MicroRNA-519c-3p promotes tumor growth and metastasis of hepatocellular carcinoma by targeting BTG3

Biomedicine & Pharmacotherapy 118 (2019) 109267

Contents lists available at ScienceDirect

Biomedicine & Pharmacotherapy journal homepage: www.elsevier.com/locate/biopha

MicroRNA-519c-3p promotes tumor growth and metastasis of hepatocellular carcinoma by targeting BTG3

T

Liang Wanga,1, Huanye Moa,1, Yezhen Jianga,b,1, Yufeng Wanga, Liankang Suna, Bowen Yaoa, ⁎ ⁎ Tianxiang Chena, Runkun Liua, Qing Lia, Qingguang Liua, , Guozhi Yina, a b

Department of Hepatobiliary Surgery, The First Affiliated Hospital of Xi’an Jiaotong University, Xi’an, Shaanxi Province 710061, China Department of General Surgery, Xi'an Beihuan Hospital, Xi’an, Shaanxi Province 710032, China

A R T I C LE I N FO

A B S T R A C T

Keywords: HCC miR-519c-3p BTG3 Tumor growth Tumor metastasis

Tumor recurrence and metastasis after surgical resection are the major causes for the cancer-related death of hepatocellular carcinoma (HCC). Thus, better understanding the mechanisms involved in tumor progression will benefit to improve HCC treatment. Accumulating evidence demonstrates that microRNAs (miRNAs) play critical roles in the development and progression of HCC. However, the function of miR-519c-3p in HCC and its related mechanism remain unexplored. Here, we reported that miR-519c-3p was strongly overexpressed in HCC tissues, which was significantly correlated with poor prognosis and clinicopathological features including tumor size ≥5 cm, vascular invasion and advanced tumor-node-metastasis (TNM) stages (III + IV). Furthermore, the elevated levels of miR-519c-3p were observed in HCC cell lines. Subsequently, gain- or loss-of-function assays demonstrated that miR-519c-3p promoted HCC cell proliferation, migration as well as invasion in vitro, and facilitated the growth and metastasis of HCC cells in vivo. Mechanistically, B-cell translocation gene 3 (BTG3) was identified as a direct downstream target of miR-519c-3p. The level of BTG3 mRNA was downregulated in HCC and negatively correlated with miR-519c-3p expression. Western blotting confirmed that BTG3 was negatively regulated by miR-519c-3p in HCC cells. Luciferase reporter assays illustrated the direct interaction between miR-519c-3p and the 3′UTR of BTG3 mRNA. Recuse experiments demonstrated that BTG3 mediated the promoting effects of miR-519c-3p on the proliferation and motility of HCC cells. Collectively, our results suggest that miR-519c-3p functions as a tumor promotor in regulating the growth and metastasis of HCC by targeting BTG3, and potentially serves as a novel therapeutic target for HCC.

1. Introduction Hepatocellular carcinoma (HCC), one of the most common cancer, represents the third leading cause of cancer-related mortality worldwide [1]. China alone accounts for approximately half new cases and deaths of HCC due to the prevalence of hepatitis B virus (HBV) [2]. In spite of advances in diagnostic and treatment strategies, the prognosis of HCC remains poor due to the metastasis and recurrence after surgical resection [3,4]. For these reasons, the identification of key molecules involved in HCC progression is urgent and potentially improves the

clinical outcomes. MicroRNAs (miRNAs) are small non-coding RNA molecules which regulate target genes on post-transcriptional level. Extensive studies indicate that dysregulated miRNAs serve as critical factors in HCC progression through regulating various cellular processes, including cell proliferation, cell cycle, invasion, migration, autophagy, apoptosis, and cellular senescence [5–8]. Our research group has revealed several aberrantly expressed miRNAs, which regulate HCC progression through different molecular mechanisms [5,9–13]. For example, miRNA-645 represses HCC progression by inhibiting SRY-box transcription factor

Abbrevation: HCC, hepatocellular carcinoma; HBV, hepatitis B virus; miRNAs, microRNAs; SOX30, SRY-box transcription factor 30; EMT, epithelial-mesenchymal transition; UBE3C, ubiquitin protein ligase E3C; ERBB2IP, erbb2 interacting protein; PPAR-γ, peroxisome proliferator activated receptor gamma; CRC, colorectal cancer; ABCG2, ATP binding cassette subfamily G member 2; HIF-1α, hypoxia inducible factor 1 subunit alpha; BTG3, BTG family, member 3; OSCC, oral squamous cell cancer; NSCLC, non-small cell lung cancer; RCC, renal cell carcinoma; CYP3A43, cytochrome P450, family 3, subfamily A, polypeptide 43; HOXD8, homeobox D8 ⁎ Corresponding authors at: Department of Hepatobiliary Surgery, The First Affiliated Hospital of Xi’an Jiaotong University, 277 Yanta West Road, Xi’an, Shaanxi Province 710061, China. E-mail addresses: [email protected] (Q. Liu), [email protected] (G. Yin). 1 Contributed equally. https://doi.org/10.1016/j.biopha.2019.109267 Received 10 June 2019; Received in revised form 15 July 2019; Accepted 24 July 2019 0753-3322/ © 2019 The Authors. Published by Elsevier Masson SAS. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/BY-NC-ND/4.0/).

Biomedicine & Pharmacotherapy 118 (2019) 109267

L. Wang, et al.

30 (SOX30)-mediated p53 transcriptional activation [12]. Moreover, miR-542-3p inhibits the metastasis and epithelial-mesenchymal transition (EMT) of HCC by targeting ubiquitin protein ligase E3C (UBE3C) [13]. Furthermore, miR-23c suppresses tumor growth of human HCC by attenuating erbb2 interacting protein (ERBB2IP) [11]. Additionally, miRNA-1468 promotes tumor progression by activating peroxisome proliferator activated receptor gamma (PPAR-γ)-mediated AKT signaling in HCC [9]. Recently, the role of miR-519c-3p has been identified in human cancer. To KK et al. find that miR-519c is involved in chemoresistance of colorectal cancer (CRC) by targeting HuR-ATP binding cassette subfamily G member 2 (ABCG2) regulatory pathway [14]. Cha ST et al. report that miR-519c suppresses tumor angiogenesis by targeting hypoxia inducible factor 1 subunit alpha (HIF-1α) in cancer cells [15]. Li X et al. show that miR-519c inversely regulates ABCG2 expression in MCF-7 human breast cancer cells and affects the intracellular mitoxantrone accumulation [16]. However, whether miR519c-3p is involved in the progress of HCC remains unknown. B-cell translocation gene 3 (BTG3) belongs to B-cell translocation gene /transducer of the ErbB2 (BTG/Tob) protein family including BTG1, BTG2/PC3/Tis21, BTG4, Tob1 and Tob2 [17]. Previous studies have indicated that BTG3 is a tumor suppressor gene in various cancers [18–20]. The expression of BTG3 is down-regulated in lung adenocarcinoma and oral squamous cell cancer (OSCC) [21,22]. Chi Lv et al. report that BTG3 is under-expressed in CRC and BTG3 knockdown promotes cancer cell proliferation, migration, invasion, relieves G2 phase arrest, and inhibits apoptosis [23]. Ren XL et al. confirm that downregulation of BTG3 promotes cell proliferation, migration and invasion in gastric cancer [24]. BTG3 expression is reduced in prostate cancer and loss of BTG3 triggers acute cellular senescence via the ERKJMJD3-p16 signaling axis [20]. Ou YH et al. demonstrate that BTG3, a transcriptional target of p53, exerts a growth suppressive function [18]. Wei K et al. confirm that miR-106b-5p promotes proliferation and inhibits apoptosis by regulating BTG3 in non-small cell lung cancer (NSCLC) [25]. Liu L et al. demonstrate that miR-142-5p promotes cell growth and migration by targeting BTG3 in renal cell carcinoma (RCC) [26]. Lv Z et al. reveal that BTG3 expression is decreased in HCC and suppresses HCC cell proliferation, invasion and induces G1/S phase arrest [27]. However, the regulatory mechanism of BTG3 expression in HCC remains unknown. In this study, we detected the expression level of miR-519c-3p in HCC tissues and cells. Functional experiments were performed to investigate the biological role of miR-519c-3p in HCC cell proliferation, migration and invasion. Next, the target gene mediating the role of miR-519c-3p was screened and verified. This study demonstrated that miR-519c-3p promoted tumor growth and metastasis of HCC by targeting BTG3.

Table 1 Association between miR-519c-3p expression and clinicopathologic features of patients with hepatocellular carcinoma. Characteristics

Age(years) ≥60 < 60 Gender Male Female HBV infection Negative Positive Liver cirrhosis Absent Present AFP (ng/ml) < 20 ≥20 Tumor size < 5 cm ≥5 cm Tumor multiplicity Single Multiple Vascular invasion No Yes Edmondson-Steiner grade Ⅰ+Ⅱ Ⅲ+Ⅳ TNM stage Ⅰ+Ⅱ Ⅲ+Ⅳ

Number (n = 86)

miR-519c-3p levels High (n = 44)

Low (n = 42)

57 29

30 14

27 15

62 24

34 10

28 14

15 71

6 38

9 33

8 78

3 41

5 37

20 66

8 36

12 30

41 45

15 29

26 16

55 31

26 18

29 13

53 33

20 24

33 9

P-value

0.702

0.273

0.341

0.415

0.254

0.010*

0.336

0.002*

0.122 48 38

21 23

27 15

70 16

31 13

39 3

0.008*

HBV hepatitis B virus, AFP alpha-fetoprotein, TNM tumor-node-metastasis. * P < 0.05, statistically significant difference.

normal hepatic cell line LO2 were obtained from the Chinese Academy of Sciences (Shanghai, China). All cells were cultured in Dulbecco’s modified Eagle medium (DMEM) (Gibco, Grand Island, NY, USA) containing 10% fetal bovine serum (FBS) (Gibco, Grand Island, NY, USA) with 1% penicillin-streptomycin (Sigma, St-Louis, MO, USA) in a humidified incubator containing of 5% CO2 at 37 °C. The control mimics (miR-control, miR1N0000001-1-5), miR-519c3p mimics (miR-519c-3p, miR10002832-1-5), control inhibitors (antimiR-NC, miR2N0000001-1-5) and miR-519c-3p inhibitors (anti-miR519c-3p, miR20002832-1-5) were purchased from RioBio (Guangzhou, China). Lentivector-mediated miR-519c-3p inhibitors (Lv-anti-miR519c-3p, HmiR-AN0590) and negative control (Lv-anti-miR-NC) were obtained from GeneCopoeia Inc. (Guangzhou, China). BTG3 expression plasmid (BTG3, RC221056), specific siRNA against BTG3 (si-BTG3, SR307479) and their corresponding negative control (EV and si-control, PS100001 and SR30004) were constructed and purchased from OriGene (OriGene Technologies Inc., USA). Cells transfection was performed with Lipofectamine 2000 reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions.

2. Methods and materials 2.1. Tissue samples Tissue samples were obtained from 86 patients who were undergoing liver resection in the Department of Hepatobiliary Surgery at the First Affiliated Hospital of Xi’an Jiaotong University (Xi’an, China) during January 2012 to December 2013. The HCC patients did not receive any adjuvant therapy before surgery, such as chemotherapy or radiotherapy. All HCC and non-tumor tissues were collected and restored in liquid nitrogen. All the patients were provided written informed consent. Approval was obtained from the Ethics Committee of Xi’an Jiaotong University on the basis of the Declaration of Helsinki. The clinicopathological parameters of patients were shown in Table 1.

2.3. Real-time quantitative polymerase chain reaction (qRT-PCR) Trizol (Invitrogen, Carlsbad, CA, USA) and miRVana miRNA Isolation Kit (Ambio, Austin, TX, USA) were used to extract RNA from tissues and cells following as the manufacture procedure. TIANScript RT Kit (Tiangen biotech, Beijing, China) was used to perform reverse transcription. Quantitative PCR were performed using TaqMan Human MiRNA Aaasy Kit (Genecopoeia, Guangzhou, China) and SYBR Premix Ex Taq™ Kit (TaKaRa, Shiga, Japan). The primers for BTG3 and β-actin

2.2. Cell culture and transfection The human HCC cell lines (Hep3B, SMMC-7721, Huh7, MHCC97-L, SK-Hep-1, PLC/PRF/5, MHCC97-H) and the human immortalized 2

Biomedicine & Pharmacotherapy 118 (2019) 109267

L. Wang, et al.

Table 2 Primers used in this study. Primers name BTG3 forward BTG3 reverse β-actin forward β-actin reverse miR-519c-3p forward miR-519c-3p reverse U6 forward U6 reverse

Primer sequence 5’-ATGAAGAATGAAATTGCTG-3’ 5’-TTAGTGAGGTGCTAACATGTG-3’ 5′-TGACGTGGACATCCGCAAAG-3′ 5′- CTGGAAGGTGGACAGCGAGG-3′ 5′- GGCGGGAAAGTGCATCTTTTT -3′ 5′- GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACATCCTC -3′ 5′-CTCGCTTCGGCAGCACA-3′ 5′-AACGCTTCACGAATTTGCGT-3

2.9. Western blotting

were purchased from Realgene (Nanjing, China). The primers for miR519c-3p and U6 were obtained from RiboBio (Guangzhou, China). Expression levels were quantified using the 2−ΔΔCt method. All of the primers used in qRT-PCR are listed in Table 2.

Proteins from HCC cells and tissues were extracted with RIPA Buffer, and the concentration was measured with the BCA Kit. Then Proteins were electrophoresed by 10% SDS-PAGE and transferred to PVDF membranes (Bio-Rad, Hercules, CA, USA). Next, the membranes were blocked in 5% non-fat milk and incubated with specific primary antibodies at 4 °C overnight. BTG3 (1:1000, ab112938; Abcam, Cambridge, MA, UK), cytochrome P450 family 3 subfamily A member 43 (CYP3A43) (1:1000, ab155029, Abcam, Cambridge, MA, UK), C8orf4 (1:1000, ab133885, Abcam, Cambridge, MA, UK), homeobox D8 (HOXD8) (1:1000, ab229321, Abcam, Cambridge, MA, UK), β-actin (1:1000, sc-47778, SANTA CRUZ, Dallas, Texas, USA) antibodies were used. After that, the membranes were incubated with the second antibody (anti-rabbit 7074 and anti-mouse 7076; Cell Signaling Technology) for 1 h at room temperature. Finally, the ECL reagent (Beyotime Institute of Biotechnology, Haimen, China) was applied for detection.

2.4. MTT assay MTT (Sigma, St. Louis, MO, USA) assay was used to assess cell viability. Cell density was 3 × 103/well in a 96-well plate. Each group comprised eight duplicate wells. After incubation for 0, 24, 48 and 72 h with DMEM containing 10% FBS, 5 mg/mL MTT (100 μL/well) dissolved in PBS was added to each well for 4 h. 200 μL DMSO was added to each well following the supernatants removed. Microplate reader (Bio-Rad, USA) was used to read the absorbance. 2.5. Ethynyl deoxyuridine (EdU) incorporation assay EdU kit (C10310-1, RioBio, Guangzhou, China) was used to detect cell proliferation in EdU incorporation assay following as the manufacturer’s instruction. Results were acquired with the Zeiss fluorescence photomicroscope (CarlZeiss, Oberkochen, Germany) and quantified via counting at least five random fields.

2.10. Luciferase reporter assay The wild-type (WT) or mutant (MUT) 3′UTR of BTG3 mRNA were synthesized and inserted into downstream of the pEZX-MT06 vector (Genecopoeia, Guangzhou, China). Cells transfected with miR-519c-3p mimics or inhibitors or the corresponding control vectors were transfected with BTG3-3′UTR-wt and BTG3-3′UTR-mut. Cells were collected 48 h later and the luciferase activity was quantified using the Luc-Pair™ Duo-Luciferase Assay Kit (Genecopoeia, Guangzhou, China).

2.6. Transwell migration and invasion assays Transwell chambers (Millipore, USA) were used for cell migration and invasion assays. For migration assays, HCC cells (2 × 104) in the upper chamber were cultured with serum-free DMEM, and the lower chamber was filled with 10% serum-containing DMEM. For invasion assays, HCC cells (2 × 104) were seeded on Matrigel-coated membrane inserts. Then, the chamber was put into the cell culture plate and incubated at 37 °C for 24 h. Subsequently, cells that migrated or invaded across the Transwell membrane were fixed with 4% paraformaldehyde for 10 min and next stained with 0.1% crystal violet for 20 min. Finally, the migratory and invasive cells were examined and counted under microscope.

2.11. Statistical analysis Data are presented as the mean ± standard and performed at least three independent replicates. SPSS software, 24.0 (SPSS Inc., Chicago, IL, USA) and Graphpad Prism 7.0 (San Diego, CA, USA) were used for one-way ANOVA, a two-tailed Student t-test, Pearson's correlation analysis, Kaplan-Meier method and the log-rank test to evaluate the statistical significance. *P < 0.05, **P < 0.01 and ***P < 0.001 were taken as indicative of statistically significant difference.

2.7. Wound-healing assay 3. Results

Cells were seeded on six-well plates and were grown to confluence overnight. The cells were then scratched using a 200 μl tip and the wound recovery was observed after 0 and 24 h.

3.1. Expression and clinical significance of miR-519c-3p in HCC Real-time PCR was performed to detect miR-519c-3p expression in 86 pairs of HCC tissues and the adjacent non-tumor tissues. The results showed a higher expression of miR-519c-3p in HCC tissues compared to non-tumor tissues (P < 0.0001, Fig.1A). In accordance, TCGA data from starBase V3.0 online platform [29,30] indicated that miR-519c-3p expression was prominently increased in HCC tissues compared to normal liver tissues (P = 0.0033, Supplementary Fig.1A). Moreover, the elevated levels of miR-519c-3p were observed in HCC cell lines (Hep3B, SMMC-7721, Huh7, MHCC97-L, SK-Hep-1, PLC/PRF/5, MHCC97-H) compared to LO2 cells (Fig.1B). To investigate the clinical significance of miR-519c-3p, patients with HCC were divided into miR-

2.8. Animal experiments BALB/C nude mice (male, 4-week-old) were obtained from Shanghai SLAC Laboratory Animal Center of Chinese Academy of Sciences (Shanghai, China). The tumor Xenograft model and pulmonary metastasis model were constructed as previously described [28]. The lung tissues were detected by H＆E staining and xenograft tumor tissues were used to immunohistochemistry for Ki-67. Animal experiments were approved by the Animal Care and Use Committee of Xi’an Jiaotong University. 3

Biomedicine & Pharmacotherapy 118 (2019) 109267

L. Wang, et al.

Fig. 1. The expression and prognostic value of miR-519c-3p in HCC. (A) The levels of miR-519c-3p in 86 paired human HCC and adjacent normal tissues were measured by qPCR. P < 0.0001 by Student’s t-test. (B) qPCR was performed to detected the levels of miR-519c-3p in HCC cell lines (Hep3B, SMMC7721, Huh7, MHCC97-L, SK-Hep-1, PLC/PRF/ 5, MHCC97-H) and L02 cells. *P < 0.05, **P < 0.01 by Student’s t-test versus L02. n=3. (C and D) Kaplan-Meier survival analysis revealed that HCC patients with higher expression of miR-519c-3p (n = 44) had poorer overall survival (P = 0.0012 by Log-rank test) and disease-free survival (P = 0.0047 by Logrank test) compared to those with low miR519c-3p expression (n=42).

519c-3p inhibitors (P < 0.05, Fig. 2H). Based on the above results, we confirmed that miR-519c-3p promoted the proliferation and motility of HCC cell in vitro.

519c-3p high or low-group based on the median value. Results in Table 1 shows that the high level of miR-519c-3p was significantly associated with tumor size ≥5 cm (P = 0.010), vascular invasion (P = 0.002) and advanced tumor-node‑metastasis (TNM) stages (P = 0.008). Kaplan‑Meier and log-rank analysis revealed that HCC patients with high miR-519c-3p expression had a prominent worse overall survival (OS) (P = 0.0012, Fig.1C) and disease‑free survival (DFS) (P = 0.0047, Fig.1D). Furthermore, TCGA data from starBase V3.0 online platform further demonstrated that high miR-519c-3p expression indicated poor survival of HCC patients (P = 0.0094, Supplementary Fig.1B). Taken together, miR-519c-3p expression was increased in HCC and could be a predictor for poor prognosis.

3.3. miR-519c-3p knockdown restrains the growth and metastasis of HCC cells in vivo To further explore the effects of miR-519c-5p on the growth and metastasis of HCC cells in vivo, MHCC97-H cells with miR-519c-3p silencing were implanted into nude mice via subcutaneous injection and tail vein injection. Results of tumor growth curves and tumor weight indicated that miR-519c-3p silencing prominently inhibited tumor growth in mice (P < 0.05, Fig. 3A and B). Next, we harvested the tumor tissues to detect the level of miR-519c-3p by qPCR. And we found that the expression of miR-519c-3p in tumor tissues arising from miR519c-3p silencing group was significantly lower than that in control group (P < 0.05, Fig. 3C). Results of Ki-67 immunostaining indicated that the percentage of Ki-67 positive cells in xenograft tissues from miR519c-3p silencing group was obviously lower than that in control group (P < 0.05, Fig. 3D). In addition, results of HE staining showed that the number of metastatic lung nodules in miR-519c-3p silencing group was significantly less than that in control group (P < 0.05, Fig. 3E). The above results confirmed that miR-519c-3p knockdown restrained the growth and metastasis of HCC cells in vivo.

3.2. miR-519c-3p facilitates the proliferation and motility of HCC cell in vitro To explore the biological roles of miR-519c-3p in HCC, the expression of miR-519c-3p in Hep3B and MHCC97-H cells was manipulated with miR-519c-3p mimics and inhibitors, respectively. And the transfection efficiency was confirmed by qPCR (P < 0.001, Supplementary Fig.2 A and B). MTT assay showed that the viability of Hep3B cells was prominently increased by miR-519c-3p mimics (P < 0.05, Fig.2A), while the miR-519c-3p inhibitors markedly restrained the viability of MHCC97-H cells (P < 0.05, Fig.2C). Additionally, EdU assay revealed that the percentage of EdU positive cells was obviously increased in Hep3B cells with miR-519c-3p overexpression (P < 0.05, Fig.2B), while miR-519c-3p knockdown remarkably decreased the percentage of EdU positive MHCC97-H cells (P < 0.05, Fig.2D). Next, results of transwell assay showed that miR-519c-3p overexpression notably increased the number of migrated and invaded Hep3B cells (P < 0.05, respectively, Fig. 2E). On the contrary, the migration and invasion MHCC97-H cells was remarkably decreased by miR-519c-3p knockdown (P < 0.05, respectively, Fig. 2F). Moreover, results of wound healing assay showed that miR-519c-3p mimics notably increased the migration ability of Hep3B cells (P < 0.05, Fig. 2G), while the migration capacity of MHCC97-H cells was obviously decreased by miR-

3.4. BTG3 is a direct target of miR-519c-3p in HCC In order to elucidate the mechanism underlying the role of miR519c-3p, starBase V3.0 online platform was used to predict potential targets. We screened four tumor suppressor genes among the predicted results including CYP3A43 [31], C8orf4 [32], BTG3 [33] and HOXD8 [34] in HCC. However, only BTG3 could be significantly regulated by miR-519c-3p at both mRNA level and protein level (P < 0.05, Fig. 4AC and Fig.S3). qPCR and western blotting showed that a lower expression level of BTG3 was detected in HCC tissues compared to adjacent normal tissues (P < 0.05, Fig.4D and E). And miR-519c-3p 4

Biomedicine & Pharmacotherapy 118 (2019) 109267

L. Wang, et al.

Fig. 2. miR-519c-3p promotes HCC cell proliferation and motility in vitro. (A) MTT assay revealed that miR-519c-3p mimics increased the viability of Hep3B. *P < 0.05 by ANOVA, n=3. (B) miR-519c-3p mimics enhanced the proliferation of Hep3B as detected by EdU assay. *P < 0.05 by Student’s t-test, n=3. (C) miR519c-3p inhibitors restrained the viability of MHCC97-H as detected by MTT assay. *P < 0.05 by ANOVA, n=3. (D) EdU assay showed that miR-519c-3p inhibitors suppressed the proliferation of MHCC97-H. *P < 0.05 by Student’s t-test, n=3. (E) Transwell migration and invasion assay revealed that miR-519c-3p mimics enhanced the motility of Hep3B compared to miR-control group. *P < 0.05 by Student’s t-test, n=3. (F) Transwell migration and invasion assay revealed that miR519c-3p inhibitors impaired the motility of MHCC97-H compared to control group. *P < 0.05 by Student’s t-test, n=3. (G) Wound healing assay indicated that miR519c-3p mimics enhanced the migration of Hep3B compared to miR-control group. *P < 0.05 by Student’s t-test, n=3. (H) Wound healing assay indicated that miR519c-3p inhibitors suppressed the migration of MHCC97-H compared to control group. *P < 0.05 by Student’s t-test, n=3.

that BTG3 was a direct target of miR-519c-3p.

expression was inversely correlated with the level of BTG3 mRNA in HCC tissues (r=-0.7115, P < 0.0001, Fig.4F). In addition, the results of luciferase reporter assay showed that miR-519c-3p overexpression suppressed, whereas miR-519c-3p knockdown enhanced the luciferase activity of vector carrying wt-3′UTR of BTG3 but not mut-3′UTR of BTG3 in HEK-293 T cell (P < 0.05, Fig.4G). These findings confirmed

3.5. BTG3 mediates the effects of miR-519c-3p on the proliferation and motility of HCC cells Rescue experiments were conducted to illuminate whether BTG3 5

Biomedicine & Pharmacotherapy 118 (2019) 109267

L. Wang, et al.

Fig. 3. miR-519c-3p silencing restrains the growth and metastasis of HCC cells in vivo. (A) MHCC97-H cells with miR-519c-3p silencing (n = 6) or control group (n = 6) were implanted into nude mice via subcutaneous injection. The tumor growth curves indicated that miR-519c-3p silencing suppressed the growth of HCC cells. *P < 0.05 by ANOVA. (B) The subcutaneous tumors were harvested and weighted at the 21 st day after implantation. P < 0.05 by Student’s t-test. (C) The tumor tissues were subjected to qPCR for the expression of miR-519c-3p. (D) Immunostaining of Ki-67 xenograft tissues from miR-519c-3p silencing group and control group. P < 0.05 by Student’s t-test. (E) HE staining of metastatic lung nodules in miR519c-3p silencing group and control group. P < 0.05 by Student’s t-test.

miRNAs have been confirmed to play pivotal roles in the regulation of HCC growth and metastasis [35,36]. Our previous studies have revealed several differentially expressed miRNAs, such as miR-23c, miR-532-3p and miR-1307-3p, which act as prognostic biomarkers for HCC [11,35,37]. Therefore, identification of novel oncogenic or tumor suppressive miRNA involved in HCC progression is benefit to discover new therapeutic targets for HCC. In the current study, we demonstrated that miR-519c-3p was strongly overexpressed in HCC tissues and cell lines. Consistently, TCGA data indicated that miR-519c-3p expression was increased in HCC tissues compared to normal liver tissues. Clinical association analysis indicated that the high expression of miR-519c-3p was significantly correlated with poor prognosis and clinicopathological features including tumor size ≥ 5 cm, vascular invasion and advanced TNM stages. Serum miRNAs hold great promise as easily accessible and measurable biomarkers of disease, and previous study reports that pre-surgical serum levels of miR-19, miR-345 and miR519c-5p help identify prostate cancer patients [38]. Thus, it is worth to further detect the serum miR-519c-3p level in HCC patients to clarify its significance as a diagnostic biomarker. Additionally, our previous

participated in the tumor promoting role of miR-519c-3p in HCC cells. Western blotting showed that BTG3 expression plasmid dramatically abolished the inhibitory effect of miR-519c-3p mimics on BTG3 expression in Hep3B cells (P < 0.05, Fig.5A). MTT and EdU assays showed that BTG3 overexpression inhibited the proliferation of Hep3B cells, and BTG3 restoration reversed miR-519c-3p mimics-induced Hep3B cell proliferation (P < 0.05, Fig.5B and 5C). Next, wound healing and transwell assays showed that ectopic expression of BTG3 suppressed the migration and invasion of Hep3B cells, and BTG3 restoration abolished the promoting effects of miR-519c-3p mimics on Hep3B cell migration and invasion (P < 0.05, Fig.6A and B). Our results supported the findings that BTG3 was a functional mediator of miR-519c-3p in HCC cells. 4. Discussion As we known, miRNAs are small non-coding RNA molecules which regulate target genes via a post-transcriptional mechanism and serve as critical regulators in tumor progression. Increasing studies reveal that 6

Biomedicine & Pharmacotherapy 118 (2019) 109267

L. Wang, et al.

Fig. 4. BTG3 is a direct target of miR-519c-3p in HCC. (A) qPCR showed that BTG3 could be significantly negatively regulated by miR-519c-3p at the mRNA level. *P < 0.05 by Student’s t-test. n=3. (B and C) Western blotting showed that BTG3 could be significantly negatively regulated by miR-519c-3p at the protein level in HCC cells. *P < 0.05 by Student’s t-test. n=3. (D) The mRNA levels of BTG3 in 86 paired HCC and adjacent normal tissues. ***P < 0.001 by Student’s t-test. (E) The levels of BTG3 protein in 4-paired human HCC and adjacent normal tissues. *P < 0.05 by Student’s t-test. n=3. (F) Pearson correlation analysis revealed that there existed a significant inverse correlation between the mRNA of BTG3 and miR-519c-3p in HCC tissues. (G) The putative miR-519c-3p binding site in the 3′UTR of BTG3 was predicted by TargetScan. The mutant binging site was generated in the complementary site for the seed region of miR-519c-3p. Luciferase reporter gene assay showed that miR-519c-3p overexpression suppressed, whereas miR-519c-3p knockdown enhance the luciferase activity of vector carrying wt-3′UTR of BTG3 but not of the mut-3′UTR in HEK-293 T cell. *P < 0.05 by Student’s t-test. n=3. Fig. 5. BTG3 mediates the promoting effects of miR-519c-3p on HCC cells proliferation. (A) Transfection efficiency was confirmed by western blotting. n = 3. (B) MTT assay revealed that miR-519c-3p mimics enhanced the viability of Hep3B cells, which partially reversed by BTG3 clone. *P < 0.05 by ANOVA, n = 3. (C) EdU assay revealed that BTG3 clone suppressed Hep3B cells proliferation, and reversed the promoting effects of miR-519c-3p mimics on Hep3B cells proliferation. *P < 0.05 by Student’s t-test. n=3.

7

Biomedicine & Pharmacotherapy 118 (2019) 109267

L. Wang, et al.

Fig. 6. BTG3 mediates the promoting effects of miR-519c-3p on HCC cells migration and invasion. (A) Transwell migration and invasion assays showed that BTG3 clone weakened the mobility of HCC cells, and BTG3 clone reversed the promoting effect of miR-519c-3p on mobility of HCC cells. *P < 0.05 by Student’s t-test. n=3. (B) Wound healing assay revealed that BTG3 clone weakened the migration of HCC cells, and BTG3 clone reversed the promoting effect of miR-519c-3p on migration of HCC cells. *P < 0.05 by Student’s t-test. n=3.

importantly, restoration of BTG3 expression could reverse the tumor promoting function of miR-519c-3p in HCC cells. These results suggested that BTG3 played an essential role in miR-519c-3p-induced HCC progression. In summary, we showed that miR-519c-3p expression was significantly elevated in HCC tissues and cell lines, and conferred to poor clinical outcomes. Moreover, miR-519c-3p facilitated the growth and metastasis of HCC cells by targeting BTG3. Our research suggests that miR-519c-3p has the potential to be a novel therapeutic target for HCC treatment.

studies indicate that the hypoxic microenvironment induces the downregulation of miR-671-5p, miR-204 and miR-1296 [5,39,40] and lncRNA MCM3AP-AS1 functions as a molecular sponge to inversely regulate miR-194-5p abundance in HCC cells [41]. Thus, the mechanisms involved in the up-regulated expression of miR-519c-3p in HCC will be investigated in our future studies. Recently, the functional role of miR-519c in malignant tumors has been proposed. Previous study indicates that miR-519c is involved in chemoresistance by targeting HuR-ABCG2 pathway in CRC [14]. Furthermore, miR-519c suppresses tumor angiogenesis by targeting HIF-1α in cancer cells [15]. Additionally, miR-519c inversely regulates ABCG2 expression in MCF-7 human breast cancer cells and affects the intracellular mitoxantrone accumulation [16]. To date, whether miR519c-3p has impact on the progression of HCC remains unclear. Here, we found that miR-519c-3p promoted HCC cell proliferation, migration and invasion by gain- and los-of-function experiments. Moreover, miR519c-3p knockdown markedly repressed in vivo growth and metastasis of HCC cells. Overall, our observations suggest that miR-519c-3p functions as an oncogene in HCC. Solid evidence supports that BTG3 is a candidate tumor suppressor gene and is widely downregulated in NSCLC [25], OSCC [22], prostate cancer [20], and HCC [27]. BTG3 expression is downregulated in colorectal cancer and its knockdown promotes cell proliferation, migration and invasion in HCT116 and LoVo cells [23]. Down-regulation of BTG3 promotes gastric cancer cell proliferation, migration and invasion and predicts poor survival of patients [24]. Furthermore, miRNA-142-5p promotes the growth and migration of RCC cells by targeting BTG3 [26]. Additionally, BTG3 level is reduced in HCC and loss of BTG3 contributes to HCC cell proliferation, invasion and cell cycle progression [33]. Here, we provided sufficient evidence to confirm that BTG3 was a direct functional target of miR-519c-3p in HCC. First, miR-519c-3p negatively modulated BTG3 expression in HCC cells at both mRNA and protein levels. Second, miR519c-3p affected the luciferase activity of vectors carrying wt-3′UTR but not mut-3′UTR of BTG3. Third, miR-519c-3p was inversely correlated with the expression of BTG3 mRNA in HCC tissues. More

5. Conclusions To conclude, we investigate the role of miR-519c-3p in HCC. We find that miR-519c-3p expression is upregulated in HCC and correlates with poor prognosis. Functionally, miR-519c-3p promotes cell proliferation, migration as well as invasion in vitro, and facilitates the growth and metastasis of HCC cells in vivo. Mechanistically, BTG3 is screened and verified as a direct target of miR-519c-3p and mediates the tumor promoting effects of miR-519c-3p on the proliferation and motility of HCC cells. This study suggests that miR-519c-3p has the potential to be a novel therapeutic target for HCC treatment. Declaration of Competing Interest The authors declare no conflict of interest. Acknowledgments This work was supported by grants from the National Natural Science Foundation of China (81874069, 81572847), Natural Science Basic Research Plan in Shaanxi Province of China (2017JM8002) and Key Clinical Research Projects of The First Affiliated Hospital of Xi’an Jiaotong University (XJTU1AF-CRF-2016-002). 8

Biomedicine & Pharmacotherapy 118 (2019) 109267

L. Wang, et al.

Appendix A. Supplementary data

ERK-JMJD3-p16(INK4a) signaling axis, Oncogene 31 (27) (2012) 3287–3297. [21] M. Yoneda, T. Suzuki, T. Nakamura, R. Ajima, Y. Yoshida, S. Kakuta, S. Katsuko, Y. Iwakura, M. Shibutani, K. Mitsumori, J. Yokota, T. Yamamoto, Deficiency of antiproliferative family protein Ana correlates with development of lung adenocarcinoma, Cancer Sci. 100 (2) (2009) 225–232. [22] N. Yamamoto, K. Uzawa, T. Yakushiji, T. Shibahara, H. Noma, H. Tanzawa, Analysis of the ANA gene as a candidate for the chromosome 21q oral cancer susceptibility locus, Br. J. Cancer 84 (6) (2001) 754–759. [23] C. Lv, H. Wang, Y. Tong, H. Yin, D. Wang, Z. Yan, Y. Liang, D. Wu, Q. Su, The function of BTG3 in colorectal cancer cells and its possible signaling pathway, J. Cancer Res. Clin. Oncol. 144 (2) (2018) 295–308. [24] X.L. Ren, X.H. Zhu, X.M. Li, Y.L. Li, J.M. Wang, P.X. Wu, Z.B. Lv, W.H. Ma, W.T. Liao, W. Wang, Y.Q. Ding, L. Liang, Down-regulation of BTG3 promotes cell proliferation, migration and invasion and predicts survival in gastric cancer, J. Cancer Res. Clin. Oncol. 141 (3) (2015) 397–405. [25] K. Wei, C. Pan, G. Yao, B. Liu, T. Ma, Y. Xia, W. Jiang, L. Chen, Y. Chen, MiR-106b5p promotes proliferation and inhibits apoptosis by regulating BTG3 in Non-small cell lung cancer, Cell. Physiol. Biochem.: Int. J. Exp. Cell. Physiol. Biochem. Pharmacol. 44 (4) (2017) 1545–1558. [26] L. Liu, S. Liu, Q. Duan, L. Chen, T. Wu, H. Qian, S. Yang, D. Xin, Z. He, Y. Guo, MicroRNA-142-5p promotes cell growth and migration in renal cell carcinoma by targeting BTG3, Am. J. Transl. Res. 9 (5) (2017) 2394–2402. [27] Z. Lv, H. Zou, K. Peng, J. Wang, Y. Ding, Y. Li, X. Ren, F. Wang, R. Chang, L. Liang, The suppressive role and aberrent promoter methylation of BTG3 in the progression of hepatocellular carcinoma, PLoS One 8 (10) (2013) e77473. [28] Q. Li, C. Wang, Y. Wang, L. Sun, Z. Liu, L. Wang, T. Song, Y. Yao, Q. Liu, K. Tu, HSCs-derived COMP drives hepatocellular carcinoma progression by activating MEK/ERK and PI3K/AKT signaling pathways, J. Exp. Clin. Cancer Res. : CR 37 (1) (2018) 231. [29] J.H. Yang, J.H. Li, P. Shao, H. Zhou, Y.Q. Chen, L.H. Qu, starBase: a database for exploring microRNA-mRNA interaction maps from argonaute CLIP-seq and degradome-seq data, Nucleic Acids Res. 39 (Database issue) (2011) D202–9. [30] J.H. Li, S. Liu, H. Zhou, L.H. Qu, J.H. Yang, starBase v2.0: decoding miRNA-ceRNA, miRNA-ncRNA and protein-RNA interaction networks from large-scale CLIP-seq data, Nucleic Acids Res. 42 (Database issue) (2014) D92–7. [31] T. Yu, X. Wang, G. Zhu, C. Han, H. Su, X. Liao, C. Yang, W. Qin, K. Huang, T. Peng, The prognostic value of differentially expressed CYP3A subfamily members for hepatocellular carcinoma, Cancer Manage. Res. 10 (2018) 1713–1726. [32] P. Zhu, Y. Wang, Y. Du, L. He, G. Huang, G. Zhang, X. Yan, Z. Fan, C8orf4 negatively regulates self-renewal of liver cancer stem cells via suppression of NOTCH2 signalling, Nat. Commun. 6 (2015) 7122. [33] Z. Lv, H. Zou, K. Peng, J. Wang, Y. Ding, Y. Li, X. Ren, F. Wang, R. Chang, L. Liang, Y. Ding, The suppressive role and aberrent promoter methylation of BTG3 in the progression of hepatocellular carcinoma, PloS One 8 (10) (2013) e77473. [34] S. Sun, N. Wang, Z. Sun, X. Wang, H. Cui, MiR-5692a promotes proliferation and inhibits apoptosis by targeting HOXD8 in hepatocellular carcinoma, J. B.U.ON. 24 (1) (2019) 178–186. [35] S. Chen, L. Wang, B. Yao, Q. Liu, C. Guo, miR-1307-3p promotes tumor growth and metastasis of hepatocellular carcinoma by repressing DAB2 interacting protein, Biomed. Pharmacother. 117 (2019) 109055. [36] L. Lv, X. Wang, T. Ma, microRNA-944 inhibits the malignancy of hepatocellular carcinoma by directly targeting IGF-1R and deactivating the PI3K/Akt signaling pathway, Cancer Manage. Res. 11 (2019) 2531–2543. [37] Y. Wang, Z. Yang, L. Wang, L. Sun, Z. Liu, Q. Li, B. Yao, T. Chen, C. Wang, W. Yang, Q. Liu, S. Han, miR-532-3p promotes hepatocellular carcinoma progression by targeting PTPRT, Biomed. Pharmacother. 109 (2019) 991–999. [38] S.Y. Wang, S. Shiboski, C.D. Belair, M.R. Cooperberg, J.P. Simko, H. Stoppler, J. Cowan, P.R. Carroll, R. Blelloch, miR-19, miR-345, miR-519c-5p serum levels predict adverse pathology in prostate cancer patients eligible for active surveillance, PloS One 9 (6) (2014) e98597. [39] C. Dou, Z. Zhou, Q. Xu, Z. Liu, Y. Zeng, Y. Wang, Q. Li, L. Wang, W. Yang, Q. Liu, K. Tu, Hypoxia-induced TUFT1 promotes the growth and metastasis of hepatocellular carcinoma by activating the Ca(2+)/PI3K/AKT pathway, Oncogene 38 (8) (2019) 1239–1255. [40] Z. Liu, Y. Wang, C. Dou, M. Xu, L. Sun, L. Wang, B. Yao, Q. Li, W. Yang, K. Tu, Q. Liu, Hypoxia-induced up-regulation of VASP promotes invasiveness and metastasis of hepatocellular carcinoma, Theranostics 8 (17) (2018) 4649–4663. [41] Y. Wang, L. Yang, T. Chen, X. Liu, Y. Guo, Q. Zhu, X. Tong, W. Yang, Q. Xu, D. Huang, K. Tu, A novel lncRNA MCM3AP-AS1 promotes the growth of hepatocellular carcinoma by targeting miR-194-5p/FOXA1 axis, Mol Cancer 18 (1) (2019) 28.

Supplementary material related to this article can be found, in the online version, at doi:https://doi.org/10.1016/j.biopha.2019.109267. References [1] R.L. Siegel, K.D. Miller, A. Jemal, Cancer statistics, 2017, CA. Cancer J. Clin. 67 (1) (2017) 7–30. [2] W. Chen, R. Zheng, P.D. Baade, S. Zhang, H. Zeng, F. Bray, A. Jemal, X.Q. Yu, J. He, Cancer statistics in China, 2015, CA. Cancer J. Clin. 66 (2) (2016) 115–132. [3] A. Forner, M. Reig, J. Bruix, Hepatocellular carcinoma, Lancet 391 (10127) (2018) 1301–1314. [4] T.F. Greten, X.W. Wang, F. Korangy, Current concepts of immune based treatments for patients with HCC: from basic science to novel treatment approaches, Gut 64 (5) (2015) 842–848. [5] Q. Xu, X. Liu, Z. Liu, Z. Zhou, Y. Wang, J. Tu, L. Li, H. Bao, L. Yang, K. Tu, MicroRNA-1296 inhibits metastasis and epithelial-mesenchymal transition of hepatocellular carcinoma by targeting SRPK1-mediated PI3K/AKT pathway, Mol. Cancer 16 (1) (2017) 103. [6] K. Tu, Z. Liu, B. Yao, S. Han, W. Yang, MicroRNA-519a promotes tumor growth by targeting PTEN/PI3K/AKT signaling in hepatocellular carcinoma, Int. J. Oncol. 48 (3) (2016) 965–974. [7] K.T. Huang, I.Y. Kuo, M.C. Tsai, C.H. Wu, L.W. Hsu, L.Y. Chen, C.P. Kung, Y.F. Cheng, S. Goto, Y.W. Chou, C.L. Chen, C.C. Lin, K.D. Chen, Factor VII-induced MicroRNA-135a inhibits autophagy and Is associated with poor prognosis in hepatocellular carcinoma, Mol. Ther. Nucleic Acids 9 (2017) 274–283. [8] Z. Chen, X. Zuo, L. Pu, Y. Zhang, G. Han, L. Zhang, J. Wu, X. Wang, circLARP4 induces cellular senescence through regulating miR-761/RUNX3/p53/p21 signaling in hepatocellular carcinoma, Cancer Sci. 110 (2) (2019) 568–581. [9] Z. Liu, Y. Wang, C. Dou, L. Sun, Q. Li, L. Wang, Q. Xu, W. Yang, Q. Liu, K. Tu, MicroRNA-1468 promotes tumor progression by activating PPAR-gamma-mediated AKT signaling in human hepatocellular carcinoma, J. Exp. Clin. Cancer Res. 37 (1) (2018) 49. [10] Q. Xu, Q. Zhu, Z. Zhou, Y. Wang, X. Liu, G. Yin, X. Tong, K. Tu, MicroRNA-876-5p inhibits epithelial-mesenchymal transition and metastasis of hepatocellular carcinoma by targeting BCL6 corepressor like 1, Biomed. Pharmacother. 103 (2018) 645–652. [11] L. Zhang, Y. Wang, L. Wang, G. Yin, W. Li, Y. Xian, W. Yang, Q. Liu, miR-23c suppresses tumor growth of human hepatocellular carcinoma by attenuating ERBB2IP, Biomed. Pharmacother. 107 (2018) 424–432. [12] J. Tao, Z. Liu, Y. Wang, L. Wang, G. Yin, W. Yang, K. Tu, Q. Liu, MicroRNA-645 represses hepatocellular carcinoma progression by inhibiting SOX30-mediated p53 transcriptional activation, Int. J. Biol. Macromol. 121 (2019) 214–222. [13] J. Tao, Z. Liu, Y. Wang, L. Wang, B. Yao, Q. Li, C. Wang, K. Tu, Q. Liu, MiR-542-3p inhibits metastasis and epithelial-mesenchymal transition of hepatocellular carcinoma by targeting UBE3C, Biomed. Pharmacother. 93 (2017) 420–428. [14] K.K. To, W.W. Leung, S.S. Ng, Exploiting a novel miR-519c-HuR-ABCG2 regulatory pathway to overcome chemoresistance in colorectal cancer, Exp. Cell. Res. 338 (2) (2015) 222–231. [15] S.T. Cha, P.S. Chen, G. Johansson, C.Y. Chu, M.Y. Wang, Y.M. Jeng, S.L. Yu, J.S. Chen, K.J. Chang, S.H. Jee, C.T. Tan, M.T. Lin, M.L. Kuo, MicroRNA-519c suppresses hypoxia-inducible factor-1alpha expression and tumor angiogenesis, Cancer Res. 70 (7) (2010) 2675–2685. [16] X. Li, Y.Z. Pan, G.M. Seigel, Z.H. Hu, M. Huang, A.M. Yu, Breast cancer resistance protein BCRP/ABCG2 regulatory microRNAs (hsa-miR-328, -519c and -520h) and their differential expression in stem-like ABCG2+ cancer cells, Biochem. Pharmacol. 81 (6) (2011) 783–792. [17] S. Matsuda, J. Rouault, J. Magaud, C. Berthet, In search of a function for the TIS21/ PC3/BTG1/TOB family, FEBS Lett. 497 (2-3) (2001) 67–72. [18] Y.H. Ou, P.H. Chung, F.F. Hsu, T.P. Sun, W.Y. Chang, S.Y. Shieh, The candidate tumor suppressor BTG3 is a transcriptional target of p53 that inhibits E2F1, EMBO J. 26 (17) (2007) 3968–3980. [19] S. Majid, A.A. Dar, A.E. Ahmad, H. Hirata, K. Kawakami, V. Shahryari, S. Saini, Y. Tanaka, A.V. Dahiya, G. Khatri, R. Dahiya, BTG3 tumor suppressor gene promoter demethylation, histone modification and cell cycle arrest by genistein in renal cancer, Carcinogenesis 30 (4) (2009) 662–670. [20] T.Y. Lin, Y.C. Cheng, H.C. Yang, W.C. Lin, C.C. Wang, P.L. Lai, S.Y. Shieh, Loss of the candidate tumor suppressor BTG3 triggers acute cellular senescence via the

9