- Email: [email protected]
microporous electrospun nanofiber scaffold improves the osteochondral regeneration
Acta Biomaterialia xxx (2013) xxx–xxx
Contents lists available at SciVerse ScienceDirect
Acta Biomaterialia journal homepage: www.elsevier.com/locate/actabiomat
Bi-layer collagen/microporous electrospun nanofiber scaffold improves the osteochondral regeneration Shufang Zhang a,b,1, Longkun Chen a,g,1, Yangzi Jiang a, Youzhi Cai a,e, Guowei Xu a,b, Tong Tong a, Wei Zhang a,b, Linlin Wang a,b, Junfeng Ji a, Peihua Shi f,⇑, Hong Wei Ouyang a,b,c,d,⇑ a
Center for Stem Cell and Tissue Engineering, School of Medicine, Zhejiang University, Hangzhou, Zhejiang, People’s Republic of China Zhejiang Provincial Key Laboratory of Tissue Engineering and Regenerative Medicine, Zhejiang University, Hangzhou, Zhejiang, People’s Republic of China Department of Stem Cell and Regenerative Medicine, School of Medicine, Zhejiang University, Hangzhou, Zhejiang, People’s Republic of China d Soft Matter Research Center, Zhejiang University, Hangzhou, Zhejiang, People’s Republic of China e The Second Affiliated Hospital (Binjiang Branch), School of Medicine, Zhejiang University, Hangzhou, Zhejiang, People’s Republic of China f Sir Run Run Shao Hospital, School of Medicine, Zhejiang University, Hangzhou, Zhejiang, People’s Republic of China g Zhejiang Xingyue Biotechnology Co. Ltd., Hangzhou, Zhejiang, People’s Republic of China b c
a r t i c l e
i n f o
Article history: Received 17 October 2012 Received in revised form 20 March 2013 Accepted 1 April 2013 Available online xxxx Keywords: Osteochondral tissue engineering Cartilage defect repair Nanofibers Bi-layer scaffolds Subchondral bone
a b s t r a c t An optimal scaffold is crucial for osteochondral regeneration. Collagen and electrospun nanofibers have been demonstrated to facilitate cartilage and bone regeneration, respectively. However, the effect of combining collagen and electrospun nanofibers on osteochondral regeneration has yet to be evaluated. Here, we report that the combination of collagen and electrospun poly-L-lactic acid nanofibers synergistically promotes osteochondral regeneration. We first fabricated bi-layer microporous scaffold with collagen and electrospun poly-L-lactic acid nanofibers (COL-nanofiber). Mesenchymal stem cells were cultured on the bi-layer scaffold and their adhesion, proliferation and differentiation were examined. Moreover, osteochondral defects were created in rabbits and implanted with COL-nanofiber scaffold. Cartilage and subchondral bone regeneration were evaluated at 6 and 12 weeks after surgery. Compared with COL scaffold, cells on COL-nanofiber scaffold exhibited more robust osteogenic differentiation, indicated by higher expression levels of OCN and runx2 genes as well as the accumulation of calcium nodules. Furthermore, implantation of COL-nanofiber scaffold seeded with cells induced more rapid subchondral bone emergence, and better cartilage formation, which led to better functional repair of osteochondral defects as manifested by histological staining, biomechanical test and micro-computed tomography data. Our study underscores the potential of using the bi-layer microporous COL-nanofiber scaffold for the treatment of deep osteochondral defects. Ó 2013 Acta Materialia Inc. Published by Elsevier Ltd. All rights reserved.
1. Introduction Articular cartilage is an avascular, aneural and alymphatic connective tissue, and possesses poor self-reparative capacity once damaged from aging and/or joint injury. With the worldwide increase of the aging population, chronic diseases and sporting injuries, there are more and more people suffering from the joint-related diseases which largely lead to the disability. Based on the depth of injury, there are mainly three types of cartilage damage: partial thickness defect, full thickness defect and osteochondral defect (the defect extends to the subchondral bone region). Osteochondral defects constitute 5% of cartilage
⇑ Corresponding authors. Tel./fax: +86 571 88208262 (H.W. Ouyang). E-mail addresses: [email protected] (P. Shi), [email protected] (H.W. Ouyang). 1 These two authors contributed equally to this work.
injuries [1]. The subchondral bone is an integral and dynamic component of the joint, providing support for the overlying articular cartilage. Osteochondral defects, if left untreated, will potentially progress from a prearthrotic deformity to joint destruction. Therefore, it is essential to repair osteochondral defects to prevent deterioration of the joint function [1,2]. Although promising results have been achieved in the past decades to treat articular cartilage defects, osteochondral defect treatment is still challenging [3]. Hangody et al. reported good clinical results on osteochondral defect treatment with osteochondral autologous/allograft transplantation [4–6]. However, the shortage of autografts, immune reaction and possible disease dissemination from allografts as well as donor site morbidity will restrict this treatment regime. Recently, commercially available synthetic scaffolds such as Trufit and Biomatrix have been tested in animal models or clinical trials, and the overall short-term clinical outcome is favorable [7].
1742-7061/$ - see front matter Ó 2013 Acta Materialia Inc. Published by Elsevier Ltd. All rights reserved. http://dx.doi.org/10.1016/j.actbio.2013.04.003
Please cite this article in press as: Zhang S et al. Bi-layer collagen/microporous electrospun nanofiber scaffold improves the osteochondral regeneration. Acta Biomater (2013), http://dx.doi.org/10.1016/j.actbio.2013.04.003
2
S. Zhang et al. / Acta Biomaterialia xxx (2013) xxx–xxx
Nevertheless, complications will be inevitable and further validation of these implants is essential [8]. Tissue engineering has emerged as a promising strategy to repair bone and cartilage defects. Scaffold is critical to tissue engineeringbased tissue regeneration as it provides mechanical support for engineered tissues or offers a proper microenvironment for the cells. Currently, few scaffolds for osteochondral defect repair are commercially available. Collagen scaffold exhibits excellent biodegradability and biocompatibility [9]. Collagen sponge with interconnected pores provides a three-dimensional (3-D) microenvironment for cell attachment and efficient nutrient supply [10]. However, collagen sponge is mechanically inferior to subchondral bone, making it difficult to provide comparable mechanical support for cartilage. In addition, collagen degrades more rapidly than regeneration of the subchondral bone, which causes the mismatch between the degradation time and the bone-healing process. As a result, newly formed subchondral bone cannot be engineered in a physiological state, thus compromising the repair of osteochondral defects. In recent years, electrospinning technology has been applied to produce nanofibrous scaffolds, which exhibit a very high surface-to-volume ratio, mechanical strength and biomimetic properties. Previous studies have shown that nanofibrous architecture is beneficial to the proliferation and differentiation of various stem/progenitor cells, such as osteoblasts, neural stem cells, mesenchymal stem cells and embryonic stem cells [11–15]. Moreover, the small scale pores (a few microns) of electrospun nanofibrous scaffolds prevent cell migration and fibrous tissue ingrowth longitudinally and guide tissue regeneration along the surface of the nanofibrous membrane [16]. These special properties may be utilized to overcome the disadvantages of the collagen scaffold and induce subchondral bone regeneration, thus facilitating the repair of osteochondral defects. However, current electrospun nanofibrous scaffold is not suitable for 3-D bone tissue regeneration because of the small scale porous structure and low thickness of the obtained electrospun mats, which are typical of two-dimensional (2-D) sheets. We hypothesize that a 3-D microporous bi-layer scaffold incorporating electrospun nanofibers would facilitate the repair of osteochondral defects. In this study, we integrated electrospun nanofibers into the scaffold and developed a new 3-D microporous electrospun nanofibrous scaffold to evaluate its efficacy for focal osteochondral defect regeneration. A bi-layer collagen/microporous nanofiber scaffold was fabricated. Mesenchymal stem cells were then cultured on the bi-layer scaffold and their adhesion, proliferation and differentiation were examined. Moreover, focal osteochondral defects were created in rabbits and the effect of COL-nanofiber scaffold on in situ osteochondral regeneration was evaluated. 2. Materials and methods 2.1. Materials Poly-L-lactic acid (PLA) with a molecular weight of 100,000 was purchased from Medisorp Co. Type I collagen was isolated and purified from pig tendon in our lab. Cell culture media, bovine serum albumin, ascorbic acid and antibiotics were purchased from Gibco. Other reagents were purchased from Sigma unless specifically indicated.
connected to a 50 cm long Teflon tube with an internal diameter of 0.5 mm. A blunt needle was connected to the end of the Teflon tube. The positive electrode of the high-voltage power supply was clamped directly to the blunted needle. The distance between the needle tip and the collector was adjusted to 20 cm. A flat piece of tinfoil was used to collect PLA fibers. The solution was controlled by a syringe pump at a flow rate of 1.0 ml h1. An adjustable highvoltage power supply was used to supply DC voltage. A polymer jet was generated from the needle to the grounded collector. The electrospun nanofibrous membranes, which were 50–70 lm thick on average, were cut into 1.5 cm2 squares and stabilized layer by layer with tissue freezing medium, then cut into 200 lm sections. The collected microporous PLA nanofibers were washed with distilled water and 100% ethanol to remove the remained CHCl3, and stored in the desiccators for several days before use. Type I collagen was extracted and purified from pig tendons [18]. The tendons were dissected out, sliced and washed with several changes of cold distilled water to remove plasma proteins, and then extracted with 1 M NaCl in 50 mM Tris-HCl (pH 7.4) and constantly stirred overnight at 4 °C. The supernatant was decanted and the remainder was washed with several changes of cold distilled water to remove salts. Then the tendon was incubated in 0.5 M acetic acid (HAc) with 1 mg ml1 pepsin overnight at 4 °C to obtain an aqueous extract. The extract was precipitated with saline (0.9 M NaCl) and dissolved in 0.5 M HAc. The solution was then dialyzed, frozen and freeze-dried to obtain the collagen. The collagen was dissolved again in 0.05 M HAc to form 10 mg ml1 solution. The bi-layer COL scaffold was fabricated by placing the collagen solution onto the mechanically compressed collagen matrix and freeze-drying the composite again (Fig. 1A). The bi-layer COL-nanofiber scaffold was fabricated by placing the collagen solution onto the microporous PLA nanofiber layer first and freeze-drying the composite (Fig. 1B). 2.3. Characterization of bi-layer COL-nanofiber and COL scaffolds The bi-layer scaffold samples were cut in half in both vertical and cross-sections, mounted on aluminum stubs, sputter-coated with gold and observed under scanning electron microscopy (SEM) (Hitachi S3000N) at an accelerating voltage of 15 kV. 2.4. Isolation and culture of bone marrow mesenchymal stem cells Bone marrow mesenchymal stem cells (BMSCs) were isolated by short-term adherence to plastic as described previously [19]. Rabbit bone marrow was aspirated from the iliac crest of 4month-old female New Zealand white (NZW) rabbits. Nucleated cells were isolated by centrifugation at 1200 rpm for 5 min and the supernatant was removed. Following this, the nucleated cell layer was carefully collected and re-suspended in culture medium containing Dulbecco’s modified Eagle medium (DMEM), 10% w/v fetal bovine serum (FBS), 100 units ml1 penicillin and 100 lg ml1 streptocycin (all from Gibco). Cells were plated at 5 106 per 100 mm dish and incubated at 37 °C with 5% humidified CO2. After 48 h, non-adherent cells were discarded and adherent cells were continuously cultured. The medium was changed every 3 days. When cells became nearly confluent, they were detached by trypsin and serially sub-cultured. Human bone marrow mesenchymal stem cells (hBMSCs) provided by Prof. He Huang [20] were cultured under the same conditions.
2.2. Fabrication of bi-layer collagen/microporous nanofiber (COL-nanofiber) and collagen (COL) scaffolds
2.5. Cell seeding and proliferation on scaffolds
The PLA nanofibers were fabricated by electrospinning [17]. Polymer solution was prepared by dissolving PLA (M = 100,000) (Medisorp Co.) in chloroform/ethanol (3:1, v/v) at 3.5% (w/v). The polymer solution to be electrospun was placed in a 10 ml syringe
Before cell seeding, the bi-layer COL-naofiber or COL scaffold was treated according to previous studies [21,22]. It was immersed in 75% ethanol twice (30 min each time) and washed with phosphate-buffered saline (PBS) three times (30 min each time).
Please cite this article in press as: Zhang S et al. Bi-layer collagen/microporous electrospun nanofiber scaffold improves the osteochondral regeneration. Acta Biomater (2013), http://dx.doi.org/10.1016/j.actbio.2013.04.003
S. Zhang et al. / Acta Biomaterialia xxx (2013) xxx–xxx
3
Fig. 1. Fabrication and characterization of bi-layer COL and COL-nanofiber scaffolds. Fabrication process of bi-layer COL scaffolds (A) and COL-nanofiber scaffolds (B) and their microstructures (C). Macroscopic images of the bi-layer COL scaffold (a) and COL-nanofiber scaffold (e) shown obvious difference between two layers. SEM images show the top collagen layer (b, f), interface between two layers (c, g), and the bottom layers (d, h) in the bi-layer scaffolds.
After that, the scaffolds were soaked in the culture medium twice (1 h each time). Before cell seeding, the culture medium was removed and the scaffolds were placed into the fuming hood and air dried before use. Rabbit bone marrow mesenchymal stem cells (rBMSCs) at passage 2–6 were seeded onto the bi-layer COL-nanofiber and COL scaffolds (n = 6 for each group) at the density of 4 105 cells per scaffold. 12 h after seeding, the scaffolds with cells were transferred into a 24-well plate to remove the unattached cells. At days 1, 3, 5 and 7, the cells were incubated in the MTT solution (Invitrogen) at 37 °C with protection from light. 4 h later, the MTT solution was replaced with 400 ll dimethyl sulfoxide (DMSO) and the whole plate was shaken for 30 min. The absorbance value was measured with the multi-plate reader (Multiskan Spectrum) at wavelength of 570 nm. 2.6. Microstructure observation of cells seeded on bi-layer COLnanofiber and COL scaffolds 40 h after cell seeding, the cell-seeded scaffolds were fixed with 2.5% glutaraldehyde for 4 h, then treated with 1% OsO4 for 1 h. Gradient dehydration was done in serial concentrations of ethanol at 30%, 50%, 70%, 80%, 90%, 95% and 100%. After that, the samples were further treated with isoamylacetate for 30 min and dried for 1.5 h. Then the scaffolds were gold sputtered and observed under SEM (Hitachi S3000 N) at an accelerating voltage of 15 kV.
group). 24 h later, the culture medium was replaced with high glucose DMEM supplemented with 10% FBS and 1% antibiotics. After another 5 days’ culture, total cellular RNA was isolated by cell lysis in TRIZOL (Invitrogen) followed by one-step phenol chloroform–isoamyl alcohol extraction as described in the protocol. 200 ng of total RNA was reverse-transcribed into complementary DNA (cDNA) by incubation with 200 U of reverse transcriptase in 20 ml of reaction buffer at 37 °C for 1 h. 0.5 ml of cDNA was used as a template. RT-PCR of human osoeocalcin, human runx2 and human GAPDH was carried out as previously described. The following 50 and 30 primers (listed with GenBank number) were used to evaluate gene expression: human osoeocalcin: GACACCATGAGGACCCTCTC and GCCTGGTAGTTGTTGTGAGC; human runx2: GTGATAAATTCAGAAGGGAGG and CTTTTGCTAATGCTTCGTGT; human GAPDH: TGACGCTGGGGCTGGCATTG and GGCTGGTGGTCCAGGGGTCT. 2.8. von Kossa staining To investigate the osteogenic differentiation of cells on the bi-layer scaffolds, 5 105 rBMSCs were seeded onto the COL-nanofiber and COL scaffolds (n = 5 for each group). 24 h later, the culture medium was replaced with high glucose DMEM supplemented with 10% FBS and 1% antibiotics. Two weeks later, rBMSCs were fixed with 4% paraformaldehyde, treated with 5% silver nitrate, exposed to UV light and developed in 5% sodium subsulfite to visualize the calcium nodules.
2.7. RNA isolation and semiquantitative reverse transcriptionpolymerase chain reaction (RT-PCR)
2.9. Animal model
For osteogenic differentiation study, 4 105 hBMSCs were seeded onto the bi-layer COL-nanofiber and COL scaffolds (n = 6 for each
Adult male New Zealand white rabbits (2.5–3 kg) were maintained singly in stainless-steel cages. Under intramuscular and
Please cite this article in press as: Zhang S et al. Bi-layer collagen/microporous electrospun nanofiber scaffold improves the osteochondral regeneration. Acta Biomater (2013), http://dx.doi.org/10.1016/j.actbio.2013.04.003
4
S. Zhang et al. / Acta Biomaterialia xxx (2013) xxx–xxx
intravenous injection with 10% chloral hydrate (4 ml kg1), the knee joint was opened with a medial parapatellar approach. The patella was dislocated laterally and the surface of the femoropatellar groove was exposed. A cylindrical osteochondral defect of 4 mm diameter and 3.5–4 mm deep was created in the patellar groove using a stainless-steel punch. The defects were untreated (group I, n = 14 joints), or treated with a bi-layer COL scaffold (group II, n = 14 joints) or with a bi-layer COL-nanofiber scaffold (group III, n = 14 joints). Immediately after surgery, the animals were returned to their individual cages without joint immobilization. A postoperative antibiotic (gentamicin) was administered intramuscularly at 400,000 U per day for 3 days. After sacrifice, three knee joints from each group were evaluated histologically at 6 and 12 weeks. Five knee joints from each group were used for mechanical testing and three knee joints from each group were evaluated by micro-computed tomography (l-CT) at 12 weeks. All animals were treated according to the standard guidelines approved by Zhejiang University Ethics Committee (No. ZJU 2010105003). 2.10. Gross morphology and histology At 6 and 12 weeks after surgery, the rabbits were sacrificed by intravenous overdose of pentobarbital. Three to four samples from each group were examined and photographed for evaluation according to the International Cartilage Repair Society (ICRS) macroscopic assessment scale for cartilage repair (Table 1) [23]. After gross examination, samples were fixed in 4% formalin, decalcified in 4% ethylenediamine tetraacetic acid (EDTA) for 14 days and then embedded in paraffin and cut into 7 lm sections. Sections from each sample were stained with hematoxylin and eosin for morphological evaluation and stained with Safranin O for glycosaminoglycan distribution. Histological and histomorphometric observation was performed under a light microscope (X71; Olympus, Tokyo, Japan) and analyzed with DP Controller 3.1.1.267 software (Olympus). For the overall evaluation of regenerated tissue in the defects, the repaired tissues were graded blindly by three observers, using the ICRS Visual Histological Assessment Scale (Table 2) [24]. 2.11. Biomechanical evaluation Following a previous study [2,25], biomechanical evaluation was performed as below. Samples were placed in PBS at room
temperature for 3–4 h to equilibrate before testing. The compressive mechanical properties of the surface cartilage layer were tested with an Instron testing machine (model 5543; Instron, Canton, MA) and software (Bluehill V2.0; Instron), using a 2 mm diameter cylindrical indenter fitted with a 10 N maximum loading cell. The unconfined equilibrium modulus was determined by applying a step displacement (20% strain) and monitoring compressive force with time until equilibrium was reached. The thickness of the fully relaxed cartilage layer was tested to estimate strain for applied deformations. The cross-head speed used was 0.06 mm min1. The ratio of equilibrium force to cross-sectional area was divided by the applied strain to calculate the equilibrium modulus (in MPa). Samples following long-term treatment in vivo (12 weeks, n = 5 samples per group) were tested, and native osteochondral samples were also evaluated (n = 5 plugs). 2.12. l-CT assay For l-CT observation, samples were first fixed with 4% paraformaldehyde for 48 h. After that, samples from each group (12 weeks, n = 5 samples per group) were scanned with l-CT imaging system with a 18 lm isotropic voxel resolution under 60 kV scanning voltage (Skyscan1076, Micro Technology Hong Kong). 2.13. Statistical analysis To assess differences in histological scoring data and biomechanical data, one-way analysis of variance, post hoc Student– Newman–Keuls (SNK) test was used with SPSS v. 16. A P-value of less than 0.05 was considered statistically significant. 3. Results 3.1. Macroscopic and microscopic structure of the bi-layer scaffolds When the bi-layer scaffolds were prepared, both layers were white in color and they can be easily distinguished from each other (Fig. 1C a, e). SEM examination of the bi-layer scaffolds revealed that both layers, either in the COL scaffold or COL-nanofiber scaffold, integrated well. In the COL scaffold, the loose collagen layer had a pore size of 100–300 lm and most were vertical pores, whereas the dense layer exhibited horizontal pores with a pore
Table 1 International Cartilage Repair Society macroscopic evaluation of cartilage repair. Cartilage repair assessment ICRS Degree of defect repair In level with surrounding cartilage 75% repair of defect depth 50% repair of defect depth 25% repair of defect depth 0% repair of defect depth Integration to border zone Complete integration with surrounding cartilage Demarcating border < 1 mm 3/4 of graft integrated, 1/4 with a notable border > 1 mm width 1/2 of graft integrated with surrounding cartilage, ½ with a notable border > 1 mm From no contact to 1/4 of graft integrated with surrounding cartilage Macroscopic appearance Intact smooth surface Fibrillated surface Small, scattered fissures or cracks Several, small or few but large fissures Total degeneration of grafted area Overall repair assessment Grade I: normal Grade II: nearly normal Grade III: abnormal Grade IV: severely abnormal
Points 4 3 2 1 0 4 3 2 1 0 4 3 2 1 0 12 11-8 7-4 3-1
Please cite this article in press as: Zhang S et al. Bi-layer collagen/microporous electrospun nanofiber scaffold improves the osteochondral regeneration. Acta Biomater (2013), http://dx.doi.org/10.1016/j.actbio.2013.04.003
5
S. Zhang et al. / Acta Biomaterialia xxx (2013) xxx–xxx Table 2 Histological scoring system for evaluation of overall tissue filling (a), subchondral bone repair (b) and cartilage repair (c) in rabbit osteochondral defects. Score (a) Overall defect evaluation (throughout the entire defect depth) 1. Percent filling with newly formed tissue 100% >50% <50% 0% 2. Percent degradation of the implant 100% >50% <50% 0% (b) Subchondral bone evaluation (within the bottom 2 mm of defect) 3. percent filling with newly formed tissue 100% >50% <50% 0% 4. Subchondral bone morphology Normal, trabecular bone Trabecular bone, with some compact bone Compact bone Compact bone and fibrous tissue Only fibrous tissue or no tissue 5. Extent of new tissue bonding with adjacent bone Complete on both edges Complete on one edge Partial on both edges Without continuity on either edge (c) Cartilage evaluation (within the upper 1 mm of defect) 6. Morphology of newly formed surface tissue Exclusively articular cartilage Mainly hyaline cartilage Fibrocartilage (spherical morphology observed with P 75% of cells) Only fibrous tissue (spherical morphology observed with < 75% of cells) No tissue 7. Thickness of newly formed cartilage Similar to the surrounding cartilage Greater than the surrounding cartilage Less than the surrounding cartilage No cartilage 8. Joint surface regularity Smooth, intact surface Surface fissures (<25% of new surface thickness) Deep fissures (P25% of new surface thickness) Complete disruption of the new surface 9. Chondrocyte clustering None at all <25% chondrocyte 25–100% chondrocyte No chondrocytes present (no cartilage) 10. Chondrocyte and GAG content of new cartilage Normal cellularity with normal Safranin O staining Normal cellularity with moderate Safranin O staining Clearly less cells with poor Safranin O staining Few cells with no or little Safranin O staining or no cartilage 11. Chondrocyte and GAG content of new cartilage Normal cellularity with normal Safranin O staining Normal cellularity with moderate Safranin O staining Clearly less cells with poor Safranin O staining Few cells with no or little Safranin O staining or no cartilage
size of 50–100 lm (Fig. 1C b–d). In the COL-nanofiber scaffold, top collagen matrix had a pore size of 50–150 lm and the PLA nanofibers, which are 80–120 lm in width, were assembled to 3-D PLA layers with a pore size of 100–300 lm (Fig. 1C f–h). 3.2. Both bi-layer scaffolds supported the adhesion and proliferation of BMSCs After rabbit BMSCs were seeded onto the bi-layer scaffolds for 40 h, the scaffolds were fixed and cells were visualized by SEM (Fig. 2A,B). Rabbit BMSCs attached and spread to the surface of
3 2 1 0 3 2 1 0
3 2 1 0 4 3 2 1 0 3 2 1 0
4 3 2 1 0 3 2 1 0 3 2 1 0 3 2 1 0 3 2 1 0 3 2 1 0
both the collagen layer and the PLA nanofiber, indicating good cell adhesion on both bi-layer scaffolds. We further tested the cell proliferation on both bi-layer scaffolds. Rabbit BMSCs were seeded on COL and COL-nanofiber scaffolds and cultured for 1 week. MTT assay was carried out on days 1, 3, 5 and 7 after cell seeding (Fig. 2C). During this culture period, the number of rabbit BMSCs increased more than three-folds on day 7 compared to day 1. The MTT reading was slightly higher in the COL group, but there was no significant difference between the COL scaffold and the COL-nanofiber scaffold. It demonstrated that both bi-layer scaffolds did not affect cell proliferation.
Please cite this article in press as: Zhang S et al. Bi-layer collagen/microporous electrospun nanofiber scaffold improves the osteochondral regeneration. Acta Biomater (2013), http://dx.doi.org/10.1016/j.actbio.2013.04.003
6
S. Zhang et al. / Acta Biomaterialia xxx (2013) xxx–xxx
3.3. Bi-layer COL-nanofiber scaffold promoted osteogenic differentiation of BMSCs hBMSCs were cultured on both COL and COL-nanofiber scaffolds. 5 days later, RNA was extracted and the expression of genes related to osteogenic differentiation was analyzed. The expression levels of both osoeocalcin (OCN) and runx2 from cells on COL-nanofiber scaffold were almost two-fold higher than that on COL scaffold (Fig. 3A and B). Osteogenic differentiation was further evaluated in rBMSCs by von Kossa staining 2 weeks after cell seeding (Fig. 3C). Obvious calcium nodules were observed on both bi-layer scaffolds. However, more positive staining was observed in cells on the COL-nanofiber scaffold, indicating that more calcium nodules were formed by cells seeded on the COL-nanofiber scaffold. Both gene expression and calcium nodule formation demonstrated that the COL-nanofiber scaffold promoted osteogenic differentiation.
3.4. Improved osteochondral repair in rabbits treated with COLnanofiber scaffold 3.4.1. Macroscopic observation of cartilage repair No swelling and inflammation were detected at both 6 and 12 weeks by gross examination of knee joints (Fig. 4A–F). Synovial hyperplasia was not observed in the knee joints. 6 weeks after transplantation, the non-treated group exhibited obvious boundary between the defect and normal tissue, and few neo-tissues formed. The defect in the COL group was filled with neo-tissue and moderately integrated with surrounding tissue. Glossy white, well-integrated repaired tissue was observed in the COL-nanofiber
group and only small fissures were observed in the center of the defect region. At 12 weeks after transplantation, obvious defects still existed in the center while white neo-tissue was observed in the boundary area in the non-treated group. There was white neo-tissue that appeared to be well-integrated with the surrounding tissue but still exhibited a different color in the COL group. However, the defect in the COL-nanofiber group was filled with cartilage-like tissue with similar color and was well integrated with the surrounding normal tissue. According to the ICRS from macroscopic observations, the overall scores in the COL-nanofiber group were 8.28 ± 1.42 and 10.89 ± 0.84 at 6 weeks and 12 weeks, respectively, higher than the other two groups (week 6: 3 ± 1 in the non-treated group, 5 ± 2.65 in the COL group; week 12: 7 ± 4 in the non-treated group, 9.78 ± 2.10 in the COL group) (⁄P < 0.05 for the COL-nanofiber group vs. non-treated group at week 6) (Fig. 4G–H).
3.4.2. Histological analysis of osteochondral repair At 6 weeks after transplantation, there was fibrous tissue instead of cartilage formation in the joint surface of the defect and the subchondral bone was replaced with adipose tissue and fibrous tissue in the non-treated group (Fig. 5A, D, G and J). In contrast, in the COL group, the joint surface of the defect was repaired with a mixture of fibrous tissue and fibrocartilage tissue as shown by hematoxylin and eosin and Safranin O staining, and the subchondral bone was formed with cancellous bone as well as compact bone (Fig. 5B, E, H and K). In the COL-nanofiber group (Fig. 5C, F, I and L), the joint surface of the defect was smooth and repaired with a mixture of fibrocartilage tissue and cartilage-like tissue, with the same thickness and integration. The subchondral bone was formed between the collagen and PLA layers, starting from
Fig. 2. Cell adhesion and proliferation on the bi-layer scaffolds. (A, B) SEM images of rBMSCs on collagen (A) and PLA nanofiber (B) scaffolds. (C) rBMSCs proliferation on both COL and COL-nanofiber bi-layer scaffolds measured by MTT assay (absorbance value means the relative proliferation and activity of the cells over time).
Please cite this article in press as: Zhang S et al. Bi-layer collagen/microporous electrospun nanofiber scaffold improves the osteochondral regeneration. Acta Biomater (2013), http://dx.doi.org/10.1016/j.actbio.2013.04.003
S. Zhang et al. / Acta Biomaterialia xxx (2013) xxx–xxx
7
Fig. 3. Osteogenic differentiation of BMSCs on the bi-layer scaffolds indicated by expression of OCN and runx2 genes after 5 days of culture (A, B) as well as calcium nodule accumulation by von Kossa staining after 14 days of culture (C). Data are shown as average scores with error bars representing standard derivation for n = 4 (⁄P < 0.05).
Fig. 4. Macroscopic images of the cartilage joints from three groups and their ICRS scores at 6 (upper panel) and 12 (lower panel) weeks after surgery. (A, D) non-treated group, (B, E) COL group and (C, F) COL-nanofiber group. Scale bar: 4 mm. Data are shown as average scores with error bars representing standard deviation (n = 3, ⁄P < 0.05 between non-treated group and the COL-nanofiber group at week 6 after surgery).
Please cite this article in press as: Zhang S et al. Bi-layer collagen/microporous electrospun nanofiber scaffold improves the osteochondral regeneration. Acta Biomater (2013), http://dx.doi.org/10.1016/j.actbio.2013.04.003
8
S. Zhang et al. / Acta Biomaterialia xxx (2013) xxx–xxx
the boundary area of the defect. Moreover, the subchondral bone was mainly cancellous bone, which was well-integrated with the surrounding bone tissue. At 12 weeks after transplantation, the joint surface of the defect in the non-treated group was still filled with fibrous tissue, and some subchondral bone that filled with adipose tissue and fibrous tissue was formed (Fig. 6A, D, G and J). However, in the COL group (Fig. 6B, E, H and K), the joint surface of the defect was mainly repaired with fibrocartilage tissue, which was thinner than the surrounding normal cartilage tissue. The subchondrla bone was thin, continuous, compact bone and was well-integrated with the surrounding bone tissue. In the COL-nanofiber group (Fig. 6C, F, I and L), repaired tissue was thicker, cartilage-like tissue, which was well-integrated with the surrounding normal cartilage tissue and exhibited adequate extracellular matrix deposition indicated by Safranin O staining. The subchondral area was filled with mature spongy bone. Half of the PLA fibers were degraded and replaced with fibroblasts and few bone tissue.
3.4.3. Total scoring and subchondral bone evaluation of osteochondral repair According to the histological scoring system (Table 2), the repaired cartilage from three groups was evaluated. The total scores in the COL-nanofiber group were 31.01 ± 0.83 and 31.66 ± 1.04 at weeks 6 and 12, respectively, significantly higher than those in the non-treated group (9.83 ± 1.53 at week 6, 10.33 ± 1.42 at week 12) and the COL group (21.77 ± 5.15 at week 6 and 23.46 ± 4.66 at week 12) (Fig. 7A). Specifically, the score of the subchondral bone formed in the COL-nanofiber group at week 6 (9.28 ± 0.30) was significantly higher than other two groups (3.42 ± 0.88 in the non-treated group, 6.52 ± 1.80 in the COL group) (P < 0.05); at week 12, score of the subchondral bone formed in the COL-nanofiber group (9.44 ± 0.18) was also higher than the other two groups (3.42 ± 0.80 in the nontreated group, 7.64 ± 2.22 in the COL group) with significant difference from non-treated group (P < 0.05) (Fig. 7B). We further analyzed the subchondral bone by evaluating the bone filling, subchondral morphology and bone bonding (Fig. 7C
Fig. 5. Histological examination of samples from three groups at 6 weeks after surgery, stained with hematoxylin and eosin (A–F) and Safranin O (G–L). (A–C, G–I) Original magnification: 40, scale bar: 500 um. (D–F, J–L) Original magnification: 100, scale bar: 200 um. Open box in each image (A–C, G–I) indicates the area shown in the lower panel with higher magnification correspondingly (D–F, J–L). The defect is indicated with black arrows in each image.
Please cite this article in press as: Zhang S et al. Bi-layer collagen/microporous electrospun nanofiber scaffold improves the osteochondral regeneration. Acta Biomater (2013), http://dx.doi.org/10.1016/j.actbio.2013.04.003
S. Zhang et al. / Acta Biomaterialia xxx (2013) xxx–xxx
9
Fig. 6. Histological examination of samples from three groups at 12 weeks after surgery, stained with hematoxylin and eosin (A–F) and Safranin O (G–L). (A–C, G–I) Original magnification: 40, scale bar: 500 um. (D–F, J–L) Original magnification: 100, scale bar: 200 um. Open box in each image (A–C, G–I) indicates the area shown in the lower panel with higher magnification correspondingly (D–F, J–L). The defect is indicated with black arrows in each image.
and D). In the COL-nanofiber group, the subchondral bone area was filled with trabecular bone (40% at week 6 and 75% at week 12) and a combination of trabecular and compact bone (50% at week 6 and 25% at week 12), while in the COL group and the non-treated group, the repaired tissue was mainly compact or fibrous tissue.
3.4.4. Improved mechanical property of neo-tissue in the COLnanofiber scaffold treated group The Young’s moduli of the repaired tissues from three groups at week 12 after surgery were determined and compared. The tissues from normal rabbit knee joints were used as the control. In the COL-nanofiber group, the compressive modulus of the repaired tissue was 0.57 MPa, which was 51% of normal cartilage and significantly higher than that of the COL group (0.33 MPa) and non-treated group (0.15 MPa) (P < 0.05) (Fig. 8A).
3.5. Stronger subchondral bone formation in rabbits treated with COLnanofiber scaffold
l-CT scanning was performed to further evaluate the formation of subchondral bone. Images from the center of the defect in three groups were represently chosen for analysis (Fig. 8B-E). The normal subchondral bones were also visualized under l-CT scanning as the control. 12 weeks after transplantation, the subchondral bones in both the non-treated group and the COL group were hardly visualized, while there were abundant subchondral bones formed in the COL-nanofiber group, as indicated by l-CT images. 4. Discussion In this study, there were three major findings: (1) bi-layer collagen/microporous poly-L-lactic acid nanofiber (COL-nanofiber) scaffold promoted osteogenic differentiation of BMSCs in vitro;
Please cite this article in press as: Zhang S et al. Bi-layer collagen/microporous electrospun nanofiber scaffold improves the osteochondral regeneration. Acta Biomater (2013), http://dx.doi.org/10.1016/j.actbio.2013.04.003
10
S. Zhang et al. / Acta Biomaterialia xxx (2013) xxx–xxx
Fig. 7. Total histological score and subchondral bone evaluation of samples in three groups at weeks 6 and 12 after surgery. (A) Total histological scores of samples. (B) Subchondral bone evaluation by HSS. (C, D) Component analysis of subchondral bone formed in three groups. Data are shown as average scores with error bars representing standard derivation (n = 3) (⁄P < 0.05).
(2) COL-nanofiber improved bone tissue formation and promoted in situ osteochondral repair of rabbit cartilage defect; (3) the regeneration of subchondral bone was found to initiate from the surrounding normal area and then extend to the central defect, like a bridge connecting the two sides of the defect. Nanomaterials promote interactions between cells and biomaterials and affect their adhesion and proliferation as well as differentiation. However, because electrospun nanofiber layers deposited during the process form a very compact structure with interconnected pores with dimensions smaller than that of a cell, it is difficult for the cell to infiltrate into the center of the scaffold [26]. In our study, the electrospun nanofibers were cut to 80–120 lm strips which were further assembled to the nanofiber scaffold. The pore size of such electrospun PLA scaffold was 100– 300 lm, big enough for the cells to adhere and migrate within its center during osteochondral regeneration [27]. Structural characterization of COL-nanofiber and COL scaffolds by SEM showed that the pore size was 50–300 lm, which provided enough space for cell attachment and migration into the center of the scaffold [28,29]. In this study, two types of bi-layer scaffolds, COL scaffold (top loose collagen layer and bottom dense collagen layer) and COLnanofiber scaffold (top collagen layer and bottom PLA nanofiber), were transplanted for cartilage osteochondral regeneration in the rabbit model. Both groups exhibited neo-tissue formation compared with the non-treated group. However, the group treated with COL-nanofiber scaffold was superior to the COL scaffold treated one in terms of the structure as well as the function of repaired tissues (indicated by histological evaluation, l-CT data and mechanical property). Dewire et al. has previously demonstrated that the thickness of the cartilage was related to its loading force [30]. Evaluation of subchondral bone by l-CT illustrated that the
group treated with COL-nanofiber scaffold generated the thickest subchondral bone, suggesting that it could provide better protection for the surface cartilage during long-term loading periods. The importance of subchondral bone on structural remodeling and functional maintenance of cartilage has drawn attention from researchers in both basic and clinical fields [24]. Based on histological staining, we further investigated the subchondral bone formation during osteochondral regeneration. In the group treated with COL-nanofiber scaffold, cancellous bone was the main component of subchondral bone. Meanwhile, the subchondral bone formed between the top cartilage and the bottom PLA scaffold, initiated from the subchondral bone of the normal area and then approached to the center of defect. This bridge-like subchondral bone structure was not observed in the group treated with COL scaffold, suggesting that it may be critical in maturation and maintenance of the top cartilage. Adam et al. reported that mesenchymal stem cells were sensitive to the physical properties of excellular matrix (ECM), i.e., soft ECM induced MSCs to differentiate to soft tissues, whereas hard ECMs predisposed MSCs to osteogenic differentiation [31]. Dalby and his colleagues found that disordered square array caused osteogenic differentiation of MSCs, similar to the effect of dexamethasone [32]. Meanwhile, the Smith group studied the effect of scaffolds made of PLA nanofibers on osteogenic differentiation of human embryonic stem cells (hESCs) in both 2-D and 3-D systems. Their results indicated that nanofiber scaffolds exhibited stronger osteogenic induction than non-nanomaterials [33]. In our study, the PLA nanofibers used for COL-nanofiber scaffold fabrication were 3-D and big porous nanomaterials. Cells cultured on such COL-nanofiber scaffolds exhibited higher expression levels of genes (runx2 and OCN) and proteins (indicated by calcium nodule formation and accumulation) related to osteogenesis compared with
Please cite this article in press as: Zhang S et al. Bi-layer collagen/microporous electrospun nanofiber scaffold improves the osteochondral regeneration. Acta Biomater (2013), http://dx.doi.org/10.1016/j.actbio.2013.04.003
S. Zhang et al. / Acta Biomaterialia xxx (2013) xxx–xxx
11
Fig. 8. Biomechanical property and architecture evaluation of the repaired tissues at 12 weeks after surgery. (A) Young’s moduli of the repaired tissues by mechanical test. (B–E) l-CT images of tissues from non-treated group (B), COL group (C), COL-nanofiber group (D) and normal joints.
those on COL bi-layer scaffolds. In terms of its mechanism for the augmented osteochondral regeneration by COL-nanofiber scaffold, our in vitro data demonstrated that PLA nanofibers induced osteogenic differentiation of BMSCs. However, from the histological evaluation, there was only a small part of bone tissues formed within the PLA scaffold. This implies that PLA nanofibers may induce the calcification of surrounding tissues instead of direct participation in the formation of subchondral bone. Another reason may be related to the slow degradation of PLA nanofibers. At weeks 6 and 12 after surgery, PLA nanofibers were observed in histologically stained samples and 25% and 50% of PLA nanofibers degraded within the defect at weeks 6 and 12, respectively (Fig. S1). Undegraded PLA nanofibers may provide mechanical support for differentiation/maturation of the top cartilage layer. Intriguingly, the subchondral bone extended from the surrounding normal area to the central defect area during the cartilage regeneration process (Figs. 5C and 6C). Such a regeneration process of subchondral bone is just like a bridge connecting the two sides of the defect. Moreover, we found that, from the surrounding normal area to the central repaired tissue, the cells mainly consisted of osteoblasts in the interface, then a combination of osteoblasts and chondrocytes, and lastly a mixture of chondrocytes, fibroblasts and osteoblasts within the defect (Fig. S2). It suggests that the formation of subchondral bone during regeneration is reminiscent of the endochondral ossification process. This ‘‘sandwich’’ regeneration process may provide insights into designing the scaffold, especially the bilayer scaffold, for osteochondral tissue engineering: the upper layer of the scaffold should be higher than the surface cartilage, whereas the lower layer of the scaffold can be lower than the subchondral bone. Such design would facilitate the formation of immature cartilage tissues first in the area of the subchondral bone, subsequent ossification from the interface of the normal subchondral bone and final bone formation in the defect area. Moreover, selection of biomaterials for this type of bi-layer scaffold should meet the abovementioned needs: while the upper layer of the scaffold should be the biomaterials with appropriate degradation ratio and bioactivity
of chondrogenic induction, the lower layer of the scaffold should be the biomaterials with slow degradation ratio and bioactivity of osteogenic induction. In summary, we designed the bi-layer COL-nanofiber scaffold possessing distinctive mechanical properties from collagen. Furthermore, this COL-nanofiber scaffold induced osteogenic differentiation of BMSCs in vitro and promoted osteochondral repair in vivo. Our results provide clues to the design of bi-layer scaffold for osteochondral repair. To better understand the mechanism behind the improved repair by COL-nanofiber scaffold, further evaluation of PLA nanofiber degradation in vivo and long-term observation of osteochondral defect repair are needed. Future study may focus on the manipulation of PLA nanofibers so as to achieve the optimized degradation of PLA nanofibers with concurrently abundant formation of subchondral bone. Prevention of overcalcification also needs to be addressed for long-term maintenance of the top hyaline cartilage. Meanwhile, evaluation of the effect of this COL-nanofiber scaffold on large defect in big animal models is also under consideration. Acknowledgements We first thank Prof. He Huang for complimentarily providing us with human bone marrow mesenchymal stem cells. This work was supported by the National High Technology Research and Development Program of China (863 Program 2012AA020503), the National Natural Science Foundation of China (81125014, 81071461, J1103603, 31000436), National Key Basic Research Program (2012CB966604), Zhejiang Provincial Grants (Z2100086, 2011C23079, 2012C33015), and the Fundamental Research funds for the Central Universities. Appendix A. Figures with essential colour discrimination Certain figures in this article, particularly Figures 1, 3–6 and 8, are difficult to interpret in black and white. The full colour images
Please cite this article in press as: Zhang S et al. Bi-layer collagen/microporous electrospun nanofiber scaffold improves the osteochondral regeneration. Acta Biomater (2013), http://dx.doi.org/10.1016/j.actbio.2013.04.003
12
S. Zhang et al. / Acta Biomaterialia xxx (2013) xxx–xxx
can be found in the on-line version, at http://dx.doi.org/10.1016/ j.actbio.2013.04.003. Appendix B. Supplementary data Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/ j.actbio.2013.04.003. References [1] Menetrey J, Unno-Veith F, Madry H, Van Breuseghem I. Epidemiology and imaging of the subchondral bone in articular cartilage repair. Knee Surg Sports Traumatol Arthrosc 2010;18:463–71. [2] Chen AC, Bae WC, Schinagl RM, Sah RL. Depth- and strain-dependent mechanical and electromechanical properties of full-thickness bovine articular cartilage in confined compression. J Biomech 2001;34:1–12. [3] Nukavarapu SP, Dorcemus DL. Osteochondral tissue engineering: current strategies and challenges. Biotechnol Adv 2012 Nov 19. pii: S07349750(12)00189-9. [Epub ahead of print]. [4] Hangody LR, Gal T, Szucs A, Vasarhelyi G, Toth F, Modis L, et al. Osteochondral allograft transplantation from a living donor. Arthroscopy 2012;28:1180–3. [5] Hangody L, Dobos J, Balo E, Panics G, Hangody LR, Berkes I. Clinical experiences with autologous osteochondral mosaicplasty in an athletic population: a 17year prospective multicenter study. Am J Sports Med 2010;38:1125–33. [6] Hangody L, Vasarhelyi G, Hangody LR, Sukosd Z, Tibay G, Bartha L, et al. Autologous osteochondral grafting—technique and long-term results. Injury 2008;39(Suppl 1):S32–9. [7] Dhollander AA, Liekens K, Almqvist KF, Verdonk R, Lambrecht S, Elewaut D, et al. A pilot study of the use of an osteochondral scaffold plug for cartilage repair in the knee and how to deal with early clinical failures. Arthroscopy 2012;28:225–33. [8] Melton JT, Wilson AJ, Chapman-Sheath P, Cossey AJ. TruFit CB bone plug: chondral repair, scaffold design, surgical technique and early experiences. Expert Rev Med Devices 2010;7:333–41. [9] Lee CH, Singla A, Lee Y. Biomedical applications of collagen. Int J Pharm 2001;221:1–22. [10] Williams 3rd RJ, Ranawat AS, Potter HG, Carter T, Warren RF. Fresh stored allografts for the treatment of osteochondral defects of the knee. J Bone Joint Surg Am 2007;89:718–26. [11] Gillogly SD. Treatment of large full-thickness chondral defects of the knee with autologous chondrocyte implantation. Arthroscopy 2003;19(Suppl 1):147–53. [12] Madry H, van Dijk CN, Mueller-Gerbl M. The basic science of the subchondral bone. Knee Surg Sports Traumatol Arthrosc 2010;18:419–33. [13] Imhof H, Breitenseher M, Kainberger F, Rand T, Trattnig S. Importance of subchondral bone to articular cartilage in health and disease. Top Magn Reson Imaging 1999;10:180–92. [14] Rocha LB, Goissis G, Rossi MA. Biocompatibility of anionic collagen matrix as scaffold for bone healing. Biomaterials 2002;23:449–56. [15] Shahbazi E, Kiani S, Gourabi H, Baharvand H. Electrospun nanofibrillar surfaces promote neuronal differentiation and function from human embryonic stem cells. Tissue Eng Part A 2011;17:3021–31.
[16] Hynes RO. Integrins: versatility, modulation, and signaling in cell adhesion. Cell 1992;69:11–25. [17] Zhang Y, Ouyang H, Lim CT, Ramakrishna S, Huang ZM. Electrospinning of gelatin fibers and gelatin/PCL composite fibrous scaffolds. J Biomed Mater Res B Appl Biomater 2005;72:156–65. [18] Miller EJ, Rhodes RK. Preparation and characterization of the different types of collagen. Methods Enzymol 1982;82 Pt A:33–64. [19] Ouyang HW, Goh JC, Thambyah A, Teoh SH, Lee EH. Knitted poly-lactide-coglycolide scaffold loaded with bone marrow stromal cells in repair and regeneration of rabbit Achilles tendon. Tissue Eng 2003;9:431–9. [20] Xu Y, Liu L, Zhang L, Fu S, Hu Y, Wang Y, et al. Efficient commitment to functional CD34+ progenitor cells from human bone marrow mesenchymal stem-cell-derived induced pluripotent stem cells. PLoS One 2012;7:e34321. [21] Cai YZ, Zhang GR, Wang LL, Jiang YZ, Ouyang HW, Zou XH. Novel biodegradable three-dimensional macroporous scaffold using aligned electrospun nanofibrous yarns for bone tissue engineering. J Biomed Mater Res A 2012;100:1187–94. [22] Chen G. UT, Tateishi T. Scaffold design for tissue engineering. Macromol Biosci 2002;2:67–77. [23] van den Borne MP, Raijmakers NJ, Vanlauwe J, Victor J, de Jong SN, Bellemans J, et al. International Cartilage Repair Society (ICRS) and Oswestry macroscopic cartilage evaluation scores validated for use in autologous chondrocyte implantation (ACI) and microfracture. Osteoarthritis Cartilage 2007;15:1397–402. [24] Guo X, Park H, Young S, Kretlow JD, van den Beucken JJ, Baggett LS, et al. Repair of osteochondral defects with biodegradable hydrogel composites encapsulating marrow mesenchymal stem cells in a rabbit model. Acta Biomater 2010;6:39–47. [25] Kandel RA, Grynpas M, Pilliar R, Lee J, Wang J, Waldman S, et al. Repair of osteochondral defects with biphasic cartilage-calcium polyphosphate constructs in a sheep model. Biomaterials 2006;27:4120–31. [26] Fujikura K, Obata A, Kasuga T. Cellular migration to electrospun poly(lactic acid) fibermats. J Biomater Sci Polym Ed 2012;23(15):1939–50. [27] Yang F, Murugan R, Wang S, Ramakrishna S. Electrospinning of nano/micro scale poly(L-lactic acid) aligned fibers and their potential in neural tissue engineering. Biomaterials 2005;26:2603–10. [28] McCarthy AD, Uemura T, Etcheverry SB, Cortizo AM. Advanced glycation endproducts interefere with integrin-mediated osteoblastic attachment to a type-I collagen matrix. Int J Biochem Cell Biol 2004;36:840–8. [29] Woo KM, Jun JH, Chen VJ, Seo J, Baek JH, Ryoo HM, et al. Nano-fibrous scaffolding promotes osteoblast differentiation and biomineralization. Biomaterials 2007;28:335–43. [30] Dewire P, Simkin PA. Subchondral plate thickness reflects tensile stress in the primate acetabulum. J Orthop Res 1996;14:838–41. [31] Xin X, Hussain M, Mao JJ. Continuing differentiation of human mesenchymal stem cells and induced chondrogenic and osteogenic lineages in electrospun PLGA nanofiber scaffold. Biomaterials 2007;28:316–25. [32] Li WJ, Tuli R, Huang X, Laquerriere P, Tuan RS. Multilineage differentiation of human mesenchymal stem cells in a three-dimensional nanofibrous scaffold. Biomaterials 2005;26:5158–66. [33] Telemeco TA, Ayres C, Bowlin GL, Wnek GE, Boland ED, Cohen N, et al. Regulation of cellular infiltration into tissue engineering scaffolds composed of submicron diameter fibrils produced by electrospinning. Acta Biomater 2005;1:377–85.
Please cite this article in press as: Zhang S et al. Bi-layer collagen/microporous electrospun nanofiber scaffold improves the osteochondral regeneration. Acta Biomater (2013), http://dx.doi.org/10.1016/j.actbio.2013.04.003
Contents lists available at SciVerse ScienceDirect
Acta Biomaterialia journal homepage: www.elsevier.com/locate/actabiomat
Bi-layer collagen/microporous electrospun nanofiber scaffold improves the osteochondral regeneration Shufang Zhang a,b,1, Longkun Chen a,g,1, Yangzi Jiang a, Youzhi Cai a,e, Guowei Xu a,b, Tong Tong a, Wei Zhang a,b, Linlin Wang a,b, Junfeng Ji a, Peihua Shi f,⇑, Hong Wei Ouyang a,b,c,d,⇑ a
Center for Stem Cell and Tissue Engineering, School of Medicine, Zhejiang University, Hangzhou, Zhejiang, People’s Republic of China Zhejiang Provincial Key Laboratory of Tissue Engineering and Regenerative Medicine, Zhejiang University, Hangzhou, Zhejiang, People’s Republic of China Department of Stem Cell and Regenerative Medicine, School of Medicine, Zhejiang University, Hangzhou, Zhejiang, People’s Republic of China d Soft Matter Research Center, Zhejiang University, Hangzhou, Zhejiang, People’s Republic of China e The Second Affiliated Hospital (Binjiang Branch), School of Medicine, Zhejiang University, Hangzhou, Zhejiang, People’s Republic of China f Sir Run Run Shao Hospital, School of Medicine, Zhejiang University, Hangzhou, Zhejiang, People’s Republic of China g Zhejiang Xingyue Biotechnology Co. Ltd., Hangzhou, Zhejiang, People’s Republic of China b c
a r t i c l e
i n f o
Article history: Received 17 October 2012 Received in revised form 20 March 2013 Accepted 1 April 2013 Available online xxxx Keywords: Osteochondral tissue engineering Cartilage defect repair Nanofibers Bi-layer scaffolds Subchondral bone
a b s t r a c t An optimal scaffold is crucial for osteochondral regeneration. Collagen and electrospun nanofibers have been demonstrated to facilitate cartilage and bone regeneration, respectively. However, the effect of combining collagen and electrospun nanofibers on osteochondral regeneration has yet to be evaluated. Here, we report that the combination of collagen and electrospun poly-L-lactic acid nanofibers synergistically promotes osteochondral regeneration. We first fabricated bi-layer microporous scaffold with collagen and electrospun poly-L-lactic acid nanofibers (COL-nanofiber). Mesenchymal stem cells were cultured on the bi-layer scaffold and their adhesion, proliferation and differentiation were examined. Moreover, osteochondral defects were created in rabbits and implanted with COL-nanofiber scaffold. Cartilage and subchondral bone regeneration were evaluated at 6 and 12 weeks after surgery. Compared with COL scaffold, cells on COL-nanofiber scaffold exhibited more robust osteogenic differentiation, indicated by higher expression levels of OCN and runx2 genes as well as the accumulation of calcium nodules. Furthermore, implantation of COL-nanofiber scaffold seeded with cells induced more rapid subchondral bone emergence, and better cartilage formation, which led to better functional repair of osteochondral defects as manifested by histological staining, biomechanical test and micro-computed tomography data. Our study underscores the potential of using the bi-layer microporous COL-nanofiber scaffold for the treatment of deep osteochondral defects. Ó 2013 Acta Materialia Inc. Published by Elsevier Ltd. All rights reserved.
1. Introduction Articular cartilage is an avascular, aneural and alymphatic connective tissue, and possesses poor self-reparative capacity once damaged from aging and/or joint injury. With the worldwide increase of the aging population, chronic diseases and sporting injuries, there are more and more people suffering from the joint-related diseases which largely lead to the disability. Based on the depth of injury, there are mainly three types of cartilage damage: partial thickness defect, full thickness defect and osteochondral defect (the defect extends to the subchondral bone region). Osteochondral defects constitute 5% of cartilage
⇑ Corresponding authors. Tel./fax: +86 571 88208262 (H.W. Ouyang). E-mail addresses: [email protected] (P. Shi), [email protected] (H.W. Ouyang). 1 These two authors contributed equally to this work.
injuries [1]. The subchondral bone is an integral and dynamic component of the joint, providing support for the overlying articular cartilage. Osteochondral defects, if left untreated, will potentially progress from a prearthrotic deformity to joint destruction. Therefore, it is essential to repair osteochondral defects to prevent deterioration of the joint function [1,2]. Although promising results have been achieved in the past decades to treat articular cartilage defects, osteochondral defect treatment is still challenging [3]. Hangody et al. reported good clinical results on osteochondral defect treatment with osteochondral autologous/allograft transplantation [4–6]. However, the shortage of autografts, immune reaction and possible disease dissemination from allografts as well as donor site morbidity will restrict this treatment regime. Recently, commercially available synthetic scaffolds such as Trufit and Biomatrix have been tested in animal models or clinical trials, and the overall short-term clinical outcome is favorable [7].
1742-7061/$ - see front matter Ó 2013 Acta Materialia Inc. Published by Elsevier Ltd. All rights reserved. http://dx.doi.org/10.1016/j.actbio.2013.04.003
Please cite this article in press as: Zhang S et al. Bi-layer collagen/microporous electrospun nanofiber scaffold improves the osteochondral regeneration. Acta Biomater (2013), http://dx.doi.org/10.1016/j.actbio.2013.04.003
2
S. Zhang et al. / Acta Biomaterialia xxx (2013) xxx–xxx
Nevertheless, complications will be inevitable and further validation of these implants is essential [8]. Tissue engineering has emerged as a promising strategy to repair bone and cartilage defects. Scaffold is critical to tissue engineeringbased tissue regeneration as it provides mechanical support for engineered tissues or offers a proper microenvironment for the cells. Currently, few scaffolds for osteochondral defect repair are commercially available. Collagen scaffold exhibits excellent biodegradability and biocompatibility [9]. Collagen sponge with interconnected pores provides a three-dimensional (3-D) microenvironment for cell attachment and efficient nutrient supply [10]. However, collagen sponge is mechanically inferior to subchondral bone, making it difficult to provide comparable mechanical support for cartilage. In addition, collagen degrades more rapidly than regeneration of the subchondral bone, which causes the mismatch between the degradation time and the bone-healing process. As a result, newly formed subchondral bone cannot be engineered in a physiological state, thus compromising the repair of osteochondral defects. In recent years, electrospinning technology has been applied to produce nanofibrous scaffolds, which exhibit a very high surface-to-volume ratio, mechanical strength and biomimetic properties. Previous studies have shown that nanofibrous architecture is beneficial to the proliferation and differentiation of various stem/progenitor cells, such as osteoblasts, neural stem cells, mesenchymal stem cells and embryonic stem cells [11–15]. Moreover, the small scale pores (a few microns) of electrospun nanofibrous scaffolds prevent cell migration and fibrous tissue ingrowth longitudinally and guide tissue regeneration along the surface of the nanofibrous membrane [16]. These special properties may be utilized to overcome the disadvantages of the collagen scaffold and induce subchondral bone regeneration, thus facilitating the repair of osteochondral defects. However, current electrospun nanofibrous scaffold is not suitable for 3-D bone tissue regeneration because of the small scale porous structure and low thickness of the obtained electrospun mats, which are typical of two-dimensional (2-D) sheets. We hypothesize that a 3-D microporous bi-layer scaffold incorporating electrospun nanofibers would facilitate the repair of osteochondral defects. In this study, we integrated electrospun nanofibers into the scaffold and developed a new 3-D microporous electrospun nanofibrous scaffold to evaluate its efficacy for focal osteochondral defect regeneration. A bi-layer collagen/microporous nanofiber scaffold was fabricated. Mesenchymal stem cells were then cultured on the bi-layer scaffold and their adhesion, proliferation and differentiation were examined. Moreover, focal osteochondral defects were created in rabbits and the effect of COL-nanofiber scaffold on in situ osteochondral regeneration was evaluated. 2. Materials and methods 2.1. Materials Poly-L-lactic acid (PLA) with a molecular weight of 100,000 was purchased from Medisorp Co. Type I collagen was isolated and purified from pig tendon in our lab. Cell culture media, bovine serum albumin, ascorbic acid and antibiotics were purchased from Gibco. Other reagents were purchased from Sigma unless specifically indicated.
connected to a 50 cm long Teflon tube with an internal diameter of 0.5 mm. A blunt needle was connected to the end of the Teflon tube. The positive electrode of the high-voltage power supply was clamped directly to the blunted needle. The distance between the needle tip and the collector was adjusted to 20 cm. A flat piece of tinfoil was used to collect PLA fibers. The solution was controlled by a syringe pump at a flow rate of 1.0 ml h1. An adjustable highvoltage power supply was used to supply DC voltage. A polymer jet was generated from the needle to the grounded collector. The electrospun nanofibrous membranes, which were 50–70 lm thick on average, were cut into 1.5 cm2 squares and stabilized layer by layer with tissue freezing medium, then cut into 200 lm sections. The collected microporous PLA nanofibers were washed with distilled water and 100% ethanol to remove the remained CHCl3, and stored in the desiccators for several days before use. Type I collagen was extracted and purified from pig tendons [18]. The tendons were dissected out, sliced and washed with several changes of cold distilled water to remove plasma proteins, and then extracted with 1 M NaCl in 50 mM Tris-HCl (pH 7.4) and constantly stirred overnight at 4 °C. The supernatant was decanted and the remainder was washed with several changes of cold distilled water to remove salts. Then the tendon was incubated in 0.5 M acetic acid (HAc) with 1 mg ml1 pepsin overnight at 4 °C to obtain an aqueous extract. The extract was precipitated with saline (0.9 M NaCl) and dissolved in 0.5 M HAc. The solution was then dialyzed, frozen and freeze-dried to obtain the collagen. The collagen was dissolved again in 0.05 M HAc to form 10 mg ml1 solution. The bi-layer COL scaffold was fabricated by placing the collagen solution onto the mechanically compressed collagen matrix and freeze-drying the composite again (Fig. 1A). The bi-layer COL-nanofiber scaffold was fabricated by placing the collagen solution onto the microporous PLA nanofiber layer first and freeze-drying the composite (Fig. 1B). 2.3. Characterization of bi-layer COL-nanofiber and COL scaffolds The bi-layer scaffold samples were cut in half in both vertical and cross-sections, mounted on aluminum stubs, sputter-coated with gold and observed under scanning electron microscopy (SEM) (Hitachi S3000N) at an accelerating voltage of 15 kV. 2.4. Isolation and culture of bone marrow mesenchymal stem cells Bone marrow mesenchymal stem cells (BMSCs) were isolated by short-term adherence to plastic as described previously [19]. Rabbit bone marrow was aspirated from the iliac crest of 4month-old female New Zealand white (NZW) rabbits. Nucleated cells were isolated by centrifugation at 1200 rpm for 5 min and the supernatant was removed. Following this, the nucleated cell layer was carefully collected and re-suspended in culture medium containing Dulbecco’s modified Eagle medium (DMEM), 10% w/v fetal bovine serum (FBS), 100 units ml1 penicillin and 100 lg ml1 streptocycin (all from Gibco). Cells were plated at 5 106 per 100 mm dish and incubated at 37 °C with 5% humidified CO2. After 48 h, non-adherent cells were discarded and adherent cells were continuously cultured. The medium was changed every 3 days. When cells became nearly confluent, they were detached by trypsin and serially sub-cultured. Human bone marrow mesenchymal stem cells (hBMSCs) provided by Prof. He Huang [20] were cultured under the same conditions.
2.2. Fabrication of bi-layer collagen/microporous nanofiber (COL-nanofiber) and collagen (COL) scaffolds
2.5. Cell seeding and proliferation on scaffolds
The PLA nanofibers were fabricated by electrospinning [17]. Polymer solution was prepared by dissolving PLA (M = 100,000) (Medisorp Co.) in chloroform/ethanol (3:1, v/v) at 3.5% (w/v). The polymer solution to be electrospun was placed in a 10 ml syringe
Before cell seeding, the bi-layer COL-naofiber or COL scaffold was treated according to previous studies [21,22]. It was immersed in 75% ethanol twice (30 min each time) and washed with phosphate-buffered saline (PBS) three times (30 min each time).
Please cite this article in press as: Zhang S et al. Bi-layer collagen/microporous electrospun nanofiber scaffold improves the osteochondral regeneration. Acta Biomater (2013), http://dx.doi.org/10.1016/j.actbio.2013.04.003
S. Zhang et al. / Acta Biomaterialia xxx (2013) xxx–xxx
3
Fig. 1. Fabrication and characterization of bi-layer COL and COL-nanofiber scaffolds. Fabrication process of bi-layer COL scaffolds (A) and COL-nanofiber scaffolds (B) and their microstructures (C). Macroscopic images of the bi-layer COL scaffold (a) and COL-nanofiber scaffold (e) shown obvious difference between two layers. SEM images show the top collagen layer (b, f), interface between two layers (c, g), and the bottom layers (d, h) in the bi-layer scaffolds.
After that, the scaffolds were soaked in the culture medium twice (1 h each time). Before cell seeding, the culture medium was removed and the scaffolds were placed into the fuming hood and air dried before use. Rabbit bone marrow mesenchymal stem cells (rBMSCs) at passage 2–6 were seeded onto the bi-layer COL-nanofiber and COL scaffolds (n = 6 for each group) at the density of 4 105 cells per scaffold. 12 h after seeding, the scaffolds with cells were transferred into a 24-well plate to remove the unattached cells. At days 1, 3, 5 and 7, the cells were incubated in the MTT solution (Invitrogen) at 37 °C with protection from light. 4 h later, the MTT solution was replaced with 400 ll dimethyl sulfoxide (DMSO) and the whole plate was shaken for 30 min. The absorbance value was measured with the multi-plate reader (Multiskan Spectrum) at wavelength of 570 nm. 2.6. Microstructure observation of cells seeded on bi-layer COLnanofiber and COL scaffolds 40 h after cell seeding, the cell-seeded scaffolds were fixed with 2.5% glutaraldehyde for 4 h, then treated with 1% OsO4 for 1 h. Gradient dehydration was done in serial concentrations of ethanol at 30%, 50%, 70%, 80%, 90%, 95% and 100%. After that, the samples were further treated with isoamylacetate for 30 min and dried for 1.5 h. Then the scaffolds were gold sputtered and observed under SEM (Hitachi S3000 N) at an accelerating voltage of 15 kV.
group). 24 h later, the culture medium was replaced with high glucose DMEM supplemented with 10% FBS and 1% antibiotics. After another 5 days’ culture, total cellular RNA was isolated by cell lysis in TRIZOL (Invitrogen) followed by one-step phenol chloroform–isoamyl alcohol extraction as described in the protocol. 200 ng of total RNA was reverse-transcribed into complementary DNA (cDNA) by incubation with 200 U of reverse transcriptase in 20 ml of reaction buffer at 37 °C for 1 h. 0.5 ml of cDNA was used as a template. RT-PCR of human osoeocalcin, human runx2 and human GAPDH was carried out as previously described. The following 50 and 30 primers (listed with GenBank number) were used to evaluate gene expression: human osoeocalcin: GACACCATGAGGACCCTCTC and GCCTGGTAGTTGTTGTGAGC; human runx2: GTGATAAATTCAGAAGGGAGG and CTTTTGCTAATGCTTCGTGT; human GAPDH: TGACGCTGGGGCTGGCATTG and GGCTGGTGGTCCAGGGGTCT. 2.8. von Kossa staining To investigate the osteogenic differentiation of cells on the bi-layer scaffolds, 5 105 rBMSCs were seeded onto the COL-nanofiber and COL scaffolds (n = 5 for each group). 24 h later, the culture medium was replaced with high glucose DMEM supplemented with 10% FBS and 1% antibiotics. Two weeks later, rBMSCs were fixed with 4% paraformaldehyde, treated with 5% silver nitrate, exposed to UV light and developed in 5% sodium subsulfite to visualize the calcium nodules.
2.7. RNA isolation and semiquantitative reverse transcriptionpolymerase chain reaction (RT-PCR)
2.9. Animal model
For osteogenic differentiation study, 4 105 hBMSCs were seeded onto the bi-layer COL-nanofiber and COL scaffolds (n = 6 for each
Adult male New Zealand white rabbits (2.5–3 kg) were maintained singly in stainless-steel cages. Under intramuscular and
Please cite this article in press as: Zhang S et al. Bi-layer collagen/microporous electrospun nanofiber scaffold improves the osteochondral regeneration. Acta Biomater (2013), http://dx.doi.org/10.1016/j.actbio.2013.04.003
4
S. Zhang et al. / Acta Biomaterialia xxx (2013) xxx–xxx
intravenous injection with 10% chloral hydrate (4 ml kg1), the knee joint was opened with a medial parapatellar approach. The patella was dislocated laterally and the surface of the femoropatellar groove was exposed. A cylindrical osteochondral defect of 4 mm diameter and 3.5–4 mm deep was created in the patellar groove using a stainless-steel punch. The defects were untreated (group I, n = 14 joints), or treated with a bi-layer COL scaffold (group II, n = 14 joints) or with a bi-layer COL-nanofiber scaffold (group III, n = 14 joints). Immediately after surgery, the animals were returned to their individual cages without joint immobilization. A postoperative antibiotic (gentamicin) was administered intramuscularly at 400,000 U per day for 3 days. After sacrifice, three knee joints from each group were evaluated histologically at 6 and 12 weeks. Five knee joints from each group were used for mechanical testing and three knee joints from each group were evaluated by micro-computed tomography (l-CT) at 12 weeks. All animals were treated according to the standard guidelines approved by Zhejiang University Ethics Committee (No. ZJU 2010105003). 2.10. Gross morphology and histology At 6 and 12 weeks after surgery, the rabbits were sacrificed by intravenous overdose of pentobarbital. Three to four samples from each group were examined and photographed for evaluation according to the International Cartilage Repair Society (ICRS) macroscopic assessment scale for cartilage repair (Table 1) [23]. After gross examination, samples were fixed in 4% formalin, decalcified in 4% ethylenediamine tetraacetic acid (EDTA) for 14 days and then embedded in paraffin and cut into 7 lm sections. Sections from each sample were stained with hematoxylin and eosin for morphological evaluation and stained with Safranin O for glycosaminoglycan distribution. Histological and histomorphometric observation was performed under a light microscope (X71; Olympus, Tokyo, Japan) and analyzed with DP Controller 3.1.1.267 software (Olympus). For the overall evaluation of regenerated tissue in the defects, the repaired tissues were graded blindly by three observers, using the ICRS Visual Histological Assessment Scale (Table 2) [24]. 2.11. Biomechanical evaluation Following a previous study [2,25], biomechanical evaluation was performed as below. Samples were placed in PBS at room
temperature for 3–4 h to equilibrate before testing. The compressive mechanical properties of the surface cartilage layer were tested with an Instron testing machine (model 5543; Instron, Canton, MA) and software (Bluehill V2.0; Instron), using a 2 mm diameter cylindrical indenter fitted with a 10 N maximum loading cell. The unconfined equilibrium modulus was determined by applying a step displacement (20% strain) and monitoring compressive force with time until equilibrium was reached. The thickness of the fully relaxed cartilage layer was tested to estimate strain for applied deformations. The cross-head speed used was 0.06 mm min1. The ratio of equilibrium force to cross-sectional area was divided by the applied strain to calculate the equilibrium modulus (in MPa). Samples following long-term treatment in vivo (12 weeks, n = 5 samples per group) were tested, and native osteochondral samples were also evaluated (n = 5 plugs). 2.12. l-CT assay For l-CT observation, samples were first fixed with 4% paraformaldehyde for 48 h. After that, samples from each group (12 weeks, n = 5 samples per group) were scanned with l-CT imaging system with a 18 lm isotropic voxel resolution under 60 kV scanning voltage (Skyscan1076, Micro Technology Hong Kong). 2.13. Statistical analysis To assess differences in histological scoring data and biomechanical data, one-way analysis of variance, post hoc Student– Newman–Keuls (SNK) test was used with SPSS v. 16. A P-value of less than 0.05 was considered statistically significant. 3. Results 3.1. Macroscopic and microscopic structure of the bi-layer scaffolds When the bi-layer scaffolds were prepared, both layers were white in color and they can be easily distinguished from each other (Fig. 1C a, e). SEM examination of the bi-layer scaffolds revealed that both layers, either in the COL scaffold or COL-nanofiber scaffold, integrated well. In the COL scaffold, the loose collagen layer had a pore size of 100–300 lm and most were vertical pores, whereas the dense layer exhibited horizontal pores with a pore
Table 1 International Cartilage Repair Society macroscopic evaluation of cartilage repair. Cartilage repair assessment ICRS Degree of defect repair In level with surrounding cartilage 75% repair of defect depth 50% repair of defect depth 25% repair of defect depth 0% repair of defect depth Integration to border zone Complete integration with surrounding cartilage Demarcating border < 1 mm 3/4 of graft integrated, 1/4 with a notable border > 1 mm width 1/2 of graft integrated with surrounding cartilage, ½ with a notable border > 1 mm From no contact to 1/4 of graft integrated with surrounding cartilage Macroscopic appearance Intact smooth surface Fibrillated surface Small, scattered fissures or cracks Several, small or few but large fissures Total degeneration of grafted area Overall repair assessment Grade I: normal Grade II: nearly normal Grade III: abnormal Grade IV: severely abnormal
Points 4 3 2 1 0 4 3 2 1 0 4 3 2 1 0 12 11-8 7-4 3-1
Please cite this article in press as: Zhang S et al. Bi-layer collagen/microporous electrospun nanofiber scaffold improves the osteochondral regeneration. Acta Biomater (2013), http://dx.doi.org/10.1016/j.actbio.2013.04.003
5
S. Zhang et al. / Acta Biomaterialia xxx (2013) xxx–xxx Table 2 Histological scoring system for evaluation of overall tissue filling (a), subchondral bone repair (b) and cartilage repair (c) in rabbit osteochondral defects. Score (a) Overall defect evaluation (throughout the entire defect depth) 1. Percent filling with newly formed tissue 100% >50% <50% 0% 2. Percent degradation of the implant 100% >50% <50% 0% (b) Subchondral bone evaluation (within the bottom 2 mm of defect) 3. percent filling with newly formed tissue 100% >50% <50% 0% 4. Subchondral bone morphology Normal, trabecular bone Trabecular bone, with some compact bone Compact bone Compact bone and fibrous tissue Only fibrous tissue or no tissue 5. Extent of new tissue bonding with adjacent bone Complete on both edges Complete on one edge Partial on both edges Without continuity on either edge (c) Cartilage evaluation (within the upper 1 mm of defect) 6. Morphology of newly formed surface tissue Exclusively articular cartilage Mainly hyaline cartilage Fibrocartilage (spherical morphology observed with P 75% of cells) Only fibrous tissue (spherical morphology observed with < 75% of cells) No tissue 7. Thickness of newly formed cartilage Similar to the surrounding cartilage Greater than the surrounding cartilage Less than the surrounding cartilage No cartilage 8. Joint surface regularity Smooth, intact surface Surface fissures (<25% of new surface thickness) Deep fissures (P25% of new surface thickness) Complete disruption of the new surface 9. Chondrocyte clustering None at all <25% chondrocyte 25–100% chondrocyte No chondrocytes present (no cartilage) 10. Chondrocyte and GAG content of new cartilage Normal cellularity with normal Safranin O staining Normal cellularity with moderate Safranin O staining Clearly less cells with poor Safranin O staining Few cells with no or little Safranin O staining or no cartilage 11. Chondrocyte and GAG content of new cartilage Normal cellularity with normal Safranin O staining Normal cellularity with moderate Safranin O staining Clearly less cells with poor Safranin O staining Few cells with no or little Safranin O staining or no cartilage
size of 50–100 lm (Fig. 1C b–d). In the COL-nanofiber scaffold, top collagen matrix had a pore size of 50–150 lm and the PLA nanofibers, which are 80–120 lm in width, were assembled to 3-D PLA layers with a pore size of 100–300 lm (Fig. 1C f–h). 3.2. Both bi-layer scaffolds supported the adhesion and proliferation of BMSCs After rabbit BMSCs were seeded onto the bi-layer scaffolds for 40 h, the scaffolds were fixed and cells were visualized by SEM (Fig. 2A,B). Rabbit BMSCs attached and spread to the surface of
3 2 1 0 3 2 1 0
3 2 1 0 4 3 2 1 0 3 2 1 0
4 3 2 1 0 3 2 1 0 3 2 1 0 3 2 1 0 3 2 1 0 3 2 1 0
both the collagen layer and the PLA nanofiber, indicating good cell adhesion on both bi-layer scaffolds. We further tested the cell proliferation on both bi-layer scaffolds. Rabbit BMSCs were seeded on COL and COL-nanofiber scaffolds and cultured for 1 week. MTT assay was carried out on days 1, 3, 5 and 7 after cell seeding (Fig. 2C). During this culture period, the number of rabbit BMSCs increased more than three-folds on day 7 compared to day 1. The MTT reading was slightly higher in the COL group, but there was no significant difference between the COL scaffold and the COL-nanofiber scaffold. It demonstrated that both bi-layer scaffolds did not affect cell proliferation.
Please cite this article in press as: Zhang S et al. Bi-layer collagen/microporous electrospun nanofiber scaffold improves the osteochondral regeneration. Acta Biomater (2013), http://dx.doi.org/10.1016/j.actbio.2013.04.003
6
S. Zhang et al. / Acta Biomaterialia xxx (2013) xxx–xxx
3.3. Bi-layer COL-nanofiber scaffold promoted osteogenic differentiation of BMSCs hBMSCs were cultured on both COL and COL-nanofiber scaffolds. 5 days later, RNA was extracted and the expression of genes related to osteogenic differentiation was analyzed. The expression levels of both osoeocalcin (OCN) and runx2 from cells on COL-nanofiber scaffold were almost two-fold higher than that on COL scaffold (Fig. 3A and B). Osteogenic differentiation was further evaluated in rBMSCs by von Kossa staining 2 weeks after cell seeding (Fig. 3C). Obvious calcium nodules were observed on both bi-layer scaffolds. However, more positive staining was observed in cells on the COL-nanofiber scaffold, indicating that more calcium nodules were formed by cells seeded on the COL-nanofiber scaffold. Both gene expression and calcium nodule formation demonstrated that the COL-nanofiber scaffold promoted osteogenic differentiation.
3.4. Improved osteochondral repair in rabbits treated with COLnanofiber scaffold 3.4.1. Macroscopic observation of cartilage repair No swelling and inflammation were detected at both 6 and 12 weeks by gross examination of knee joints (Fig. 4A–F). Synovial hyperplasia was not observed in the knee joints. 6 weeks after transplantation, the non-treated group exhibited obvious boundary between the defect and normal tissue, and few neo-tissues formed. The defect in the COL group was filled with neo-tissue and moderately integrated with surrounding tissue. Glossy white, well-integrated repaired tissue was observed in the COL-nanofiber
group and only small fissures were observed in the center of the defect region. At 12 weeks after transplantation, obvious defects still existed in the center while white neo-tissue was observed in the boundary area in the non-treated group. There was white neo-tissue that appeared to be well-integrated with the surrounding tissue but still exhibited a different color in the COL group. However, the defect in the COL-nanofiber group was filled with cartilage-like tissue with similar color and was well integrated with the surrounding normal tissue. According to the ICRS from macroscopic observations, the overall scores in the COL-nanofiber group were 8.28 ± 1.42 and 10.89 ± 0.84 at 6 weeks and 12 weeks, respectively, higher than the other two groups (week 6: 3 ± 1 in the non-treated group, 5 ± 2.65 in the COL group; week 12: 7 ± 4 in the non-treated group, 9.78 ± 2.10 in the COL group) (⁄P < 0.05 for the COL-nanofiber group vs. non-treated group at week 6) (Fig. 4G–H).
3.4.2. Histological analysis of osteochondral repair At 6 weeks after transplantation, there was fibrous tissue instead of cartilage formation in the joint surface of the defect and the subchondral bone was replaced with adipose tissue and fibrous tissue in the non-treated group (Fig. 5A, D, G and J). In contrast, in the COL group, the joint surface of the defect was repaired with a mixture of fibrous tissue and fibrocartilage tissue as shown by hematoxylin and eosin and Safranin O staining, and the subchondral bone was formed with cancellous bone as well as compact bone (Fig. 5B, E, H and K). In the COL-nanofiber group (Fig. 5C, F, I and L), the joint surface of the defect was smooth and repaired with a mixture of fibrocartilage tissue and cartilage-like tissue, with the same thickness and integration. The subchondral bone was formed between the collagen and PLA layers, starting from
Fig. 2. Cell adhesion and proliferation on the bi-layer scaffolds. (A, B) SEM images of rBMSCs on collagen (A) and PLA nanofiber (B) scaffolds. (C) rBMSCs proliferation on both COL and COL-nanofiber bi-layer scaffolds measured by MTT assay (absorbance value means the relative proliferation and activity of the cells over time).
Please cite this article in press as: Zhang S et al. Bi-layer collagen/microporous electrospun nanofiber scaffold improves the osteochondral regeneration. Acta Biomater (2013), http://dx.doi.org/10.1016/j.actbio.2013.04.003
S. Zhang et al. / Acta Biomaterialia xxx (2013) xxx–xxx
7
Fig. 3. Osteogenic differentiation of BMSCs on the bi-layer scaffolds indicated by expression of OCN and runx2 genes after 5 days of culture (A, B) as well as calcium nodule accumulation by von Kossa staining after 14 days of culture (C). Data are shown as average scores with error bars representing standard derivation for n = 4 (⁄P < 0.05).
Fig. 4. Macroscopic images of the cartilage joints from three groups and their ICRS scores at 6 (upper panel) and 12 (lower panel) weeks after surgery. (A, D) non-treated group, (B, E) COL group and (C, F) COL-nanofiber group. Scale bar: 4 mm. Data are shown as average scores with error bars representing standard deviation (n = 3, ⁄P < 0.05 between non-treated group and the COL-nanofiber group at week 6 after surgery).
Please cite this article in press as: Zhang S et al. Bi-layer collagen/microporous electrospun nanofiber scaffold improves the osteochondral regeneration. Acta Biomater (2013), http://dx.doi.org/10.1016/j.actbio.2013.04.003
8
S. Zhang et al. / Acta Biomaterialia xxx (2013) xxx–xxx
the boundary area of the defect. Moreover, the subchondral bone was mainly cancellous bone, which was well-integrated with the surrounding bone tissue. At 12 weeks after transplantation, the joint surface of the defect in the non-treated group was still filled with fibrous tissue, and some subchondral bone that filled with adipose tissue and fibrous tissue was formed (Fig. 6A, D, G and J). However, in the COL group (Fig. 6B, E, H and K), the joint surface of the defect was mainly repaired with fibrocartilage tissue, which was thinner than the surrounding normal cartilage tissue. The subchondrla bone was thin, continuous, compact bone and was well-integrated with the surrounding bone tissue. In the COL-nanofiber group (Fig. 6C, F, I and L), repaired tissue was thicker, cartilage-like tissue, which was well-integrated with the surrounding normal cartilage tissue and exhibited adequate extracellular matrix deposition indicated by Safranin O staining. The subchondral area was filled with mature spongy bone. Half of the PLA fibers were degraded and replaced with fibroblasts and few bone tissue.
3.4.3. Total scoring and subchondral bone evaluation of osteochondral repair According to the histological scoring system (Table 2), the repaired cartilage from three groups was evaluated. The total scores in the COL-nanofiber group were 31.01 ± 0.83 and 31.66 ± 1.04 at weeks 6 and 12, respectively, significantly higher than those in the non-treated group (9.83 ± 1.53 at week 6, 10.33 ± 1.42 at week 12) and the COL group (21.77 ± 5.15 at week 6 and 23.46 ± 4.66 at week 12) (Fig. 7A). Specifically, the score of the subchondral bone formed in the COL-nanofiber group at week 6 (9.28 ± 0.30) was significantly higher than other two groups (3.42 ± 0.88 in the non-treated group, 6.52 ± 1.80 in the COL group) (P < 0.05); at week 12, score of the subchondral bone formed in the COL-nanofiber group (9.44 ± 0.18) was also higher than the other two groups (3.42 ± 0.80 in the nontreated group, 7.64 ± 2.22 in the COL group) with significant difference from non-treated group (P < 0.05) (Fig. 7B). We further analyzed the subchondral bone by evaluating the bone filling, subchondral morphology and bone bonding (Fig. 7C
Fig. 5. Histological examination of samples from three groups at 6 weeks after surgery, stained with hematoxylin and eosin (A–F) and Safranin O (G–L). (A–C, G–I) Original magnification: 40, scale bar: 500 um. (D–F, J–L) Original magnification: 100, scale bar: 200 um. Open box in each image (A–C, G–I) indicates the area shown in the lower panel with higher magnification correspondingly (D–F, J–L). The defect is indicated with black arrows in each image.
Please cite this article in press as: Zhang S et al. Bi-layer collagen/microporous electrospun nanofiber scaffold improves the osteochondral regeneration. Acta Biomater (2013), http://dx.doi.org/10.1016/j.actbio.2013.04.003
S. Zhang et al. / Acta Biomaterialia xxx (2013) xxx–xxx
9
Fig. 6. Histological examination of samples from three groups at 12 weeks after surgery, stained with hematoxylin and eosin (A–F) and Safranin O (G–L). (A–C, G–I) Original magnification: 40, scale bar: 500 um. (D–F, J–L) Original magnification: 100, scale bar: 200 um. Open box in each image (A–C, G–I) indicates the area shown in the lower panel with higher magnification correspondingly (D–F, J–L). The defect is indicated with black arrows in each image.
and D). In the COL-nanofiber group, the subchondral bone area was filled with trabecular bone (40% at week 6 and 75% at week 12) and a combination of trabecular and compact bone (50% at week 6 and 25% at week 12), while in the COL group and the non-treated group, the repaired tissue was mainly compact or fibrous tissue.
3.4.4. Improved mechanical property of neo-tissue in the COLnanofiber scaffold treated group The Young’s moduli of the repaired tissues from three groups at week 12 after surgery were determined and compared. The tissues from normal rabbit knee joints were used as the control. In the COL-nanofiber group, the compressive modulus of the repaired tissue was 0.57 MPa, which was 51% of normal cartilage and significantly higher than that of the COL group (0.33 MPa) and non-treated group (0.15 MPa) (P < 0.05) (Fig. 8A).
3.5. Stronger subchondral bone formation in rabbits treated with COLnanofiber scaffold
l-CT scanning was performed to further evaluate the formation of subchondral bone. Images from the center of the defect in three groups were represently chosen for analysis (Fig. 8B-E). The normal subchondral bones were also visualized under l-CT scanning as the control. 12 weeks after transplantation, the subchondral bones in both the non-treated group and the COL group were hardly visualized, while there were abundant subchondral bones formed in the COL-nanofiber group, as indicated by l-CT images. 4. Discussion In this study, there were three major findings: (1) bi-layer collagen/microporous poly-L-lactic acid nanofiber (COL-nanofiber) scaffold promoted osteogenic differentiation of BMSCs in vitro;
Please cite this article in press as: Zhang S et al. Bi-layer collagen/microporous electrospun nanofiber scaffold improves the osteochondral regeneration. Acta Biomater (2013), http://dx.doi.org/10.1016/j.actbio.2013.04.003
10
S. Zhang et al. / Acta Biomaterialia xxx (2013) xxx–xxx
Fig. 7. Total histological score and subchondral bone evaluation of samples in three groups at weeks 6 and 12 after surgery. (A) Total histological scores of samples. (B) Subchondral bone evaluation by HSS. (C, D) Component analysis of subchondral bone formed in three groups. Data are shown as average scores with error bars representing standard derivation (n = 3) (⁄P < 0.05).
(2) COL-nanofiber improved bone tissue formation and promoted in situ osteochondral repair of rabbit cartilage defect; (3) the regeneration of subchondral bone was found to initiate from the surrounding normal area and then extend to the central defect, like a bridge connecting the two sides of the defect. Nanomaterials promote interactions between cells and biomaterials and affect their adhesion and proliferation as well as differentiation. However, because electrospun nanofiber layers deposited during the process form a very compact structure with interconnected pores with dimensions smaller than that of a cell, it is difficult for the cell to infiltrate into the center of the scaffold [26]. In our study, the electrospun nanofibers were cut to 80–120 lm strips which were further assembled to the nanofiber scaffold. The pore size of such electrospun PLA scaffold was 100– 300 lm, big enough for the cells to adhere and migrate within its center during osteochondral regeneration [27]. Structural characterization of COL-nanofiber and COL scaffolds by SEM showed that the pore size was 50–300 lm, which provided enough space for cell attachment and migration into the center of the scaffold [28,29]. In this study, two types of bi-layer scaffolds, COL scaffold (top loose collagen layer and bottom dense collagen layer) and COLnanofiber scaffold (top collagen layer and bottom PLA nanofiber), were transplanted for cartilage osteochondral regeneration in the rabbit model. Both groups exhibited neo-tissue formation compared with the non-treated group. However, the group treated with COL-nanofiber scaffold was superior to the COL scaffold treated one in terms of the structure as well as the function of repaired tissues (indicated by histological evaluation, l-CT data and mechanical property). Dewire et al. has previously demonstrated that the thickness of the cartilage was related to its loading force [30]. Evaluation of subchondral bone by l-CT illustrated that the
group treated with COL-nanofiber scaffold generated the thickest subchondral bone, suggesting that it could provide better protection for the surface cartilage during long-term loading periods. The importance of subchondral bone on structural remodeling and functional maintenance of cartilage has drawn attention from researchers in both basic and clinical fields [24]. Based on histological staining, we further investigated the subchondral bone formation during osteochondral regeneration. In the group treated with COL-nanofiber scaffold, cancellous bone was the main component of subchondral bone. Meanwhile, the subchondral bone formed between the top cartilage and the bottom PLA scaffold, initiated from the subchondral bone of the normal area and then approached to the center of defect. This bridge-like subchondral bone structure was not observed in the group treated with COL scaffold, suggesting that it may be critical in maturation and maintenance of the top cartilage. Adam et al. reported that mesenchymal stem cells were sensitive to the physical properties of excellular matrix (ECM), i.e., soft ECM induced MSCs to differentiate to soft tissues, whereas hard ECMs predisposed MSCs to osteogenic differentiation [31]. Dalby and his colleagues found that disordered square array caused osteogenic differentiation of MSCs, similar to the effect of dexamethasone [32]. Meanwhile, the Smith group studied the effect of scaffolds made of PLA nanofibers on osteogenic differentiation of human embryonic stem cells (hESCs) in both 2-D and 3-D systems. Their results indicated that nanofiber scaffolds exhibited stronger osteogenic induction than non-nanomaterials [33]. In our study, the PLA nanofibers used for COL-nanofiber scaffold fabrication were 3-D and big porous nanomaterials. Cells cultured on such COL-nanofiber scaffolds exhibited higher expression levels of genes (runx2 and OCN) and proteins (indicated by calcium nodule formation and accumulation) related to osteogenesis compared with
Please cite this article in press as: Zhang S et al. Bi-layer collagen/microporous electrospun nanofiber scaffold improves the osteochondral regeneration. Acta Biomater (2013), http://dx.doi.org/10.1016/j.actbio.2013.04.003
S. Zhang et al. / Acta Biomaterialia xxx (2013) xxx–xxx
11
Fig. 8. Biomechanical property and architecture evaluation of the repaired tissues at 12 weeks after surgery. (A) Young’s moduli of the repaired tissues by mechanical test. (B–E) l-CT images of tissues from non-treated group (B), COL group (C), COL-nanofiber group (D) and normal joints.
those on COL bi-layer scaffolds. In terms of its mechanism for the augmented osteochondral regeneration by COL-nanofiber scaffold, our in vitro data demonstrated that PLA nanofibers induced osteogenic differentiation of BMSCs. However, from the histological evaluation, there was only a small part of bone tissues formed within the PLA scaffold. This implies that PLA nanofibers may induce the calcification of surrounding tissues instead of direct participation in the formation of subchondral bone. Another reason may be related to the slow degradation of PLA nanofibers. At weeks 6 and 12 after surgery, PLA nanofibers were observed in histologically stained samples and 25% and 50% of PLA nanofibers degraded within the defect at weeks 6 and 12, respectively (Fig. S1). Undegraded PLA nanofibers may provide mechanical support for differentiation/maturation of the top cartilage layer. Intriguingly, the subchondral bone extended from the surrounding normal area to the central defect area during the cartilage regeneration process (Figs. 5C and 6C). Such a regeneration process of subchondral bone is just like a bridge connecting the two sides of the defect. Moreover, we found that, from the surrounding normal area to the central repaired tissue, the cells mainly consisted of osteoblasts in the interface, then a combination of osteoblasts and chondrocytes, and lastly a mixture of chondrocytes, fibroblasts and osteoblasts within the defect (Fig. S2). It suggests that the formation of subchondral bone during regeneration is reminiscent of the endochondral ossification process. This ‘‘sandwich’’ regeneration process may provide insights into designing the scaffold, especially the bilayer scaffold, for osteochondral tissue engineering: the upper layer of the scaffold should be higher than the surface cartilage, whereas the lower layer of the scaffold can be lower than the subchondral bone. Such design would facilitate the formation of immature cartilage tissues first in the area of the subchondral bone, subsequent ossification from the interface of the normal subchondral bone and final bone formation in the defect area. Moreover, selection of biomaterials for this type of bi-layer scaffold should meet the abovementioned needs: while the upper layer of the scaffold should be the biomaterials with appropriate degradation ratio and bioactivity
of chondrogenic induction, the lower layer of the scaffold should be the biomaterials with slow degradation ratio and bioactivity of osteogenic induction. In summary, we designed the bi-layer COL-nanofiber scaffold possessing distinctive mechanical properties from collagen. Furthermore, this COL-nanofiber scaffold induced osteogenic differentiation of BMSCs in vitro and promoted osteochondral repair in vivo. Our results provide clues to the design of bi-layer scaffold for osteochondral repair. To better understand the mechanism behind the improved repair by COL-nanofiber scaffold, further evaluation of PLA nanofiber degradation in vivo and long-term observation of osteochondral defect repair are needed. Future study may focus on the manipulation of PLA nanofibers so as to achieve the optimized degradation of PLA nanofibers with concurrently abundant formation of subchondral bone. Prevention of overcalcification also needs to be addressed for long-term maintenance of the top hyaline cartilage. Meanwhile, evaluation of the effect of this COL-nanofiber scaffold on large defect in big animal models is also under consideration. Acknowledgements We first thank Prof. He Huang for complimentarily providing us with human bone marrow mesenchymal stem cells. This work was supported by the National High Technology Research and Development Program of China (863 Program 2012AA020503), the National Natural Science Foundation of China (81125014, 81071461, J1103603, 31000436), National Key Basic Research Program (2012CB966604), Zhejiang Provincial Grants (Z2100086, 2011C23079, 2012C33015), and the Fundamental Research funds for the Central Universities. Appendix A. Figures with essential colour discrimination Certain figures in this article, particularly Figures 1, 3–6 and 8, are difficult to interpret in black and white. The full colour images
Please cite this article in press as: Zhang S et al. Bi-layer collagen/microporous electrospun nanofiber scaffold improves the osteochondral regeneration. Acta Biomater (2013), http://dx.doi.org/10.1016/j.actbio.2013.04.003
12
S. Zhang et al. / Acta Biomaterialia xxx (2013) xxx–xxx
can be found in the on-line version, at http://dx.doi.org/10.1016/ j.actbio.2013.04.003. Appendix B. Supplementary data Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/ j.actbio.2013.04.003. References [1] Menetrey J, Unno-Veith F, Madry H, Van Breuseghem I. Epidemiology and imaging of the subchondral bone in articular cartilage repair. Knee Surg Sports Traumatol Arthrosc 2010;18:463–71. [2] Chen AC, Bae WC, Schinagl RM, Sah RL. Depth- and strain-dependent mechanical and electromechanical properties of full-thickness bovine articular cartilage in confined compression. J Biomech 2001;34:1–12. [3] Nukavarapu SP, Dorcemus DL. Osteochondral tissue engineering: current strategies and challenges. Biotechnol Adv 2012 Nov 19. pii: S07349750(12)00189-9. [Epub ahead of print]. [4] Hangody LR, Gal T, Szucs A, Vasarhelyi G, Toth F, Modis L, et al. Osteochondral allograft transplantation from a living donor. Arthroscopy 2012;28:1180–3. [5] Hangody L, Dobos J, Balo E, Panics G, Hangody LR, Berkes I. Clinical experiences with autologous osteochondral mosaicplasty in an athletic population: a 17year prospective multicenter study. Am J Sports Med 2010;38:1125–33. [6] Hangody L, Vasarhelyi G, Hangody LR, Sukosd Z, Tibay G, Bartha L, et al. Autologous osteochondral grafting—technique and long-term results. Injury 2008;39(Suppl 1):S32–9. [7] Dhollander AA, Liekens K, Almqvist KF, Verdonk R, Lambrecht S, Elewaut D, et al. A pilot study of the use of an osteochondral scaffold plug for cartilage repair in the knee and how to deal with early clinical failures. Arthroscopy 2012;28:225–33. [8] Melton JT, Wilson AJ, Chapman-Sheath P, Cossey AJ. TruFit CB bone plug: chondral repair, scaffold design, surgical technique and early experiences. Expert Rev Med Devices 2010;7:333–41. [9] Lee CH, Singla A, Lee Y. Biomedical applications of collagen. Int J Pharm 2001;221:1–22. [10] Williams 3rd RJ, Ranawat AS, Potter HG, Carter T, Warren RF. Fresh stored allografts for the treatment of osteochondral defects of the knee. J Bone Joint Surg Am 2007;89:718–26. [11] Gillogly SD. Treatment of large full-thickness chondral defects of the knee with autologous chondrocyte implantation. Arthroscopy 2003;19(Suppl 1):147–53. [12] Madry H, van Dijk CN, Mueller-Gerbl M. The basic science of the subchondral bone. Knee Surg Sports Traumatol Arthrosc 2010;18:419–33. [13] Imhof H, Breitenseher M, Kainberger F, Rand T, Trattnig S. Importance of subchondral bone to articular cartilage in health and disease. Top Magn Reson Imaging 1999;10:180–92. [14] Rocha LB, Goissis G, Rossi MA. Biocompatibility of anionic collagen matrix as scaffold for bone healing. Biomaterials 2002;23:449–56. [15] Shahbazi E, Kiani S, Gourabi H, Baharvand H. Electrospun nanofibrillar surfaces promote neuronal differentiation and function from human embryonic stem cells. Tissue Eng Part A 2011;17:3021–31.
[16] Hynes RO. Integrins: versatility, modulation, and signaling in cell adhesion. Cell 1992;69:11–25. [17] Zhang Y, Ouyang H, Lim CT, Ramakrishna S, Huang ZM. Electrospinning of gelatin fibers and gelatin/PCL composite fibrous scaffolds. J Biomed Mater Res B Appl Biomater 2005;72:156–65. [18] Miller EJ, Rhodes RK. Preparation and characterization of the different types of collagen. Methods Enzymol 1982;82 Pt A:33–64. [19] Ouyang HW, Goh JC, Thambyah A, Teoh SH, Lee EH. Knitted poly-lactide-coglycolide scaffold loaded with bone marrow stromal cells in repair and regeneration of rabbit Achilles tendon. Tissue Eng 2003;9:431–9. [20] Xu Y, Liu L, Zhang L, Fu S, Hu Y, Wang Y, et al. Efficient commitment to functional CD34+ progenitor cells from human bone marrow mesenchymal stem-cell-derived induced pluripotent stem cells. PLoS One 2012;7:e34321. [21] Cai YZ, Zhang GR, Wang LL, Jiang YZ, Ouyang HW, Zou XH. Novel biodegradable three-dimensional macroporous scaffold using aligned electrospun nanofibrous yarns for bone tissue engineering. J Biomed Mater Res A 2012;100:1187–94. [22] Chen G. UT, Tateishi T. Scaffold design for tissue engineering. Macromol Biosci 2002;2:67–77. [23] van den Borne MP, Raijmakers NJ, Vanlauwe J, Victor J, de Jong SN, Bellemans J, et al. International Cartilage Repair Society (ICRS) and Oswestry macroscopic cartilage evaluation scores validated for use in autologous chondrocyte implantation (ACI) and microfracture. Osteoarthritis Cartilage 2007;15:1397–402. [24] Guo X, Park H, Young S, Kretlow JD, van den Beucken JJ, Baggett LS, et al. Repair of osteochondral defects with biodegradable hydrogel composites encapsulating marrow mesenchymal stem cells in a rabbit model. Acta Biomater 2010;6:39–47. [25] Kandel RA, Grynpas M, Pilliar R, Lee J, Wang J, Waldman S, et al. Repair of osteochondral defects with biphasic cartilage-calcium polyphosphate constructs in a sheep model. Biomaterials 2006;27:4120–31. [26] Fujikura K, Obata A, Kasuga T. Cellular migration to electrospun poly(lactic acid) fibermats. J Biomater Sci Polym Ed 2012;23(15):1939–50. [27] Yang F, Murugan R, Wang S, Ramakrishna S. Electrospinning of nano/micro scale poly(L-lactic acid) aligned fibers and their potential in neural tissue engineering. Biomaterials 2005;26:2603–10. [28] McCarthy AD, Uemura T, Etcheverry SB, Cortizo AM. Advanced glycation endproducts interefere with integrin-mediated osteoblastic attachment to a type-I collagen matrix. Int J Biochem Cell Biol 2004;36:840–8. [29] Woo KM, Jun JH, Chen VJ, Seo J, Baek JH, Ryoo HM, et al. Nano-fibrous scaffolding promotes osteoblast differentiation and biomineralization. Biomaterials 2007;28:335–43. [30] Dewire P, Simkin PA. Subchondral plate thickness reflects tensile stress in the primate acetabulum. J Orthop Res 1996;14:838–41. [31] Xin X, Hussain M, Mao JJ. Continuing differentiation of human mesenchymal stem cells and induced chondrogenic and osteogenic lineages in electrospun PLGA nanofiber scaffold. Biomaterials 2007;28:316–25. [32] Li WJ, Tuli R, Huang X, Laquerriere P, Tuan RS. Multilineage differentiation of human mesenchymal stem cells in a three-dimensional nanofibrous scaffold. Biomaterials 2005;26:5158–66. [33] Telemeco TA, Ayres C, Bowlin GL, Wnek GE, Boland ED, Cohen N, et al. Regulation of cellular infiltration into tissue engineering scaffolds composed of submicron diameter fibrils produced by electrospinning. Acta Biomater 2005;1:377–85.
Please cite this article in press as: Zhang S et al. Bi-layer collagen/microporous electrospun nanofiber scaffold improves the osteochondral regeneration. Acta Biomater (2013), http://dx.doi.org/10.1016/j.actbio.2013.04.003