- Email: [email protected]
Microsequence heterogeneity and expression of the LSU rRNA genes within the two single copy ribosomal transcription units of Theileria parva
Gene 257 (2000) 299–305 www.elsevier.com/locate/gene
Microsequence heterogeneity and expression of the LSU rRNA genes within the two single copy ribosomal transcription units of Theileria parva Richard Bishop a, *, Elke Gobright a,1, Paul Spooner a, Basil Allsopp b, Baljinder Sohanpal a,2, Nicola Collins b a International Livestock Research Institute (ILRI), P.O. Box 30709, Nairobi, Kenya b Onderstepoort Veterinary Institute, Private Bag X5, Onderstepoort 0110, Pretoria, South Africa Received 4 May 2000; received in revised form 13 July 2000; accepted 24 August 2000 Received by B. Dujon
Abstract The nucleotide sequences of the large subunit ribosomal RNA coding genes within the two single copy ribosomal DNA transcription units of a cloned Theileria parva isolate from a buffalo were determined. The two LSU rRNA coding units differed by 11 nucleotide substitutions and two deletions of 1 and 6 bp, all located in the 5∞ end of the LSU coding region. We also observed microsequence heterogeneity between the two buffalo parasite LSU sequences and the previously determined LSU rRNA gene of a T. parva parasite isolated from cattle. At all positions which were variable between the two LSU rRNA coding sequences of the buffalo-derived parasite, either unit 1 or unit 2 matched the LSU rRNA coding sequence of the cattle-derived T. parva parasite in a mosaic pattern. Synthetic oligonucleotides specific for LSU units 1 and 2 of the buffalo T. parva were developed, and used to assay expression of the two units. Both units were expressed in the intra-lymphocytic schizont stage of T. parva. A 2.5–10-fold excess of rRNA derived from LSU unit 1, compared with unit 2, was observed in the schizont stage, the difference being attributable to variation in the level of expression of unit 2. Theileria represents the third genus of Sporozoan protozoa, in addition to Plasmodium and Babesia, exhibiting rRNA coding genes, which are divergent in sequence between different transcription units. © 2000 Elsevier Science B.V. All rights reserved. Keywords: Large subunit ribosomal RNA; Nucleotide sequence polymorphism; Plasmodium; Sporozoan protozoa; Stage-specific ribosomes
1. Introduction In most eukaryotes ribosomal RNA (rRNA) genes occur in multiple copies in tandem arrays ranging from 50 to 10 000 in copy number (reviewed by Long and Dawid, 1980). By contrast, the ribosomal RNA genes of two genera of parasitic, Sporozoan protozoa, Abbreviations: bp, base pairs; LSU, large subunit; rDNA, ribosomal DNA; rRNA, ribosomal RNA; SDS, sodium dodecyl sulphate; SSC, 150 mM NaCl/15 mM sodium citrate (pH 7). * Corresponding author. Tel.: +254-2-630-743; fax: +254-2-631-499. E-mail address: [email protected] (R. Bishop) 1 Present address: Swiss Tropical Institute, Socinstrasse 59, Postfach, CH 4002 Basel, Switzerland. 2 Present address: Department of Biosciences, University of Kent at Canterbury, Canterbury, Kent CT2 7NJ, UK.
Plasmodium (reviewed by McCutchan et al., 1995) and Babesia (Dalrymple, 1990; Reddy et al., 1991) are atypical in that they are present as three to eight separate transcription units, which in Plasmodium are usually located on different chromosomes. The large subunit (LSU ) and small subunit (SSU ) rRNA coding genes of Plasmodium are divergent in sequence between the different coding units and are differentially expressed in different life cycle stages (McCutchan et al., 1995). This results in distinct ribosomal populations in malaria parasites, in the mammalian host and mosquito vector (Gunderson et al., 1987). In Plasmodium vivax, it has recently been demonstrated that three categories of rRNA occur: A type, which is expressed in mammalian asexual blood stages; O type, expressed in maturing ookinetes/oocysts in the mosquito vector; and S type, which is most prevalent in mature sporozoites (Li et al.,
0378-1119/00/$ - see front matter © 2000 Elsevier Science B.V. All rights reserved. PII: S0 3 7 8 -1 1 1 9 ( 0 0 ) 0 0 38 6 - 3
300
R. Bishop et al. / Gene 257 (2000) 299–305
1997). Two types of SSU rRNA gene are differentially expressed in the erythrocytic stages of Babesia bigemina (Reddy et al., 1991), but ribosomes which differ between mammalian and arthropod life cycle stages have so far been demonstrated only in Plasmodium species. Theileria parva is a tick-transmitted protozoan parasite of cattle, which like Plasmodium has two intracellular stages in the mammalian host, the schizont in lymphocytes and the piroplasm in erythrocytes. Theileria are classified in the class Sporozoa, being closely related to Babesia according to phylogenetic analysis using SSU rRNA sequence data (Allsopp et al., 1994). T. parva has two single copy rDNA transcription units located on separate chromosomes, the lowest number known in any eukaryote which does not amplify rRNA genes extrachromosomally ( Kibe et al., 1994). In some T. parva isolates the internal transcribed spacer (ITS) sequences differ markedly between the two rDNA units ( Kibe et al., 1994; Collins and Allsopp, 1999). Herein we demonstrate that the LSU rRNA coding sequences of the two rDNA units of a cloned buffaloderived T. parva parasite differ in sequence within the 5∞ end of the LSU gene. We show that the two polymorphic units are expressed in the intra-lymphocytic schizont stage of the parasite, which is most closely equivalent to the liver infective stages of Plasmodium. The existence of rDNA transcription units with rRNA coding genes which differ in sequence therefore extends to parasites transmitted by ticks as well as mosquitoes, and may therefore be widespread among parasitic Sporozoan protozoa with arthropod vectors.
2. Materials and methods 2.1. Parasite material and nucleic acid preparation Generation of a cloned, buffalo 7014 T. parva parasite, in cell line 7344 G5.F5.E8, derived from the buffalo 7014 stabilate, number 3081 has been described previously, as have the production and characterisation of the cloned T. parva Muguga parasite (Morzaria et al., 1995). Preparation of T. parva DNA was according to Conrad et al. (1987). Preparation of total RNA used
the one-step method (Chomczynski and Sacchi, 1987), as implemented in the RNAzol kit (Cinna Biotecx). 2.2. PCR amplification of LSU rRNA genes The two LSU rRNA coding units of the cloned buffalo 7014 T. parva parasite were PCR amplified using the Expand Long Template Kit (Boerhinger Mannheim), according to the manufacturer’s instructions. LSU unit 1 was amplified with primers ILO 3223 and NC2 using a priming temperature of 50°C. LSU unit 2 was amplified using primers ILO 3224 and NC2 using a priming temperature of 60°C. See Table 1 for details of oligonucleotides. 2.3. Nucleotide sequencing The LSU PCR products were sequenced directly, without cloning, by synthesising successive rounds of oligonucleotides, designed using acquired sequence, as primers. Sequencing reactions were performed using the ‘fmol’ DNA sequencing system (Promega). Sequences were determined on both strands. Sequences were submitted to GenBank with accession numbers AF218824 (LSU unit 1) and AF218825 (LSU unit 2). 2.4. Slot blotting and hybridisation Slot blotting of RNA (60–480 ng) and DNA (1 mg) onto nytran filters (Schleicher and Schuell ) followed standard procedures (Sambrook et al., 1989). Prior to slot blotting, total RNA was denatured in 50% formamide/7% formaldehyde for 15 min, at 68°C. Preybridisation and hybridisation of filters were in standard solutions (Sambrook et al., 1989). Oligonucleotides were labelled with [c-32P]ATP using T4 polynucleotide kinase and incorporated into hybridisation reactions without purification of the probe. Filters were hybridised with oligonucleotide probes at Tm-9 and washed in 5×SSC/0.1% SDS at Tm-4. Quantification of hybridisation signals on the slot blots was performed using a Molecular Dynamics personal densitometer.
Table. 1 Synthetic oligonucleotides Number
Tma
Sequence 5∞ to 3∞
Application
NC2 3223 3224 4096 4097
79.3 64.0 74.4 62.4 67.0
GAGCACCTCGGGTAGAATCTCAGCG CGGAGTAGTTACATTACTATAT CTGAGTTCCAGAGGGAACTACTTGT ACACATTGTCACCGAGAA ACACATTGCCGCCGAGAA
Amplification of T. parva LSU rRNA coding sequence Amplification of T. parva buffalo 7014 LSU rRNA transcription unit 1 Amplification of T. parva buffalo 7014 LSU rRNA transcription unit 2 Specific for T. parva buffalo 7014 LSU rRNA transcription unit 2 Specific for T. parva buffalo 7014 LSU rRNA transcription unit 1
a Tm is calculated for 5×SSC using the equation Tm=16.6 log [Na+]+0.41P +81.5−675/L where P is percentage of G+C in the probe 10 gc gc and L is the probe length in base pairs.
R. Bishop et al. / Gene 257 (2000) 299–305
3. Results 3.1. Nucleotide sequence differences between LSU rRNA coding regions of two T. parva buffalo 7014 clone 1 ribosomal transcription units The LSU rRNA coding units from two different ribosomal transcription units of a cloned T. parva parasite isolated from buffalo 7014 (Morzaria et al., 1995) were amplified using the polymerase chain reaction. Specific amplification of each ribosomal transcription unit was achieved using locus-specific primers, ILO 3223 and ILO 3224, derived from the 5∞ end of the internal transcribed spacers (ITS), which had previously been shown to be very different in sequence between the two units ( Kibe et al., 1994). The ITS primers were used in combination with a conserved primer, NC2, derived from the 3∞ end of the T. parva LSU. Oligonucleotide primer sequences are shown in Table 1. Nucleotide sequences of the PCR products, including most of the 5∞ ITS region and the complete coding sequence of the LSU, excluding the 3∞ 72 bp, were determined directly, without cloning. The sequences of the two units are available under GenBank accession numbers AF218824 (LSU unit 1) and AF218825 (LSU unit 2). Comparison of the LSU gene sequences of units 1 and 2, within the coding region, revealed 13 differences comprising 11 substitutions and two deletions, one of 1 bp and one of 6 bp. The differences were all located within the 5∞ end of the LSU coding gene between 114 and 1971 bp from the estimated start point of the consensus T. parva LSU coding sequence. The LSU unit 1 sequence was identical at all variable positions to a previously published T. parva buffalo 7014 LSU gene sequence available under GenBank accession AF013419 (Collins and Allsopp, 1999). Both the deletions were located within the variable region between the first and second conserved secondary structure domains of LSU rRNA (Guttell et al., 1993). The differences between the two LSU coding sequences and their distribution within the 5∞ end of the gene are shown in Fig. 1. Overall the two units differed by 0.034%. Comparison of the variable nucleotide positions within the two buffalo 7014 LSU gene sequences with the LSU gene sequence of the cattle-derived parasite T. parva Muguga ( Kibe et al., 1994) revealed a mosaic pattern of similarity. At some positions 7014 LSU unit 1 was identical to the T. parva Muguga sequence, while at others unit 2 was like Muguga (see Fig. 1). With the exception of one base within the 6 bp deletion, variable nucleotide positions between the two 7014 LSU units always matched the T. parva Muguga LSU sequence in one or other of the units (see Fig. 1). This result of apparent mosaic evolution within the LSU coding gene was similar to the situation in T. parva ribosomal ITS sequences which also exhibit different combinations of identifiable
301
sequence segments when different isolates are compared (Collins and Allsopp, 1999). In addition there were 12 positions, involving 10 substitutions and two deletions of 1 and 3 bp, at which the two 7014 buffalo LSU units were similar to one another, but differed from the T. parva Muguga LSU sequence. In contrast to the differences between the two LSU units of T. parva buffalo 7014, seven of these substitutions and also the 1 bp deletion were located between bp 2000 and the 3∞ end of the LSU coding gene. 3.2. Differential expression of two T. parva buffalo 7014 LSU rRNA units in the intra-lymphocytic schizont life cycle stage Two reverse complement oligonucleotides, ILO 4097 and ILO 4096 (see Table 1 for the oligonucleotide sequences), were designed from T. parva 7014 LSU units 1 and 2, respectively, incorporating the nucleotide substitutions at positions 1365 and 1367 within the T. parva LSU consensus sequence (see Fig. 1). When incubated at Tm-9 and washed at Tm-4, oligonucleotide 4097 hybridised specifically to a PCR product of LSU unit 1. Under the same hybridisation and washing conditions oligonucleotide 4096 was specific for a PCR product generated from unit 2 (Fig. 2), although it also exhibited a very faint cross-reactivity with the unit 1 PCR product ( Fig. 2A). Under these conditions, hybridisation of ILO 4096 to the unit 2 PCR product was approximately twice as intense as that of ILO 4097 to the unit 1 product, although equal quantities of PCR-amplified DNA (1 mg) were used on the slot blots. The two oligonucleotides were hybridised using similar hybridisation and washing conditions to denatured total RNA from T. parva 7014 buffalo clone 1 schizont infected bovine lymphocytes, which had been slot blotted onto nytran filters. In multiple replicate experiments both the ILO 4097 and ILO 4096 oligonucleotides hybridised to schizont infected lymphocyte LSU rRNA. The hybridisation signal generated using the unit 1-specific ILO 4097 oligonucleotide was approximately 2.5–10 times more intense than that using the unit 2-specific ILO 4096 over all experiments. The difference in the ratio resulted from variability in the level of expression of unit 2 in total RNA preparations from different passages of the T. parva infected lymphocytes. Representative results, in which the unit 1 hybridisation signal was approximately 2.5 times (Fig. 3A) and 10 times (Fig. 3B) greater than that of unit 2 are shown in Fig. 3. Experiments using similar quantities of total RNA from an uninfected bovine T cell clone stimulated with concanavalin A resulted in no hybridisation signal (data not shown). It was not possible to test expression of the two buffalo 7014 LSU rRNA units in T. parva infected tick salivary glands, because buffalo-derived parasites pro-
302
R. Bishop et al. / Gene 257 (2000) 299–305
Fig. 1. Nucleotide sequence differences between the two LSU rRNA coding units of a cloned T. parva parasite derived from buffalo 7014. A consensus of the 5∞ 2000 bp of the T. parva LSU coding sequence is shown in upper case letters. The consensus was assembled from units 1 and 2 of the cloned T. parva isolate from buffalo 7014 (GenBank accessions AF218824 and AF218825) and the T. parva Muguga LSU rRNA (derived from GenBank accessions L28036 and L28998, plus a cloned sequence spanning the connecting 147 bp). The two 7014 units are labelled TpB LSU1 and TpB LSU2, respectively, and the Muguga sequence Tpm LSU. The nucleotide bases at which the individual sequences differ from the consensus are shown in lower case above the consensus. Missing bases are indicated by . and positions with no consensus by –.
R. Bishop et al. / Gene 257 (2000) 299–305
303
Fig. 2. Oligonucleotide probes derived from T. parva buffalo 7014 clone 1 LSU rRNA coding units 1 and 2. LSU rRNA transcription units 1 and 2 were separately amplified using specific primer pairs and the PCR products (1 mg) were slot blotted onto nytran filters. Radiolabelled oligonucleotides, ILO 4096 (specific for unit 2; A) and ILO 4097 (specific for unit 1; B), were hybridised to the filters at 53 and 58°C ( Tm-9), respectively and subsequently washed in 5×SSC/0.1% SDS, at either 58 or 63°C (Tm-4). See Table 1 for details of oligonucleotides.
duce very low levels of infection in Rhipicephalus appendiculatus salivary glands when ticks are fed on cattle (Neitz, 1955; Norval et al., 1992). The sequence of oligonucleotide ILO 4096 is identical to the corresponding region of the LSU rRNA gene of T. parva Muguga ( Kibe et al., 1994; GenBank accession L28998). ILO 4096 hybridised to total RNA from R. appendiculatus salivary glands infected with T. parva Muguga, but not to uninfected R. appendiculatus salivary glands (data not shown).
4. Discussion
Fig. 3. Hybridisation of oligonucleotides specific for T. parva buffalo 7014 clone 1 LSU rRNA coding units 1 and 2 to rRNA from T. parva schizont-infected bovine lymphocytes. Total RNA of T. parva infected bovine lymphocytes was incubated with 50% formamide/7% formaldehyde and slot blotted onto nytran filters. Filters were hybridised with ILO 4097 which is specific for unit 1 and ILO 4096 which is specific for unit 2, at Tm-9 and washed in 5×SSC/0.1% SDS at Tm-4. See Table 1 for details of oligonucleotides. (A, B) Results from two independent experiments in which the ratio of rRNA expressed from unit 1 relative to unit 2 differed within the schizont stage of T. parva.
The ribosomal DNA units of certain apicomplexan parasites are unusual among eukaryotes in being nontandemly repeated, divergent in sequence between copies, and differentially expressed. In the genus Plasmodium, which has been intensively studied, both SSU and LSU rRNA coding genes within rDNA units on different chromosomes are divergent in sequence. The units are differentially expressed between life cycle stages in mammalian and arthropod hosts (Dame et al., 1984; Dame and McCutchan, 1983; Gunderson et al., 1987; Rogers et al., 1996; McCutchan et al., 1995). Very limited sequence variation has also been shown in Babesia between single copy SSU rRNA units, which are differentially expressed in the erythrocytic stage (Dalrymple, 1990; Reddy et al., 1991). Whether the LSU coding units of Babesia also differ in sequence has
not been investigated. Our demonstration of sequence heterogeneity between the two LSU coding units of T. parva therefore represents only the second known example of this phenomenon. Currently, it is unknown whether the two SSU coding units of T. parva also differ in sequence. In general, the LSU evolves more rapidly than the SSU (reviewed by Hillis and Dixon, 1991), and no differences were observed between the sequence of an SSU rRNA gene of T. parva Muguga and an SSU gene of the cloned buffalo 7014 parasite (Collins and Allsopp, 1999). Thus there may be either very limited, or no, divergence between the T. parva SSU rRNA genes in different transcription units. The non-random distribution of point mutations and deletions between the two units, in the 5∞ end of the
304
R. Bishop et al. / Gene 257 (2000) 299–305
LSU gene, suggests that both LSU units of T. parva may be functional. The fact that all polymorphic positions between LSU units 1 and 2 in the 7014 buffalo parasite match the T. parva Muguga LSU sequence in one or other unit may also indicate a level of functional constraint. However, the mosaic pattern of differences within the buffalo parasite LSU 1 and 2 relative to the T. parva Muguga LSU gene could also be a consequence of intragenic recombination, as suggested to explain evolution of T. parva ribosomal ITS sequences (Collins and Allsopp, 1999). It is unknown whether the divergent rDNA units of Apicomplexa form the core of ribosomes which are distinct in terms of properties such as translational fidelity or rate, or are a consequence of genes which, because they are not tandemly arrayed, are independently evolving, but produce functionally equivalent ribosomes. The fact that several of the variable positions between Plasmodium falciparum LSU units result in differences in sequences that are otherwise conserved among eukaryotic LSU sequences (Rogers et al., 1996) is consistent with the hypothesis of functionally different ribosomes. Our data also provide evidence for sequence heterogeneity between T. parva isolates in the LSU coding regions involving four deletions of one to six bases and 15–17 nucleotide substitutions between 7014 units 1 or 2, and the Muguga LSU. Similar observations of sequence polymorphism have been made between the LSU genes of two isolates of P. falciparum ( Waters et al., 1995). Previous analyses of ITS sequences and rDNA restriction site polymorphisms between T. parva isolates have suggested a division into two categories, one of which has two divergent rDNA units and the other two very similar or identical units (Bishop et al., 1993; Kibe et al., 1994; Collins and Allsopp, 1999). The current data demonstrates that the LSU coding regions of a T. parva parasite with two very distinct ITS sequences ( Kibe et al., 1994) also differ. It will be of interest to determine the SSU and LSU rRNA coding sequences of both transcription units of other T. parva stocks which have identical ITS sequences ( Kibe et al., 1994; Collins and Allsopp, 1999). We demonstrate that the 7014 buffalo parasite LSU unit 1 is expressed at a 2.5–10-fold higher level relative to LSU unit 2 in the intra-lymphocytic schizont stage of T. parva, which is equivalent to the liver stage of Plasmodium spp life cycle. The LSU unit 1 of T. parva buffalo 7014 might therefore be equivalent to the asexual (A) type transcript of Plasmodium (McCutchan et al., 1995). In Plasmodium, the switch to A type SSU transcripts occurs rapidly after invasion of hepatocytes ( Zhu et al., 1990). Due to the difficulty of obtaining RNA from the tick stages of buffalo-derived T. parva, we were unable to test whether Theileria, like Plasmodium, has ‘stage-specific ribosomes’ differing between the mammalian and arthropod infective life cycle stages. However,
the existence of microsequence heterogeneity between rDNA units in the LSU and SSU coding sequences of Theileria and Babesia, respectively, does suggest that stage-specific rRNA expression may also occur in ticktransmitted Sporozoan protozoa. Theileria might be a useful model for analysing differential expression of rDNA units because it has only two single copy ribosomal transcription units ( Kibe et al., 1994). The various species of Plasmodium (McCutchan et al., 1995) have four to eight pairs of ribosomal transcription units, some of which are similar to one another, rendering the genomic origin of the differing ribosomal transcripts observed more difficult to determine.
Acknowledgements We are grateful to Dr. S.P. Morzaria for supplying the cloned buffalo T. parva parasite. We appreciate the excellent technical assistance of Luka Juma. This is ILRI publication number 200004.
References Allsopp, M.T.E.P., Cavalier-Smith, T., De Waal, D.T., Allsopp, B.A., 1994. Phylogeny and evolution of the piroplasms. Parasitol. 108, 147–152. Bishop, R., Sohanpal, B., Morzaria, S., 1993. Theileria parva: detection of genomic polymorphisms by polymerase chain reaction amplification of DNA using arbitrary primers. Exp. Parasitol. 77, 53–61. Chomczynski, P., Sacchi, N., 1987. Single-step method of RNA isolation by acid guanidium thiocyanate–phenol–chloroform extraction. Anal. Biochem. 162, 156–159. Collins, N.E., Allsopp, B.A., 1999. Theileria parva ribosomal internal transcribed spacer sequences exhibit extensive polymorphism and mosaic evolution: application to characterisation of parasites from cattle and buffalo. Parasitol. 118, 541–551. Conrad, P.A., Iams, K., Brown, W.C., Sohanpal, B., ole-MoiYoi, O., 1987. DNA probes detect genomic diversity in Theileria parva stocks. Mol. Biochem. Parasitol. 25, 213–226. Dalrymple, B.P., 1990. Cloning and characterisation of the rRNA genes and flanking regions from Babesia bovis: use of the genes as strain discriminating probes. Mol. Biochem. Parasitol. 43, 117–124. Dame, J.B., McCutchan, T.F., 1983. The four ribosomal DNA units of the malaria parasite Plasmodium falciparum: identification, restriction map and copy number analysis. J. Biol. Chem. 258, 6890–6894. Dame, J.B., Sullivan, M., McCutchan, T.F., 1984. Two major sequence classes of ribosomal RNA genes in Plasmodium berghei. Nucleic Acids Res. 12, 5943–5952. Gunderson, J.H., Sogin, M.L., Wollet, G., Hollingdale, M., De La Cruz, V.F., Waters, A.P., McCutchan, T.F., 1987. Structurally distinct, stage-specific ribosomes occur in Plasmodium. Science 238, 933–937. Guttell, R.R., Gray, M.W., Schare, M.N., 1993. A compilation of large subunit (23S and 23S-like) ribosomal RNA structures. Nucleic Acids Res. 21, 3055–3074. Hillis, D.M., Dixon, M.T., 1991. Ribosomal DNA: molecular evolution and phylogenetic inference. Q. Rev. Biol. 66, 411–453. Kibe, M.K., ole-MoiYoi, O.K., Nene, V., Khan, B., Allsopp, B.A., Collins, N.E., Morzaria, S.P., Gobright, E.I., Bishop, R.P., 1994.
R. Bishop et al. / Gene 257 (2000) 299–305 Evidence for two single copy units in Theileria parva ribosomal RNA genes. Mol. Biochem. Parasitol. 66, 249–259. Li, J., Guttell, R.R., Damberger, S.H., Wirtz, R.A., Kissinger, J.C., Rogers, M.J., Sattabongkot, J., McCutchan, T.F., 1997. Regulation and trafficking of three distinct 18S ribosomal RNAs during development of the malaria parasite. J. Mol. Biol. 269, 203–213. Long, E.O., Dawid, I.B., 1980. Repeated genes in eukaryotes. Ann. Rev. Biochem. 4, 727–764. McCutchan, T.F., Li, J., McConkey, G.A., Rogers, M.J., Waters, A.P., 1995. The cytoplasmic ribosomal RNAs of Plasmodium spp. Parasitol. Today 11, 134–138. Morzaria, S.P., Dolan, T.T., Norval, R.A.I., Bishop, R.P., Spooner, P.R., 1995. Generation and characterisation of cloned Theileria parva parasites. Parasitol. 111, 39–49. Neitz, W.O., 1955. Corridor disease: a fatal form of bovine theileriosis encountered in Zululand. Bull. Epizoot. Dis. Afr. 3, 121–123. Norval, R.A.I., Perry, B.D., Young, A.S., 1992. The Epidemiology of Theileriosis in Africa. Academic Press, London.
305
Reddy, G.R., Chakrabarti, D., Yowell, C.A., Dame, J.B., 1991. Sequence microheterogeneity of the three small subunit ribosomal RNA genes of Babesia bigemina: expression in erythrocyte culture. Nucleic Acids Res. 19, 3641–3645. Rogers, M.J., Gutell, R.R., Damberger, S.H., Li, J., McConkey, G.A., Waters, A.P., McCutchan, T.F., 1996. Structural features of the large subunit rRNA expressed in Plasmodium falciparum sporozoites that distinguish it from the asexually expressed subunit rRNA. RNA 2, 134–135. Sambrook, J., Fritsch, E.F., Maniatis, T., 1989. Molecular Cloning: A Laboratory Manual. second ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. Waters, A.P., White, W., McCutchan, T.F., 1995. The structure of the large subunit RNA expressed in blood stages of Plasmodium falciparum. Mol. Biochem. Parasitol. 72, 227–237. Zhu, J.D., Waters, A.P., Appiah, A., McCutchan, T.F., Lal, A.A., Hollingdale, M.R., 1990. Stage-specific ribosomal RNA expression switches during sporozoite invasion of hepatocytes. J. Biol. Chem. 265, 12 740–12 744.
Microsequence heterogeneity and expression of the LSU rRNA genes within the two single copy ribosomal transcription units of Theileria parva Richard Bishop a, *, Elke Gobright a,1, Paul Spooner a, Basil Allsopp b, Baljinder Sohanpal a,2, Nicola Collins b a International Livestock Research Institute (ILRI), P.O. Box 30709, Nairobi, Kenya b Onderstepoort Veterinary Institute, Private Bag X5, Onderstepoort 0110, Pretoria, South Africa Received 4 May 2000; received in revised form 13 July 2000; accepted 24 August 2000 Received by B. Dujon
Abstract The nucleotide sequences of the large subunit ribosomal RNA coding genes within the two single copy ribosomal DNA transcription units of a cloned Theileria parva isolate from a buffalo were determined. The two LSU rRNA coding units differed by 11 nucleotide substitutions and two deletions of 1 and 6 bp, all located in the 5∞ end of the LSU coding region. We also observed microsequence heterogeneity between the two buffalo parasite LSU sequences and the previously determined LSU rRNA gene of a T. parva parasite isolated from cattle. At all positions which were variable between the two LSU rRNA coding sequences of the buffalo-derived parasite, either unit 1 or unit 2 matched the LSU rRNA coding sequence of the cattle-derived T. parva parasite in a mosaic pattern. Synthetic oligonucleotides specific for LSU units 1 and 2 of the buffalo T. parva were developed, and used to assay expression of the two units. Both units were expressed in the intra-lymphocytic schizont stage of T. parva. A 2.5–10-fold excess of rRNA derived from LSU unit 1, compared with unit 2, was observed in the schizont stage, the difference being attributable to variation in the level of expression of unit 2. Theileria represents the third genus of Sporozoan protozoa, in addition to Plasmodium and Babesia, exhibiting rRNA coding genes, which are divergent in sequence between different transcription units. © 2000 Elsevier Science B.V. All rights reserved. Keywords: Large subunit ribosomal RNA; Nucleotide sequence polymorphism; Plasmodium; Sporozoan protozoa; Stage-specific ribosomes
1. Introduction In most eukaryotes ribosomal RNA (rRNA) genes occur in multiple copies in tandem arrays ranging from 50 to 10 000 in copy number (reviewed by Long and Dawid, 1980). By contrast, the ribosomal RNA genes of two genera of parasitic, Sporozoan protozoa, Abbreviations: bp, base pairs; LSU, large subunit; rDNA, ribosomal DNA; rRNA, ribosomal RNA; SDS, sodium dodecyl sulphate; SSC, 150 mM NaCl/15 mM sodium citrate (pH 7). * Corresponding author. Tel.: +254-2-630-743; fax: +254-2-631-499. E-mail address: [email protected] (R. Bishop) 1 Present address: Swiss Tropical Institute, Socinstrasse 59, Postfach, CH 4002 Basel, Switzerland. 2 Present address: Department of Biosciences, University of Kent at Canterbury, Canterbury, Kent CT2 7NJ, UK.
Plasmodium (reviewed by McCutchan et al., 1995) and Babesia (Dalrymple, 1990; Reddy et al., 1991) are atypical in that they are present as three to eight separate transcription units, which in Plasmodium are usually located on different chromosomes. The large subunit (LSU ) and small subunit (SSU ) rRNA coding genes of Plasmodium are divergent in sequence between the different coding units and are differentially expressed in different life cycle stages (McCutchan et al., 1995). This results in distinct ribosomal populations in malaria parasites, in the mammalian host and mosquito vector (Gunderson et al., 1987). In Plasmodium vivax, it has recently been demonstrated that three categories of rRNA occur: A type, which is expressed in mammalian asexual blood stages; O type, expressed in maturing ookinetes/oocysts in the mosquito vector; and S type, which is most prevalent in mature sporozoites (Li et al.,
0378-1119/00/$ - see front matter © 2000 Elsevier Science B.V. All rights reserved. PII: S0 3 7 8 -1 1 1 9 ( 0 0 ) 0 0 38 6 - 3
300
R. Bishop et al. / Gene 257 (2000) 299–305
1997). Two types of SSU rRNA gene are differentially expressed in the erythrocytic stages of Babesia bigemina (Reddy et al., 1991), but ribosomes which differ between mammalian and arthropod life cycle stages have so far been demonstrated only in Plasmodium species. Theileria parva is a tick-transmitted protozoan parasite of cattle, which like Plasmodium has two intracellular stages in the mammalian host, the schizont in lymphocytes and the piroplasm in erythrocytes. Theileria are classified in the class Sporozoa, being closely related to Babesia according to phylogenetic analysis using SSU rRNA sequence data (Allsopp et al., 1994). T. parva has two single copy rDNA transcription units located on separate chromosomes, the lowest number known in any eukaryote which does not amplify rRNA genes extrachromosomally ( Kibe et al., 1994). In some T. parva isolates the internal transcribed spacer (ITS) sequences differ markedly between the two rDNA units ( Kibe et al., 1994; Collins and Allsopp, 1999). Herein we demonstrate that the LSU rRNA coding sequences of the two rDNA units of a cloned buffaloderived T. parva parasite differ in sequence within the 5∞ end of the LSU gene. We show that the two polymorphic units are expressed in the intra-lymphocytic schizont stage of the parasite, which is most closely equivalent to the liver infective stages of Plasmodium. The existence of rDNA transcription units with rRNA coding genes which differ in sequence therefore extends to parasites transmitted by ticks as well as mosquitoes, and may therefore be widespread among parasitic Sporozoan protozoa with arthropod vectors.
2. Materials and methods 2.1. Parasite material and nucleic acid preparation Generation of a cloned, buffalo 7014 T. parva parasite, in cell line 7344 G5.F5.E8, derived from the buffalo 7014 stabilate, number 3081 has been described previously, as have the production and characterisation of the cloned T. parva Muguga parasite (Morzaria et al., 1995). Preparation of T. parva DNA was according to Conrad et al. (1987). Preparation of total RNA used
the one-step method (Chomczynski and Sacchi, 1987), as implemented in the RNAzol kit (Cinna Biotecx). 2.2. PCR amplification of LSU rRNA genes The two LSU rRNA coding units of the cloned buffalo 7014 T. parva parasite were PCR amplified using the Expand Long Template Kit (Boerhinger Mannheim), according to the manufacturer’s instructions. LSU unit 1 was amplified with primers ILO 3223 and NC2 using a priming temperature of 50°C. LSU unit 2 was amplified using primers ILO 3224 and NC2 using a priming temperature of 60°C. See Table 1 for details of oligonucleotides. 2.3. Nucleotide sequencing The LSU PCR products were sequenced directly, without cloning, by synthesising successive rounds of oligonucleotides, designed using acquired sequence, as primers. Sequencing reactions were performed using the ‘fmol’ DNA sequencing system (Promega). Sequences were determined on both strands. Sequences were submitted to GenBank with accession numbers AF218824 (LSU unit 1) and AF218825 (LSU unit 2). 2.4. Slot blotting and hybridisation Slot blotting of RNA (60–480 ng) and DNA (1 mg) onto nytran filters (Schleicher and Schuell ) followed standard procedures (Sambrook et al., 1989). Prior to slot blotting, total RNA was denatured in 50% formamide/7% formaldehyde for 15 min, at 68°C. Preybridisation and hybridisation of filters were in standard solutions (Sambrook et al., 1989). Oligonucleotides were labelled with [c-32P]ATP using T4 polynucleotide kinase and incorporated into hybridisation reactions without purification of the probe. Filters were hybridised with oligonucleotide probes at Tm-9 and washed in 5×SSC/0.1% SDS at Tm-4. Quantification of hybridisation signals on the slot blots was performed using a Molecular Dynamics personal densitometer.
Table. 1 Synthetic oligonucleotides Number
Tma
Sequence 5∞ to 3∞
Application
NC2 3223 3224 4096 4097
79.3 64.0 74.4 62.4 67.0
GAGCACCTCGGGTAGAATCTCAGCG CGGAGTAGTTACATTACTATAT CTGAGTTCCAGAGGGAACTACTTGT ACACATTGTCACCGAGAA ACACATTGCCGCCGAGAA
Amplification of T. parva LSU rRNA coding sequence Amplification of T. parva buffalo 7014 LSU rRNA transcription unit 1 Amplification of T. parva buffalo 7014 LSU rRNA transcription unit 2 Specific for T. parva buffalo 7014 LSU rRNA transcription unit 2 Specific for T. parva buffalo 7014 LSU rRNA transcription unit 1
a Tm is calculated for 5×SSC using the equation Tm=16.6 log [Na+]+0.41P +81.5−675/L where P is percentage of G+C in the probe 10 gc gc and L is the probe length in base pairs.
R. Bishop et al. / Gene 257 (2000) 299–305
3. Results 3.1. Nucleotide sequence differences between LSU rRNA coding regions of two T. parva buffalo 7014 clone 1 ribosomal transcription units The LSU rRNA coding units from two different ribosomal transcription units of a cloned T. parva parasite isolated from buffalo 7014 (Morzaria et al., 1995) were amplified using the polymerase chain reaction. Specific amplification of each ribosomal transcription unit was achieved using locus-specific primers, ILO 3223 and ILO 3224, derived from the 5∞ end of the internal transcribed spacers (ITS), which had previously been shown to be very different in sequence between the two units ( Kibe et al., 1994). The ITS primers were used in combination with a conserved primer, NC2, derived from the 3∞ end of the T. parva LSU. Oligonucleotide primer sequences are shown in Table 1. Nucleotide sequences of the PCR products, including most of the 5∞ ITS region and the complete coding sequence of the LSU, excluding the 3∞ 72 bp, were determined directly, without cloning. The sequences of the two units are available under GenBank accession numbers AF218824 (LSU unit 1) and AF218825 (LSU unit 2). Comparison of the LSU gene sequences of units 1 and 2, within the coding region, revealed 13 differences comprising 11 substitutions and two deletions, one of 1 bp and one of 6 bp. The differences were all located within the 5∞ end of the LSU coding gene between 114 and 1971 bp from the estimated start point of the consensus T. parva LSU coding sequence. The LSU unit 1 sequence was identical at all variable positions to a previously published T. parva buffalo 7014 LSU gene sequence available under GenBank accession AF013419 (Collins and Allsopp, 1999). Both the deletions were located within the variable region between the first and second conserved secondary structure domains of LSU rRNA (Guttell et al., 1993). The differences between the two LSU coding sequences and their distribution within the 5∞ end of the gene are shown in Fig. 1. Overall the two units differed by 0.034%. Comparison of the variable nucleotide positions within the two buffalo 7014 LSU gene sequences with the LSU gene sequence of the cattle-derived parasite T. parva Muguga ( Kibe et al., 1994) revealed a mosaic pattern of similarity. At some positions 7014 LSU unit 1 was identical to the T. parva Muguga sequence, while at others unit 2 was like Muguga (see Fig. 1). With the exception of one base within the 6 bp deletion, variable nucleotide positions between the two 7014 LSU units always matched the T. parva Muguga LSU sequence in one or other of the units (see Fig. 1). This result of apparent mosaic evolution within the LSU coding gene was similar to the situation in T. parva ribosomal ITS sequences which also exhibit different combinations of identifiable
301
sequence segments when different isolates are compared (Collins and Allsopp, 1999). In addition there were 12 positions, involving 10 substitutions and two deletions of 1 and 3 bp, at which the two 7014 buffalo LSU units were similar to one another, but differed from the T. parva Muguga LSU sequence. In contrast to the differences between the two LSU units of T. parva buffalo 7014, seven of these substitutions and also the 1 bp deletion were located between bp 2000 and the 3∞ end of the LSU coding gene. 3.2. Differential expression of two T. parva buffalo 7014 LSU rRNA units in the intra-lymphocytic schizont life cycle stage Two reverse complement oligonucleotides, ILO 4097 and ILO 4096 (see Table 1 for the oligonucleotide sequences), were designed from T. parva 7014 LSU units 1 and 2, respectively, incorporating the nucleotide substitutions at positions 1365 and 1367 within the T. parva LSU consensus sequence (see Fig. 1). When incubated at Tm-9 and washed at Tm-4, oligonucleotide 4097 hybridised specifically to a PCR product of LSU unit 1. Under the same hybridisation and washing conditions oligonucleotide 4096 was specific for a PCR product generated from unit 2 (Fig. 2), although it also exhibited a very faint cross-reactivity with the unit 1 PCR product ( Fig. 2A). Under these conditions, hybridisation of ILO 4096 to the unit 2 PCR product was approximately twice as intense as that of ILO 4097 to the unit 1 product, although equal quantities of PCR-amplified DNA (1 mg) were used on the slot blots. The two oligonucleotides were hybridised using similar hybridisation and washing conditions to denatured total RNA from T. parva 7014 buffalo clone 1 schizont infected bovine lymphocytes, which had been slot blotted onto nytran filters. In multiple replicate experiments both the ILO 4097 and ILO 4096 oligonucleotides hybridised to schizont infected lymphocyte LSU rRNA. The hybridisation signal generated using the unit 1-specific ILO 4097 oligonucleotide was approximately 2.5–10 times more intense than that using the unit 2-specific ILO 4096 over all experiments. The difference in the ratio resulted from variability in the level of expression of unit 2 in total RNA preparations from different passages of the T. parva infected lymphocytes. Representative results, in which the unit 1 hybridisation signal was approximately 2.5 times (Fig. 3A) and 10 times (Fig. 3B) greater than that of unit 2 are shown in Fig. 3. Experiments using similar quantities of total RNA from an uninfected bovine T cell clone stimulated with concanavalin A resulted in no hybridisation signal (data not shown). It was not possible to test expression of the two buffalo 7014 LSU rRNA units in T. parva infected tick salivary glands, because buffalo-derived parasites pro-
302
R. Bishop et al. / Gene 257 (2000) 299–305
Fig. 1. Nucleotide sequence differences between the two LSU rRNA coding units of a cloned T. parva parasite derived from buffalo 7014. A consensus of the 5∞ 2000 bp of the T. parva LSU coding sequence is shown in upper case letters. The consensus was assembled from units 1 and 2 of the cloned T. parva isolate from buffalo 7014 (GenBank accessions AF218824 and AF218825) and the T. parva Muguga LSU rRNA (derived from GenBank accessions L28036 and L28998, plus a cloned sequence spanning the connecting 147 bp). The two 7014 units are labelled TpB LSU1 and TpB LSU2, respectively, and the Muguga sequence Tpm LSU. The nucleotide bases at which the individual sequences differ from the consensus are shown in lower case above the consensus. Missing bases are indicated by . and positions with no consensus by –.
R. Bishop et al. / Gene 257 (2000) 299–305
303
Fig. 2. Oligonucleotide probes derived from T. parva buffalo 7014 clone 1 LSU rRNA coding units 1 and 2. LSU rRNA transcription units 1 and 2 were separately amplified using specific primer pairs and the PCR products (1 mg) were slot blotted onto nytran filters. Radiolabelled oligonucleotides, ILO 4096 (specific for unit 2; A) and ILO 4097 (specific for unit 1; B), were hybridised to the filters at 53 and 58°C ( Tm-9), respectively and subsequently washed in 5×SSC/0.1% SDS, at either 58 or 63°C (Tm-4). See Table 1 for details of oligonucleotides.
duce very low levels of infection in Rhipicephalus appendiculatus salivary glands when ticks are fed on cattle (Neitz, 1955; Norval et al., 1992). The sequence of oligonucleotide ILO 4096 is identical to the corresponding region of the LSU rRNA gene of T. parva Muguga ( Kibe et al., 1994; GenBank accession L28998). ILO 4096 hybridised to total RNA from R. appendiculatus salivary glands infected with T. parva Muguga, but not to uninfected R. appendiculatus salivary glands (data not shown).
4. Discussion
Fig. 3. Hybridisation of oligonucleotides specific for T. parva buffalo 7014 clone 1 LSU rRNA coding units 1 and 2 to rRNA from T. parva schizont-infected bovine lymphocytes. Total RNA of T. parva infected bovine lymphocytes was incubated with 50% formamide/7% formaldehyde and slot blotted onto nytran filters. Filters were hybridised with ILO 4097 which is specific for unit 1 and ILO 4096 which is specific for unit 2, at Tm-9 and washed in 5×SSC/0.1% SDS at Tm-4. See Table 1 for details of oligonucleotides. (A, B) Results from two independent experiments in which the ratio of rRNA expressed from unit 1 relative to unit 2 differed within the schizont stage of T. parva.
The ribosomal DNA units of certain apicomplexan parasites are unusual among eukaryotes in being nontandemly repeated, divergent in sequence between copies, and differentially expressed. In the genus Plasmodium, which has been intensively studied, both SSU and LSU rRNA coding genes within rDNA units on different chromosomes are divergent in sequence. The units are differentially expressed between life cycle stages in mammalian and arthropod hosts (Dame et al., 1984; Dame and McCutchan, 1983; Gunderson et al., 1987; Rogers et al., 1996; McCutchan et al., 1995). Very limited sequence variation has also been shown in Babesia between single copy SSU rRNA units, which are differentially expressed in the erythrocytic stage (Dalrymple, 1990; Reddy et al., 1991). Whether the LSU coding units of Babesia also differ in sequence has
not been investigated. Our demonstration of sequence heterogeneity between the two LSU coding units of T. parva therefore represents only the second known example of this phenomenon. Currently, it is unknown whether the two SSU coding units of T. parva also differ in sequence. In general, the LSU evolves more rapidly than the SSU (reviewed by Hillis and Dixon, 1991), and no differences were observed between the sequence of an SSU rRNA gene of T. parva Muguga and an SSU gene of the cloned buffalo 7014 parasite (Collins and Allsopp, 1999). Thus there may be either very limited, or no, divergence between the T. parva SSU rRNA genes in different transcription units. The non-random distribution of point mutations and deletions between the two units, in the 5∞ end of the
304
R. Bishop et al. / Gene 257 (2000) 299–305
LSU gene, suggests that both LSU units of T. parva may be functional. The fact that all polymorphic positions between LSU units 1 and 2 in the 7014 buffalo parasite match the T. parva Muguga LSU sequence in one or other unit may also indicate a level of functional constraint. However, the mosaic pattern of differences within the buffalo parasite LSU 1 and 2 relative to the T. parva Muguga LSU gene could also be a consequence of intragenic recombination, as suggested to explain evolution of T. parva ribosomal ITS sequences (Collins and Allsopp, 1999). It is unknown whether the divergent rDNA units of Apicomplexa form the core of ribosomes which are distinct in terms of properties such as translational fidelity or rate, or are a consequence of genes which, because they are not tandemly arrayed, are independently evolving, but produce functionally equivalent ribosomes. The fact that several of the variable positions between Plasmodium falciparum LSU units result in differences in sequences that are otherwise conserved among eukaryotic LSU sequences (Rogers et al., 1996) is consistent with the hypothesis of functionally different ribosomes. Our data also provide evidence for sequence heterogeneity between T. parva isolates in the LSU coding regions involving four deletions of one to six bases and 15–17 nucleotide substitutions between 7014 units 1 or 2, and the Muguga LSU. Similar observations of sequence polymorphism have been made between the LSU genes of two isolates of P. falciparum ( Waters et al., 1995). Previous analyses of ITS sequences and rDNA restriction site polymorphisms between T. parva isolates have suggested a division into two categories, one of which has two divergent rDNA units and the other two very similar or identical units (Bishop et al., 1993; Kibe et al., 1994; Collins and Allsopp, 1999). The current data demonstrates that the LSU coding regions of a T. parva parasite with two very distinct ITS sequences ( Kibe et al., 1994) also differ. It will be of interest to determine the SSU and LSU rRNA coding sequences of both transcription units of other T. parva stocks which have identical ITS sequences ( Kibe et al., 1994; Collins and Allsopp, 1999). We demonstrate that the 7014 buffalo parasite LSU unit 1 is expressed at a 2.5–10-fold higher level relative to LSU unit 2 in the intra-lymphocytic schizont stage of T. parva, which is equivalent to the liver stage of Plasmodium spp life cycle. The LSU unit 1 of T. parva buffalo 7014 might therefore be equivalent to the asexual (A) type transcript of Plasmodium (McCutchan et al., 1995). In Plasmodium, the switch to A type SSU transcripts occurs rapidly after invasion of hepatocytes ( Zhu et al., 1990). Due to the difficulty of obtaining RNA from the tick stages of buffalo-derived T. parva, we were unable to test whether Theileria, like Plasmodium, has ‘stage-specific ribosomes’ differing between the mammalian and arthropod infective life cycle stages. However,
the existence of microsequence heterogeneity between rDNA units in the LSU and SSU coding sequences of Theileria and Babesia, respectively, does suggest that stage-specific rRNA expression may also occur in ticktransmitted Sporozoan protozoa. Theileria might be a useful model for analysing differential expression of rDNA units because it has only two single copy ribosomal transcription units ( Kibe et al., 1994). The various species of Plasmodium (McCutchan et al., 1995) have four to eight pairs of ribosomal transcription units, some of which are similar to one another, rendering the genomic origin of the differing ribosomal transcripts observed more difficult to determine.
Acknowledgements We are grateful to Dr. S.P. Morzaria for supplying the cloned buffalo T. parva parasite. We appreciate the excellent technical assistance of Luka Juma. This is ILRI publication number 200004.
References Allsopp, M.T.E.P., Cavalier-Smith, T., De Waal, D.T., Allsopp, B.A., 1994. Phylogeny and evolution of the piroplasms. Parasitol. 108, 147–152. Bishop, R., Sohanpal, B., Morzaria, S., 1993. Theileria parva: detection of genomic polymorphisms by polymerase chain reaction amplification of DNA using arbitrary primers. Exp. Parasitol. 77, 53–61. Chomczynski, P., Sacchi, N., 1987. Single-step method of RNA isolation by acid guanidium thiocyanate–phenol–chloroform extraction. Anal. Biochem. 162, 156–159. Collins, N.E., Allsopp, B.A., 1999. Theileria parva ribosomal internal transcribed spacer sequences exhibit extensive polymorphism and mosaic evolution: application to characterisation of parasites from cattle and buffalo. Parasitol. 118, 541–551. Conrad, P.A., Iams, K., Brown, W.C., Sohanpal, B., ole-MoiYoi, O., 1987. DNA probes detect genomic diversity in Theileria parva stocks. Mol. Biochem. Parasitol. 25, 213–226. Dalrymple, B.P., 1990. Cloning and characterisation of the rRNA genes and flanking regions from Babesia bovis: use of the genes as strain discriminating probes. Mol. Biochem. Parasitol. 43, 117–124. Dame, J.B., McCutchan, T.F., 1983. The four ribosomal DNA units of the malaria parasite Plasmodium falciparum: identification, restriction map and copy number analysis. J. Biol. Chem. 258, 6890–6894. Dame, J.B., Sullivan, M., McCutchan, T.F., 1984. Two major sequence classes of ribosomal RNA genes in Plasmodium berghei. Nucleic Acids Res. 12, 5943–5952. Gunderson, J.H., Sogin, M.L., Wollet, G., Hollingdale, M., De La Cruz, V.F., Waters, A.P., McCutchan, T.F., 1987. Structurally distinct, stage-specific ribosomes occur in Plasmodium. Science 238, 933–937. Guttell, R.R., Gray, M.W., Schare, M.N., 1993. A compilation of large subunit (23S and 23S-like) ribosomal RNA structures. Nucleic Acids Res. 21, 3055–3074. Hillis, D.M., Dixon, M.T., 1991. Ribosomal DNA: molecular evolution and phylogenetic inference. Q. Rev. Biol. 66, 411–453. Kibe, M.K., ole-MoiYoi, O.K., Nene, V., Khan, B., Allsopp, B.A., Collins, N.E., Morzaria, S.P., Gobright, E.I., Bishop, R.P., 1994.
R. Bishop et al. / Gene 257 (2000) 299–305 Evidence for two single copy units in Theileria parva ribosomal RNA genes. Mol. Biochem. Parasitol. 66, 249–259. Li, J., Guttell, R.R., Damberger, S.H., Wirtz, R.A., Kissinger, J.C., Rogers, M.J., Sattabongkot, J., McCutchan, T.F., 1997. Regulation and trafficking of three distinct 18S ribosomal RNAs during development of the malaria parasite. J. Mol. Biol. 269, 203–213. Long, E.O., Dawid, I.B., 1980. Repeated genes in eukaryotes. Ann. Rev. Biochem. 4, 727–764. McCutchan, T.F., Li, J., McConkey, G.A., Rogers, M.J., Waters, A.P., 1995. The cytoplasmic ribosomal RNAs of Plasmodium spp. Parasitol. Today 11, 134–138. Morzaria, S.P., Dolan, T.T., Norval, R.A.I., Bishop, R.P., Spooner, P.R., 1995. Generation and characterisation of cloned Theileria parva parasites. Parasitol. 111, 39–49. Neitz, W.O., 1955. Corridor disease: a fatal form of bovine theileriosis encountered in Zululand. Bull. Epizoot. Dis. Afr. 3, 121–123. Norval, R.A.I., Perry, B.D., Young, A.S., 1992. The Epidemiology of Theileriosis in Africa. Academic Press, London.
305
Reddy, G.R., Chakrabarti, D., Yowell, C.A., Dame, J.B., 1991. Sequence microheterogeneity of the three small subunit ribosomal RNA genes of Babesia bigemina: expression in erythrocyte culture. Nucleic Acids Res. 19, 3641–3645. Rogers, M.J., Gutell, R.R., Damberger, S.H., Li, J., McConkey, G.A., Waters, A.P., McCutchan, T.F., 1996. Structural features of the large subunit rRNA expressed in Plasmodium falciparum sporozoites that distinguish it from the asexually expressed subunit rRNA. RNA 2, 134–135. Sambrook, J., Fritsch, E.F., Maniatis, T., 1989. Molecular Cloning: A Laboratory Manual. second ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. Waters, A.P., White, W., McCutchan, T.F., 1995. The structure of the large subunit RNA expressed in blood stages of Plasmodium falciparum. Mol. Biochem. Parasitol. 72, 227–237. Zhu, J.D., Waters, A.P., Appiah, A., McCutchan, T.F., Lal, A.A., Hollingdale, M.R., 1990. Stage-specific ribosomal RNA expression switches during sporozoite invasion of hepatocytes. J. Biol. Chem. 265, 12 740–12 744.