MicroRNA-421 inhibits breast cancer metastasis by targeting metastasis associated 1

Biomedicine & Pharmacotherapy 83 (2016) 1398–1406

Available online at

ScienceDirect www.sciencedirect.com

Original article

MicroRNA-421 inhibits breast cancer metastasis by targeting metastasis associated 1 Yongqin Pana , Genlong Jiaob , Cunchuan Wanga,* , Jingge Yanga,* , Wah Yanga a b

Department of General Surgery, First Affiliated Hospital of Jinan University, Guangzhou, 510632, PR China Department of Orthopedics, First Affiliated Hospital of Jinan University, Guangzhou, 510632, PR China

A R T I C L E I N F O

Article history: Received 29 June 2016 Received in revised form 16 August 2016 Accepted 24 August 2016 Keywords: MicroRNA-421 Migration Invasion Metastasis associated 1 MCF-7 MDA-MB-231

A B S T R A C T

Dysregulation of microRNAs is involved in the initiation and progression of several human cancers, including breast cancer, as strong evidence of miRNAs acting as oncogenes or tumour suppressor genes has been found. This study was performed to investigate the biological functions of microRNA-421 (miR421) in breast cancer and the underlying mechanisms. The expression level of miR-421 was detected in 50 pairs of surgical specimens and human breast cancer cell lines. The results showed that miR-421 is downregulated in breast cancer tissues and metastatic cell lines. In addition, the decrease in miR-421 levels was significantly associated with lymph node metastasis, recurrence/metastasis, or pTNM stage. Functions of miR-421 in cell migration and invasion were assessed through its silencing and overexpression. The results showed that miR-421 knockdown promotes invasion and metastasis in MCF-7 cells and its overexpression suppresses invasion and metastasis in MDA-MB-231 cells. The specific target genes of miR-421 were predicted by TargetScan algorithm and determined by dual luciferase reporter assay, quantitative reverse transcriptase PCR, and western blot analysis. miR-421 could suppress luciferase activity of the reporter containing 30 -untranslated region of metastasis associated 1 (MTA1), a potent oncogene. miR-421 overexpression or knockdown had no effect on the mRNA expression of MTA1, but it could modulate MTA1 protein level. Furthermore, MTA1 knockdown receded the effect of miR-421 inhibitor on invasion and metastasis of MCF-7 cells, and its overexpression receded the effect of miR-421 on invasion and metastasis of MDA-MB-231 cells. Our findings clearly demonstrate that miR-421 suppresses breast cancer metastasis by directly inhibiting MTA1 expression. The present study provides a new insight into the tumour suppressor roles of miR-421 and suggests that miR-421/MTA1 pathway is a putative therapeutic target in breast cancer. ã 2016 Elsevier Masson SAS. All rights reserved.

1. Introduction MicroRNAs (miRNAs) are a class of evolutionarily conserved, small (18–25nucleotides), non-coding RNAs. They have an important function in post-transcriptional gene regulation by either inducing messenger RNA (mRNA) degradation or by inhibiting mRNA translation of target genes, through imperfect base-pairing with the 30 -untranslated region (30 UTR) of the target mRNAs [1–4].

Abbreviations: miR, 421 microRNA-421; miRNAs, microRNAs; mRNA, messenger RNA; 30 UTR, 30 -untranslated region; LN, lymph node; MTA1, metastasis associated 1; HEK-293T, human embryonic kidney 293T cell line; snRNA, small nuclear RNA; GAPDH, glyceraldehyde 3-phosphate dehydrogenase; qRT-PCR, quantitative reverse transcriptase PCR. * Corresponding authors. E-mail addresses: [email protected] (C. Wang), [email protected] (J. Yang). http://dx.doi.org/10.1016/j.biopha.2016.08.058 0753-3322/ã 2016 Elsevier Masson SAS. All rights reserved.

Several studies show that miRNAs play a key regulating role in a number of human diseases, especially cancer [2,5–12]. In many cancers, miRNAs have been demonstrated to play a role in the regulation of cell growth, cell cycle, apoptosis, migration, invasion, angiopoiesis, and cell adhesion, acting as oncogenes or tumour suppressors [13,14,7,12]. Breast cancer is the second most common cancer in the world and the most frequent cancer among women, contributing to an estimated 25% of all new cancers or cases diagnosed in 2012 [15]. It ranks fifth amongst cancer deaths overall. It is the most frequent cause of cancer deaths in women in less developed regions and is now the second cause of cancer deaths in developed regions [15]. Lymph node (LN) status is one of the most important prognostic factors in patients with breast cancer. In a previous study, miRNAs related to breast cancer LN metastasis were identified by miRNA microarray, and 8 miRNAs, including miR-206, miR-3923, miR181a, miR-92a, miR-421, miR-339-5p, miR-3196, and miR-29b,

Y. Pan et al. / Biomedicine & Pharmacotherapy 83 (2016) 1398–1406

were downregulated in LN metastasis group indicating that these miRNAs might play a role in regulating breast cancer metastasis [16]. Among eight miRNAs, only the role of miR-421 in regulating breast cancer metastasis have not been investigated. In addition, the roles of miR-421 have been investigated in some cancers, including gastric cancer, nasopharyngeal carcinoma, biliary tract cancer and prostate cancer [17–22], but it played different roles in these cancers [17–22]. In gastric cancer cells, miR-421 was overexpressed and promoted metastasis, inhibited apoptosis, and induced cisplatin resistance in vivo and in vitro [18,23], which indicated its oncogenic role. In prostate cancer, the expression of miR-421 was significantly suppressed by androgen treatment; however, overexpression of miR-421 markedly supressed cell viability, delayed cell cycle, reduced glycolysis, and inhibited migration in prostate cancer cells indicating its tumour suppressor role [19]. These results indicate that miR-421 plays different roles in different cancers. Therefore, we aimed to investigate the role of miR-421 in breast cancer in vitro to confirm the role of miR-421 in regulating breast cancer metastasis in the present study. Firstly, we first detected the expression level of miR-421 in invasive breast cancer tissues and metastatic cell lines. Subsequently, the correlations between the levels of miR-421 and various clinicopathological parameters were analysed. Furthermore, the effect of miR-421 on invasion and metastasis was investigated through knockdown or overexpression of miR-421. Finally, metastasis associated 1 (MTA1) was identified as a direct target of miR-421. The results revealed that miR-421 behaved as a tumour suppressor in breast cancer. 2. Materials and methods 2.1. Human tissue samples Fifty cases of surgically resected breast cancer samples (tumour and adjacent non-tumour tissue samples) were collected from First Affiliated Hospital of Jinan University. These samples were frozen in liquid nitrogen immediately and stored at 80  C. All pathological documents, including patients’ age, tumour size, lymph node status, histological grade, pTNM stage, recurrence/ metastasis, oestrogen receptor, progesterone receptor, and HER2 status, were carefully reviewed. The tumour dimension was measured by a pathologist while sampling, and the maximal diameter was documented and used in this study. None of the patients received chemotherapy or radiation therapy before surgery. Ethical approval was obtained from the Clinical Research Ethics Committee of First Affiliated Hospital of Jinan University. 2.2. Cell lines and cultures Human embryonic kidney 293T cell line (HEK-293T), human mammary epithelial cell line MCF10A, human breast cancer cell lines (including non-metastatic BT474 [24] and MCF-7 [25], metastatic MDA-MB-231 [25] and T-47D [25]) were purchased from American Type Culture Collection (Manassas, VA, USA). Cells, including HEK-293T, BT474, MCF-7, MDA-MB-231, and T-47D, were cultured in recommended media supplemented with 10% foetal bovine serum (FBS, Gibco, Carlsbad, CA, USA). MCF10A was maintained in DMEM/F12 (1:1) (Gibco), supplemented with EGF (100 mg/mL) (Life Technologies, Carlsbad, CA USA), cholera toxin (100 ng/mL) (Sigma, St. Louis, MO, USA), insulin (10 mg/mL) (Sigma), hydrocortisone (1 mg/mL) (Sigma), and 5% horse serum (Gibco). All cells were maintained in a humidified atmosphere with 5% CO2 at 37  C.

1399

2.3. miRNA mimic, small interfering RNA (siRNA), plasmid construction, and transfection miR-421 mimic (50 -AUCAACAGACAUUAAUUGGGCGC-30 ), miR421 mimic negative control (NC, 50 -UUCUCCGAACGUGUCACGUTT30 ), miR-421 inhibitor (inhibitor, 50 -GCGCCCAAUUAAUGUCUGUUGAU-30 , a single-stranded modified RNA with a sequence complimentary to mature miRNA), and miR-421 inhibitor negative control (inhibitor NC, 50 -CAGUACUUUUGUGUAGUACAA-30 ) were synthesised by Shanghai GenePharma Co., Ltd (Suzhou, China). The MTA1 full coding sequence (NM_001203258) was inserted into pcDNA3.0 vector by using endonucleases BamHI and EcoRI. The cloning primers for MTA1 cDNA were as follows: forward primer, 50 -AAAGGATCCATGGCCGCCAACATGTACA-30 and reverse primer, 50 -AAAGAATTCCTAGTCCTCAATAACAATGGGCTC-30 . siRNA targeting MTA1 was designed and synthesised by GenePharma Co., Ltd. The sense MTA1 siRNA (si-MTA1) sequence was 50 CTTGTGCCGTGAGATCCTAdTdT-30 . The sense negative control siRNA (si-NC) sequence was 50 -GACTTCATAAGGCGCATdTdT-30 . For transient transfection, MDA-MB-231 or MCF-7 cells were plated at 50% confluence and transfected with 200 nM miRNA mimic or 100 nM siRNA using Lipofectamine1 RNAiMAX transfection reagent (Invitrogen, CA, USA), according to the manufacturer’s protocol. Cells were harvested 24 or 48 h after transfection, for further analysis. 2.4. RNA extraction and quantitative reverse transcriptase PCR (qRTPCR) Total RNA was extracted from frozen samples or harvested cells using Trizol reagent (Invitrogen). For the quantification of mature miR-421, polyadenylation and reverse transcription were performed with All-in-One miRNA quantitative reverse transcription PCR Detection Kit (GeneCopoeia, Rockville, MD, USA), according to the manufacturer's protocol. Subsequently, qRT-PCR was performed using SYBR green-based assays on an Applied Biosystems 7500 system (Applied Biosystems, Foster City, CA, USA), with a forward primer for the mature miR-421 (50 -ATCAACAGACATTAATTGGGCGC-30 ) and the reverse universal qPCR primer from the kit. The level of mature miR-421 was normalised with U6 small nuclear RNA (snRNA), and the forward and reverse primers for human U6 snRNA in qPCR were 50 -CGCTTCGGCAGCACATATACTAA30 and 50 -TATGGAACGCTTCACGAATTTGC-30 , respectively. To quantify mRNA levels of MTA1, reverse transcription PCR was performed using PrimeScript RT Reagent Kit with cDNA Eraser (Takara, Dalian, China), and quantitative real-time PCR was performed using SYBR Premix Ex Taq (Takara). Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) gene was used as an internal control. The primer sequences of MTA1 used in qRT-PCR are 50 AGCTACGAGCAGCACAACGGGGT-30 (forward), and 50 0 CACGCTTGGTTTCCGAGGAT-3 (reverse). The primer sequences of GAPDH used in qRT-PCR were 50 -ACACCCACTCCTCCACCTTT-30 (forward) and 50 -TTACTCCTTGGAGGCCATGT-30 (reverse). Gene expression was measured in triplicates, quantified using the 2DDCT method, and normalised to a control. 2.5. Western blot analysis Harvested cells were washed twice with ice-cold phosphatebuffered saline and resuspended in ice-cold radioimmunoprecipitation assay buffer containing 1 mmol/L phenylmethanesulfonyl fluoride and a cocktail of protease inhibitors (1:100 dilution; Beyotime, Nantong, China). Samples were centrifuged at 4  C for 15 min at 14,000 rpm. Supernatants were collected and protein content was quantified using a BCA Protein Assay kit (Beyotime).

1400

Y. Pan et al. / Biomedicine & Pharmacotherapy 83 (2016) 1398–1406

Protein (30 mg) was separated using 10% SDS polyacrylamide gel and transferred to polyvinylidene fluoride membrane (Pall, New York, USA). Membranes were blocked for 1 h at 37  C in blocking buffer (5% milk in tris-buffered saline (TBS) containing 0.05% Tween-20; TBST) and then incubated with primary antibodies (anti-MTA1, 1:1000; anti-GAPDH, 1:2000; Abcam, Cambridge, MA, USA) at 37  C for 1 h. Membranes were washed thrice with TBST, incubated with horseradish peroxidase (HRP)-conjugated secondary antibody at 37  C for 40 min, and then washed thrice with TBST before protein visualisation using Immobilon Western Chemiluminescent HRP Substrate (Millipore, Billerica, MA, USA). The film was scanned and the densitometric anlysis was performed using Image Pro-Plus 6.0 software (Media Cybernetics, Silver Spring, MD, USA). For the quantification of specific bands, the same size square was drawn around each band to measure the density and then the value was adjusted by the density of the background near that band. The results of densitometric analysis were expressed as a relative ratio of the target protein to reference protein. GAPDH served as a reference protein.

sequencing. 293T cells plated on 24-well plates were co-transfected with 100 ng plasmid and 200 nmol/L of miR-421 mimic or NC. Cell lysates were harvested 48 h after transfection, and firefly and Renilla luciferase activities were measured by the DualLuciferase Reporter Assay System (Promega, USA), according to the manufacturer’s instructions. Three independent experiments were performed. 2.9. Statistical analysis Statistical analyses were performed using SPSS19.0 software (IBM, Chicago, IL, USA). Results are depicted as mean  standard deviation (SD). Student’s t-test or Dunnett’s multiple comparison was used to compare means between groups. A p-value of less than 0.05 was considered statistically significant. 3. Results 3.1. MiR-421 is downregulated in invasive breast cancer tissues and metastatic cell lines

2.6. Transwell migration and invasion assays Cell migration and invasion were assessed using a transwell assay. For migration assays, MCF-7 or MDA-MB-231 cells were harvested, and 1 105 cells suspended in 100 mL of serum-free medium was placed in a transwell insert (pore size, 8 mm; BD Biosciences, San Jose, CA, USA). The lower chamber was filled with 600 mL medium containing 10% FBS. For invasion assays, cells were suspended as in the migration assay and placed into a transwell insert pre-coated with Matrigel (BD Biosciences, Bedford, MA, USA). After incubating cells for 24 h at 37  C and gently removing the cells in the upper chamber with a cotton swab, the cells on the underside of the membrane were fixed with 4% paraformaldehyde for 15 min, stained with 0.1% crystal violet in 20% ethanol, and counted in five randomly selected fields using phase contrast microscopy. Cells were imaged at 200 magnification using Olympus microscope (Hamburg, Germany). Six independent fields per well were imaged. Each assay was performed in triplicates. 2.7. Putative targets predication TargetScan online software (http://www.targetscan.org/) was used to predict biological targets of miR-421. Then all transcripts were submitted to the Database for Annotation, Visualization and Integrated Discovery (DAVID) (https://david.ncifcrf.gov/). Through Functional Annotation Clustering tool, the putative targets related to cell migration were obtained.

To examine miR-421 expression levels, qRT-PCR analysis was performed on 50 pairs of surgical specimens (tumour and adjacent non-tumour tissue samples). A significant reduction in miR-421 expression was identified in tumour tissue samples as compared to paired non-tumour tissue samples (Fig. 1A). However, this reduction in miR-421 expression was only observed in invasive breast cancer tissues (Fig. 1B). In addition, the expression of miR421 in MCF10A, BT474, MCF-7, MDA-MB-231, and T-47D was also detected by qRT-PCR analysis. The results showed that miR-421 expression was higher in non-metastatic cell lines BT474 and MCF7 as compared to MCF10A, and the expression of miR-421 was higher in MCF-7 than in BT474. miR-421 expression was lower in metastatic cell lines MDA-MB-231 and T-47D as compared to MCF10A, and the expression of miR-421 was lower in MDA-MB231 than in T-47D (Fig. 1C). Based on these results, MCF-7 and MDA-MB-231 were chosen for further studies. In addition, the correlations between the levels of miR-421 and various clinicopathological parameters were analysed, and the results are summarised in Table 2. miR-421 expression was not found to be associated with age, tumour size, histological grade, HER2 status, progesterone receptor, or oestrogen receptor, whereas the decrease in miR-421 level was significantly associated with LN metastasis, recurrence/metastasis, or pTNM stage (Table 2, p < 0.05 for each). These results indicate that decrease in miR-421 level may be associated with breast cancer aggressiveness, especially tumour migration and invasion. 3.2. MiR-421 functioned as an invasion and metastasis suppressor

2.8. Reporter vector construction and luciferase reporter assay The full-length wild type and mutant 30 UTRs of MTA1 were amplified and cloned into the pMir-Glo vector (Promega, USA). The primer sequences used in reporter vector construction are shown in Table 1. All inserts and plasmids were verified by DNA

To knockdown miR-421 expression, miR-421 inhibitor or NC inhibitor was transiently transfected into MCF-7 cells, and to overexpress miR-421, miR-421 mimic or NC was transiently transfected into MDA-MB-231 cells. After 48 h of transfection, cells were harvested for qRT-PCR analysis. The results showed that

Table 1 Primers for luciferase reporter construction. Primer name

Sequence (50 –30 )

Nhel-F XbaI-R mutant-F mutant-R

CCGgctagcGCCATGAAGACCAGGCAGGCT ATAAGAATtctagaGCACGATCCTAACATTCCAGGTGT GCCGGGCCCTAAGGTTTTGTTGTGTTGTCAAGTAGGTGCCATTTTAAA TTTAAAATGGCACCTACTTGACAACACAACAAAACCTTAGGGCCCGGC

F: forward primer, R: reverse primer.

Y. Pan et al. / Biomedicine & Pharmacotherapy 83 (2016) 1398–1406

1401

Table 2 Correlation between miR-421 expression and clinicopathological factors of patients with breast cancer. Characteristics

Age <55 >55 Tumour size (cm) <2.5 >2.5 Lymph node metastasis 0 1–2 >2 Histological grade Grade I Grade II Grade III-IV pTNM stage I II III-IV Recurrence/metastasis Yes No Oestrogen receptor Negative Positive Progesterone receptor Negative Positive HER2 status Negative Positive

n

miR-421 expression High expression

Low expression

30 20

6(20%) 5 (25%)

24 (80%) 15 (75%)

21 29

4 (19%) 7 (24%)

17 (91%) 22 (76%)

20 16 14

8 (40%) 2 (13%) 1 (7%)

12 (60%) 14 (87%) 13 (93%)

15 22 13

7 (47%) 3 (14%) 1 (8%)

8 (53%) 19 (86%) 12 (92%)

14 20 16

7 (50%) 3 (15%) 1 (6%)

7(50%) 17 (85%) 15 (94%)

26 24

9 (34%) 2 (8%)

17 (66%) 22 (92%)

26 24

7 (27%) 4 (17%)

19 (73%) 20 (83%)

22 28

5 (23%) 6 (21%)

17 (78%) 22 (79%)

27 23

6 (22%) 5 (22%)

21 (78%) 18 (78%)

p-value

0.676

0.668

0.040

0.021

0.010

0.025

0.382

0.912

0.967

miR-421 was successfully silenced in MCF-7 cells (Fig. 2A) and overexpressed in MDA-MB-231 cells (Fig. 2B). To demonstrate the role of miR-421 in regulating breast cancer cell migration and invasion, transwell assay was performed after miR-421 was successfully silenced in MCF-7 cells and overexpressed in MDA-MB-231 cells. The results showed that miR-421 knockdown promoted metastasis and invasion in MCF-7 cells (Fig. 2C and) and miR-421 overexpression suppressed metastasis and invasion in MDA-MB-231 cells (Fig. 2E and F). 3.3. MTA1 is a direct target of miR-421

Fig. 1. miR-421 is downregulated in invasive breast cancer tissues and metastatic cell lines. (A) The expression level of miR-421 in 50 pairs of surgical specimens. Data were analysed using Student’s t-test. (B) The expression level of miR-421 in invasive breast cancer tissues or breast cancer tissues in situ. (C)The expression level of miR421 in human mammary epithelial cell line MCF10A, human breast cancer cell lines (including non-metastatic BT474 and MCF-7, metastatic MDA-MB-231 and T-47D). Data were analysed using Dunnett’s multiple comparison. Vertical bars indicate SD. T, tumour; ANT, adjacent non-tumour; *, p < 0.05 compared to MCF10A.

To elucidate the underlying mechanism by which miR-421 regulates migration and invasion in breast cancer cells, TargetScan online software was used to predict biological targets of miR-421 and 426 transcripts with conserved sites were predicated. Then all transcripts were submitted to DAVID and 390 IDs of DAVID were obtained. Through Functional Annotation Clustering tool, 10 putative targets related to cell migration were obtained, shown in Table 3. Predicted targets of a miRNA family are sorted by total context score and the most favorable context score is the lowest [26]. Among 10 putative targets, the total context+ score of MTA1 is lowest and MTA1 was chose for the following study. A putative conserved target sequence of miR-421 was found at position 1120–1127 of the MTA1 30 UTR (Fig. 3A). To confirm the relationship between miR-421 and MTA1, we first examined the protein levels of MTA1 in50 pairs of surgical specimens (tumour and adjacent non-tumour tissue samples). A significant increase in MTA1 protein expression was identified in tumour tissue samples as compared to paired non-tumour tissue samples (Fig. 3B). However, this increase in MTA1 protein expression was only observed in invasive breast cancer tissues (Fig. 3C). To further examine whether miR-421 directly targets MTA1, luciferase reporter vectors containing wild type or mutant versions of the

1402

Y. Pan et al. / Biomedicine & Pharmacotherapy 83 (2016) 1398–1406

Fig. 2. miR-421 functioned as an invasion and metastasis suppressor in breast cancer cell lines MCF-7 and MDA-MB-231. The expression level of miR-421 after miR-421 inhibitor transfection in MCF-7 cells (A) or miR-421 mimic transfection in MDA-MB-231 cells (B); miR-421 knockdown promoted metastasis (C) and invasion (D) in MCF-7 cells; Left is the representative images and right is the average number per field. miR-421 overexpression suppressed metastasis (E) and invasion (F) in MDA-MB-231 cells; Left is the representative images and right is the average number per field. Data are presented as means  SD. *, p < 0.05.

predicted miR-421 binding sequence in the MTA1 30 UTR were cotransfected with miR-421 mimic or NC into 293T cells. Luciferase assays were performed 48 h after transfection. A significant decrease in the luciferase activity of the reporter was observed

for the wild type MTA1 30 UTR-containing vector after miR-421 mimic transfection, compared to NC transfection (Fig. 3D). This significant decrease in reporter activity was not seen when the reporter was in the vector containing the mutant MTA1 30 UTR

Y. Pan et al. / Biomedicine & Pharmacotherapy 83 (2016) 1398–1406

1403

Table 3 The list of the putative targets related to cell migration indicated by Targetscan and DAVID online databases. Target gene

Representative transcript

Gene full name

Total context+ score

ARHGAP26 PDGFRA CITED2 BTG1 APBB2 ARX MYH10 NRCAM ONECUT2 MTA1

NM_001135608 NM_006206 NM_001168388 NM_001731 NM_001166050 NM_139058 NM_005964 NM_001037132 NM_004852 NM_001203258

Rho GTPase activating protein 26 platelet-derived growth factor receptor, alpha polypeptide Cbp/p300-interacting transactivator, with Glu/Asp-rich carboxy-terminal domain, 2 B-cell translocation gene 1, anti-proliferative amyloid beta (A4) precursor protein-binding, family B, member 2 aristaless related homeobox myosin, heavy chain 10, non-muscle neuronal cell adhesion molecule one cut homeobox 2 metastasis associated 1

0.14 0.17 0.1 0.04 0.02 0.23 0.12 0.06 0.17 0.27

Fig. 3. MTA1 is a direct target of miR-421. (A) Predicted duplex formation between miR-421 and the wild type or mutant MTA1 30 UTR. (B) The protein levels of MTA1 in tumour (T) and adjacent non-tumour tissue samples (ANT). (C) The protein expression level of MTA1 in invasive breast cancer tissues or breast cancer tissues in situ. (D) Luciferase activity of wild type (Wild 30 UTR) or mutant (Mutant 30 UTR) MTA1 30 UTR containing reporters, in 293T cells transfected with miR-421 mimic or NC. (E) quantitative reverse transcriptase PCR (qRT-PCR) of MTA1 mRNA in MCF-7 cells transfected with miR-421 inhibitor or inhibitor NC. (F) qRT-PCR of MTA1 mRNA in MDA-MB231 cells transfected with miR-421 mimic or NC. Data were normalised to glyceraldehyde 3-phosphate dehydrogenase (GAPDH) mRNA. (G) Western blot of MTA1 level in MCF-7 or MDA-MB-231 after transfection with miR-421 inhibitor, inhibitor NC, NC, or miR-421 mimic. GAPDH protein was used as an internal loading control. Data are expressed as mean  SD. NC, negative control; *, p < 0.05.

1404

Y. Pan et al. / Biomedicine & Pharmacotherapy 83 (2016) 1398–1406

Fig. 4. The change of MTA1 expression recedes the effect of miR-421 on invasion and metastasis. (A) The mRNA expression level of MTA1 after si-MTA1 or si-NC transfection in MCF-7 cells. (B) The mRNA expression level of MTA1 after pcDNA or pcDNA-MTA1 transfection in MDA-MB-231 cells. (C) Western blot of MTA1 level in MCF-7 or MDA-MB-231 after transfection with si-MTA1, si-NC, pcDNA, or pcDNA-MTA1. Glyceraldehyde 3-phosphate dehydrogenase was used as an internal loading control. MTA1 knockdown recedes the effect of miR-421 inhibitor on metastasis (D) and invasion (E) of MCF-7 cells. Left is the representative images and right is the average number per field. MTA1 overexpression recedes the effect of miR-421 on metastasis (F) and invasion (G) of MDA-MB-231 cells. Left is the representative images and right is the average number per field. Data are presented as means  SD. *, p < 0.05.

(Fig. 3D) despite the presence of miR-421; thus, indicating that the sequence in the 1120–1127 bp region of the MTA1 30 UTR indeed interacts with miR-421 and inhibits the expression of MTA1. We then examined the effects of miR-421 overexpression or

knockdown on MTA1 mRNA and protein levels. In MCF-7 and MDA-MB-231 cells, miR-421 overexpression or knockdown did not cause degradation of MTA1 mRNA (Fig. 3E and F). However, an obvious increase in the level of endogenous MTA1 protein was

Y. Pan et al. / Biomedicine & Pharmacotherapy 83 (2016) 1398–1406

observed after miR-421 inhibitor transfection in MCF-7 cells and a clear reduction in the level of endogenous MTA1 protein was observed after miR-421 mimic transfection in MDA-MB-231 cells (Fig. 3G). 3.4. The change of MTA1 expression recedes the effect of miR-421 on invasion and metastasis To knockdown the expression of MTA1, si-MTA1 was synthesised, and to overexpress MTA1, pcDNA-MTA1 vector was constructed. After their transient transfection into MCF-7 or MDA-MB231 cells, the cells were harvested for qRT-PCR and western blot analysis. The results showed an obvious decrease in the mRNA and protein expression levels of MTA1 after si-MTA1 transfection in MCF-7 cells (Fig. 4A and C). Additionally, the mRNA and protein expression levels of MTA1 were obviously increased after pcDNAMTA1 vector transfection in MDA-MB-231 cells (Fig. 4B and C). To further examine whether miR-421 suppresses breast cancer migration and invasion through MTA1, transwell assays were performed after MTA1 knockdown or overexpression. The results MTA1 knockdown could recede the effect of miR-421 inhibitor on metastasis and invasion of MCF-7 cells (Fig. 4D and E) and MTA1 overexpression could recede the effect of miR-421 on metastasis and invasion of MDA-MB-231 cells (Fig. 4F and G). 4. Discussion Dysregulation of miRNAs is involved in the initiation and progression of several human cancers, including breast cancer, as strong evidence has been found that miRNAs can act as oncogenes or tumour suppressors [13,14,7,12]. However, miRNAs affecting breast cancer progression require further exploration. In the present study, we found that miR-421 is downregulated in invasive breast cancer tissues and metastatic cell lines and the decrease in miR-421 level was significantly associated with LN metastasis, recurrence/metastasis, or pTNM stage. These results suggested that miR-421 might play a role in regulating breast cancer migration and invasion, and our study demonstrated that miR421 behaved as a tumour suppressor in invasion and metastasis of breast cancer. In prostate cancer, miR-421 acted as a tumour suppressor [19]. Hence, the present study can be supported by these previous studies. However, our results are inconsistent with some other previous studies. In gastric cancer, pancreatic cancer, biliary tract cancer, and neuroblastoma, miR-421 functions as an oncogene [27,28,20,22,21]. This indicates that miR-421 plays different roles in different cancers. In our present study, miR421 expression was not found to be associated with tumour size, so we did not investigate the role of miR-421 in regulating cell proliferation. However, miR-421 played a role in regulating cell proliferation in gastric cancer, pancreatic cancer, biliary tract cancer, and neuroblastoma [27,28,20,22,21]. Due to only 50 pairs of surgical specimens were studied in our present study, the relationship between miR-421 expression and tumour size may have some uncertainty and further study is needed to confirm the role of miR-421 in regulating cell proliferation in breast cancer. miRNAs act either by inducing mRNA degradation or by inhibiting mRNA translation of target genes, through imperfect base-pairing with the 30 UTR of target mRNAs [1–4]. Therefore, identification of miR-421 target genes is critical for understanding its role in invasion and metastasis. In the present study, we found that MTA1, a component of the nucleosome remodelling and histone deacetylase complex that plays an important role in progression of breast cancer [29], was a novel functional target of miR-421 in breast cancer. Based on our present study, we can conclude that miR-421 regulated MTA1 protein expression by

1405

inhibiting mRNA translation of MTA1 through imperfect basepairing with the 30 UTR. Several genes have been identified as targets of miR-421, including farnesoid X receptor, forkhead box protein O4, menin, and ataxia-telangiectasia mutated were identified as directed targets of miR-421 and miR-421 act by inhibiting mRNA translation of target genes [17,22,30,28]. Our study is consistent with previous studies. In addition, we found that MTA1 knockdown recedes the effect of miR-421 inhibitor on invasion and metastasis of MCF-7 cells, and MTA1 overexpression recedes the effect of miR-421 on invasion and metastasis of MDAMB-231 cells. These results indicated that miR-421 inhibits breast cancer invasion and metastasis by MTA1. MTA1 is overexpressed in breast cancer tissues with LN metastasis, and MTA1 expression is significantly higher in noninvasive breast cancer cell lines than in invasive cells [31,32]. In the present study, we found that miR-421 is downregulated in invasive breast cancer tissues and metastatic cell lines. These results indicated that miR-421 and MTA1 might have a close relationship, and our data demonstrated this. In addition, MTA1 behaves as an oncogene in breast cancer [33,34], and our results indicated that MTA1 was a direct target of miR-421. Hence, these data can further support our conclusion that miR-421 plays a tumour suppressor role in breast cancer. In conclusion, we demonstrated that miR-421 is downregulated in invasive breast cancer tissues and metastatic cell lines, and the decrease in miR-421 was significantly associated with LN metastasis, recurrence/metastasis, or pTNM stage. In addition, miR-421 played a tumour suppressor role in breast cancer through targeting of MTA1. Conflicts of interest The authors declare that there is no conflict of interest regarding the publication of this paper. Acknowledgements This study was supported by Medical Science Fund Project of Guangdong Province, P.R. China (Grant B2012192). References [1] J. Winter, S. Jung, S. Keller, R.I. Gregory, S. Diederichs, Many roads to maturity: microRNA biogenesis pathways and their regulation, Nat. Cell Biol. 11 (3) (2009) 228–234. [2] Bartel D.P. MicroR.N.As, genomics, biogenesis, mechanism, and function, Cell 116 (2) (2004) 281–297. [3] P. Graves, Y. Zeng, Biogenesis of mammalian microRNAs: a global view, Genomics Proteomics Bioinf. 10 (5) (2012) 239–245. [4] J.H. Park, C. Shin, MicroRNA-directed cleavage of targets: mechanism and experimental approaches, BMB Rep. 47 (8) (2014) 417–423. [5] G. Bertoli, C. Cava, I. Castiglioni, MicroRNAs as biomarkers for diagnosis, prognosis and theranostics in prostate cancer, Int. J. Mol. Sci. 17 (3) (2016). [6] T.A. Farazi, J.I. Hoell, P. Morozov, T. Tuschl, MicroRNAs in human cancer, Adv. Exp. Med. Biol. 774 (2013) 1–20. [7] N. Lynam-Lennon, S.G. Maher, J.V. Reynolds, The roles of microRNA in cancer and apoptosis, Biol. Rev. Camb. Philos. Soc. 84 (1) (2009) 55–71. [8] M.M. Tsai, C.S. Wang, C.Y. Tsai, H.W. Huang, H.C. Chi, Y.H. Lin, et al., Potential diagnostic, prognostic and therapeutic targets of MicroRNAs in human gastric cancer, Int. J. Mol. Sci. 17 (6) (2016). [9] M. Weiss, L.O. Brandenburg, M. Burchardt, M.B. Stope, MicroRNA-1 properties in cancer regulatory networks and tumor biology, Crit. Rev. Oncol. Hematol. 26 (16) (2016) 30121–30124. [10] R. Yi, Y. Li, F.L. Wang, G. Miao, R.M. Qi, Y.Y. Zhao, MicroRNAs as diagnostic and prognostic biomarkers in colorectal cancer, World J. Gastrointest. Oncol. 8 (4) (2016) 330–340. [11] K. Yonemori, H. Kurahara, K. Maemura, S. Natsugoe, MicroRNA in pancreatic cancer, J. Hum. Genet. 2 (10) (2016) 59. [12] B. Zhang, X. Pan, G.P. Cobb, T.A. Anderson, microRNAs as oncogenes and tumor suppressors, Dev. Biol. 302 (1) (2007) 1–12. [13] F. Asghari, N. Haghnavaz, B. Baradaran, M. Hemmatzadeh, T. Kazemi, Tumor suppressor microRNAs: targeted molecules and signaling pathways in breast cancer, Biomed. Pharmacother. 81 (2016) 305–317.

1406

Y. Pan et al. / Biomedicine & Pharmacotherapy 83 (2016) 1398–1406

[14] D.P. Joyce, M.J. Kerin, R.M. Dwyer, Exosome-encapsulated microRNAs as circulating biomarkers for breast cancer, Int. J. Cancer 11 (10) (2016) 30179. [15] J. Ferlay, I. Soerjomataram, R. Dikshit, S. Eser, C. Mathers, M. Rebelo, et al., Cancer incidence and mortality worldwide: sources, methods and major patterns in GLOBOCAN 2012, Int. J. Cancer 136 (5) (2015) 9. [16] B. Wang, J. Li, M. Sun, L. Sun, X. Zhang, miRNA expression in breast cancer varies with lymph node metastasis and other clinicopathologic features, IUBMB Life 66 (5) (2014) 371–377. [17] L. Chen, Y. Tang, J. Wang, Z. Yan, R. Xu, miR-421 induces cell proliferation and apoptosis resistance in human nasopharyngeal carcinoma via downregulation of FOXO4, Biochem. Biophys. Res. Commun. 435 (4) (2013) 745–750. [18] X. Ge, X. Liu, F. Lin, P. Li, K. Liu, R. Geng, et al., MicroRNA-4 regulated by HIF1alpha promotes metastasis, inhibits apoptosis, and induces cisplatin resistance by targeting E-cadherin and caspase-3 in gastric cancer, Oncotarget 21 (10) (2016). [19] D. Meng, S. Yang, X. Wan, Y. Zhang, W. Huang, P. Zhao, et al., A transcriptional target of androgen receptor, miR-421 regulates proliferation and metabolism of prostate cancer cells, Int. J. Biochem. Cell Biol. 73 (2016) 30–40. [20] J.H. Wu, Y.L. Yao, T. Gu, Z.Y. Wang, X.Y. Pu, W.W. Sun, et al., MiR-421 regulates apoptosis of BGC-823 gastric cancer cells by targeting caspase-3, Asian Pac. J. Cancer Prev. 15 (13) (2014) 5463–5468. [21] H. Zhou, B. Xiao, F. Zhou, H. Deng, X. Zhang, Y. Lou, et al., MiR-421 is a functional marker of circulating tumor cells in gastric cancer patients, Biomarkers 17 (2) (2012) 104–110. [22] X.Y. Zhong, J.H. Yu, W.G. Zhang, Z.D. Wang, Q. Dong, S. Tai, et al., MicroRNA-421 functions as an oncogenic miRNA in biliary tract cancer through downregulating farnesoid X receptor expression, Gene 493 (1) (2012) 44–51. [23] Z. Jiang, J. Guo, B. Xiao, Y. Miao, R. Huang, D. Li, et al., Increased expression of miR-421 in human gastric carcinoma and its clinical association, J. Gastroenterol. 45 (1) (2010) 17–23. [24] N.D. Rambaruth, P. Greenwell, M.V. Dwek, The lectin Helix pomatia agglutinin recognizes O-GlcNAc containing glycoproteins in human breast cancer, Glycobiology 22 (6) (2012) 839–848.

[25] A. Rizwan, C. Bulte, A. Kalaichelvan, M. Cheng, B. Krishnamachary, Z.M. Bhujwalla, et al., Metastatic breast cancer cells in lymph nodes increase nodal collagen density, Sci. Rep. 5 (2015) 10002. [26] A. Grimson, K.K. Farh, W.K. Johnston, P. Garrett-Engele, L.P. Lim, D.P. Bartel, MicroRNA targeting specificity in mammals: determinants beyond seed pairing, Mol. Cell 27 (1) (2007) 91–105. [27] J. Hao, S. Zhang, Y. Zhou, C. Liu, X. Hu, C. Shao, MicroRNA 421 suppresses DPC4/ Smad4 in pancreatic cancer, Biochem. Biophys. Res. Commun. 406 (4) (2011) 552–557. [28] Y. Li, W. Li, J.G. Zhang, H.Y. Li, Y.M. Li, Downregulation of tumor suppressor menin by miR-421 promotes proliferation and migration of neuroblastoma, Tumour Biol. 35 (10) (2014) 10011–10017. [29] H.J. Kang, M.H. Lee, H.L. Kang, S.H. Kim, J.R. Ahn, H. Na, et al., Differential regulation of estrogen receptor alpha expression in breast cancer cells by metastasis-associated protein 1, Cancer Res. 74 (5) (2014) 1484–1494. [30] H. Hu, L. Du, G. Nagabayashi, R.C. Seeger, R.A. Gatti, ATM is down-regulated by N-Myc-regulated microRNA-421, Proc. Natl. Acad. Sci. U. S. A. 107 (4) (2010) 1506–1511. [31] C.W. Cheng, Y.F. Liu, J.C. Yu, H.W. Wang, S.L. Ding, C.N. Hsiung, et al., Prognostic significance of cyclin D1, beta-catenin, and MTA1 in patients with invasive ductal carcinoma of the breast, Ann. Surg. Oncol. 19 (13) (2012) 4129–4139. [32] D. Tong, G. Heinze, M. Schremmer, E. Schuster, K. Czerwenka, S. Leodolter, et al., Expression of the human MTA1 gene in breast cell lines and in breast cancer tissues, Oncol. Res. 16 (10) (2007) 465–470. [33] S.R. Nagaraj, P. Shilpa, K. Rachaiah, B.P. Salimath, Crosstalk between VEGF and MTA1 signaling pathways contribute to aggressiveness of breast carcinoma, Mol. Carcinog. 54 (5) (2015) 333–350. [34] S.B. Pakala, S.K. Rayala, R.A. Wang, K. Ohshiro, P. Mudvari, S.D. Reddy, et al., MTA1 promotes STAT3 transcription and pulmonary metastasis in breast cancer, Cancer Res. 73 (12) (2013) 3761–3770.