- Email: [email protected]
miR-181a suppresses autophagy and sensitizes gastric cancer cells to cisplatin
GENE-40992; No. of pages: 6; 4C: Gene xxx (2015) xxx–xxx
Contents lists available at ScienceDirect
Gene journal homepage: www.elsevier.com/locate/gene
Research paper
miR-181a suppresses autophagy and sensitizes gastric cancer cells to cisplatin Jing Zhao a, Yuqiang Nie b, Hong Wang b, Yong Lin b,⁎ a
School of Public Health, Guangzhou Medical University, Xinzao, Panyu District, Guangzhou, 511436, PR China Department of Gastroenterology, Guangzhou Digestive Disease Center, Guangzhou Key Laboratory of Digestive Disease, Guangzhou First People's Hospital, Guangzhou Medical University, No. 1 Panfu Road, Guangzhou 510180, PR China
b
a r t i c l e
i n f o
Article history: Received 18 September 2015 Received in revised form 22 October 2015 Accepted 12 November 2015 Available online xxxx Keywords: miR-181a Gastric cancer ATG5 Autophagy Drug resistance
a b s t r a c t A number of chemotherapy drugs can induce autophagy. This inducible autophagy is a pro-survival mechanism and contributes to the development of acquired drug resistance. Emerging evidence indicates that miRNA regulates autophagy via targeting autophagy related genes and is involved in drug resistance. We previously demonstrated that miR-181a plays an important role in gastric cancer. The present study aimed to explore the effect of miR-181a on autophagy regulation and cisplatin resistance. We revealed that miR-181a is a novel negative regulator of autophagy in cisplatin-resistant cells SGC7901/CDDP. Then we indicated that ATG5 was a potential target of miR-181a. Furthermore, overexpression of miR-181a significantly enhanced the sensitivity of SGC7901/CDDP cells to cisplatin in vitro and reduced the volumes of gastric tumor xenografts in nude mice. Our finding provides evidence that miR-181a functions as a primary autophagy-related modulator and reverses cisplatin-resistance in GC cells. © 2015 Elsevier B.V. All rights reserved.
1. Introduction Gastric cancer (GC) is the fourth most common malignancy and the third most common cause of cancer-related death worldwide (Torre et al., 2015). Because there are no specific symptoms at the early stages when GC is surgically curable, most cases were diagnosed at an advanced stage of the disease (Cooke et al., 2013). For these patients, chemotherapy is the first-line treatment (Dicken et al., 2005). However, even though many novel chemotherapeutic drugs are used in clinical practice, chemotherapy often fail due to drug resistance (Burris, 2013). Although the mechanisms underlying drug resistance have been widely explored, the key determinants remain largely unclear. Recent reports indicate that a number of chemotherapy drugs can induce autophagy (Janku et al., 2011; An et al., 2015). This inducible autophagy is a pro-survival mechanism and contributes to the development of acquired drug resistance (Kumar et al., 2015). Hence, inhibition of autophagy may provide a new combined therapeutic strategy (Li et al., 2015). Accumulating evidences show that miRNAs are capable of modulating autophagic activity through changing intracellular levels of key autophagy proteins (Zhu et al., 2009; Chang et al., 2014). In our
Abbreviations: GC, gastric cancer; miRNA, microRNA; CDDP, cisplatin; qRT-PCR, quantitative reverse transcription PCR; DAPI, 4′-6-diamidino-2-phenylindole; IC50, halfmaximal inhibitory concentration; UTR, untranslated region; Lenti, lentivirus. ⁎ Corresponding author. E-mail address: [email protected] (Y. Lin).
previous study, based on miRNA microarray analysis, we identified that miR-181a played an important role in GC (Lin et al., 2012). However, whether miR-181a can inhibit this kind of protective autophagy and reverse drug resistance in GC remains unknown. In the present study, firstly, we demonstrated that miR-181a inhibited autophagy in cisplatin-resistant cell line SGC7901/CDDP. Then we showed that ATG5 was a potential target of miR-181a. Furthermore, we identified that miR-181a sensitized SGC7901/CDDP cells to cisplatin in vivo and in vitro. Our findings indicated that miR-181a functions as a primary autophagy-related modulator and reverses cisplatinresistance in GC cells. 2. Materials and methods 2.1. Cell culture Human gastric cancer cisplatin-resistant cell line SGC7901/CDDP was purchased from Nanjing KeyGEN BioTECH company. Cells were cultured in RPMI-1640 medium supplemented with 10% fetal bovine serum, 50 U/ml penicillin and 50 μg/ml streptomycin (both from Gibco, Carlsbad, CA, USA), 800 ng/ml cisplatin at 37 °C in humidified 5% CO2 atmosphere. 2.2. RNA extraction and quantitative reverse transcription PCR Total RNA was extracted from cell lines using Trizol (Invitrogen). Reverse transcription was done using GoScript Reverse Transcription
http://dx.doi.org/10.1016/j.gene.2015.11.013 0378-1119/© 2015 Elsevier B.V. All rights reserved.
Please cite this article as: Zhao, J., et al., miR-181a suppresses autophagy and sensitizes gastric cancer cells to cisplatin, Gene (2016), http:// dx.doi.org/10.1016/j.gene.2015.11.013
2
J. Zhao et al. / Gene xxx (2015) xxx–xxx
System (Promega, Madison, WI, USA). Quantitative PCR (QPCR) was performed using SYBR Green qPCR SuperMix (Invitrogen). 18S rRNA was used as an internal control. PCR Primers used were as follows: ATG5 forward: 5′-CAACTTGTTTCACGCTATATCAGG-3′; and reverse: 5′CACTTTGTCAGTTACCAACGTCA-3′; 18S rRNA forward: 5′-CCTGGATA CCGCAGCTAGGA-3′; and reverse: 5′-GCGGCGCAATACGAATGCCCC-3′. PCR was performed at 95 °C for 10 min, followed by 40 cycles of 95 °C for 15 s and 60 °C for 50 s. The qRT-PCR kit and protocol for miR-181a have been described in detail previously (Lin et al., 2012). QPCR was performed on ABI PRISM 7500 Sequence Detection System (Applied Biosystems, Foster City, CA, USA). The relative quantification was calculated using the 2−ΔΔCt method (Livak and Schmittgen, 2001).. 2.3. Oligonucleotide construction and transfection All the RNA Oligonucleotides were synthesized and purchased from GenePharma (Shanghai, China). Oligonucleotides sequences used were as follows: miR-181a mimic: AACAUUCAACGCUGUCGG UGAGU; miR-181a inhibitor: ACCAUCGACCGUUGAUUGUACC; negative control (NC): UUCUCCGAACGUGUCACGUTT and ACGUGACACG UUCGGAGAATT; NC inhibitor: CAGUACUUUUGUGUAGUACAA. Cells were transfected with miR-181a mimic (50 nmol/l), miR-181a inhibitor (100 nmol/l), miRNA negative control (NC) (50 nmol/l) or NC inhibitor (100 nmol/l), using Lipofectamine RNAiMAX (Invitrogen). After five-hour incubation, medium in each well was replaced by serum-containing medium. Total RNA and protein were extracted 48 h after transfection. 2.4. Western blot analysis Total proteins were extracted using Cell Lysis Reagents (Pierce, Rockford, IL, USA) and quantified using the BCA method (Pierce). Protein was separated on 10% SDS-polyacrylamide gel, and then transferred to a PVDF membrane (Amersham Biosciences, Chicago, IL, USA).
The membrane was blocked and incubated with anti-ATG5 antibody (dilution, 1:1000, Novus, Littleton, CO, USA), anti-LC3B antibody (dilution, 1:500, Sigma, St. Louis, MO, USA) or anti-GAPDH antibody (dilution, 1:2500, Abcam, Cambridge, UK) overnight at 4 °C, followed by incubation with secondary antibody (Dako, Glostrup, Denmark) for 50 min at room temperature. The membranes were developed using ECL kit (Pierce) and exposed to X-ray film to visualize the images. The GAPDH gene was used as an internal control. The band intensity was analyzed using Gel-Pro Analyzer software (Version 4.0, Media Cybernetics, LP, USA). 2.5. GFP-LC3 analysis Cells were transfected with pSELECT-GFP-LC3 (InvivoGen, San Diego, CA) using Lipofectamine reagent (Invitrogen) following the manufacturer's instructions. Cells were fixed with 4% paraformaldehyde in PBS after the treatments. Nuclei were counterstained with DAPI (blue). Images were obtained by confocal microscope (Olympus FV 1000). Cells with five or more intense GFP-LC3 puncta were considered autophagic, whereas those with diffuse cytoplasmic GFP-LC3 staining were considered non-autophagic. The percentage of GFP-LC3 positive cells were counted in at least 100 cells. 2.6. Transmission electron microscopy Cells harvested by trypsinization were fixed in 2.5% gluteraldehyde in 0.1 M sodium phosphate buffer, and then post-fixed in 1% osmium tetroxide buffer. After dehydration in a graded series of ethanol and acetone, the cells were embedded in Spurr resin, cut into 50 nm sections and stained with 3% uranyl acetate and lead citrate. Images were generated using AMT camera system on JEOL JEM 100CX transmission electron microscope at 20000 ×. Autophagic vacuoles per cell were determined by counting 10 cells for each sample.
Fig. 1. miR-181a regulated autophagy in SGC7901/CDDP cells. A) Twenty-four hours after cotransfection of miRNA and GFP-LC3 plasmid, autophagic activities were observed using confocal microscope. Cells with five or more intense GFP-LC3 puncta were considered autophagic, whereas those with diffuse cytoplasmic GFP-LC3 staining were considered non-autophagic. B) Quantitative analysis of the GFP-LC3 positive cells percentage. Overexpression of miR-181a reduced autophagy, whereas inhibition of miR-181a induced autophagy. C) Transmission electron microscopy analysis of autophagy in cells treated as indicated. Arrows indicate autophagic vacuoles. D) Quantitative analysis of the autophagic vacuoles per cell. The results represent means ± SD for three independent experiments. *p b 0.05. E) Western blot results of cells treated as indicated. LC3Ⅱ/ LC3Ⅰ densitometric ratios were indicated. GAPDH was used as a loading control. Untreated cell group was assigned as the reference group.
Please cite this article as: Zhao, J., et al., miR-181a suppresses autophagy and sensitizes gastric cancer cells to cisplatin, Gene (2016), http:// dx.doi.org/10.1016/j.gene.2015.11.013
J. Zhao et al. / Gene xxx (2015) xxx–xxx
2.7. MTS assay For half-maximal inhibitory concentration (IC50), 24 h after transfection, cells were trypsinized and seeded into 96-well plates at a density of 1 × 104 cells/well. The medium, which contained cisplatin at different concentrations, was added to each well. After 24 h, MTS (cellTiter 96 AQ, Promega, Madison, WI) assay was performed following the manufacturer's protocol, and the absorption was read at 490 nm. The concentration at which each drug produced IC50 was then calculated. 2.8. Animal xenograft model The animal study was performed in strict accordance with the recommendations in the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health. Protocols were reviewed and consented by the Ethics Committee of Guangzhou Medical University. For in vivo experiments, the lentivirus expressing miR181a (lenti-miR-181a) and lenti-miR-NC vectors were constructed by Land Biology Technology Company (Guangzhou, China). Four female BALB/c nude mice (5 weeks old) were separately injected with 5 × 10 6 SGC7901/CDDP cells stably transfected with lentimiR-181a or lenti-miR-NC in right and left flanks. After 2 weeks, the mice were intraperitoneally injected with PBS containing cisplatin (10 mg/kg) once per week. Tumor volumes were determined by measuring the length (L) and the width (W) of the tumors and calculating using the formula: V = LW2/2. The mice were euthanized on day 28, and the tumors were dissected out and photographed, then specimens were submitted to western blot analysis.
3
(*p b 0.05). All together, these findings suggest that miR-181a is a negative regulator of autophagy.
3.2. miR-181a inhibits ATG5 expression in SGC7901/CDDP cells To search for potential autophagy related target genes of miR-181a, four online algorithms, including TargetScan (Lewis et al., 2003), miRanda (Betel et al., 2008), PITA (Kertesz et al., 2007) and PicTar (Krek et al., 2005), were used. ATG5 was identified as a miR-181a target by all these four target prediction algorithms. The predicted interaction between miR-181a and ATG5 3′UTR was shown in Fig. 2A. There are two miR-181a binding sites in the 3′UTR of ATG5. ATG5 is essential for autophagosome formation. Loss of ATG5 results in defective autophagy (Miller et al., 2008). To further confirm the bioinformatics predictions, qRT-PCR and western blot analysis were performed in SGC7901/CDDP cells. As shown in Fig. 2B–C, transfection of miR-181a mimic led to a significant decrease in ATG5 mRNA and protein levels, whereas inhibition of endogenous miR-181a notably increased the levels of ATG5 mRNA and protein, when compared with their respective controls (*p b 0.05). In addition, precursor study has verified that miR-181a can directly target 3′ untranslated region (UTR) of ATG5 and suppress the expression of ATG5 by dual-luciferase assays in HEK-293T cells (Tekirdag et al., 2013). Collectively, these data provide evidence that miR-181a regulates autophagy through targeting of ATG5.
2.9. Statistical analysis Differences between two groups were analyzed by Student's t-test. Data were represented as means ± SD from three independent experiments. Statistical tests were two-sided, and a p b 0.05 was considered statistically significant using SPSS 17.0 (SPSS, Chicago, IL). 3. Results 3.1. miR-181a regulates autophagy in SGC7901/CDDP cells Emerging evidence indicates that miRNA regulates autophagy via targeting autophagy related genes, and is subsequently involved in chemotherapy drug resistance. Hence, we firstly tested the effect of miR181a on autophagy in cisplatin-resistant cells SGC7901/CDDP. Autophagy was determined by observing the redistribution of GFP-LC3 from a diffuse to a punctate pattern under confocal microscope, or by evaluating the double membrane vacuoles using transmission electron microscope, or by assessing the conversion of endogenous LC3 protein from the cytosolic LC3I to the autophagosome associated LC3II via western blot. As shown in Fig. 1A–D, the untreated SGC7901/CDDP cells exhibited basic autophagic activity as evidenced by the GFP-LC3 punctate and the double membrane vacuoles in the cytoplasm. After transfection of miR-181a mimic, the autophagic activity was significantly decreased (*p b 0.05). GFP-LC3 was observed predominantly as diffuse green fluorescence in the cytoplasm, indicating low autophagic activity. In addition, the autolysosomes detected by transmission electron microscope were fewer than that in miR-NC control group. This phenomenon was also confirmed by immunoblot analysis (Fig. 1E). The LC3II was attenuated after overexpression of miR-181a. To further demonstrate the effect of endogenous miR-181a inhibition on autophagy, we transfected cells with miR-181a inhibitor or miR-NC inhibitor. Results showed that cells treated with miR-181a inhibitor exhibited significantly higher percentage of GFP-LC3 dot accumulation, double membrane vacuoles and LC3II conversion than cells transfected with miR-NC inhibitor
Fig. 2. miR-181a affected ATG5 expression in SGC7901/CDDP cells. A) Schematic representation of the interaction of miR-181a and the 3′UTR of ATG5 based on miRanda software prediction. B) qRT-PCR analysis of ATG5 mRNA levels in cells treated as indicated. ATG5 were normalized to 18S rRNA. The results represent the means ± SD for three independent experiments. *p b 0.05. C) Western blots showing the expression of ATG5 protein in cells treated as indicated. Data were normalized to GAPDH. Untreated cell group was set as the reference group.
Please cite this article as: Zhao, J., et al., miR-181a suppresses autophagy and sensitizes gastric cancer cells to cisplatin, Gene (2016), http:// dx.doi.org/10.1016/j.gene.2015.11.013
4
J. Zhao et al. / Gene xxx (2015) xxx–xxx
indicated that overexpression of miR-181a dramatically enhanced the sensitivity of SGC7901/CDDP cells to cisplatin. The IC50 value dropped from 11.13 μg/ml to 3.3 μg/ml (*p b 0.05), which indicated that the viability of miR-181a mimic transfected cells was significantly inhibited, compared with the untreated cells.
3.4. Overexpression of miR-181a increases cisplatin sensitivity of SGC7901/ CDDP cells in vivo Fig. 3. Overexpressed miR-181a sensitized SGC7901/CDDP cells to cisplatin. The results represent the means ± SD for three independent experiments. *p b 0.05.
3.3. miR-181a mimic sensitizes SGC7901/CDDP cells to cisplatin in vitro A number of chemotherapy drugs can induce autophagy. This inducible autophagy seems to serve as a cancer pro-survival mechanism. We hypothesized that inhibition of this kind of protective autophagy might reverse drug resistance. Since our previous data suggested that miR181a mimic was able to suppress autophagy in SGC7901/CDDP cells, here we evaluated the effect of miR-181a on cisplatin-induced cell death. MTS assays were performed to identify IC50 of cisplatin. Fig. 3
To preliminary investigate whether miR-181a also chemosensitized GC cells in vivo, we transfected SGC7901/CDDP cells with lenti-miR181a or lenti-miR-NC, then transplanted SGC7901/CDDP-lenti-miR181a and SGC7901/CDDP-lenti-miR-NC cells into the right and left side of the nude mice respectively. Two weeks later, the tumorbearing mice were treated with cisplatin. As shown in Fig. 4A–B, the volumes of the miR-181a transfected tumors were markedly decreased after chemotherapy, which indicated the reversion of drug resistance by ectopic miR-181a expression. The in vivo results were consistent with the in vitro findings. Moreover, western blot analysis of tumor tissues revealed that there was less conversion from LC3I to the lipidated LC3II in lenti-miR-181a group then that in control group (*p b 0.05). Meanwhile, ATG5 protein levels were decreased in lenti-miR-181a
Fig. 4. Overexpression of miR-181a increased cisplatin sensitivity of SGC7901/CDDP cells in vivo. A-B) SGC7901/CDDP-lenti-miR-NC and SGC7901/CDDP-lenti-miR-181a transfected cells were transplanted into the left and right side of the mice, respectively. Two weeks later, the tumor-bearing mice were treated with cisplatin. Tumor specimens were dissected on day 28. The tumor volumes decreased in lenti-miR-181a group after chemotherapy. C-E) Western blots analysis of LC3 and ATG5 protein levels in tumor specimens of the four mice. Less conversion from LC3Ⅰ to LC3Ⅱ and ATG5 protein levels in lenti-miR-181a group, indicating low autophagic activity. The results represent the means ± SD for three independent experiments. *p b 0.05.
Please cite this article as: Zhao, J., et al., miR-181a suppresses autophagy and sensitizes gastric cancer cells to cisplatin, Gene (2016), http:// dx.doi.org/10.1016/j.gene.2015.11.013
J. Zhao et al. / Gene xxx (2015) xxx–xxx
group, indicating that the chemosensitizing effects of miR-181a were partially associated with autophagy inhibition (Fig. 4C–E).
4. Discussion Chemotherapy drug resistance remains a major obstacle to the clinical management of GC, resulting in relapse and metastasis of cancer. Hence, exploring novel strategy to overcome drug resistance is currently under intense investigation. Autophagy is a cellular degradation pathway for the clearance of damaged or superfluous proteins and organelles. The role of autophagy in cancer is a double-edged sword (Mathew et al., 2007). Although some reports show that autophagy seems to induce autophagic cell death (Das et al., 2012), most studies considered autophagy as a cell survival mechanism (White, 2012; (Kuo et al., 2014). Therefore, inhibition of autophagy provides a new combined therapeutic strategy for modulation of chemosensitivity of cancer. In addition, it has been reported that inhibition of autophagy using 3-methyladenine or chloroquine augmented cisplatin cytotoxicity and improved chemotherapy (Liu et al., 2011; Xu et al., 2012). Also, inhibition of autophagy by silencing autophagy-associated gene, such as beclin 1, significantly improved therapy efficiency of conventional chemotherapeutics (Guo et al., 2012). Meanwhile, it is widely acknowledged that miRNAs played key roles in posttranscriptional regulation mainly by pairing to the 3′UTR of target mRNA (Brodersen and Voinnet, 2009). Recent reports indicate that miRNAs are involved in modulating autophagic activity through targeting key autophagy genes. Zhu et al. revealed that miR-30a negatively regulated beclin 1 expression resulting in decreased autophagic activity (Zhu et al., 2009). Tekirdag et al. showed that overexpression of miR-181a resulted in the attenuation of starvation- and rapamycin-induced autophagy in MCF-7, Huh-7 and K562 cells. Moreover, inhibition of endogenous miR-181a stimulated autophagy. They also identified ATG5 as an miR181a target (Tekirdag et al., 2013). Consistent with this report, our results demonstrated that miR-181a served as a negative regulator of autophagy. Artificial overexpression of miR-181a effectively reduced autophagy, whereas inhibition of endogenous miR-181a led to a further stimulation of autophagic activity in SGC7901/CDDP cells. These data indicate that miR-181a is an important regulator of autophagy. Increasing evidence has suggested that miRNA can potentially improve the effectiveness of chemotherapeutic regimes (Kim et al., 2015; Manvati et al., 2015). Overexpression of miR-101 suppresses autophagy and enhances chemosensitivity both in osteosarcoma and hepatocellular carcinoma (Chang et al., 2014; Xu et al., 2014). Dysregulation of miR-30d in anaplastic thyroid carcinoma (ATC) is responsible for the insensitivity to cisplatin by promoting autophagic survival. Thus, introduction of miR-30d mimic sensitized ATC cells to cisplatin both in vitro and in vivo (Zhang et al., 2014). Upregulated miR-23b-3p inhibits autophagy mediated by ATG12 and HMGB2, and sensitizes GC cells to chemotherapy (An et al., 2015). In line with these results, our observation revealed that transfection of miR-181a mimic dramatically decreased the IC50 of cisplatin and enhanced the sensitivity of SGC7901/CDDP cells to cisplatin. We further validated the function of miR-181a in a xenograft tumor model, showing that miR-181a also regulated cisplatin resistance in vivo. Our data suggests that miR-181a may be exploited as a novel approach to reinforce the efficacy of chemotherapeutic drugs such as cisplatin in GC. However, due to the small number of animals, interpreting this finding should be cautious. In summary, our work identified miR-181a as a novel autophagy regulating miRNA. Inhibition of autophagy by miR-181a overexpression potentiated the toxicity of the cisplatin and reversed drug resistance. These findings may help understand the potential molecular mechanisms underlying chemotherapy drug resistance, and may provide evidence for a novel combined therapeutic strategy to overcome drug resistance in GC.
5
Author contributions Conceived and designed the experiments: YL, JZ. Performed the experiments: YL, JZ, YQN and HW. Analyzed the data: YL, JZ. Contributed reagents/materials/analysis tools: YQN, HW. Contributed to the writing of the manuscript: YL and JZ. Acknowledgment This work was supported by the National Nature Science Foundation of China (No. 81302078). References An, Y., Zhang, Z., Shang, Y., Jiang, X., Dong, J., Yu, P., Nie, Y., Zhao, Q., 2015. miR-23b-3p regulates the chemoresistance of gastric cancer cells by targeting ATG12 and HMGB2. Cell Death Dis. 6, e1766. Betel, D., Wilson, M., Gabow, A., Marks, D.S., Sander, C., 2008. The microRNA.org resource: targets and expression. Nucleic Acids Res. 36, D149–D153. Brodersen, P., Voinnet, O., 2009. Revisiting the principles of microRNA target recognition and mode of action. Nat. Rev. Mol. Cell Biol. 10, 141–148. Burris III, H.A., 2013. Overcoming acquired resistance to anticancer therapy: focus on the PI3K/AKT/mTOR pathway. Cancer Chemother. Pharmacol. 71, 829–842. Chang, Z., Huo, L., Li, K., Wu, Y., Hu, Z., 2014. Blocked autophagy by miR-101 enhances osteosarcoma cell chemosensitivity in vitro. ScientificWorldJournal 2014, 794756. Cooke, C.L., Torres, J., Solnick, J.V., 2013. Biomarkers of Helicobacter pylori-associated gastric cancer. Gut Microbes 4, 532–540. Das, G., Shravage, B.V., Baehrecke, E.H., 2012. Regulation and function of autophagy during cell survival and cell death. Cold Spring Harb. Perspect. Biol. 4. Dicken, B.J., Bigam, D.L., Cass, C., Mackey, J.R., Joy, A.A., Hamilton, S.M., 2005. Gastric adenocarcinoma: review and considerations for future directions. Ann. Surg. 241, 27–39. Guo, X.L., Li, D., Hu, F., Song, J.R., Zhang, S.S., Deng, W.J., Sun, K., Zhao, Q.D., Xie, X.Q., Song, Y.J., Wu, M.C., Wei, L.X., 2012. Targeting autophagy potentiates chemotherapyinduced apoptosis and proliferation inhibition in hepatocarcinoma cells. Cancer Lett. 320, 171–179. Janku, F., McConkey, D.J., Hong, D.S., Kurzrock, R., 2011. Autophagy as a target for anticancer therapy. Nat. Rev. Clin. Oncol. 8, 528–539. Kertesz, M., Iovino, N., Unnerstall, U., Gaul, U., Segal, E., 2007. The role of site accessibility in microRNA target recognition. Nat. Genet. 39, 1278–1284. Kim, J., Jeong, D., Nam, J., Aung, T.N., Gim, J.A., Park, K.U., Kim, S.W., 2015. MicroRNA-124 regulates glucocorticoid sensitivity by targeting phosphodiesterase 4B in diffuse large B cell lymphoma. Gene 558, 173–180. Krek, A., Grun, D., Poy, M.N., Wolf, R., Rosenberg, L., Epstein, E.J., MacMenamin, P., da Piedade, I., Gunsalus, K.C., Stoffel, M., Rajewsky, N., 2005. Combinatorial microRNA target predictions. Nat. Genet. 37, 495–500. Kumar, A., Singh, U.K., Chaudhary, A., 2015. Targeting autophagy to overcome drug resistance in cancer therapy. Future Med. Chem. 7, 1535–1542. Kuo, Y.Z., Tai, Y.H., Lo, H.I., Chen, Y.L., Cheng, H.C., Fang, W.Y., Lin, S.H., Yang, C.L., Tsai, S.T., Wu, L.W., 2014. MiR-99a exerts anti-metastasis through inhibiting myotubularinrelated protein 3 expression in oral cancer. Oral Dis. 20, e65–e75. Lewis, B.P., Shih, I.H., Jones-Rhoades, M.W., Bartel, D.P., Burge, C.B., 2003. Prediction of mammalian microRNA targets. Cell 115, 787–798. Li, S., Wang, L., Hu, Y., Sheng, R., 2015. Autophagy regulators as potential cancer therapeutic agents: a review. Curr. Top. Med. Chem. 15, 720–744. Lin, Y., Nie, Y., Zhao, J., Chen, X., Ye, M., Li, Y., Du, Y., Cao, J., Shen, B., Li, Y., 2012. Genetic polymorphism at miR-181a binding site contributes to gastric cancer susceptibility. Carcinogenesis 33, 2377–2383. Liu, D., Yang, Y., Liu, Q., Wang, J., 2011. Inhibition of autophagy by 3-MA potentiates cisplatin-induced apoptosis in esophageal squamous cell carcinoma cells. Med. Oncol. 28, 105–111. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using realtime quantitative PCR and the 2(−Delta Delta C(T)) method. Methods 25, 402–408. Manvati, S., Mangalhara, K.C., Kalaiarasan, P., Srivastava, N., Bamezai, R.N., 2015. miR-24-2 regulates genes in survival pathway and demonstrates potential in reducing cellular viability in combination with docetaxel. Gene 567, 217–224. Mathew, R., Karantza-Wadsworth, V., White, E., 2007. Role of autophagy in cancer. Nat. Rev. Cancer 7, 961–967. Miller, B.C., Zhao, Z., Stephenson, L.M., Cadwell, K., Pua, H.H., Lee, H.K., Mizushima, N.N., Iwasaki, A., He, Y.W., Swat, W. and Virgin, H.W.t., 2008. The autophagy gene ATG5 plays an essential role in B lymphocyte development. Autophagy 4, 309–14. Tekirdag, K.A., Korkmaz, G., Ozturk, D.G., Agami, R., Gozuacik, D., 2013. MIR181A regulates starvation- and rapamycin-induced autophagy through targeting of ATG5. Autophagy 9, 374–385. Torre, L.A., Bray, F., Siegel, R.L., Ferlay, J., Lortet-Tieulent, J., Jemal, A., 2015. Global cancer statistics, 2012. CA Cancer J. Clin. 65, 87–108. White, E., 2012. Deconvoluting the context-dependent role for autophagy in cancer. Nat. Rev. Cancer 12, 401–410. Xu, L., Beckebaum, S., Iacob, S., Wu, G., Kaiser, G.M., Radtke, A., Liu, C., Kabar, I., Schmidt, H.H., Zhang, X., Lu, M., Cicinnati, V.R., 2014. MicroRNA-101 inhibits human hepatocellular carcinoma progression through EZH2 downregulation and increased cytostatic drug sensitivity. J. Hepatol. 60, 590–598.
Please cite this article as: Zhao, J., et al., miR-181a suppresses autophagy and sensitizes gastric cancer cells to cisplatin, Gene (2016), http:// dx.doi.org/10.1016/j.gene.2015.11.013
6
J. Zhao et al. / Gene xxx (2015) xxx–xxx
Xu, Y., Yu, H., Qin, H., Kang, J., Yu, C., Zhong, J., Su, J., Li, H., Sun, L., 2012. Inhibition of autophagy enhances cisplatin cytotoxicity through endoplasmic reticulum stress in human cervical cancer cells. Cancer Lett. 314, 232–243. Zhang, Y., Yang, W.Q., Zhu, H., Qian, Y.Y., Zhou, L., Ren, Y.J., Ren, X.C., Zhang, L., Liu, X.P., Liu, C.G., Ming, Z.J., Li, B., Chen, B., Wang, J.R., Liu, Y.B., Yang, J.M., 2014. Regulation of au-
tophagy by miR-30d impacts sensitivity of anaplastic thyroid carcinoma to cisplatin. Biochem. Pharmacol. 87, 562–570. Zhu, H., Wu, H., Liu, X., Li, B., Chen, Y., Ren, X., Liu, C.G., Yang, J.M., 2009. Regulation of autophagy by a beclin 1-targeted microRNA, miR-30a, in cancer cells. Autophagy 5, 816–823.
Please cite this article as: Zhao, J., et al., miR-181a suppresses autophagy and sensitizes gastric cancer cells to cisplatin, Gene (2016), http:// dx.doi.org/10.1016/j.gene.2015.11.013
Contents lists available at ScienceDirect
Gene journal homepage: www.elsevier.com/locate/gene
Research paper
miR-181a suppresses autophagy and sensitizes gastric cancer cells to cisplatin Jing Zhao a, Yuqiang Nie b, Hong Wang b, Yong Lin b,⁎ a
School of Public Health, Guangzhou Medical University, Xinzao, Panyu District, Guangzhou, 511436, PR China Department of Gastroenterology, Guangzhou Digestive Disease Center, Guangzhou Key Laboratory of Digestive Disease, Guangzhou First People's Hospital, Guangzhou Medical University, No. 1 Panfu Road, Guangzhou 510180, PR China
b
a r t i c l e
i n f o
Article history: Received 18 September 2015 Received in revised form 22 October 2015 Accepted 12 November 2015 Available online xxxx Keywords: miR-181a Gastric cancer ATG5 Autophagy Drug resistance
a b s t r a c t A number of chemotherapy drugs can induce autophagy. This inducible autophagy is a pro-survival mechanism and contributes to the development of acquired drug resistance. Emerging evidence indicates that miRNA regulates autophagy via targeting autophagy related genes and is involved in drug resistance. We previously demonstrated that miR-181a plays an important role in gastric cancer. The present study aimed to explore the effect of miR-181a on autophagy regulation and cisplatin resistance. We revealed that miR-181a is a novel negative regulator of autophagy in cisplatin-resistant cells SGC7901/CDDP. Then we indicated that ATG5 was a potential target of miR-181a. Furthermore, overexpression of miR-181a significantly enhanced the sensitivity of SGC7901/CDDP cells to cisplatin in vitro and reduced the volumes of gastric tumor xenografts in nude mice. Our finding provides evidence that miR-181a functions as a primary autophagy-related modulator and reverses cisplatin-resistance in GC cells. © 2015 Elsevier B.V. All rights reserved.
1. Introduction Gastric cancer (GC) is the fourth most common malignancy and the third most common cause of cancer-related death worldwide (Torre et al., 2015). Because there are no specific symptoms at the early stages when GC is surgically curable, most cases were diagnosed at an advanced stage of the disease (Cooke et al., 2013). For these patients, chemotherapy is the first-line treatment (Dicken et al., 2005). However, even though many novel chemotherapeutic drugs are used in clinical practice, chemotherapy often fail due to drug resistance (Burris, 2013). Although the mechanisms underlying drug resistance have been widely explored, the key determinants remain largely unclear. Recent reports indicate that a number of chemotherapy drugs can induce autophagy (Janku et al., 2011; An et al., 2015). This inducible autophagy is a pro-survival mechanism and contributes to the development of acquired drug resistance (Kumar et al., 2015). Hence, inhibition of autophagy may provide a new combined therapeutic strategy (Li et al., 2015). Accumulating evidences show that miRNAs are capable of modulating autophagic activity through changing intracellular levels of key autophagy proteins (Zhu et al., 2009; Chang et al., 2014). In our
Abbreviations: GC, gastric cancer; miRNA, microRNA; CDDP, cisplatin; qRT-PCR, quantitative reverse transcription PCR; DAPI, 4′-6-diamidino-2-phenylindole; IC50, halfmaximal inhibitory concentration; UTR, untranslated region; Lenti, lentivirus. ⁎ Corresponding author. E-mail address: [email protected] (Y. Lin).
previous study, based on miRNA microarray analysis, we identified that miR-181a played an important role in GC (Lin et al., 2012). However, whether miR-181a can inhibit this kind of protective autophagy and reverse drug resistance in GC remains unknown. In the present study, firstly, we demonstrated that miR-181a inhibited autophagy in cisplatin-resistant cell line SGC7901/CDDP. Then we showed that ATG5 was a potential target of miR-181a. Furthermore, we identified that miR-181a sensitized SGC7901/CDDP cells to cisplatin in vivo and in vitro. Our findings indicated that miR-181a functions as a primary autophagy-related modulator and reverses cisplatinresistance in GC cells. 2. Materials and methods 2.1. Cell culture Human gastric cancer cisplatin-resistant cell line SGC7901/CDDP was purchased from Nanjing KeyGEN BioTECH company. Cells were cultured in RPMI-1640 medium supplemented with 10% fetal bovine serum, 50 U/ml penicillin and 50 μg/ml streptomycin (both from Gibco, Carlsbad, CA, USA), 800 ng/ml cisplatin at 37 °C in humidified 5% CO2 atmosphere. 2.2. RNA extraction and quantitative reverse transcription PCR Total RNA was extracted from cell lines using Trizol (Invitrogen). Reverse transcription was done using GoScript Reverse Transcription
http://dx.doi.org/10.1016/j.gene.2015.11.013 0378-1119/© 2015 Elsevier B.V. All rights reserved.
Please cite this article as: Zhao, J., et al., miR-181a suppresses autophagy and sensitizes gastric cancer cells to cisplatin, Gene (2016), http:// dx.doi.org/10.1016/j.gene.2015.11.013
2
J. Zhao et al. / Gene xxx (2015) xxx–xxx
System (Promega, Madison, WI, USA). Quantitative PCR (QPCR) was performed using SYBR Green qPCR SuperMix (Invitrogen). 18S rRNA was used as an internal control. PCR Primers used were as follows: ATG5 forward: 5′-CAACTTGTTTCACGCTATATCAGG-3′; and reverse: 5′CACTTTGTCAGTTACCAACGTCA-3′; 18S rRNA forward: 5′-CCTGGATA CCGCAGCTAGGA-3′; and reverse: 5′-GCGGCGCAATACGAATGCCCC-3′. PCR was performed at 95 °C for 10 min, followed by 40 cycles of 95 °C for 15 s and 60 °C for 50 s. The qRT-PCR kit and protocol for miR-181a have been described in detail previously (Lin et al., 2012). QPCR was performed on ABI PRISM 7500 Sequence Detection System (Applied Biosystems, Foster City, CA, USA). The relative quantification was calculated using the 2−ΔΔCt method (Livak and Schmittgen, 2001).. 2.3. Oligonucleotide construction and transfection All the RNA Oligonucleotides were synthesized and purchased from GenePharma (Shanghai, China). Oligonucleotides sequences used were as follows: miR-181a mimic: AACAUUCAACGCUGUCGG UGAGU; miR-181a inhibitor: ACCAUCGACCGUUGAUUGUACC; negative control (NC): UUCUCCGAACGUGUCACGUTT and ACGUGACACG UUCGGAGAATT; NC inhibitor: CAGUACUUUUGUGUAGUACAA. Cells were transfected with miR-181a mimic (50 nmol/l), miR-181a inhibitor (100 nmol/l), miRNA negative control (NC) (50 nmol/l) or NC inhibitor (100 nmol/l), using Lipofectamine RNAiMAX (Invitrogen). After five-hour incubation, medium in each well was replaced by serum-containing medium. Total RNA and protein were extracted 48 h after transfection. 2.4. Western blot analysis Total proteins were extracted using Cell Lysis Reagents (Pierce, Rockford, IL, USA) and quantified using the BCA method (Pierce). Protein was separated on 10% SDS-polyacrylamide gel, and then transferred to a PVDF membrane (Amersham Biosciences, Chicago, IL, USA).
The membrane was blocked and incubated with anti-ATG5 antibody (dilution, 1:1000, Novus, Littleton, CO, USA), anti-LC3B antibody (dilution, 1:500, Sigma, St. Louis, MO, USA) or anti-GAPDH antibody (dilution, 1:2500, Abcam, Cambridge, UK) overnight at 4 °C, followed by incubation with secondary antibody (Dako, Glostrup, Denmark) for 50 min at room temperature. The membranes were developed using ECL kit (Pierce) and exposed to X-ray film to visualize the images. The GAPDH gene was used as an internal control. The band intensity was analyzed using Gel-Pro Analyzer software (Version 4.0, Media Cybernetics, LP, USA). 2.5. GFP-LC3 analysis Cells were transfected with pSELECT-GFP-LC3 (InvivoGen, San Diego, CA) using Lipofectamine reagent (Invitrogen) following the manufacturer's instructions. Cells were fixed with 4% paraformaldehyde in PBS after the treatments. Nuclei were counterstained with DAPI (blue). Images were obtained by confocal microscope (Olympus FV 1000). Cells with five or more intense GFP-LC3 puncta were considered autophagic, whereas those with diffuse cytoplasmic GFP-LC3 staining were considered non-autophagic. The percentage of GFP-LC3 positive cells were counted in at least 100 cells. 2.6. Transmission electron microscopy Cells harvested by trypsinization were fixed in 2.5% gluteraldehyde in 0.1 M sodium phosphate buffer, and then post-fixed in 1% osmium tetroxide buffer. After dehydration in a graded series of ethanol and acetone, the cells were embedded in Spurr resin, cut into 50 nm sections and stained with 3% uranyl acetate and lead citrate. Images were generated using AMT camera system on JEOL JEM 100CX transmission electron microscope at 20000 ×. Autophagic vacuoles per cell were determined by counting 10 cells for each sample.
Fig. 1. miR-181a regulated autophagy in SGC7901/CDDP cells. A) Twenty-four hours after cotransfection of miRNA and GFP-LC3 plasmid, autophagic activities were observed using confocal microscope. Cells with five or more intense GFP-LC3 puncta were considered autophagic, whereas those with diffuse cytoplasmic GFP-LC3 staining were considered non-autophagic. B) Quantitative analysis of the GFP-LC3 positive cells percentage. Overexpression of miR-181a reduced autophagy, whereas inhibition of miR-181a induced autophagy. C) Transmission electron microscopy analysis of autophagy in cells treated as indicated. Arrows indicate autophagic vacuoles. D) Quantitative analysis of the autophagic vacuoles per cell. The results represent means ± SD for three independent experiments. *p b 0.05. E) Western blot results of cells treated as indicated. LC3Ⅱ/ LC3Ⅰ densitometric ratios were indicated. GAPDH was used as a loading control. Untreated cell group was assigned as the reference group.
Please cite this article as: Zhao, J., et al., miR-181a suppresses autophagy and sensitizes gastric cancer cells to cisplatin, Gene (2016), http:// dx.doi.org/10.1016/j.gene.2015.11.013
J. Zhao et al. / Gene xxx (2015) xxx–xxx
2.7. MTS assay For half-maximal inhibitory concentration (IC50), 24 h after transfection, cells were trypsinized and seeded into 96-well plates at a density of 1 × 104 cells/well. The medium, which contained cisplatin at different concentrations, was added to each well. After 24 h, MTS (cellTiter 96 AQ, Promega, Madison, WI) assay was performed following the manufacturer's protocol, and the absorption was read at 490 nm. The concentration at which each drug produced IC50 was then calculated. 2.8. Animal xenograft model The animal study was performed in strict accordance with the recommendations in the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health. Protocols were reviewed and consented by the Ethics Committee of Guangzhou Medical University. For in vivo experiments, the lentivirus expressing miR181a (lenti-miR-181a) and lenti-miR-NC vectors were constructed by Land Biology Technology Company (Guangzhou, China). Four female BALB/c nude mice (5 weeks old) were separately injected with 5 × 10 6 SGC7901/CDDP cells stably transfected with lentimiR-181a or lenti-miR-NC in right and left flanks. After 2 weeks, the mice were intraperitoneally injected with PBS containing cisplatin (10 mg/kg) once per week. Tumor volumes were determined by measuring the length (L) and the width (W) of the tumors and calculating using the formula: V = LW2/2. The mice were euthanized on day 28, and the tumors were dissected out and photographed, then specimens were submitted to western blot analysis.
3
(*p b 0.05). All together, these findings suggest that miR-181a is a negative regulator of autophagy.
3.2. miR-181a inhibits ATG5 expression in SGC7901/CDDP cells To search for potential autophagy related target genes of miR-181a, four online algorithms, including TargetScan (Lewis et al., 2003), miRanda (Betel et al., 2008), PITA (Kertesz et al., 2007) and PicTar (Krek et al., 2005), were used. ATG5 was identified as a miR-181a target by all these four target prediction algorithms. The predicted interaction between miR-181a and ATG5 3′UTR was shown in Fig. 2A. There are two miR-181a binding sites in the 3′UTR of ATG5. ATG5 is essential for autophagosome formation. Loss of ATG5 results in defective autophagy (Miller et al., 2008). To further confirm the bioinformatics predictions, qRT-PCR and western blot analysis were performed in SGC7901/CDDP cells. As shown in Fig. 2B–C, transfection of miR-181a mimic led to a significant decrease in ATG5 mRNA and protein levels, whereas inhibition of endogenous miR-181a notably increased the levels of ATG5 mRNA and protein, when compared with their respective controls (*p b 0.05). In addition, precursor study has verified that miR-181a can directly target 3′ untranslated region (UTR) of ATG5 and suppress the expression of ATG5 by dual-luciferase assays in HEK-293T cells (Tekirdag et al., 2013). Collectively, these data provide evidence that miR-181a regulates autophagy through targeting of ATG5.
2.9. Statistical analysis Differences between two groups were analyzed by Student's t-test. Data were represented as means ± SD from three independent experiments. Statistical tests were two-sided, and a p b 0.05 was considered statistically significant using SPSS 17.0 (SPSS, Chicago, IL). 3. Results 3.1. miR-181a regulates autophagy in SGC7901/CDDP cells Emerging evidence indicates that miRNA regulates autophagy via targeting autophagy related genes, and is subsequently involved in chemotherapy drug resistance. Hence, we firstly tested the effect of miR181a on autophagy in cisplatin-resistant cells SGC7901/CDDP. Autophagy was determined by observing the redistribution of GFP-LC3 from a diffuse to a punctate pattern under confocal microscope, or by evaluating the double membrane vacuoles using transmission electron microscope, or by assessing the conversion of endogenous LC3 protein from the cytosolic LC3I to the autophagosome associated LC3II via western blot. As shown in Fig. 1A–D, the untreated SGC7901/CDDP cells exhibited basic autophagic activity as evidenced by the GFP-LC3 punctate and the double membrane vacuoles in the cytoplasm. After transfection of miR-181a mimic, the autophagic activity was significantly decreased (*p b 0.05). GFP-LC3 was observed predominantly as diffuse green fluorescence in the cytoplasm, indicating low autophagic activity. In addition, the autolysosomes detected by transmission electron microscope were fewer than that in miR-NC control group. This phenomenon was also confirmed by immunoblot analysis (Fig. 1E). The LC3II was attenuated after overexpression of miR-181a. To further demonstrate the effect of endogenous miR-181a inhibition on autophagy, we transfected cells with miR-181a inhibitor or miR-NC inhibitor. Results showed that cells treated with miR-181a inhibitor exhibited significantly higher percentage of GFP-LC3 dot accumulation, double membrane vacuoles and LC3II conversion than cells transfected with miR-NC inhibitor
Fig. 2. miR-181a affected ATG5 expression in SGC7901/CDDP cells. A) Schematic representation of the interaction of miR-181a and the 3′UTR of ATG5 based on miRanda software prediction. B) qRT-PCR analysis of ATG5 mRNA levels in cells treated as indicated. ATG5 were normalized to 18S rRNA. The results represent the means ± SD for three independent experiments. *p b 0.05. C) Western blots showing the expression of ATG5 protein in cells treated as indicated. Data were normalized to GAPDH. Untreated cell group was set as the reference group.
Please cite this article as: Zhao, J., et al., miR-181a suppresses autophagy and sensitizes gastric cancer cells to cisplatin, Gene (2016), http:// dx.doi.org/10.1016/j.gene.2015.11.013
4
J. Zhao et al. / Gene xxx (2015) xxx–xxx
indicated that overexpression of miR-181a dramatically enhanced the sensitivity of SGC7901/CDDP cells to cisplatin. The IC50 value dropped from 11.13 μg/ml to 3.3 μg/ml (*p b 0.05), which indicated that the viability of miR-181a mimic transfected cells was significantly inhibited, compared with the untreated cells.
3.4. Overexpression of miR-181a increases cisplatin sensitivity of SGC7901/ CDDP cells in vivo Fig. 3. Overexpressed miR-181a sensitized SGC7901/CDDP cells to cisplatin. The results represent the means ± SD for three independent experiments. *p b 0.05.
3.3. miR-181a mimic sensitizes SGC7901/CDDP cells to cisplatin in vitro A number of chemotherapy drugs can induce autophagy. This inducible autophagy seems to serve as a cancer pro-survival mechanism. We hypothesized that inhibition of this kind of protective autophagy might reverse drug resistance. Since our previous data suggested that miR181a mimic was able to suppress autophagy in SGC7901/CDDP cells, here we evaluated the effect of miR-181a on cisplatin-induced cell death. MTS assays were performed to identify IC50 of cisplatin. Fig. 3
To preliminary investigate whether miR-181a also chemosensitized GC cells in vivo, we transfected SGC7901/CDDP cells with lenti-miR181a or lenti-miR-NC, then transplanted SGC7901/CDDP-lenti-miR181a and SGC7901/CDDP-lenti-miR-NC cells into the right and left side of the nude mice respectively. Two weeks later, the tumorbearing mice were treated with cisplatin. As shown in Fig. 4A–B, the volumes of the miR-181a transfected tumors were markedly decreased after chemotherapy, which indicated the reversion of drug resistance by ectopic miR-181a expression. The in vivo results were consistent with the in vitro findings. Moreover, western blot analysis of tumor tissues revealed that there was less conversion from LC3I to the lipidated LC3II in lenti-miR-181a group then that in control group (*p b 0.05). Meanwhile, ATG5 protein levels were decreased in lenti-miR-181a
Fig. 4. Overexpression of miR-181a increased cisplatin sensitivity of SGC7901/CDDP cells in vivo. A-B) SGC7901/CDDP-lenti-miR-NC and SGC7901/CDDP-lenti-miR-181a transfected cells were transplanted into the left and right side of the mice, respectively. Two weeks later, the tumor-bearing mice were treated with cisplatin. Tumor specimens were dissected on day 28. The tumor volumes decreased in lenti-miR-181a group after chemotherapy. C-E) Western blots analysis of LC3 and ATG5 protein levels in tumor specimens of the four mice. Less conversion from LC3Ⅰ to LC3Ⅱ and ATG5 protein levels in lenti-miR-181a group, indicating low autophagic activity. The results represent the means ± SD for three independent experiments. *p b 0.05.
Please cite this article as: Zhao, J., et al., miR-181a suppresses autophagy and sensitizes gastric cancer cells to cisplatin, Gene (2016), http:// dx.doi.org/10.1016/j.gene.2015.11.013
J. Zhao et al. / Gene xxx (2015) xxx–xxx
group, indicating that the chemosensitizing effects of miR-181a were partially associated with autophagy inhibition (Fig. 4C–E).
4. Discussion Chemotherapy drug resistance remains a major obstacle to the clinical management of GC, resulting in relapse and metastasis of cancer. Hence, exploring novel strategy to overcome drug resistance is currently under intense investigation. Autophagy is a cellular degradation pathway for the clearance of damaged or superfluous proteins and organelles. The role of autophagy in cancer is a double-edged sword (Mathew et al., 2007). Although some reports show that autophagy seems to induce autophagic cell death (Das et al., 2012), most studies considered autophagy as a cell survival mechanism (White, 2012; (Kuo et al., 2014). Therefore, inhibition of autophagy provides a new combined therapeutic strategy for modulation of chemosensitivity of cancer. In addition, it has been reported that inhibition of autophagy using 3-methyladenine or chloroquine augmented cisplatin cytotoxicity and improved chemotherapy (Liu et al., 2011; Xu et al., 2012). Also, inhibition of autophagy by silencing autophagy-associated gene, such as beclin 1, significantly improved therapy efficiency of conventional chemotherapeutics (Guo et al., 2012). Meanwhile, it is widely acknowledged that miRNAs played key roles in posttranscriptional regulation mainly by pairing to the 3′UTR of target mRNA (Brodersen and Voinnet, 2009). Recent reports indicate that miRNAs are involved in modulating autophagic activity through targeting key autophagy genes. Zhu et al. revealed that miR-30a negatively regulated beclin 1 expression resulting in decreased autophagic activity (Zhu et al., 2009). Tekirdag et al. showed that overexpression of miR-181a resulted in the attenuation of starvation- and rapamycin-induced autophagy in MCF-7, Huh-7 and K562 cells. Moreover, inhibition of endogenous miR-181a stimulated autophagy. They also identified ATG5 as an miR181a target (Tekirdag et al., 2013). Consistent with this report, our results demonstrated that miR-181a served as a negative regulator of autophagy. Artificial overexpression of miR-181a effectively reduced autophagy, whereas inhibition of endogenous miR-181a led to a further stimulation of autophagic activity in SGC7901/CDDP cells. These data indicate that miR-181a is an important regulator of autophagy. Increasing evidence has suggested that miRNA can potentially improve the effectiveness of chemotherapeutic regimes (Kim et al., 2015; Manvati et al., 2015). Overexpression of miR-101 suppresses autophagy and enhances chemosensitivity both in osteosarcoma and hepatocellular carcinoma (Chang et al., 2014; Xu et al., 2014). Dysregulation of miR-30d in anaplastic thyroid carcinoma (ATC) is responsible for the insensitivity to cisplatin by promoting autophagic survival. Thus, introduction of miR-30d mimic sensitized ATC cells to cisplatin both in vitro and in vivo (Zhang et al., 2014). Upregulated miR-23b-3p inhibits autophagy mediated by ATG12 and HMGB2, and sensitizes GC cells to chemotherapy (An et al., 2015). In line with these results, our observation revealed that transfection of miR-181a mimic dramatically decreased the IC50 of cisplatin and enhanced the sensitivity of SGC7901/CDDP cells to cisplatin. We further validated the function of miR-181a in a xenograft tumor model, showing that miR-181a also regulated cisplatin resistance in vivo. Our data suggests that miR-181a may be exploited as a novel approach to reinforce the efficacy of chemotherapeutic drugs such as cisplatin in GC. However, due to the small number of animals, interpreting this finding should be cautious. In summary, our work identified miR-181a as a novel autophagy regulating miRNA. Inhibition of autophagy by miR-181a overexpression potentiated the toxicity of the cisplatin and reversed drug resistance. These findings may help understand the potential molecular mechanisms underlying chemotherapy drug resistance, and may provide evidence for a novel combined therapeutic strategy to overcome drug resistance in GC.
5
Author contributions Conceived and designed the experiments: YL, JZ. Performed the experiments: YL, JZ, YQN and HW. Analyzed the data: YL, JZ. Contributed reagents/materials/analysis tools: YQN, HW. Contributed to the writing of the manuscript: YL and JZ. Acknowledgment This work was supported by the National Nature Science Foundation of China (No. 81302078). References An, Y., Zhang, Z., Shang, Y., Jiang, X., Dong, J., Yu, P., Nie, Y., Zhao, Q., 2015. miR-23b-3p regulates the chemoresistance of gastric cancer cells by targeting ATG12 and HMGB2. Cell Death Dis. 6, e1766. Betel, D., Wilson, M., Gabow, A., Marks, D.S., Sander, C., 2008. The microRNA.org resource: targets and expression. Nucleic Acids Res. 36, D149–D153. Brodersen, P., Voinnet, O., 2009. Revisiting the principles of microRNA target recognition and mode of action. Nat. Rev. Mol. Cell Biol. 10, 141–148. Burris III, H.A., 2013. Overcoming acquired resistance to anticancer therapy: focus on the PI3K/AKT/mTOR pathway. Cancer Chemother. Pharmacol. 71, 829–842. Chang, Z., Huo, L., Li, K., Wu, Y., Hu, Z., 2014. Blocked autophagy by miR-101 enhances osteosarcoma cell chemosensitivity in vitro. ScientificWorldJournal 2014, 794756. Cooke, C.L., Torres, J., Solnick, J.V., 2013. Biomarkers of Helicobacter pylori-associated gastric cancer. Gut Microbes 4, 532–540. Das, G., Shravage, B.V., Baehrecke, E.H., 2012. Regulation and function of autophagy during cell survival and cell death. Cold Spring Harb. Perspect. Biol. 4. Dicken, B.J., Bigam, D.L., Cass, C., Mackey, J.R., Joy, A.A., Hamilton, S.M., 2005. Gastric adenocarcinoma: review and considerations for future directions. Ann. Surg. 241, 27–39. Guo, X.L., Li, D., Hu, F., Song, J.R., Zhang, S.S., Deng, W.J., Sun, K., Zhao, Q.D., Xie, X.Q., Song, Y.J., Wu, M.C., Wei, L.X., 2012. Targeting autophagy potentiates chemotherapyinduced apoptosis and proliferation inhibition in hepatocarcinoma cells. Cancer Lett. 320, 171–179. Janku, F., McConkey, D.J., Hong, D.S., Kurzrock, R., 2011. Autophagy as a target for anticancer therapy. Nat. Rev. Clin. Oncol. 8, 528–539. Kertesz, M., Iovino, N., Unnerstall, U., Gaul, U., Segal, E., 2007. The role of site accessibility in microRNA target recognition. Nat. Genet. 39, 1278–1284. Kim, J., Jeong, D., Nam, J., Aung, T.N., Gim, J.A., Park, K.U., Kim, S.W., 2015. MicroRNA-124 regulates glucocorticoid sensitivity by targeting phosphodiesterase 4B in diffuse large B cell lymphoma. Gene 558, 173–180. Krek, A., Grun, D., Poy, M.N., Wolf, R., Rosenberg, L., Epstein, E.J., MacMenamin, P., da Piedade, I., Gunsalus, K.C., Stoffel, M., Rajewsky, N., 2005. Combinatorial microRNA target predictions. Nat. Genet. 37, 495–500. Kumar, A., Singh, U.K., Chaudhary, A., 2015. Targeting autophagy to overcome drug resistance in cancer therapy. Future Med. Chem. 7, 1535–1542. Kuo, Y.Z., Tai, Y.H., Lo, H.I., Chen, Y.L., Cheng, H.C., Fang, W.Y., Lin, S.H., Yang, C.L., Tsai, S.T., Wu, L.W., 2014. MiR-99a exerts anti-metastasis through inhibiting myotubularinrelated protein 3 expression in oral cancer. Oral Dis. 20, e65–e75. Lewis, B.P., Shih, I.H., Jones-Rhoades, M.W., Bartel, D.P., Burge, C.B., 2003. Prediction of mammalian microRNA targets. Cell 115, 787–798. Li, S., Wang, L., Hu, Y., Sheng, R., 2015. Autophagy regulators as potential cancer therapeutic agents: a review. Curr. Top. Med. Chem. 15, 720–744. Lin, Y., Nie, Y., Zhao, J., Chen, X., Ye, M., Li, Y., Du, Y., Cao, J., Shen, B., Li, Y., 2012. Genetic polymorphism at miR-181a binding site contributes to gastric cancer susceptibility. Carcinogenesis 33, 2377–2383. Liu, D., Yang, Y., Liu, Q., Wang, J., 2011. Inhibition of autophagy by 3-MA potentiates cisplatin-induced apoptosis in esophageal squamous cell carcinoma cells. Med. Oncol. 28, 105–111. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using realtime quantitative PCR and the 2(−Delta Delta C(T)) method. Methods 25, 402–408. Manvati, S., Mangalhara, K.C., Kalaiarasan, P., Srivastava, N., Bamezai, R.N., 2015. miR-24-2 regulates genes in survival pathway and demonstrates potential in reducing cellular viability in combination with docetaxel. Gene 567, 217–224. Mathew, R., Karantza-Wadsworth, V., White, E., 2007. Role of autophagy in cancer. Nat. Rev. Cancer 7, 961–967. Miller, B.C., Zhao, Z., Stephenson, L.M., Cadwell, K., Pua, H.H., Lee, H.K., Mizushima, N.N., Iwasaki, A., He, Y.W., Swat, W. and Virgin, H.W.t., 2008. The autophagy gene ATG5 plays an essential role in B lymphocyte development. Autophagy 4, 309–14. Tekirdag, K.A., Korkmaz, G., Ozturk, D.G., Agami, R., Gozuacik, D., 2013. MIR181A regulates starvation- and rapamycin-induced autophagy through targeting of ATG5. Autophagy 9, 374–385. Torre, L.A., Bray, F., Siegel, R.L., Ferlay, J., Lortet-Tieulent, J., Jemal, A., 2015. Global cancer statistics, 2012. CA Cancer J. Clin. 65, 87–108. White, E., 2012. Deconvoluting the context-dependent role for autophagy in cancer. Nat. Rev. Cancer 12, 401–410. Xu, L., Beckebaum, S., Iacob, S., Wu, G., Kaiser, G.M., Radtke, A., Liu, C., Kabar, I., Schmidt, H.H., Zhang, X., Lu, M., Cicinnati, V.R., 2014. MicroRNA-101 inhibits human hepatocellular carcinoma progression through EZH2 downregulation and increased cytostatic drug sensitivity. J. Hepatol. 60, 590–598.
Please cite this article as: Zhao, J., et al., miR-181a suppresses autophagy and sensitizes gastric cancer cells to cisplatin, Gene (2016), http:// dx.doi.org/10.1016/j.gene.2015.11.013
6
J. Zhao et al. / Gene xxx (2015) xxx–xxx
Xu, Y., Yu, H., Qin, H., Kang, J., Yu, C., Zhong, J., Su, J., Li, H., Sun, L., 2012. Inhibition of autophagy enhances cisplatin cytotoxicity through endoplasmic reticulum stress in human cervical cancer cells. Cancer Lett. 314, 232–243. Zhang, Y., Yang, W.Q., Zhu, H., Qian, Y.Y., Zhou, L., Ren, Y.J., Ren, X.C., Zhang, L., Liu, X.P., Liu, C.G., Ming, Z.J., Li, B., Chen, B., Wang, J.R., Liu, Y.B., Yang, J.M., 2014. Regulation of au-
tophagy by miR-30d impacts sensitivity of anaplastic thyroid carcinoma to cisplatin. Biochem. Pharmacol. 87, 562–570. Zhu, H., Wu, H., Liu, X., Li, B., Chen, Y., Ren, X., Liu, C.G., Yang, J.M., 2009. Regulation of autophagy by a beclin 1-targeted microRNA, miR-30a, in cancer cells. Autophagy 5, 816–823.
Please cite this article as: Zhao, J., et al., miR-181a suppresses autophagy and sensitizes gastric cancer cells to cisplatin, Gene (2016), http:// dx.doi.org/10.1016/j.gene.2015.11.013