seconds and primer annealing and extension at 60°C for 1 minute. As a control, genotyping was repeated for 20% of the samples using DNA prepared separately from the original blood sample. Genotypes were determined without knowledge of patients’ clinical and angiographic data. Statistical analysis: Data are presented as mean ⫾ SD, counts, or proportions (percentages). Comparisons between groups were performed using unpaired 2-tailed t tests or Wilcoxon rank-sum tests, when appropriate. Comparisons of ⬎2 groups were performed with analysis of variance. Categorical data were compared with the chi-square test. The independent influence of various factors on plasma homocysteine concentration was assessed with a multiple linear regression model. The independent relation of the MTHFR gene C677T or A1298C polymorphisms and homocycteine to the presence of CAD was tested after adjusting for the influence of other factors by multiple logistic regression analysis. A p value ⬍0.05 was considered statistically significant.

RESULTS

Differences in patients with and without CAD: Distribution of MTHFR C677T and A1298C genotypes is shown in Table 1. Genotype frequencies in the control group agreed with those predicted by the Hardy-Weinberg equilibrium. As expected, patients with CAD had a more adverse atherosclerosis risk profile than controls. Plasma total homocysteine levels were significantly higher in the group of patients with CAD than in subjects without CAD. Conversely, plasma folate concentrations were significantly lower in patients MAY 15, 2004

TABLE 1 Characteristics of Cases and Controls Variables Age (yrs) Men Arterial hypertension Cholesterolemia ⱖ240 mg/dl Smoking Diabetes mellitus Serum creatinine (mg/dl) Lipoprotein(a) (mg/dl) Plasma homocysteine (␮mol/L) Plasma folate (ng/ml) Plasma vitamin B12 (pg/ml) MTHFR C677T genotypes CC CT TT MTHFR A1298C genotypes AA AC CC Combined genotypes CC/AA CC/AC CC/CC CT/AA CT/AC CT/CC TT/AA

Cases (n ⫽ 2,121) 66.8 1,535 1,698 1,461 941 507 1.13 40.6 12.9 9.5 421.9

⫾ 12.8 (72.0) (80.1) (69.0) (44.4) (24.0) ⫾ 0.31 ⫾ 48.6 ⫾ 5.1 ⫾ 3.1 ⫾ 301.9

915 (43.1) 955 (45.0) 251 (11.9)

Controls (n ⫽ 617) 60.8 296 420 246 180 63 1.0 31.4 11.9 9.9 424.6

⫾ 12.4 (48.0) (68.1) (40.0) (29.2) (10.2) ⫾ 0.22 ⫾ 39.5 ⫾ 4.5 ⫾ 3.8 ⫾ 263.7

p Value ⬍0.001 ⬍0.001 ⬍0.001 ⬍0.001 ⬍0.001 ⬍0.001 ⬍0.001 0.002 ⬍0.001 0.008 0.83 0.84

266 (43.1) 283 (45.9) 68 (11.0)

combined genotypes in patients with CAD (p ⬍0.001 for homocysteine and folate concentration differences) and without CAD (p ⫽ 0.01 for homocysteine concentration differences and p ⫽ 0.04 for folate concentration differences). However, significant differences were determined by the presence in the combined genotypes of CT or TT genotype of the MTHFR gene C677T polymorphism. MTHFR gene polymorphisms, homocysteine, folate, and vitamin B12 concentrations and extent of CAD: Pa-

tients with CAD (n ⫽ 2,121) were classified into 3 subgroups according 973 (45.9) 281 (45.5) to the number of affected coronary 905 (42.7) 284 (46.0) 243 (11.4) 52 (8.5) arteries (Table 3). Patients with more 0.41 advanced coronary atherosclerosis 236 (11.1) 72 (11.7) tended to be older (p ⫽ 0.10). Male 437 (20.6) 142 (23.0) sex proportion, arterial hypertension, 242 (11.45) 52 (8.4) diabetes mellitus, plasma creatinine 486 (22.9) 141 (22.9) 468 (22.1) 142 (23.0) homocysteine, and lipoprotein(a) lev1 (0.05) 0 (0) els increased in a stepwise and signif251 (11.8) 68 (11.0) icant way from 1- to 3-vessel disease. Values are expressed as mean ⫾ SD or number (%). Plasma folate and vitamin B12 concentrations did not correlate with the extent of CAD. MTHFR C677T and with than without CAD. No differences in the concen- A1298C genotypes, alone or combined, did not cortration of vitamin B12 were observed between the 2 relate with the extent of CAD. groups. With regard to the distribution of the MTHFR Results of multivariate analysis: The model of mulC677T or A1298C genotypes and their combinations, tiple linear regression was used to define the indepenno significant differences between groups were ob- dent correlates of plasma homocysteine concentration. served (Table 1). There was only 1 patient with CAD Age, gender, arterial hypertension, hypercholesterolin whom a CT/CC combined genotype was observed. emia, smoking, diabetes, plasma folate concentration, Combined genotypes TT/AC and TT/CC were not plasma vitamin B12 concentration, serum creatinine, observed. and MTHFR gene C677T and A1298C polymorMTHFR gene polymorphisms and homocysteine, fo- phisms were included in the model. The MTHFR gene late, and vitamin B12 concentrations: Plasma concentra- C677T and A1298C polymorphisms were entered into tions of homocysteine, folate, and vitamin B12 were the model after being categorized as CC versus calculated according to the MTHFR C677T and CT⫹TT genotypes and AA versus AC⫹CC genoA1298C genotypes. Data are listed in Table 2. There types, respectively. The model showed that age (p was a graded increase in the plasma homocysteine ⬍0.001), serum creatinine (p ⬍0.001), plasma folate concentrations from CC to TT genotypes of MTHFR (p ⬍0.001), plasma vitamin B12 (p ⬍0.001), and gene C677T polymorphism in both patients with and MTHFR gene C677T polymorphism (p ⫽ 0.006) were without CAD. In contrast, plasma folate concentration independent predictors of plasma homocysteine conwas reduced significantly from CC genotype to TT centration. A significant interaction between MTHFR genotype of the MTHFR gene C677T polymorphism C677T gene TT genotype and plasma folate was demin patients with and without CAD. With regard to onstrated by the model (p ⫽ 0.02) in determining plasma concentrations of vitamin B12, no significant plasma homocysteine levels. Multiple logistic regression was used to test for differences were observed in the different genotypes of the MTHFR gene C677T polymorphism. MTHFR independent correlates of the presence of CAD. Ingene A1298C polymorphism was not associated with cluded in the model were: age, gender, arterial hypersignificant changes in the plasma homocysteine, fo- tension, hypercholesterolemia, smoking, diabetes, selate, or vitamin B12 concentrations. Plasma concentra- rum creatinine, lipoprotein(a), plasma homocysteine, tions of homocysteine, folate, and vitamin B12 were plasma folate, plasma vitamin B12, and MTHFR gene analyzed for all observed combined genotypes of C677T and A1298C polymorphisms. Age (p ⬍0.001), MTHFR gene C677T or A1298C polymorphisms. gender (p ⬍0.001), diabetes (p ⬍0.001), hypercholesValues for 6 combined genotypes are listed in Table 2. terolemia (p ⬍0.001), and smoking (p ⬍0.001) were There were significant differences in the plasma ho- independent correlates of the presence of CAD. Artemocysteine and folate concentrations between various rial hypertension tended to show a strong association 0.07

CORONARY ARTERY DISEASE/MTHFR GENE POLYMORPHISMS

1203

TABLE 2 Homocysteine, Folate, and Vitamin B12 Concentrations According to MTHFR Gene Polymorphisms in Cases and Controls Homocysteine (␮mol/L)

Vitamin B12 (pg/ml)

Cases

Controls

Cases

Controls

Cases

Controls

12.5 ⫾ 4.8* 12.8 ⫾ 4.8 14.8 ⫾ 6.7

11.7 ⫾ 4.5† 11.9 ⫾ 4.1 13.2 ⫾ 5.7

10.0 ⫾ 3.1‡ 9.3 ⫾ 3.1 8.4 ⫾ 3.3

10.1 ⫾ 3.0§ 9.9 ⫾ 4.6 8.7 ⫾ 2.9

427.8 ⫾ 309.8 415.1 ⫾ 296.2 426.0 ⫾ 295.2

431.0 ⫾ 254.2 409.1 ⫾ 256.8 464.6 ⫾ 321.6

12.9 ⫾ 5.0 12.8 ⫾ 5.3 12.6 ⫾ 4.4

11.8 ⫾ 4.5 11.8 ⫾ 4.9 11.4 ⫾ 4.6

9.3 ⫾ 3.1 9.6 ⫾ 3.2 9.7 ⫾ 3.1

10.0 ⫾ 4.5 9.8 ⫾ 3.2 9.9 ⫾ 2.9

427.0 ⫾ 312.0 419.2 ⫾ 297.5 411.5 ⫾ 277.3

433.3 ⫾ 278.1 412.5 ⫾ 245.4 444.1 ⫾ 282.3

Genotypes MTHFR C677T CC CT TT MTHFR A1298C AA AC CC Combined genotypes CC/AA CC/AC CC/CC CT/AA CT/AC TT/AA

Folate (ng/ml)

11.8 12.7 12.6 12.5 13.0 14.8

⫾ ⫾ ⫾ ⫾ ⫾ ⫾

3.7 5.4 4.4 4.3 5.2 6.7

11.8 11.8 11.4 11.1 12.7 13.2

⫾ ⫾ ⫾ ⫾ ⫾ ⫾

5.1 4.3 4.6 3.1 4.8 5.7

10.2 10.0 9.7 9.3 9.3 8.4

⫾ ⫾ ⫾ ⫾ ⫾ ⫾

2.9 3.1 3.1 3.0 3.2 3.3

10.4 10.0 9.9 10.4 9.6 8.7

⫾ ⫾ ⫾ ⫾ ⫾ ⫾

3.0 3.0 2.8 5.6 3.3 2.9

455.8 422.4 410.5 413.6 416.1 426.0

⫾ ⫾ ⫾ ⫾ ⫾ ⫾

348.2 304.4 277.4 301.4 291.1 295.2

452.9 415.0 444.1 408.2 409.9 464.6

⫾ ⫾ ⫾ ⫾ ⫾ ⫾

274.0 233.0 282.3 256.6 257.9 321.6

*p ⬍0.001 (for a trend from CC to TT); †p ⫽ 0.047 (for a trend from CC to TT); ‡p ⬍ 0.001 (for a trend from CC to TT); §p ⫽ 0.02 (for a trend from CC to TT).

TABLE 3 Relation Between Coronary Risk Profile and Methylenetetrahydrofolate Reductase Gene Polymorphisms and Extent of Coronary Artery Disease No. of Coronary Arteries Narrowed Variable Age (yrs) Men Arterial hypertension Total cholesterol ⱖ240 mg/dl Smoker Diabetes mellitus Serum creatinine (mg/dl) Plasma homocysteine (␮mol/L) Plasma folate (ng/ml) Plasma vitamin B12 (pg/ml) Lipoprotein(a) (mg/dl) MTHFR C677T genotypes CC CT TT MTHFR A1298C genotypes AA AC CC Combined genotypes* CC/AA CC/AC CC/CC CT/AA CT/AC TT/AA

1 (n ⫽ 593) 63.6 375 440 395 259 101 1.0 12.2 9.6 412.9 36.3

2 (n ⫽ 614)

⫾ 12.0 (63.2) (74.2) (66.6) (44.0) (17.0) ⫾ 0.3 ⫾ 4.6 ⫾ 3.1 ⫾ 262.8 ⫾ 45.1

66.5 455 489 433 272 138 1.13 12.8 9.5 424.6 38.7

⫾ 10.9 (74.1) (79.6) (70.5) (44.0) (22.5) ⫾ 0.34 ⫾ 5.1 ⫾ 3.2 ⫾ 317.9 ⫾ 45.7

3 (n ⫽ 914) 68.7 705 769 633 410 268 1.16 13.3 9.4 425.9 45.0

⫾ 9.8 (77.1) (84.1) (69.3) (45.0) (29.3) ⫾ 0.31 ⫾ 5.3 ⫾ 3.2 ⫾ 314.6 ⫾ 52.6

257 (43.3) 263 (44.4) 73 (12.3)

250 (40.7) 291 (47.4) 73 (11.9)

408 (44.6) 401 (43.9) 105 (11.5)

270 (45.5) 261 (44.0) 62 (10.5)

300 (48.8) 254 (41.4) 60 (9.8)

403 (44.1) 390 (42.7) 121 (13.2)

67 129 61 130 132 73

72 118 60 155 136 73

97 190 121 201 200 105

p Value 0.10 ⬍0.001 ⬍0.001 0.32 0.90 ⬍0.001 ⬍0.001 ⬍0.001 0.32 0.69 0.01 0.62

0.14

0.52 (11.3) (21.8) (10.3) (21.9) (22.2) (12.3)

(11.7) (19.2) (9.8) (25.2) (22.2) (11.9)

(10.6) (20.8) (13.2) (22.0) (21.9) (11.5)

*The patient with CT/CC combined genotype is shown in Table I. Values are expressed as mean ⫾ SD or number (%).

with CAD (p ⫽ 0.1). MTHFR gene C677T (p ⫽ 0.38) or A1298C (p ⫽ 0.47) polymorphisms, plasma homocysteine (p ⫽ 0.89), folate (p ⫽ 0.13), and vitamin B12 concentrations (p ⫽ 0.41) were not independent predictors of CAD.

DISCUSSION The homocysteine hypothesis of atherosclerosis was largely based on the clinical and pathologic observations in patients with homocystinuria, a meta1204 THE AMERICAN JOURNAL OF CARDIOLOGY姞

VOL. 93

bolic disorder characterized by markedly increased levels of homocysteine.9 Biologic support of the theory was derived from experimental studies in which homocysteine concentrations far exceeded the levels encountered, even under the most severe pathologic conditions, putting doubt on pathophysiologic relevance in the clinical setting.10 The strongest support for a possible causal link between homocysteine levels and atherosclerosis came from retrospective, crosssectional, or case-control studies; prospective studies MAY 15, 2004

have been less supportive or have even refuted the existence of a link between mild hyperhomocysteinemia and atherosclerosis.11–13 Several characteristics of the present study deserve to be stressed. First, as in previous studies,1 we found a strong link between the MTHFR gene C677T polymorphism and plasma levels of homocysteine, which could be viewed as an index of accuracy of our data. Second, our study represents one of the largest series conducted to test the potential association between MTHFR gene C677T and A1298C polymorphisms and CAD. Third, by performing coronary angiography in all patients and controls, our study provides a very reliable phenotypic characterization of CAD. In the present study, MTHFR C677T or A1298C polymorphisms and their combined genotypes were not associated with an increased rate of angiographic CAD or its extent in univariate and multivariate analyses. With regard to the lack of association between C677T gene variants and CAD, our study is in the same line with previous smaller-scale studies in which no association between C677T variants and angiographic CAD was found.14 –16 Anderson et al,14 in a prospective study of patients with angiographically proved CAD, found no relation between MTHFR gene C677T polymorphism and the risk of myocardial infarction or angiographically defined CAD. In a health report of US physicians, the frequency of distribution of the MTHFR gene polymorphism was similar between patients and control subjects.15 Van Bockxmeer et al16 found no relation between MTHFR gene C677T polymorphism and myocardial infarction, CAD, or restenosis. In a large prospective study of 1,412 patients with angiographically defined CAD, homozygosity for the MTHFR TT-variant was a weak predictor of total homocysteine but not mortality.17 Our study showed that MTHFR gene C677T polymorphism, but not A1298C polymorphism, was an independent predictor of plasma homocysteine levels. Other variables such as age, plasma folate, and vitamin B12 concentrations and serum creatinine correlated even more strongly with plasma homocysteine levels. Furthermore, our study showed that there was a particularly significant interaction between MTHFR gene C677T polymorphism and low folate concentration in determining homocysteine levels. In a recent, double-blind, placebo-controlled study of 90 patients with CAD, folic acid at a dose of 5 mg/day reduced plasma homocysteine and was associated with a trend toward improved endothelial function.18 Mean total homocysteine levels and prevalence of high homocycteine concentrations were significantly reduced using fortification of the enriched grain products with folic acid.19 A recent meta-analysis concluded that MTHFR 677 TT genotype carriers have a significantly higher risk of CAD, particularly in the setting of low folate status.7 Our study showed that patients with angiographycally documented CAD had higher levels of homoysteine than those without CAD. Moreover, plasma homocysteine levels progressively increased with more severe coronary atherosclerosis. However, after ad-

justment for other risk factors of atherosclerotic disease in a multivariate model, the positive association between plasma homocysteine and angiographic CAD lost statistical significance. Because plasma homocysteine level was not an independent risk factor for angiographic CAD, these data do not support a causal link between mild hyperhomocysteinemia and coronary atherosclerosis. In a prospective study of patients with angiographically confirmed CAD, Nygard et al20 found only a weak correlation between plasma homocysteine and extent of coronary atherosclerosis. Other studies have reported abolition of the association between elevated homocysteine levels and CAD after adjusting for cardiovascular risk factors. In the Atherosclerosis Risk In Communities (ARIC) study and the Caerphilly cohort, adjustment for CAD risk factors abolished the association between elevated homocysteine and CAD.21,22 In the ARIC study, only the plasma vitamin B6 concentration was associated independently with CAD incidence; no association of CAD and MTHFR gene C677T polymorphism was observed.21 The Hordaland study, a large populationbased study, showed that elevated plasma homocysteine was strongly and positively associated with major cardiovascular risk factors.4 A recent metaanalysis including 30 prospective and retrospective studies concluded that elevated homocysteine levels are at best a modest predictor of ischemic heart disease and stroke in healthy populations.13 A recent prospective study by Knekt et al23 showed that hyperhomocysteinemia predicts the risk of future CAD events only in men with a history of disease but not in those without a history of CAD. Finally, many studies have suggested that elevated plasma homocysteine may be a marker of cardiovascular risk in subjects with preexisting disease rather than a primary risk factor for atherosclerosis. Some investigators have advocated that atherosclerosis itself increases homocysteine levels, resulting in an apparent association between mild hyperhomocysteinemia and cardiovascular disease (reverse causality hypothesis),1,21,24 or that elevated homocysteine levels are an acute-phase reactant12 that interacts with conventional cardiovascular risk factors to provoke acute events.25 More epidemiologic evidence is required to corroborate these hypotheses. 1. Brattstrom L, Wilcken DE, Ohrvik J, Brudin L. Common methylenetetrahy-

drofolate reductase gene mutation leads to hyperhomocysteinemia but not to vascular disease: the result of a meta-analysis. Circulation 1998;98:2520 –2526. 2. Jacques PF, Bostom AG, Wilson PW, Rich S, Rosenberg IH, Selhub J. Determinants of plasma total homocysteine concentration in the Framingham Offspring cohort. Am J Clin Nutr 2001;73:613–621. 3. Selhub J, Jacques PF, Rosenberg IH, Rogers G, Bowman BA, Gunter EW, Wright JD, Johnson CL. Serum total homocysteine concentrations in the third National Health and Nutrition Examination Survey (1991–1994): population reference ranges and contribution of vitamin status to high serum concentrations. Ann Intern Med 1999;131:331–339. 4. Nygard O, Vollset SE, Refsum H, Stensvold I, Tverdal A, Nordrehaug JE, Ueland M, Kvale G. Total plasma homocysteine and cardiovascular risk profile. The Hordaland Homocysteine Study. JAMA 1995;274:1526 –1533. 5. Frosst P, Blom HJ, Milos R, Goyette P, Sheppard CA, Matthews RG, Boers GJ, den Heijer M, Kluijtmans LA, van den Heuvel LP, Rozen R. A candidate genetic risk factor for vascular disease: a common mutation in methylenetetrahydrofolate reductase. Nat Genet 1995;10:111–113.

CORONARY ARTERY DISEASE/MTHFR GENE POLYMORPHISMS

1205

6. Weisberg IS, Jacques PF, Selhub J, Bostom AG, Chen Z, Curtis Ellison R, Eckfeldt JH, Rozen R. The 1298A3 C polymorphism in methylenetetrahydrofolate reductase (MTHFR): in vitro expression and association with homocysteine. Atherosclerosis 2001;156:409 –415. 7. Klerk M, Verhoef P, Clarke R, Blom HJ, Kok FJ, Schouten EG. MTHFR 677C–⬎T polymorphism and risk of coronary heart disease: a meta-analysis. JAMA 2002;288:2023–2031. 8. World Health Organization. Diabetes mellitus. WHO Tech Rep Ser 1985;727: 1–104. 9. McCully KS. Vascular pathology of homocysteinemia: implications for the pathogenesis of arteriosclerosis. Am J Pathol 1969;56:111–128. 10. Selhub J, D’Angelo A. Hyperhomocysteinemia and thrombosis: acquired conditions. Thromb Haemost 1997;78:527–531. 11. Eikelboom JW, Lonn E, Genest J Jr, Hankey G, Yusuf S. Homocyst(e)ine and cardiovascular disease: a critical review of the epidemiologic evidence. Ann Intern Med 1999;131:363–375. 12. Christen WG, Ajani UA, Glynn RJ, Hennekens CH. Blood levels of homocysteine and increased risks of cardiovascular disease: causal or casual? Arch Intern Med 2000;160:422–434. 13. The Homocysteine Studies Collaboration. Homocysteine and risk of ischemic heart disease and stroke: a meta-analysis. JAMA 2002;288:2015–2022. 14. Anderson JL, King GJ, Thomson MJ, Todd M, Bair TL, Muhlestein JB, Carlquist JF. A mutation in the methylenetetrahydrofolate reductase gene is not associated with increased risk for coronary artery disease or myocardial infarction. J Am Coll Cardiol 1997;30:1206 –1211. 15. Ma J, Stampfer MJ, Hennekens CH, Frosst P, Selhub J, Horsford J, Malinow MR, Willett WC, Rozen R. Methylenetetrahydrofolate reductase polymorphism, plasma folate, homocysteine, and risk of myocardial infarction in US physicians. Circulation 1996;94:2410 –2416. 16. van Bockxmeer FM, Mamotte CD, Vasikaran SD, Taylor RR. Methylenetetrahydrofolate reductase gene and coronary artery disease. Circulation 1997;95: 21–23.

1206 THE AMERICAN JOURNAL OF CARDIOLOGY姞

VOL. 93

17. Anderson JL, Muhlestein JB, Horne BD, Carlquist JF, Bair TL, Madsen TE, Pearson RR. Plasma homocysteine predicts mortality independently of traditional risk factors and C-reactive protein in patients with angiographically defined coronary artery disease. Circulation 2000;102:1227–1232. 18. Thambyrajah J, Landray MJ, Jones HJ, McGlynn FJ, Wheeler DC, Townend JN. A randomized double-blind placebo-controlled trial of the effect of homocysteine-lowering therapy with folic acid on endothelial function in patients with coronary artery disease. J Am Coll Cardiol 2001;37:1858 –1863. 19. Jacques PF, Selhub J, Bostom AG, Wilson PW, Rosenberg IH. The effect of folic acid fortification on plasma folate and total homocysteine concentrations. N Engl J Med 1999;340:1449 –1454. 20. Nygard O, Nordrehaug JE, Refsum H, Ueland PM, Farstad M, Vollset SE. Plasma homocysteine levels and mortality in patients with coronary artery disease. N Engl J Med 1997;337:230 –236. 21. Folsom AR, Nieto FJ, McGovern PG, Tsai MY, Malinow MR, Eckfeldt JH, Hess DL, Davis CE. Prospective study of coronary heart disease incidence in relation to fasting total homocysteine, related genetic polymorphisms, and B vitamins: the Atherosclerosis Risk In Communities (ARIC) study. Circulation 1998;98:204 –210. 22. Ubbink JB, Fehily AM, Pickering J, Elwood PC, Vermaak WJ. Homocysteine and ischaemic heart disease in the Caerphilly cohort. Atherosclerosis 1998;140: 349 –356. 23. Knekt P, Reunanen A, Alfthan G, Heliovaara M, Rissanen H, Marniemi J, Aromaa A. Hyperhomocystinemia: a risk factor or a consequence of coronary heart disease? Arch Intern Med 2001;161:1589 –1594. 24. Evans RW, Shaten BJ, Hempel JD, Cutler JA, Kuller LH. Homocyst(e)ine and risk of cardiovascular disease in the Multiple Risk Factor Intervention Trial. Arterioscler Thromb Vasc Biol 1997;17:1947–1953. 25. Nurk E, Tell GS, Vollset SE, Nygard O, Refsum H, Ueland PM. Plasma total homocysteine and hospitalizations for cardiovascular disease: the Hordaland Homocysteine Study. Arch Intern Med 2002;162:1374 –1381.

MAY 15, 2004