Mismatch Repair Blocks Expansions of Interrupted Trinucleotide Repeats in Yeast

Molecular Cell, Vol. 6, 1501–1507, December, 2000, Copyright 2000 by Cell Press

Mismatch Repair Blocks Expansions of Interrupted Trinucleotide Repeats in Yeast Michael L. Rolfsmeier,*§ Michael J. Dixon,*† and Robert S. Lahue*†‡ * Eppley Institute for Research in Cancer and Allied Diseases † Department of Pathology and Microbiology University of Nebraska Medical Center Omaha, Nebraska 68198-6805

Summary Disease-causing expansions of trinucleotide repeats (TNRs) can occur very frequently. In contrast, expansions are rare if the TNR is interrupted (imperfect). The molecular mechanism stabilizing interrupted alleles and thereby preventing disease has been elusive. We show that mismatch repair is the major stabilizing force for interrupted TNRs in Saccharomyces cerevisiae. Interrupted alleles expand much more often when mismatch repair is blocked by mutation or by poorly corrected mispairs. These results suggest that interruptions lead to mismatched expansion precursors. In normal cells, expansions are prevented in trans by mismatch repair, which coexcises the mismatches plus the aberrant, TNR-mediated secondary structure that otherwise resists removal. This study indicates a novel role for mismatch repair in mutation avoidance and, potentially, in disease prevention. Introduction The unusual instability of trinucleotide repeats (TNRs) forms the genetic basis for at least 14 hereditary diseases (Cummings and Zoghbi, 2000). Expansions of TNRs to longer than normal lengths interfere with gene function or expression, usually leading to premature cell death in key tissues. The frequencies of TNR expansions can be very high, approaching unity in some cases (Paulson and Fischbeck, 1996). These high frequencies indicate that mutation avoidance pathways such as DNA repair are ineffective at blocking expansions. The key element in inhibiting repair is very likely TNR-mediated, aberrant DNA secondary structure (McMurray, 1999). Nearly all TNR sequences that expand form stable DNA hairpins in vitro (Gacy et al., 1995; Mitas, 1997), and these structures defeat DNA repair components both in vitro (Spiro et al., 1999; Henricksen et al., 2000) and in vivo (Moore et al., 1999). Formation of hairpins is highly dependent on TNR sequence, and those sequences which expand most frequently in human families form many of the strongest secondary structures (Gacy et al., 1995; Mitas, 1997). The ability to inhibit DNA repair also correlates strongly with structure-forming capacity (Spiro et al., 1999). Invoking localized secondary struc‡ To whom correspondence should be addressed (e-mail: rlahue@

unmc.edu). § Present address: University of California, Davis, Division of Biological Sciences, Section of Microbiology, Davis, California 95616.

ture helps explain why TNR expansions occur in a sitespecific manner as opposed to the genome-wide instability that occurs when DNA repair processes are defective. An important exception to the high frequency of TNR expansions occurs in at least three human genes. In these cases, the risk of disease-causing expansions is substantially reduced by one to three base substitutions that interrupt the repeat tract. The SCA1 locus contains CAT interruptions in a CAG tract (Chung et al., 1993; Pearson et al., 1998), the CGG tract of the fragile X syndrome gene FMR1 is punctuated with AGGs (Eichler et al., 1994; Kunst and Warren, 1994; Snow et al., 1994; Pearson et al., 1998), and CAAs are dispersed through the CAG tract of SCA2 (Pulst et al., 1996). Most normal, genetically stable alleles of these genes contain interruptions, whereas expanded alleles have fewer or no interruptions. The strong correlation between stability and interruptions underscores their genetic and medical importance. Several models have been proposed to account for the stabilizing influence of interruptions by action in cis (Richards and Sutherland, 1992; Eichler et al., 1994; Snow et al., 1994; Gacy et al., 1995; Pulst et al., 1996; Pearson et al., 1998). For example, interruptions might reduce base pairing of TNR hairpins (Gacy et al., 1995; Pulst et al., 1996), perhaps making it easier to unfold them. However, it has been difficult to assess these models due to the paucity of human cases where expansions arise from an interrupted allele. This paper addresses the possibility that stabilization occurs primarily in trans. Our hypothesis is that DNA repair is more effective at preventing expansions of interrupted alleles than for perfect alleles. Since TNR hairpins occur by intramolecular folding, each interruption would create a mismatch instead of a G-C base pair (Gacy et al., 1995; Pulst et al., 1996; Pearson et al., 1998). Pearson et al. (1998) suggested that mismatch repair might stabilize interrupted alleles, but possibly as a secondary mechanism relative to effects in cis. Therefore, it was reasonable to examine mismatch repair as a stabilizing mechanism for interruptions. Results and Discussion Mismatch Repair Mutants Fail to Stabilize Interrupted TNRs To help understand stabilization of interrupted TNRs, we took advantage of a sensitive yeast genetic system (Miret et al., 1998) to detect and characterize expansions (Figure 1A). Increases in tract size, from starting alleles of 25 repeats to final sizes of ⱖ30 repeats, change the phenotype of the cells and can be directly selected. This assay allows us to focus on expansions of ⱖ5 repeats, which are among the most frequent events in the polyglutamine class of TNR diseases (Paulson and Fischbeck, 1996). One benefit of the yeast system is that expansions from interrupted alleles, even if rare, can be identified and analyzed. Using this assay, we previously showed (Rolfsmeier and Lahue, 2000) up to 90-fold sta-

Molecular Cell 1502

bilization of an interrupted repeat relative to an uninterrupted control (Figure 1B, perfect repeat and ATGATG interrupted allele). For comparison, CTA repeats, which do not form strong hairpins, expand about 1000-fold less often than perfect CTG tracts in our assay (Miret et al., 1998). To test whether mismatch repair stabilizes interrupted TNRs, the behavior of perfect repeats and several interrupted alleles (Figure 1B) was examined in wild type and mismatch repair mutants. Mismatch repair defects had little influence on the rate of expansions from perfect CTG repeats (Figure 1C). In contrast, most of the stabilization of interrupted TNRs was lost in msh2 or pms1 mismatch repair mutants. Although wild-type cells stabilized the ATGATG interrupted allele by 90-fold, pms1 and msh2 mutants failed to stabilize this sequence. Expansion rates in these mutants were 17- to 27-fold higher than wild type. Loss of either essential mismatch repair gene results in substantial destabilization. In msh3 and msh6 mutants, there was partial stabilization (Figure 1C). The milder defect for msh3 or msh6 mutants than msh2 mutants is consistent with findings that Msh3p and Msh6p function as heterodimers with Msh2p and display overlapping mismatch recognition spectra (Marsischky et al., 1996). Destabilization was also observed for another interruption, the central ATGATG allele, in msh2 and msh3 backgrounds. Again, the msh2 defect was the stronger of the two. The loss of stabilization in four mismatch repair mutants and at two interrupted alleles indicates the general nature of these observations.

Figure 1. Stabilization of Interrupted Alleles by Mismatch Repair Assay for TNR expansions (Miret et al., 1998) and alleles tested. (A) The region controlling expression of the reporter gene URA3 is shown, including the TATA box, the TNR region, an out-of-frame initiation codon, the preferred transcription initiation site (I), and the start of the URA3 gene. The upper diagram demonstrates the starting construct. The brackets represent a window of potential transcription initiation sites located 55–125 base pairs from the TATA box. With a 25 TNR tract, the transcription window includes the preferred site I, thus leading to expression of URA3 and making the yeast 5FOA sensitive. The lower diagram demonstrates what happens when the TNR tract expands to ⱖ30 repeats. The bracketed window does not include site I. Transcription initiating 5⬘ of the preferred initiation site will include the out-of-frame ATG, resulting in translational incompetence and, therefore, resistance to 5FOA. (B) The TNR sequences used for this study are shown. Nomenclature is that of the lagging daughter strand. The ATGATG and ATG test sequences are similar to interrupted alleles of SCA1, many of which contain 1–3 CAT interruptions of CAG repeats, resulting in total tract lengths equal to 23–36 repeats (Chung et al., 1993). The complementary strand in SCA1 therefore harbors ATG interruptions in a CTG tract. If ATG interruptions stabilize CTG tracts in yeast as in humans, the rate of expansion should be reduced relative to an uninterrupted control. The importance of the CTCCTC-interrupted allele is explained in the text. (C) Expansion rates are expressed as events per cell generation ⫻ 10⫺5. All values shown are the average of two to four independent measurements. Rates are typically accurate to within 2-fold, based on measurements of the standard deviations. WT refers to the wildtype parental strain. Fold stabilization refers to the ratio of the expansion rate of the perfect repeat allele divided by the expansion rate for the test situation. Rates for the perfect repeat in wild-type and

A Coexcision Model for Stabilization A molecular model to explain the stabilization of interrupted repeats by mismatch repair is shown in Figure 2A. The key feature of the model is that mismatch repair recognizes mismatches in hairpins, which are believed to be the crucial intermediates in most TNR expansions (McMurray, 1999). The mismatches arise from noncomplementarity due to the interruptions (Figure 2B). Mismatch repair–dependent excision, utilizing the nearby DNA terminus as an entry point (Figure 2A), excises the hairpin that is otherwise highly resistant to correction (Moore et al., 1999; Spiro et al., 1999; Henricksen et al., 2000). Resynthesis then replicates the repeat tract, leading to no expansion. In mismatch repair mutants, excision would not occur, and expansions would result. This model, therefore, provides a simple coexcision mechanism for stabilization of interrupted TNRs. Although one study indicates difficulties in repairing mismatches within perfect, non-TNR hairpins during yeast meiosis (Nag and Kurst, 1997), our rate results (Figure 1C) suggest that mismatched hairpins are removed up to 95% of the time in vegetatively growing cells. Our model also allows for a contribution to stability by mismatch repair–independent stabilization. As suggested previously (Gacy et al., 1995; Pulst et al., 1996; Pearson et al., 1998), mismatched hairpins are predicted

msh2 strains were taken from Miret et al. (1998). Rates for ATGATG and central ATGATG in wild type were taken from Rolfsmeier and Lahue (2000).

Mismatch Repair Stabilizes Interrupted Triplets 1503

Figure 2. A Coexcision Model for Stabilization (A) A model for stabilization of interrupted repeats. Open rectangles represent nonrepetitive flanking sequence, the lines denote the TNR, the filled circles symbolize the interruptions, arrowheads mark the 3⬘ end of the Okazaki fragment, and carats represent mismatches. The model is described in detail in the text. (B) Possible mispaired hairpin structures. Watson-Crick pairs are denoted by a hyphen. The T nucleotides in the stem are intrahelical and form single H-bond wobble pairs, based on in vitro analysis of CTG repeats (Gacy et al., 1995; Mitas, 1997). Note that the ATGATG interruption generates two A-G mispairs separated by two base pairs. Another possible structure for this sequence is a four-base bubble in which the presence of the mispairs destabilizes the intervening base pairs. The ATG interruption yields a single A-G mispair, whereas the CTCCTC yields two C-C mismatches. (C) 3⬘ additions and duplications were determined by molecular analysis of the expanded TNR in 5FOAR colonies. PCR products, either undigested or cleaved with SfaNI (for ATG-containing interruptions) or with BseRI (for CTC-containing interruptions), were analyzed on sequencing gels as described (Rolfsmeier and Lahue, 2000). Data for ATGATG in wild type were taken from Rolfsmeier and Lahue (2000).

to be energetically weakened and to unfold more readily. The first two steps (Figure 2A) could be reversed more readily when interruptions are present, allowing correct reannealing of the strand and/or access for repair proteins. The results in Figure 1C indicate a 3- to 5-fold stabilization of the interrupted alleles in pms1 and msh2 strains, consistent with a small mismatch repair–independent contribution to stabilization. In addition to the experimental support for coexcision of mispairs and hairpins by mismatch repair, precedents for coexcision events are well established in the recombination literature. For example, placement of a poorly repaired mismatch (a non-TNR hairpin) near a wellrepaired mismatch leads to efficient correction of both alleles during meiotic recombination in yeast (Detloff and Petes, 1992). We also note that simple variations of our model apply to other potential sources of TNR expansions. All models for TNR expansions include a step of error-prone DNA synthesis, whether arising from replication (Gordenin et al., 1997; Freudenreich et al., 1998), unequal gene conversion (Jakupciak and Wells, 1999), or double-strand break repair (Richard et al., 2000). In the case of replication errors, hairpin formation could occur either by 5⬘ flap formation (Gordenin et al., 1997) or by 3⬘ strand slippage (Richards and Sutherland, 1994). Coexcision of the mismatches and the hairpin would block expansions by any of the general models for instability. We favor the excision model over a simple unwinding model in which mismatch repair proteins recruit a helicase to unwind the hairpin. Unwinding in the absence of associated nuclease activity would only prevent expansion if the unwound strand could reanneal properly to its complementary sequence. In the 5⬘ flap model (Gordenin et al., 1997), for example, reannealing is not possible because the complementary strand has already been replicated. Thus, the unwound TNR sequence would have no single-strand partner for reannealing. While simple unwinding cannot be excluded as a possibility, we find the coexcision model more plausible. Perfect CTG repeats fold into hairpins with apposition of T residues (Figure 2B), so it might seem that mismatch repair would also act on perfect repeats. However, structural studies of TNRs (Gacy et al., 1995; Mitas, 1997) showed that the T bases are stacked within the hairpin and form wobble H-bonds. Perhaps this stacking helps hairpins from perfect CTG repeats escape mismatch repair. While our control experiments are quite clear on the lack of a mismatch repair effect on perfect repeats (Figure 1C), we emphasize that our assay detects expansions of five repeats or more (Figure 1A). Variations of one to four repeats are known to occur in yeast mismatch repair mutants (Schweitzer and Livingston, 1997), but our system is focused on larger expansions. Meiotic recombination studies in yeast (Detloff and Petes, 1992; Moore et al., 1999) show that hairpins arising from CTG/ CAG repeats and from nonrepeating palindromes are similarly resistant to repair, which also suggests an inability of mismatch repair to recognize TNR hairpins. Mispair Number and Composition Influence Stabilization Additional experiments provide further support for the role of mismatch repair in stabilization. If two interrup-

Molecular Cell 1504

tions lead to two mismatches in the hairpin, a single interruption should create one mispair, and therefore, expansions would be inhibited by mismatch repair (Figure 2B). Figure 1C shows a 7.7-fold stabilization for the single ATG-interrupted repeat relative to the perfect tract, and nearly all of this stabilization is lost in an msh2 background. In wild-type cells, the lower level of stabilization compared to the double interruption (7.7fold compared to 90-fold) suggests that a hairpin with one mismatch is less well repaired than a hairpin with two. In the mismatch repair mutant, the single interruption also shows a lower level of stabilization than the doubly interrupted allele (1.7-fold versus 3.3- and 5.3fold), consistent with the idea that one mismatch would not weaken a hairpin as much as two. The putative mismatch structure of the double ATGATG interruption (Figure 2B) suggests a possible explanation for why msh3 and msh6 mutants each give partial defects in stabilization. As drawn, the double mispair would presumably be a target for recognition by the Msh2p/Msh6p heterodimer. Perhaps the presence of two closely spaced mispairs promotes localized opening to a fourbase “bubble” structure that might be recognized by the alternate heterodimer Msh2p/Msh3p. If there are two structural forms of the mismatched hairpin, then stabilization might require MSH6 function some of the time and MSH3 function at other times. The substrate specificity of mismatch repair also indicates that the nature of the mispairs is important. Since C-C mismatches are poor substrates for mismatch repair in yeast (Kramer et al., 1989; Detloff et al., 1991), we tested a CTCCTC interruption that yields C-C mispairs (Figure 2B). CTCCTC interruptions were poorly stabilized relative to perfect repeats even in wild-type cells, and an msh2 mutation makes little difference on the expansion rate (Figure 1C). Thus, inhibition of mismatch repair in cis by C-C mispairs destabilizes TNRs by about the same extent as mutation of mismatch repair genes in our assay. Together with the single interruption results, the substrate specificity data provide important support for mismatch repair as the major force inhibiting expansions of interrupted TNRs. Mismatch Binding Alone Is Not Sufficient for Stabilization To differentiate between whether mismatch binding alone or whether downstream events (such as excision and resynthesis) are necessary for stabilization, we tested the msh2 allele msh2R730W. Strains with this mutation are defective in mismatch repair but are proficient in the removal of nonhomologous ends during recombination (Studamire et al., 1999). This phenotype suggests that MMR complexes containing msh2-R730Wp can bind to mismatches but are defective in downstream steps in mismatch repair (Studamire et al., 1999). Figure 1C shows that msh2R730W expressed in trans was unable to stabilize the ATGATG interruption in an msh2 background, whereas wild-type MSH2 provided full stabilization. It therefore seems unlikely that mispair binding alone can provide stabilization. Together with the large destabilization seen in the pms1 mutant, we conclude that downstream events in mismatch repair are required to stabilize interrupted TNRs.

Novel Expanded Alleles Occur When Mismatch Repair Is Inactivated If mismatch repair suppresses expansions, mismatch repair deficiencies might allow mismatched hairpins to go uncorrected and, therefore, lead to novel expanded alleles. To test this idea, molecular characterization of the expanded alleles was performed using PCR amplification and digestion with SfaNI, which cleaves sequences that retain at least one ATG interruption. The location of new repeats relative to the interruption site can be pinpointed by comparing the digestion patterns of the expanded allele and the starting tract (Rolfsmeier and Lahue, 2000). The expansions fell into two structural categories. For the ATGATG interruption, new CTG repeats were added 3⬘ to the interruption in 17 of 17 expansions in wild-type cells and in 90% of events (28 of 31) from mismatch repair mutants (Figure 2C). No duplication of the interrupting base pairs was observed in these expanded alleles. Similar results were seen in 5 of 6 events from the single ATG interruption and in 11 of 20 expansions arising from the CTCCTC-containing TNR. Most of the mismatch repair–dependent stabilization of interrupted TNRs is, therefore, consistent with the left branch of Figure 2A. The second class of expanded alleles, containing duplications of the interrupting base pairs, nearly always occurred when mismatch repair was inactivated. Duplications were seen in three expanded alleles from mismatch repair mutants and for nearly half of the expansions arising from the CTCCTC interruptions. The sole exception was one expansion of the ATG interruption in wild-type cells. Therefore, duplications are rarely seen (1 of 23, or 4%) when mismatch repair is active, but 30% (12 of 39) of the expansions are duplications in the absence of mismatch repair. Expansions with duplications are consistent with the right branch of Figure 2A. The most stringent interpretation of the allele data in Figure 2C comes from comparison of wild type with only those mutants (pms1 and msh2) displaying a strong phenotype on expansions. By this view, smaller differences were seen between the numbers of duplications and nonduplications. Thus, some care must be used in interpreting these results. The observation of a high percentage of duplications for the CTCCTC-interrupted allele provides an argument that mismatches in the hairpin rather than in the duplex are targets for stabilization. The allele data for the CTCCTC interruption (Figure 2C) is consistent with the predicted mismatched hairpin, according to the right branch of Figure 2A. In contrast, we were unable to draw a convincing model that explained how the CTCCTC interruption could lead to duplications if the mismatches were in the duplex. If mismatched hairpins are targets for recognition, then they would have to be large enough to provide adequate binding space for the Msh2p/Msh6p and Msh2p/Msh3p heterodimers. The best available estimates of binding sizes are for E. coli (Su and Modrich, 1986) and T. aquaticus (Biswas and Hsieh, 1997) MutS proteins, which, as homodimers in solution, protect 8–12 bp and 12–13 bp from chemical footprinting agents. Using 12 bp as a guide, adequate space would be available from a TNR hairpin of approximately 9 repeats (4 repeats, or 12 bases, on one side of the stem, about 1 repeat for the loop, and 4 more repeats for the second

Mismatch Repair Stabilizes Interrupted Triplets 1505

of the 3⬘ end of the Okazaki fragment to the template (Figure 2A, left branch) would produce two C-C mispairs in the hairpin and also two G-G mispairs in the duplex where the template strand contains interruptions. If the G-G mispairs triggered mismatch correction, corepair of the nearby hairpin would stabilize the CTCCTC-interrupted allele. Since we see virtually no stabilization for this allele, this argues that mismatches in the duplex are unable to trigger mismatch repair. Perhaps the TNR hairpin somehow masks the duplex region from mismatch repair proteins.

Figure 3. Limited Stabilization of Contractions (A) The assay for contractions utilizes a similar strategy as for expansions. The starting TNR tract contains 25 CTG repeats plus 24 base pairs of randomized sequence (“25 ⫹ 8”). The total length is therefore equivalent to 33 repeats. This size tract inactivates the URA3 reporter gene, leading to a Ura⫺ phenotype (requires uracil for growth). Contractions that reduce the tract length to final sizes of 0–20 CTG repeats allow utilization of the preferred initiation site I and thereby confer a Ura⫹ phenotype. (B) The alleles used for analysis of contractions were the perfect 25 ⫹ 8 tract and two interrupted alleles in which ATGATG interruptions were placed at two different positions within the repeating sequence. All sequences are shown as the lagging strand template. (C) Analysis of contractions for the perfect and interrupted alleles yielded the indicated rate values expressed as events per cell generation ⫻ 10–5. Stabilization factors were calculated as the perfect repeat rate divided by the rate for the interrupted alleles. (D) A model to explain how contraction rates are reduced by interruptions is shown. A description is provided in the text.

half of the stem). Therefore, when mismatch repair is inactivated either by mutation or by the C-C mispairs, the expansions we observe should be nine repeats or more. In 90% of the cases (46/51), expansions were nine repeats or larger under these circumstances, supporting the idea that mismatched hairpins can be targets for recognition. We note that for the CTCCTC interruption, annealing

Stabilization Is Reduced on the Template Strand Mismatch repair is targeted for correction of mispairs on the newly synthesized strand. In eukaryotes, this is achieved through identification of free DNA termini (Modrich and Lahue, 1996), such as at the ends of Okazaki fragments, that are used as entry points for helicases and/or exonucleases associated with mismatch repair. Since TNR expansions are thought to arise primarily by hairpin formation on newly synthesized DNA (Gordenin et al., 1997; Freudenreich et al., 1998; Jakupciak and Wells, 1999; Richard et al., 2000), it makes sense that mismatched expansion intermediates could be processed by mismatch repair proteins. A different situation prevails for mismatched hairpins on the template strand. Since free termini are not normally present on the template, it would be more difficult for mismatch repair to remove mismatched hairpins because there are no entry points for excision. To test this idea, we examined the effect of interruptions on TNR contractions (Figures 3A and 3B). Contractions are thought to arise from TNR-mediated folding of the single-stranded template into a hairpin (Figure 3D; Kang et al., 1995). Bypass synthesis then results in a shortened nascent strand that is converted to the full contraction in the next round of replication. When interruptions are present, they can produce mismatches in the hairpin (Figure 3D). Stabilization in cis would involve facilitated unfolding of the hairpin, whereas stabilization in trans would involve mismatch repair–dependent excision of the hairpin. If our hypothesis about mismatch repair is correct, there should be reduced mismatch repair stabilization of contractions from interrupted alleles compared to the mismatch repair effect on expansions. Interruptions provide only mild (10- and 8.3-fold; Figure 3C) stabilization of contractions compared to the 90-fold stabilization seen for expansions. Contraction rates of interruption 1, as a representative allele, were examined in pms1 and msh2 backgrounds. These mismatch repair mutations resulted in only 2- to 3-fold changes in contraction rates, indicating that mismatch repair is not the major stabilizing force for contractions. The residual 3.7to 4.3-fold stabilization is mismatch repair independent and probably arises from hairpin weakening due to mispairs. Similar results were observed for contractions of a longer allele that contained 50-mer CTG repeats with or without interruptions. The perfect repeat (CTG)50 contracted at a rate of 1.1 ⫻ 10– 3 per generation. There was only 4-fold stabilization for the interrupted allele (CTG)35 ATGATG (CTG)13 in wild-type cells, and this stabilization did not change appreciably (to a final value of 3-fold) in

Molecular Cell 1506

either pms1 or msh2 backgrounds. Contraction results from several alleles, therefore, support hairpin weakening rather than mismatch repair for most of the stabilization of contractions. Another difference is that for contractions, placement of the interruption either 5⬘ or 3⬘ in the tract makes little difference in the degree of stabilization (10-fold versus 8.3-fold; Figure 3C). This is in contrast to the large difference in stabilization for expansions (90-fold compared to 2.4-fold) when similarly placed interruptions were examined for expansions in wild-type cells (Rolfsmeier and Lahue, 2000). In summary, contractions of two different interrupted alleles show modest stabilization that is much less dependent on mismatch repair than is seen for expansions. A Novel Role for Mismatch Repair in Mutation Avoidance: Relevance for Prevention of TNR Expansion Diseases? The results of this study indicate a role for mismatch repair in stabilizing the genome by inhibiting expansions of interrupted TNRs. This function of mismatch repair is different for TNRs than for dinucleotide repeats, whose stabilization by interruptions in yeast is not due to mismatch repair (Petes et al., 1997). Based on the numerous parallels of mismatch repair in yeast and humans (Kolodner, 1996; Modrich and Lahue, 1996), it is reasonable to assume that mismatch repair also stabilizes interrupted TNRs in humans. Although this prediction remains to be tested directly, stabilization of interrupted TNR alleles by mismatch repair would provide a powerful disease-preventing force in human families at risk for expansions. Experimental Procedures Strains The S. cerevisiae strain used was MW 3317–21A (MATa ⌬trp1 ura352 ade2⌬ ade8 hom3-10 his3-KpnI met4 met13) (Kramer et al., 1989). Isogenic derivatives containing disruptions of mismatch repair genes were performed by standard one-step or two-step procedures. The integration of TNR containing plasmids at LYS2 and the confirmation of correct single integrants was as described (Rolfsmeier and Lahue, 2000). Plasmids The CTCCTC and ATG interrupted allele plasmids were created and confirmed as described previously (Rolfsmeier and Lahue, 2000). The oligonucleotide pair to create CTCCTC interruption was (CTG)6CTC CTC(CTG)17CATG and (CAG)17GAGGAG(CAG)6CATG. The ATG allele was created with oligonucleotides (CTG)6ATG(CTG)18 CATG and (CAG)18CAT(CTG)6CATG. For contraction alleles, the two oligonucleotide pairs were (CTG)6ATGATG(CTG)17TTGGCGGTCCT GCGCGGCCCGCGCATG annealed to CGCGGGCCGCGCAAGGAC CGCCAA(CAG)17CATCAT(CAG)6CATG and (CTG)17ATGATG (CTG)6 TTGGCGGTCCTTGCGCGGCCCGCGCATG paired with CGCGGGC CGCGCAAGGACCGCCAA(CAG)6CATCAT(CAG)17CATG. All oligonucleotides are listed in the 5⬘ to 3⬘ polarity. Centromeric plasmids containing wild-type MSH2 or mutant msh2R730W (Studamire et al., 1999) were the kind gift of Eric Alani, Cornell University. Expansion Rates and Molecular Analysis of Expanded Alleles Fluctuation analysis was performed as previously described for expansions (Miret et al., 1998), and contraction events were analyzed similarly, except that selective plates for contractions lacked uracil instead of containing 5FOA. Single-colony PCR analysis was carried out using published procedures (Miret et al., 1998). Bona fide expansions were identified as those events that lengthened the PCR product relative to a starting-tract control. Determination of

the retention and position of ATG-containing interruptions was determined (Rolfsmeier and Lahue, 2000) by restriction analysis with SfaNI (New England Biolabs). CTCCTC-containing interruptions were analyzed with BseRI as the diagnostic restriction enzyme. Acknowledgments This work was supported by NIH award GM61961 (to R. S. L.), by NCI Training Grant T32 CA09476 (to M. L. R. and M. J. D.), by a UNMC graduate assistantship (to M. J. D.), and by NCI Cancer Center Support Grant P30 CA36727 (to the Eppley Institute). Received September 22, 2000; revised October 27, 2000. References Biswas, I., and Hsieh, P. (1997). Interaction of MutS protein with the major and minor grooves of a heteroduplex DNA. J. Biol. Chem. 272, 13355–13364. Chung, M.-Y., Ranum, L.P.W., Duvick, L.A., Servadio, A., Zoghbi, H.Y., and Orr, H.T. (1993). Evidence for a mechanism predisposing to intergenerational CAG repeat instability in spinocerebellar ataxia type I. Nat. Genet. 5, 254–258. Cummings, C.J., and Zoghbi, H.Y. (2000). Fourteen and counting: unraveling trinucleotide repeat diseases. Hum. Mol. Genet. 9, 909–916. Detloff, P., and Petes, T.D. (1992). Measurements of excision repair tracts formed during meiotic recombination in Saccharomyces cerevisiae. Mol. Cell. Biol. 12, 1805–1814. Detloff, P., Sieber, J., and Petes, T.D. (1991). Repair of specific base pair mismatches formed during meiotic recombination in the yeast Saccharomyces cerevisiae. Mol. Cell. Biol. 11, 737–745. Eichler, E.E., Holden, J.J.A., Popovich, B.A., Reiss, A.L., Snow, K., Thibodeau, S.N., Richards, C.S., Ward, P.A., and Nelson, D.L. (1994). Length of uninterrupted CGG repeats determines instability of the FMR1 gene. Nat. Genet. 8, 88–94. Freudenreich, C.H., Kantrow, S.M., and Zakian, V.A. (1998). Expansion and length-dependent fragility of CTG repeats in yeast. Science 279, 853–856. Gacy, A.M., Goellner, G., Juranic, N., Macura, S., and McMurray, C.T. (1995). Trinucleotide repeats that expand in human disease form hairpin structure in vitro. Cell 81, 533–540. Gordenin, D.A., Kunkel, T.A., and Resnick, M.A. (1997). Repeat expansion—all in a flap? Nat. Genet. 16, 116–118. Henricksen, L.A., Tom, S., Liu, Y., and Bambara, R.A. (2000). Inhibition of flap endonuclease 1 by flap secondary structure and relevance to repeat sequence expansion. J. Biol. Chem. 275, 16420– 16427. Jakupciak, J.P., and Wells, R.D. (1999). Genetic instabilities in (CTGCAG) repeats occur by recombination. J. Biol. Chem. 274, 23468– 23479. Kang, S., Jaworski, A., Ohshima, K., and Wells, R.D. (1995). Expansion and deletion of CTG repeats from human disease genes are determined by the direction of replication in E. coli. Nat. Genet. 10, 213–218. Kolodner, R. (1996). Biochemistry and genetics of eukaryotic mismatch repair. Genes Dev. 10, 1433–1442. Kramer, B., Kramer, W., Williamson, M.S., and Fogel, S. (1989). Heteroduplex DNA correction in Saccharomyces cerevisiaeis mismatch specific and requires functional PMS genes. Mol. Cell. Biol. 9, 4432– 4440. Kunst, C.B., and Warren, S.T. (1994). Cryptic and polar variation of the fragile X repeat could result in predisposing normal alleles. Cell 77, 853–861. Marsischky, G.T., Filosi, N., Kane, M.F., and Kolodner, R. (1996). Redundancy of Saccharomyces cerevisiae MSH3 and MSH6 in MSH2-dependent mismatch repair. Genes Dev. 10, 407–420. McMurray, C.T. (1999). DNA secondary structure: a common and causative factor for expansion in human disease. Proc. Natl. Acad. Sci. USA 96, 1823–1825.

Mismatch Repair Stabilizes Interrupted Triplets 1507

Miret, J.J., Pessoa-Brandao, L., and Lahue, R.S. (1998). Orientationdependent and sequence-specific expansions of CTG/CAG trinucleotide repeats in Saccharomyces cerevisiae. Proc. Natl. Acad. Sci. USA 95, 12438–12443. Mitas, M. (1997). Trinucleotide repeats associated with human disease. Nucleic Acids Res. 25, 2245–2253. Modrich, P., and Lahue, R.S. (1996). Mismatch repair in replication fidelity, genetic recombination and cancer biology. Annu. Rev. Biochem. 65, 101–133. Moore, H., Greenwell, P.W., Liu, C.-P., Arnheim, N., and Petes, T.D. (1999). Triplet repeats form secondary structures that escape DNA repair in yeast. Proc. Natl. Acad. Sci. USA 96, 1504–1509. Nag, D.K., and Kurst, A. (1997). A 140-bp-long palindromic sequence induces double-strand breaks during meiosis in the yeast Saccharomyces cerevisiae. Genetics 146, 835–847. Paulson, H.L., and Fischbeck, K.H. (1996). Trinucleotide repeats in neurogenetic disorders. Annu. Rev. Neurosci. 19, 79–107. Pearson, C.E., Eichler, E.E., Lorenzetti, D., Kramer, S.F., Zoghbi, H.Y., Nelson, D.L., and Sinden, R.R. (1998). Interruptions in the triplet repeats of SCAI and FRAXA reduce the propensity and complexity of slipeed strand DNA (S-DNA) formation. Biochemistry 37, 2701–2708. Petes, T., Greenwell, P.W., and Dominska, M. (1997). Stabilization of microsatellite sequences by variant repeats in the yeast Saccharomyces cerevisiae. Genetics 146, 491–498. Pulst, S.-M., Nechiporuk, A., Nechiporuk, T., Gispert, S., Chen, X.-N., Lopes-Cendes, I., Pearlman, S., Starkman, S., OrozcoDiaz, G., Lunkes, A., et al. (1996). Moderate expansion of a normally biallelic trinucleotide repeat in spinocerebellar ataxia type 2. Nat. Genet. 14, 269–276. Richard, G.-F., Goellner, G.M., McMurray, C.T., and Haber, J.E. (2000). Recombination-induced CAG trinucleotide repeat expansions in yeast involve the MRE11–RAD50–XRS2 complex. EMBO J. 19, 2381–2390. Richards, R.I., and Sutherland, G.R. (1992). Dynamic mutations: a new class of mutations causing human disease. Cell 70, 709–712. Richards, R.I., and Sutherland, G.R. (1994). Simple repeat DNA is not replicated simply. Nat. Genet. 6, 114–116. Rolfsmeier, M.L., and Lahue, R.S. (2000). Stabilizing effects of interruptions on trinucleotide repeat expansions in Saccharomyces cerevisiae. Mol. Cell. Biol. 20, 173–180. Schweitzer, J.K., and Livingston, D.M. (1997). Destabilization of CAG trinucleotide repeat tracts by mismatch repair mutations in yeast. Hum. Mol. Genet. 6, 349–355. Snow, K., Tester, D.J., Kruckeberg, K.E., Schaid, D.J., and Thibodeau, S.N. (1994). Sequence analysis of the fragile X trinucleotide repeat: implications for the origin of the fragile X mutation. Hum. Mol. Genet. 3, 1543–1551. Spiro, C., Pelletier, R., Rolfsmeier, M.L., Dixon, M.J., Lahue, R.S., Gupta, G., Park, M.S., Chen, X., Mariappan, S.V.S., and McMurray, C.T. (1999). Inhibition of FEN-1 processing by DNA secondary structure at trinucleotide repeats. Mol. Cell 4, 1079–1085. Studamire, B., Price, G., Sugawara, N., Haber, J.E., and Alani, E. (1999). Separation-of-function mutations in Saccharomyces cerevisiae MSH2 that confer mismatch repair defects but do not affect nonhomologous-tail removal during recombination. Mol. Cell. Biol. 19, 7558–7567. Su, S.-S., and Modrich, P. (1986). Escherichia coli mutS-encoded protein binds to mismatched DNA base pairs. Proc. Natl. Acad. Sci. USA 83, 5057–5061.