MiR-150-5p regulates melanoma proliferation, invasion and metastasis via SIX1-mediated Warburg Effect

Biochemical and Biophysical Research Communications 515 (2019) 85e91

Contents lists available at ScienceDirect

Biochemical and Biophysical Research Communications journal homepage: www.elsevier.com/locate/ybbrc

MiR-150-5p regulates melanoma proliferation, invasion and metastasis via SIX1-mediated Warburg Effect Xuhui Yang a, 1, Hui Zhao b, 1, Jing Yang a, 1, Yongfu Ma a, 1, Zihao Liu a, Chenxi Li b, Tao Wang c, ***, Zhifeng Yan a, **, Nan Du a, b, * a b c

Department of Oncology, Chinese PLA General Hospital, Chinese PLA Medical School, Beijing, 100853, China Department of Oncology, Fourth Medical Center of Chinese PLA General Hospital, Beijing, 100037, China Department of Oncology, Fifth Medical Center of Chinese PLA General Hospital, Beijing, 100071, China

a r t i c l e i n f o

a b s t r a c t

Article history: Received 14 May 2019 Accepted 16 May 2019 Available online 23 May 2019

Aerobic glycolysis is a hallmark of cancer. Sine oculis homeobox 1 (SIX1), a key transcription factor in terms of regulating aerobic glycolysis (the Warburg Effect), plays a critical role in tumorigenesis of various cancer types, including breast cancer, liver cancer, and lung cancer. However, the upstream regulating mechanisms of SIX1 in melanoma remain to be determined. MicroRNAs (miRNAs) have emerged as key regulators in tumorigenesis and progression. Here, we initially showed that microRNA150-5p (miR-150-5p) inhibits SIX1 expression by directly targeting its 30 -UTR in melanoma cells. miR150-5p suppressed melanoma cell proliferation, migration, and invasion through inhibition of SIX1. Mechanistically, miR-150-5p dampens glycolysis by decreasing the glucose uptake, lactate production, ATP generation, and extracellular acidification rate (ECAR), and increasing oxygen consumption rate (OCR) by targeting SIX1. Importantly, glycolysis regulated by miR-150-5p/SIX1 axis is critical for its regulation of melanoma growth and metastasis both in vitro and in vivo. Collectively, our study demonstrates the importance of miR-150-5p/SIX1 axis in melanoma, which could be a promising therapeutic target in melanoma. © 2019 Elsevier Inc. All rights reserved.

Keywords: miR-150-5p SIX1 Melanoma Glycolysis Metabolism

1. Introduction Malignant melanoma is the most aggressive and lifethreatening form of cutaneous cancer [1,2]. Despite of significantly improvements of treatment options for patients over the past decade, understanding of the underlying mechanisms of melanoma growth and progression remains limited. Thus, it is vital to identify the biomarkers, pathways and therapeutic targets for melanoma [3e5]. Most cancer cells, including melanoma cells [6], rely mainly on aerobic glycolysis or the Warburg effect which is one of the basic mechanisms for cancer proliferation and progression [7]. In our

* Corresponding author. Department of Oncology, Chinese PLA General Hospital, Chinese PLA Medical School, Beijing, 100853, China. ** Corresponding author. *** Corresponding author. E-mail addresses: [email protected] (X. Yang), [email protected] (T. Wang), [email protected] (Z. Yan), [email protected] (N. Du). 1 These authors contributed equally to this work. https://doi.org/10.1016/j.bbrc.2019.05.111 0006-291X/© 2019 Elsevier Inc. All rights reserved.

previous study [8], SIX1 is identified as a key transcription factor in modulating the Warburg effect. We have also found that the miR548a-3p/SIX1 axis regulates the Warburg effect and tumor growth in breast infiltrative ductal carcinoma and liver cancer etc. However, the role of SIX1 in melanoma remains unknown. Moreover, the upstream regulating mechanisms and the distinct functions that mediate SIX1 in melanoma still need further investigation. It is reported that MicroRNAs (miRNAs) are significant regulators of aerobic glycolysis in cancer glucose metabolism by directly and indirectly regulating closely related genes [9]. miRNAs regulate various processes in tumorigenesis and progression [10]. However, whether miR-150-5p functions in melanoma via the process of aerobic glycolysis remains poorly characterized. In this study, we show that miR-150-5p inhibits aerobic glycolysis in melanoma cells via targeting SIX1-mediated Warburg Effect, resulting in inhibition of cancer cell proliferation, migration, invasion, and metastasis in vitro and in vivo. The miR-150-5p/SIX1 axis could be a potential therapeutic strategy for melanoma.

86

X. Yang et al. / Biochemical and Biophysical Research Communications 515 (2019) 85e91

2. Materials and methods 2.1. Cell lines, RNA oligonucleotides, reagents Human malignant melanoma cell lines (A375, SK-MEL-2) and human embryonic kidneycell line HEK293T were obtained from the American Type Culture Collection (Manassas, VA, USA). Wild-type and mutated miR-150-5p putative targets on SIX1 30 -UTR were cloned into pmir-GLO dual-luciferase miRNA target expression vector (Promega USA). miR-150-5p mimics and miR-150-5p inhibitor were purchased from GenePharma (Shanghai, China). AntiSIX1 and anti-b-actin antibodies were purchased from Santa Cruz Bio-technology Inc (Dallas, TX, USA).

cDNA synthesis Kit (Tiangen). The expression level of miRNA was measured by a miScript SYBR Green PCR Kit (Qiagen NV, Venlo, the Netherlands) and performed on the CFX96 system (BioRad Laboratories Inc., Hercules, CA, USA). miR-150-5p expression level was assessed by qRT-PCR with the following primers: 50 TCGGCGTCTCCCAACCCTTGTAC-3’ (forward), and 50 - GTCGTATCCAGTGCAGGGTCCGAGGT-3’ (reverse). The control primers (U6) were 50 -CGCGCTTCGGCAGCACATATACT-3’ (forward) and 50 ACGCTTCACGAATTTGCGTGTC-3’ (reverse). SIX1 mRNA expression was determined by qRT-PCR with the following primers: 50 CGCGCACAATCCCTACCCATCGCC -3’ (forward), and 5’ - CTTCCAGAGGAGAGAGTTGGTTCTG -3’ (reverse). The control primers for b -actin were 50 -ATCACCATTGGCAATGAGCG-3’ (forward) and 50 TTGAAGGTAGTTTCGTGGAT-30 (reverse).

2.2. Cell growth and colony formation assays Cell Counting Kit-8 (CCK-8) assays were performed to determine cell proliferation (Dojindo) according to the producer's instructions. For colony formation assay, transfected cells were seeded in 3.5 cm plates (3000 cells/well). After two weeks, colonies were fixed with 4% paraformaldehyde for 30 min and stained with 1% crystal violet for 30 min. The number of colonies with diameters of more than 1.5 mm was counted. 2.3. Cell migration and invasion assays Cell migration was assessed by wound healing assays. Transfected cells grown to 90% in 6-well plates were scratched by a 200 ml pipette tip to create the wound followed by washing twice with PBS. Cultured cells were grown for 24 h to allow wound closure. The wound healing rates were measured and compared to the width at 0 h. Cell invasion assay was performed with Matrigel Invasion Chambers following the producer's protocols (BD Biosciences). Transfected cells were seeded into the upper well. After 24 h, the invasive cells were fixed with 4% paraformaldehyde and stained with 0.5% crystal violet for 30 min respectively. The number of invasive cells were counted in casually selected microscope visions and photographed. 2.4. Luciferase reporter assay 1  105 cells per well were seeded in 24-well plates. Cells were transiently transfected with luciferase reporters. Lipofectamine 2000 was used to cotransfect the wild-type or mutant SIX1 30 -UTR, combined with miR-150-5p mimics or negative control for miRNA mimics. Forty eight hours later, cells were harvested and analyzed for luciferase and b-galactosidase activities following the manufacture's instruction (Promega). 2.5. Measurement of lactate, glucose uptake, ATP Glucose uptake colorimetric assay kit, Lactate Assay Kit II, and ATP Colorimetric Assay kit were utilized following the manufacturer's instructions (BioVision, Milpitas, CA, USA). For glucose uptake, after cells seeded, 100 mL Krebs-Ringer-Phosphate-HEPES buffer containing 2% BSA was added for 40 min, and then 10 mM 2DG was added. For lactate and ATP assays, cells were homogenized in corresponding assay buffer offered by the kits and centrifuged at 4  C. 2.6. miRNA extraction and quantitative real-time PCR(qRT-PCR) A miRcute miRNA isolation kit (Tiangen) was used to extract the total RNA involving miRNA from cultured cells. Target miRNA was reverse transcribed to cDNA by the miRcute miRNA First-Strand

2.7. Extracellular acidification (ECAR) and oxygen consumption rate assays (OCR) ECAR and OCR were tested by the Seahorse XFe 96 Extracellular Flux Analyzer (Seahorse Bioscience). Experiments were performed according to the manufacturer's protocol. 1  104 cells/well was plated in a Seahorse XFe 96 cell culture microplate. After baseline measurements, for ECAR, glucose, the oxidative phosphorylation inhibitor oligomycin, and the glycolytic inhibitor 2-DG were sequentially injected into each well at indicated time points; and for OCR, oligomycin, the reversible inhibitor of oxidative phosphorylation FCCP (p-trifluoromethoxy carbonyl cyanide phenylhydrazone), and the mitochondrial complex I inhibitor rotenone plus the mitochondrial complex III inhibitor antimycin A (Rote/AA) were sequentially injected. Data obtained were analyzed by Seahorse XFe Wave software. 2.8. Tumor growth analysis in vivo The animal study was approved and monitored by the Ethics Committees of the Chinese PLA of General Hospital. For in vivo tumor assay, a total of 1  107 A375 cells subcutaneously inoculated into the right flank of nude mice respectively. Tumor size was calculated at the indicated times. The mice were sacrificed at the indicated times. Excised tumors were conserved in liquid nitrogen. 2.9. Statistical analysis Each experiment was performed in triplicate and repeated 3 times in vitro. The significance in cell proliferation, migration and invasion assays, glucose uptake, lactate, ATP, ECAR and OCR, as well as luciferase reporter assays were assessed by two-tailed Student's t-test. The statistical analyses were computed by the SPSS 22.0 statistical software package. P-values of less than 0.05 were considered statistically significant. 3. Results 3.1. Aerobic glycolysis is critical for regulating melanoma cell proliferation by miR-150-5p Since aerobic glycolysis plays a vital role in cancer progression and miR-150-5p acts as a suppressor gene, we explored whether aerobic glycolysis plays a role in miR-150-5p mediated suppression of melanoma cell proliferation. As a result, the glycolytic inhibitor 2-deoxy-d-glucose (2-DG), diminished the ability of miR-150-5p mimics to inhibit proliferation in A375 and SK-MEL-2 cells (Fig. 1A and B), suggesting that aerobic glycolysis is critical for regulating melanoma cell proliferation by miR-150-5p.

X. Yang et al. / Biochemical and Biophysical Research Communications 515 (2019) 85e91

87

Fig. 1. Aerobic glycolysis is involved in the regulation of melanoma cell proliferation by miR-150-5p. (A and B) The proliferation curve of A375 and SK-MEL-2 melanoma cells transfected with miR-150-5p or non-specific control for miRNA (NC) and treated with 2.5 mM 2-DG as indicated. Quantitative real-time PCR (qRT-PCR) analysis suggests miR-1505p expression. Data shown are mean ± SD of triplicate measurements that have been repeated three times with similar results. **p < 0.01.

3.2. miR-150-5p inhibits SIX1 expression by directly targeting its 30 UTR To further explore the association between miR-150-5p and aerobic glycolysis, we used TargetScan and miRanda (target prediction programs), to screen for potential targets of miR-150-5p. Several potential targets were predicted. We chose four targets reported to play roles in glycolysis to verify the potential relationship in human kidney embryonic HEK293T by Western blot. As previously reported [11], overexpression of miR-150-5p mimics inhibited the VEGFA expression (Supplementary Figures S1). Moreover, miR-150-5p repressed the expression of SIX1, but not SIX2, another SIX family member. Therefore, we chose miR-150-5p for further study. Overexpression of miR-150-5p mimics inhibited the SIX1 oncogene expression in the melanoma cell lines A375 and SK-MEL2 (Fig. 2A). In contrast, miR-150-5p inhibition upregulated SIX1 expression in the above-mentioned cell lines (Fig. 2B). Quantitative reverse transcription PCR (qRT-PCR) was performed to further examine how miR-150-5p influenced the expression of SIX1. The results indicated that miR-150-5p mimics decreased SIX1 mRNA expression while miR-150-5p inhibition increased SIX1 mRNA expression (Fig. 2C and D). To explore whether miR-150-5p is a direct and specific target of SIX1, we transfected A375 and SK-MEL-2 cells with wild-type SIX1 30 -UTR or 30 -UTR mutated luciferase reporter and the plasmid for miR-150-5p. miR-150-5p decreased the SIX1 30 -UTR reporter activity, but not affect the luciferase activity of the mutant reporter in which the binding sites for miR-150-5p were mutated (Fig. 2E). Collectively, these results suggest that miR-150-5p inhibits SIX1 expression by targeting its 30 -UTR in melanoma cells. 3.3. miR-150/SIX1 axis mediates melanoma cells proliferation, migration and invasion both in vitro and in vivo SIX1 has been shown to promote tumor cells proliferation, migration and invasion. We tested if miR-150-5p/SIX1 axis mediates proliferation, migration and invasion in melanoma cells. Cell proliferation and colony formation assays showed that

overexpression of miR-150-5p mimics reduced the proliferation of A375 and SK-MEL-2 cells. Moreover, SIX1 knockdown inhibited the ability of miR-150-5p to regulate melanoma cell proliferation (Fig. 3A and B, Supplementary Figures S2A and B). As expected, wound-healing and transwell assays showed that miR-150-5p overexpression decreased migration and invasion ability. Furthermore, SIX1 knockdown inhibited the ability of miR-150-5p to regulate melanoma cell migration, and invasion (Fig. 3C and D, Supplementary Figures S2 C and D). To investigate the in vivo phenotype of the miR-150-5p/SIX1 pathway, A375 cells harboring miR-150 or SIX1 shRNA or miR-150 plus SIX1 shRNA were subcutaneously injected into the right flanks of male nude mice. As expected, compared with the empty control vector, the tumors with miR-150 overexpression or SIX1 knockdown grew slowly (Fig. 3E and F). Importantly, SIX1 knockdown abolished the ability of miR-150 to regulate the growth of cancer xenografts. Lactate production analysis and immunoblot analysis of the tumor masses further validated that miR-150 significantly repressed the lactate production via SIX1 (Fig. 3G and H). These data suggests that miR-150 suppresses tumor growth via SIX1-mediated glycolysis. 3.4. miR-150-5p dampens glycolysis via inhibition of SIX1 expression in melanoma cells in vivo SIX1 is a key transcription factor involved in aerobic glycolysis. To confirm whether miR-150-5p might influence glycolysis via SIX1 in melanoma cells, we performed measurement of glucose uptake, lactate production and ATP generation. As expected, miR-150-5p mimics decreased glucose uptake, lactate production and ATP generation (Fig. 4A and Supplementary Figures S3A). Additionally, both extracellular acidification rate (ECAR), reflecting overall glycolytic flux and oxygen consumption rate (OCR) reflecting mitochondrial respiration are indicators of glycolysis. The results showed that miR-150-5p mimics displayed decreased ECAR, and increased OCR (Fig. 4B and Supplementary Figures S3B). miR-1505p mimics in the SIX1 knockdown A375 and SK-MEL-2 cells had no effects on the glycolytic phenotype, indicating that miR-150-5p represses the glycolytic phenotype via SIX1. These data collectively

88

X. Yang et al. / Biochemical and Biophysical Research Communications 515 (2019) 85e91

Fig. 2. SIX1 is a direct target of miR-150-5p. (A and B) Immunoblot analysis of A375 and SK-MEL-2 cells transfected with NC or miR-150-5p mimics or scramble or miR-150-5p inhibitor. Scramble was a negative control for miRNA inhibitors. Histograms under the immunoblot reveal corresponding expression levels of miRNAs testing by qRT-PCR. beactin was a loading control for immunoblot. (C and D) qRT-PCR analysis of SIX1 mRNA levels in the above-mentioned melanoma cell lines transfected with miR-150-5p mimics or miR150-5p inhibitor. (E) miRNA luciferase reporter assays of A375 and SK-MEL-2 cells transfected with wild-type or mutated SIX1 reporter plus miR-150-5p mimics. The top panel shows wild-type and mutant forms of putative miR-150-5p target sequences of SIX1 30 -UTR. Red font indicates the putative miR-150-5p binding sites within human SIX1 30 -UTR. Red and italicized font indicates the mutations introduced into the SIX1 30 -UTR. All values shown are mean ± SD of triplicate measurements and experiments have been repeated 3 times with similar results (**p < 0.01). (For interpretation of the references to color in this figure legend, the reader is referred to the Web version of this article.)

X. Yang et al. / Biochemical and Biophysical Research Communications 515 (2019) 85e91

89

Fig. 3. miR-150-5p inhibits proliferation, invasion and metastasis via inhibition of SIX1 expression in A375 cells. (A) A375 cells were transfected with NC or miR-150-5p mimics or lentivirus mediated-SIX1 knockdown (SIX1 shRNA) or SIX1 shRNA plus miR-489-3p mimics. Cell numbers was assessed by CCK-8 assay. The representative immunoblot shows SIX1 expression. Histograms display miR-150-5p expression determined by qRT-PCR. (B,C and D) Colony formation (B), Wound healing (C) and invasion (D) assays of A375 cells transfected as in (A). Illustrative images show colonies in plates, cell migration and invasion. Histograms show colony number, comparative cell migration and invasion. All values displayed are mean ± SD and have been duplicated 3 times with similar results (AeD). **p < 0.01 versus corresponding NC. (E) A375 cells stably infected with lentivirus carrying the indicated constructs were injected into nude mice as indicated. After 45 days, mice were sacrificed to harvest tumors. (F) At the indicated times, the tumors were measured (mean ± SD, n ¼ 7), and the growth curve was plotted. **p < 0.01 at day 45. (G) Lactate production of representative tumor tissues from (E). Data shown are mean ± SD of quintuplicate measurements and have been repeated 3 times with similar results. **p < 0.01 versus empty vector. (H) Immunoblot analysis of the expression of SIX1 in representative excised tumor from (E).

90

X. Yang et al. / Biochemical and Biophysical Research Communications 515 (2019) 85e91

Fig. 4. miR-150-5p regulates glycolysis via inhibition of SIX1 expression in A375 cells. (A) A375 cells were transfected with NC or miR-150-5p mimics or lentivirus mediatedSIX1 knockdown (SIX1 shRNA) or SIX1 shRNA plus miR-489-3p mimics. Glucose uptake and lactate production and ATP production were measured. Typical immunoblot reveals the expression of SIX1. qRT-PCR analysis shows miR-150-5p expression. (B) A375 cells were transfected as in (A), and ECAR and OCR were measured. All values displayed are mean ± SD and have been duplicated 3 times with similar results. **p < 0.01 versus corresponding NC.

suggest that miR-150-5p dampens glycolysis through inhibition of SIX1 expression in melanoma cells. 4. Discussion We have firstly confirmed that miR-150-5p inhibits melanoma cell proliferation both in vitro and in vivo by dampening glycolysis via inhibition of SIX1 expression. glycolytic inhibitor 2-DG diminishes the effect of miR-150-5p to regulate melanoma cell proliferation. miR-150-5p inhibits glucose uptake, lactate production, ATP production and induces a switch from glycolysis to mitochondrial respiration through inhibition of SIX1 mediated the Warburg effect. miR-150-5p was proved to be a novel SIX1targeting miRNA in melanoma cells. gur J et al. [12,13]reported that the Warburg Recently, Pouysse effect is dispensable for tumor growth in melanoma and colon cancer. Knocking out GPI (GPI-KO) gene, or double knocking out LDHA/B (LDHA/B-DKO) genes which abolished the Warburg effect demonstrated only a moderate impact on melanoma and colon gur J et al. performed all expericancer cell growth. First, Pouysse ments using human colon cancer cell line LS174T and murine melanoma cell line B16. We conducted experiments using human malignant melanoma cell lines, A375 and SK-MEL-2 cells. Second, gur J et al. disrupted glycolysis by genetic knocking out key Pouysse glycolysis enzymes whereas we blocked glycolysis using pharmacologic inhibitor. It's said that use of glycolysis inhibitors are effective in blocking tumor growth, however, they have metabolic dual effects or off-target effect. Others' work also identified that with this pharmacological approach most of the tumor cell lines

analyzed stopped growing and died. As for genetic approach used gur J et al.'s study, they avoided dual or off-target effects in Pouysse led by pharmacological approach. We cannot exclude the possibility that a few GPI-KO or LDHA/B-DKO cells were able to escape the blockade of glycolysis and grow because they performed a more successful OXPHOS metabolic reprogramming. Anyway, further studies will be developed to compare genetic and pharmacologic blockade of glycolysis on these cell lines. In solid tumors, miR-150-5p has been recognized as a suppressor in several tumors. miR-150-5p exerted its inhibitory function in colorectal cancer via the VEGFA/VEGFR2/Akt/mTOR signaling pathway or targeting MUC4 [11,14]. miR-150-5p suppresses glioma cell proliferation and migration through targeting membrane-type-1 matrix metalloproteinase (MT1-MMP) [15]. MiR-150-5p inhibits the proliferation and promoted apoptosis of pancreatic cancer cells [16]. In melanoma, Tembe et al. [17] suggested that miR-150-5p is down-regulated in metastatic melanoma and portends a worse prognosis. Liang et al. have proved that RAB9A expression was regulated negatively by miR-150-5p [18]. miR-150 suppressed the proliferation, migration, and invasion of melanoma cell by downregulating MYB [19]. However, whether miR-150-5p regulates the Warburg effect in melanoma is unknown. We proved that miR-150-5p inhibits the Warburg effect and suppresses melanoma cell proliferation through inhibition of SIX1mediated Warburg effect. A large number of studies have showed that SIX1 participates in the occurrence of multiple human cancers. SIX1 overexpression correlates strongly with a poor prognosis in patients with a variety of cancers, such as breast cancer, ovarian cancer, esophageal cancer,

X. Yang et al. / Biochemical and Biophysical Research Communications 515 (2019) 85e91

glioma etc. [20e24]. Moreover, SIX1 mediates resistance to paclitaxel in breast cancer cells [25]. As a critical transcription factor, SIX1 plays a critical role in tumorigenesis and metastasis [26e28]. The SIX1-EYA transcriptional complex is co-overexpressed and interaction in multiple cancers [29,30]. SIX1 promotes proliferation and migration/invasion/metastasis of multiple cancer cells, such as breast, liver and gastric cancer cells, etc. Identification of the upregulation of SIX1 could be a potential therapeutic strategy for cancer. Recently, some miRNAs, such as miR-548a-3p [8], miR-2045p [31], miR-140-5p [32], miR-23b-3p [33], MicroRNA-362 [34] have been shown to inhibit SIX1 expression. To the best of our knowledge, our study initially proved miR-150-5p to be a novel inhibitor of SIX1 in melanoma. We confirmed that miR-150-5p not only inhibits the Warburg effect in melanoma, but also suppresses melanoma growth and metastasis through inhibition of SIX1mediated Warburg effect. In conclusion, we showed that miR-150-5p regulates the transcription factor SIX1-mediated glycolysis in melanoma both in vitro and in vivo. The ability to target SIX1 of miR-150-5p elevates current understanding of the regulatory network of SIX1. The miR-1505p/SIX1 axis may be a promising therapeutic target for melanoma. Acknowledgments This work was supported by the National Natural Science Foundation of China (81672602, 81502264 and 81872090), and the Logistics Scientific Research project (BWS16J010), the Capital Foundation of Medical Developments (2016-4-5061). Conflicts of interest All authors have no conflict of interest. Appendix A. Supplementary data Supplementary data to this article can be found online at https://doi.org/10.1016/j.bbrc.2019.05.111. Transparency document Transparency document related to this article can be found online at https://doi.org/10.1016/j.bbrc.2019.05.111. References [1] S.C. Trotter, N. Sroa, R.R. Winkelmann, T. Olencki, M. Bechtel, A global review of melanoma follow-up guidelines, J. Clin. Aesthet. Dermatol. 6 (2013) 18e26. [2] F. Dimitriou, R. Krattinger, E. Ramelyte, M.J. Barysch, S. Micaletto, R. Dummer, S.M. Goldinger, The world of melanoma: epidemiologic, genetic, and anatomic differences of melanoma across the globe, Curr. Oncol. Rep. 20 (2018) 87. [3] E.A. Rozeman, T.J.A. Dekker, J. Haanen, C.U. Blank, Advanced melanoma: current treatment options, biomarkers, and future perspectives, Am. J. Clin. Dermatol. 19 (2018) 303e317. [4] A.W.L. Bayci, D.A. Baker, A.E. Somerset, O. Turkoglu, Z. Hothem, R.E. Callahan, R. Mandal, B. Han, T. Bjorndahl, D. Wishart, R. Bahado-Singh, S.F. Graham, R. Keidan, Metabolomic identification of diagnostic serum-based biomarkers for advanced stage melanoma, Metabolomics 14 (2018) 105. [5] C. Sole, D. Tramonti, M. Schramm, I. Goicoechea, M. Armesto, L.I. Hernandez, L. Manterola, M. Fernandez-Mercado, K. Mujika, A. Tuneu, A. Jaka, M. Tellaetxe, M.R. Friedlander, X. Estivill, P. Piazza, P.L. Ortiz-Romero, M.R. Middleton, C.H. Lawrie, The circulating transcriptome as a source of biomarkers for melanoma, Cancers 11 (2019). [6] D.A. Scott, A.D. Richardson, F.V. Filipp, C.A. Knutzen, G.G. Chiang, Z.A. Ronai, A.L. Osterman, J.W. Smith, Comparative metabolic flux profiling of melanoma cell lines: beyond the Warburg effect, J. Biol. Chem. 286 (2011) 42626e42634. [7] W. Jones, K. Bianchi, Aerobic glycolysis: beyond proliferation, Front. Immunol. 6 (2015) 227. [8] L. Li, Y. Liang, L. Kang, Y. Liu, S. Gao, S. Chen, Y. Li, W. You, Q. Dong, T. Hong, Z. Yan, S. Jin, T. Wang, W. Zhao, H. Mai, J. Huang, X. Han, Q. Ji, Q. Song, C. Yang, S. Zhao, X. Xu, Q. Ye, Transcriptional regulation of the Warburg effect in cancer by SIX1, Cancer Cell 33 (2018) 368e385, e367.

91

[9] P.K. Singh, K. Mehla, M.A. Hollingsworth, K.R. Johnson, Regulation of aerobic glycolysis by microRNAs in cancer, Mol. Cell. Pharmacol. 3 (2011) 125e134. [10] I. Berindan-Neagoe, C. Monroig Pdel, B. Pasculli, G.A. Calin, MicroRNAome genome: a treasure for cancer diagnosis and therapy, CA A Cancer J. Clin. 64 (2014) 311e336. [11] X. Chen, X. Xu, B. Pan, K. Zeng, M. Xu, X. Liu, B. He, Y. Pan, H. Sun, S. Wang, miR-150-5p suppresses tumor progression by targeting VEGFA in colorectal cancer, Aging (Albany NY) 10 (2018) 3421e3437. [12] M.C. de Padua, G. Delodi, M. Vucetic, J. Durivault, V. Vial, P. Bayer, G.R. Noleto, N.M. Mazure, M. Zdralevic, J. Pouyssegur, Disrupting glucose-6-phosphate isomerase fully suppresses the "Warburg effect" and activates OXPHOS with minimal impact on tumor growth except in hypoxia, Oncotarget 8 (2017) 87623e87637. [13] M. Zdralevic, A. Brand, L. Di Ianni, K. Dettmer, J. Reinders, K. Singer, K. Peter, A. Schnell, C. Bruss, S.M. Decking, G. Koehl, B. Felipe-Abrio, J. Durivault, P. Bayer, M. Evangelista, T. O'Brien, P.J. Oefner, K. Renner, J. Pouyssegur, M. Kreutz, Double genetic disruption of lactate dehydrogenases A and B is required to ablate the "Warburg effect" restricting tumor growth to oxidative metabolism, J. Biol. Chem. 293 (2018) 15947e15961. [14] W.H. Wang, J. Chen, F. Zhao, B.R. Zhang, H.S. Yu, H.Y. Jin, J.H. Dai, MiR-150-5p suppresses colorectal cancer cell migration and invasion through targeting MUC4, Asian Pac. J. Cancer Prev. APJCP 15 (2014) 6269e6273. [15] M. Sakr, T. Takino, H. Sabit, M. Nakada, Z. Li, H. Sato, miR-150-5p and miR133a suppress glioma cell proliferation and migration through targeting membrane-type-1 matrix metalloproteinase, Gene 587 (2016) 155e162. [16] Y. Sun, X.L. Jin, T.T. Zhang, C.W. Jia, J. Chen, MiR-150-5p inhibits the proliferation and promoted apoptosis of pancreatic cancer cells, Zhonghua Bing Li Xue Za Zhi 42 (2013) 460e464. [17] V. Tembe, S.J. Schramm, M.S. Stark, E. Patrick, V. Jayaswal, Y.H. Tang, A. Barbour, N.K. Hayward, J.F. Thompson, R.A. Scolyer, Y.H. Yang, G.J. Mann, MicroRNA and mRNA expression profiling in metastatic melanoma reveal associations with BRAF mutation and patient prognosis, Pigment Cell Melanoma Res. 28 (2015) 254e266. [18] L. Liang, Z. Zhang, X. Qin, Y. Gao, P. Zhao, J. Liu, W. Zeng, Long noncoding RNA ZFAS1 promotes tumorigenesis through regulation of miR-150-5p/RAB9A in melanoma, Melanoma Res. (2019), https://doi.org/10.1097/CMR.000000 0000000595. [19] X. Sun, C. Zhang, Y. Cao, E. Liu, miR-150 suppresses tumor growth in melanoma through downregulation of MYB, Oncol. Res. 27 (2019) 317e323. [20] L. Chao, J. Liu, D. Zhao, Increased Six1 expression is associated with poor prognosis in patients with osteosarcoma, Oncol. Lett. 13 (2017) 2891e2896. [21] X. Zhang, R. Xu, Six1 expression is associated with a poor prognosis in patients with glioma, Oncol. Lett. 13 (2017) 1293e1298. [22] T. Nishimura, M. Tamaoki, R. Komatsuzaki, N. Oue, H. Taniguchi, M. Komatsu, K. Aoyagi, K. Minashi, F. Chiwaki, H. Shinohara, Y. Tachimori, W. Yasui, M. Muto, T. Yoshida, Y. Sakai, H. Sasaki, SIX1 maintains tumor basal cells via transforming growth factor-beta pathway and associates with poor prognosis in esophageal cancer, Cancer Sci. 108 (2017) 216e225. [23] K.J. Reichenberger, R.D. Coletta, A.P. Schulte, M. Varella-Garcia, H.L. Ford, Gene amplification is a mechanism of Six1 overexpression in breast cancer, Cancer Res. 65 (2005) 2668e2675. [24] K. Behbakht, L. Qamar, C.S. Aldridge, R.D. Coletta, S.A. Davidson, A. Thorburn, H.L. Ford, Six1 overexpression in ovarian carcinoma causes resistance to TRAIL-mediated apoptosis and is associated with poor survival, Cancer Res. 67 (2007) 3036e3042. [25] Z. Li, T. Tian, X. Hu, X. Zhang, F. Nan, Y. Chang, F. Lv, M. Zhang, Six1 mediates resistance to paclitaxel in breast cancer cells, Biochem. Biophys. Res. Commun. 441 (2013) 538e543. [26] W. Wu, Z. Ren, P. Li, D. Yu, J. Chen, R. Huang, H. Liu, Six1: a critical transcription factor in tumorigenesis, Int. J. Cancer 136 (2015) 1245e1253. [27] W. Zheng, L. Huang, Z.B. Wei, D. Silvius, B. Tang, P.X. Xu, The role of Six1 in mammalian auditory system development, Development 130 (2003) 3989e4000. [28] D. Kong, Y. Liu, Q. Liu, N. Han, C. Zhang, R.G. Pestell, K. Wu, G. Wu, The retinal determination gene network: from developmental regulator to cancer therapeutic target, Oncotarget 7 (2016) 50755e50765. [29] T.J. Kingsbury, M. Kim, C.I. Civin, Regulation of cancer stem cell properties by SIX1, a member of the PAX-SIX-EYA-DACH network, Adv. Cancer Res. 141 (2019) 1e42. [30] M.A. Blevins, C.G. Towers, A.N. Patrick, R. Zhao, H.L. Ford, The SIX1-EYA transcriptional complex as a therapeutic target in cancer, Expert Opin. Ther. Targets 19 (2015) 213e225. [31] Y. Chu, M. Jiang, F. Du, D. Chen, T. Ye, B. Xu, X. Li, W. Wang, Z. Qiu, H. Liu, Y. Nie, J. Liang, D. Fan, miR-204-5p suppresses hepatocellular cancer proliferation by regulating homeoprotein SIX1 expression, FEBS Open Bio 8 (2018) 189e200. [32] Z.Y. Nie, X.J. Liu, Y. Zhan, M.H. Liu, X.Y. Zhang, Z.Y. Li, Y.Q. Lu, J.M. Luo, L. Yang, miR-140-5p induces cell apoptosis and decreases Warburg effect in chronic myeloid leukemia by targeting SIX1, Biosci. Rep. (2019), https://doi.org/ 10.1042/BSR20190150. [33] H. Liu, W. Wei, X. Wang, X. Guan, Q. Chen, Z. Pu, X. Xu, A. Wei, miR23b3p promotes the apoptosis and inhibits the proliferation and invasion of osteosarcoma cells by targeting SIX1, Mol. Med. Rep. 18 (2018) 5683e5692. [34] C. Shi, Z. Zhang, MicroRNA-362 is downregulated in cervical cancer and inhibits cell proliferation, migration and invasion by directly targeting SIX1, Oncol. Rep. 37 (2017) 501e509.