Modulation of ethanol toxicity by Asian ginseng (Panax ginseng) in Japanese ricefish (Oryzias latipes) embryogenesis

Comparative Biochemistry and Physiology, Part C 157 (2013) 287–297

Contents lists available at SciVerse ScienceDirect

Comparative Biochemistry and Physiology, Part C journal homepage: www.elsevier.com/locate/cbpc

Modulation of ethanol toxicity by Asian ginseng (Panax ginseng) in Japanese ricefish (Oryzias latipes) embryogenesis M.H. Haron a, B. Avula b, I.A. Khan a, c, d, S.K. Mathur e, A.K. Dasmahapatra a, b,⁎ a

Department of Pharmacology, School of Pharmacy, University of Mississippi, University, MS 38677, USA National Center for Natural Product Research, Research Institute of Pharmaceutical Sciences, School of Pharmacy, University of Mississippi, University, MS 38677, USA Department of Pharmacognosy, School of Pharmacy, University of Mississippi, University, MS 38677, USA d Department of Pharmacognosy, King Saud University, Saudi Arabia e Division of Epidemiology and Biostatistics, School of Public Health, University of Memphis, TN 38152, USA b c

a r t i c l e

i n f o

Article history: Received 10 November 2012 Received in revised form 2 February 2013 Accepted 4 February 2013 Available online 9 February 2013 Keywords: Fetal alcohol spectrum disorder Panax ginseng Japanese ricefish Alcohol Medaka

a b s t r a c t Alcohol consumption by women during pregnancy often induces fetal alcohol spectrum disorder (FASD) in children who have serious central nervous system (CNS), cardiovascular, and craniofacial defects. Prevention of FASD, other than women abstaining from alcohol drinking during pregnancy, is not known. A limitation of the use of synthetic anti-alcoholic drugs during pregnancy led us to investigate herbal products. In particular, many plants including Asian ginseng (Panax ginseng) have therapeutic potential for the treatment of alcoholism. We used Japanese ricefish (medaka) (Oryzias latipes), an animal model of FASD, for identifying herbal medicines that can attenuate ethanol toxicity. Fertilized eggs in standard laboratory conditions were exposed to ginseng (PG) root extract (0–2 mg/mL) either 0–2 (group A) or 1–3 (group B) day post fertilization (dpf) followed by maintenance in a clean hatching solution. The calculated IC50 as determined 10 dpf in A and B groups were 355.3± 1.12 and 679.7± 1.6 μg/mL, respectively. Simultaneous exposure of embryos in sub-lethal concentrations of PG (50–200 μg/mL) and ethanol (300 mM) for 48 h disrupted vessel circulation and enhanced mortality. However, PG (100 μg/mL) may partially protect trabecular cartilage (TC) deformities in the neurocranium in B group embryos induced by ethanol (300 mM). To understand the mechanism, embryonic ethanol concentration was measured at 2 dpf and adh5, adh8, aldh2, aldh9a, catalase, GST, and GR mRNAs were analyzed at 6 dpf. It was observed that although ethanol is able to reduce adh8 and GST mRNA contents, the simultaneous addition of PG was unable to alter ethanol level as well as mRNA contents in these embryos. Therefore, antagonistic effects of PG on ethanol toxicity are mediated by a mechanism which is different from those regulating ethanol metabolism and oxidative stress. Published by Elsevier Inc.

1. Introduction Fetal alcohol spectrum disorder (FASD) is an important clinical problem resulting from prenatal exposure to alcohol. FASD has serious central nervous system (CNS), cardiovascular, and craniofacial defects affecting the entire lifetime of an individual (Abel and Hannigan, 1995; Streissguth and O'Malley, 2000; Autti-Ramo et al., 2006; Manning and Eugene, 2007). The extreme form of FASD is fetal alcohol syndrome (FAS), which is characterized by facial dysmorphogenesis, mental dysfunction, growth retardation, cardiovascular and limb defects. It is estimated that in the USA about 1 to 3% of the children are born with FASD, but the incidence of FAS is 1–2 per 1000 live births (Cook et al., 1990; Sampson et al., 1997; May et al., 2004; Russo et al., 2004). In some selected populations such as in Native American communities, FAS is 10.3 per 1000 live births (Duimstra et al., 1993; Burd and Moffatt, ⁎ Corresponding author at: Department of Pharmacology, University of Mississippi, University, MS 38677, USA. Tel.: + 1 662 9157077; fax: + 1 662 9155148. E-mail address: [email protected] (A.K. Dasmahapatra). 1532-0456/$ – see front matter. Published by Elsevier Inc. http://dx.doi.org/10.1016/j.cbpc.2013.02.001

1994). Due to ethical constraints, human studies of FAS are very limited (Cudd, 2005); therefore, to understand the molecular mechanisms of FASD, it is necessary to develop alternate models. We have emphasized the identification of genes that mediate the effects of ethanol to induce FASD and to discover drugs that can attenuate the disorder. FASD can be completely prevented by not drinking any alcohol during pregnancy; however, given the difficulties in achieving this goal, it is important to discover practical therapeutic approaches to prevent FASD. Efforts have been made in the last several decades to discover an appropriate drug that can prevent alcoholism. With these attempts, many anti-alcoholic compounds have been isolated and the Food and Drug Administration (FDA) has approved three synthetic compounds, disulfiram, naltrexone and acamprosate, as antialcoholic drugs. Since these three chemicals are considered FDA pregnancy category C (adverse effects on the fetus in animal studies but no human trials) (Williams, 2005; Collins et al., 2006), they cannot be used by women during pregnancy. Many other new compounds, such as topiramate, gabapentin, ondansetron, baclofen, and rimonabant, are currently under investigation; however, their safety and efficacy on embryo development

288

M.H. Haron et al. / Comparative Biochemistry and Physiology, Part C 157 (2013) 287–297

need verification. Several neuroprotective peptides, growth factors, and antioxidants that have demonstrated partial protection of the fetus from ethanol teratogenesis (Sari and Gozes, 2006; Zhou et al., 2008) need further studies. An alternative approach to the problem is to search for medicinal plants with anti-alcoholic properties. Several plant products have been documented to show anti-alcoholic properties (Xu et al., 2005; Tomczyk et al., 2012). The active components in these plant products are able to antagonize alcoholism either by reducing alcohol intake or by inhibiting alcohol absorption in GI, or by stimulating the activity of alcohol metabolites (Carai et al., 2000; Overstreet et al., 2003; Rezvani et al., 2003; Xu et al., 2005; McGregor, 2007). Therefore, it is expected that a safe and effective anti-alcoholic compound could be isolated from any of these plant products which might be used for the prevention of FASD. In this investigation we have used ginseng which is one of the best-selling botanicals in the USA for many years (Blumenthal, 2001). More than six million Americans regularly consume ginseng products (Smolinski and Pestka, 2003). Moreover, ginseng has no adverse effect in human pregnancy (Seely et al., 2008). Although there are many species of ginseng, two of the most commonly used species are Panax ginseng (Chinese ginseng) and Panax quinquefolius (American ginseng) are widely used. The active constituents of ginseng are ginsenosides or ginseng saponins and more than 40 other ginsenosides have been identified from Panax (Liberti and Der Mardersian, 1978; Liu and Xiao, 1992; Back et al., 1996). The ginsenoside content of ginseng varies with the species, the plant age, the parts of the plant, the preservation methods, the season of harvest, and the extraction method (Liberti and Der Mardersian, 1978; Phillipson and Anderson, 1984). Recently, black ginseng (red ginseng passed through 9 cycles of 95–100 °C for 2–3 h) has been found to inhibit ethanol-induced teratogenesis in mouse embryos in vitro (Lee et al., 2009). Therefore, we attempted to evaluate the efficacy of Asian ginseng (methanolic extract from the roots of P. ginseng) as a potential preventive agent of FASD in Japanese ricefish (medaka) embryogenesis which we have developed as a unique model to study FASD (reviewed in Haron et al., 2012). We have observed that in standard laboratory conditions developmental exposure of fertilized Japanese ricefish eggs to alcohol induced deformities that are analogous to human FASD phenotypes. Moreover, these anomalies are specific to the dose and day of development of the embryo. In this communication we demonstrate that in Japanese ricefish embryogenesis methanolic extracts of ginseng root (PG) at sublethal concentrations are unable to induce measurable toxic effects, however, able to modify ethanol toxicity by some unknown mechanisms. 2. Materials and methods 2.1. Preparation of the root extracts of PG Asian ginseng (P. ginseng) roots used in these experiments were collected from China and after identification, vouchers (voucher number 66) are stored in the National Center for Natural Products Research (NCNPR) repository for reference. The collected materials which were free from insects, diseases, and bryophytes, were washed several times with distilled water, cut into manageable pieces, and kept warm (below 40 °C) until thoroughly dry. The dried material (1 mm mesh size), was weighed and packaged in 950 mL opaque amber HDPE wide-mouth jars with an identification label. The jarred samples were deposited into the NCNPR plant material storage facility until extraction. For extraction, 7.5 g of powdered plant material was used in an automated process utilizing programmed Dionex Accelerated Solvent Extraction (ASE200/300) systems. The extraction was made using 95% methanol at 40 °C with 1500 psi for 10 min. This process was repeated twice more to afford the final extract. The methanolic extract was concentrated using a combination of rotary evaporation and vacuum centrifugation. All pertinent information regarding the extraction and the representative plant material was placed on the vial containing

the dried extract, and the samples were maintained at −80 °C. The concentrated extract was used for TLC, LCMS, and HPLC analysis for chemical composition.

2.2. Embryo culture Methods of animal maintenance, egg collection and embryo culture conditions were previously described (Hu et al., 2008, 2009). In brief, fertilized eggs of Oryzias latipes after collection were maintained in a hatching solution (17 mM NaCl, 0.4 mM KCl, 0.3 mM MgSO4, 0.3 mM CaCl2, with the required amount of NaHCO3 to maintain the pH 7.4 and 0.0002% methylene blue to reduce fungal infection) in a precision high performance incubator (Thermo Fisher Scientific, Waltham, MA, USA) at 26±1 °C with 16L:8D light cycle. PG was initially dissolved in DMSO and diluted to the desired concentration by hatching solution keeping the final DMSO concentration to 1 μL/mL (0.1%). PG (0–2 mg/mL) and ethanol (300 mM) were added to the medium after transferring the viable embryos at respective developmental stages to 2 mL tubes (1 egg/tube in 1 mL medium). To stop ethanol loss by evaporation the tubes were tightly capped. The DMSO concentration in both control and ethanol treated embryos were adjusted to 0.1%. Embryos were exposed to different treatment conditions at two different time points of development (A group: 0 dpf, blastula, Iwamatsu stages ~9–10, and B group: 1 dpf, neurula, Iwamatsu stages ~17–20) and discontinued after 48 h, following a one-time renewal of media after 24 h. Embryos before sacrifice (6 dpf) were examined for routine developmental changes such as cardiovasculature, thrombus (blood clot), and vessel circulation (flow of blood through a blood vessel) under a phase contrast microscope (AO Scientific Instruments) and were classified after Iwamatsu (2004). For the determination of hatching efficiency (HE), separate experiments were done and the embryos were allowed to hatch until 10 dpf. HE was determined by using the following formula: number of embryos hatched 7–10 dpf / total number of embryos used in the experiment× 100.

2.3. Determination of embryonic ethanol concentrations Ethanol concentration in the embryos exposed either to ethanol or ethanol and PG was determined after Reimers et al. (2004) with some modifications (Wang et al., 2006). In brief, group A embryos (Iwamatsu stages 9–10) in 2 mL tubes were exposed to 1 mL 300 mM ethanol with or without 100 μg/mL PG for 48 h. The media were changed once at 24 h. Parallel control embryos were also maintained in clean hatching solution (no ethanol or PG) or containing only PG (100 μg/mL). After removal from culture the embryos were transferred to 1.5 mL centrifuge tubes on ice and were washed with 1 mL cold 3.5% perchloric acid (PCA) twice to remove residual alcohol from outside of the chorion. Four embryos from each group were pooled together and homogenized in 100 μL 3.5% PCA. The homogenate was centrifuged at 12,000 g for 15 min at 4 °C. The supernatants were saved and stored at 4 °C in sealed tubes. The ethanol concentration of the supernatants was determined in a 96-well plate reader (Spectra Max M5, Molecular Devices, Sunnyvale, CA, USA) at 340 nm by measuring NADH production at 37 °C. The reaction mixture in 200 μL final volume contained 175 μL NAD in 0.5 M Tris pH 8.8, 15 μL yeast ADH (0.75 mg/mL) and 10 μL of either sample or standard ethanol (44– 221 μg) solution. After 2 min pre-incubation at 37 °C production of NADH was measured. A blank reaction without ethanol (10 μL 3.5% PCA) was run simultaneously to correct any substrate-independent generation of NADH. In this condition the linearity of the reaction was maintained ~ 15 min. Embryonic ethanol concentration was calculated from standard curves. The results were expressed as mg alcohol/egg or calculated to mM alcohol considering the average diameter of the egg is 1200 μm.

M.H. Haron et al. / Comparative Biochemistry and Physiology, Part C 157 (2013) 287–297

289

Table 1 Primers used in qPCR amplifications of the mRNAs for alcohol metabolizing and antioxidant enzymes of Oryzias latipes embryos. mRNA

Sense (5′–3′)

Antisense (5′–3′)

Product size (bp)

mRNA related to oxidative stress/alcohol metabolism

Ensembl number/GenBank accession

Catalase GST GR Adh5 Adh8 Aldh2 Aldh9a EF-α1

gcggtacaacagcgcagatgaag gaacctgcagggctacaacc ggactactcctgcattcccacag gtcacacagatgcctacactc cattgctggacggacctggaag gtggaacttccctttgctgatg tgcttgcatcccgaacgacatg agcgacaagatgagctggtt

ggatggacggccttcaagttc ggccctcaaacatgcgttgg cattgactcttcctgcgtgtgatg gccccgcaactttgcagccc gtcgggaaacactcaggactg gttgatccagtgaaggccac cttgccattgttgatcacttc gggcacagcttctggtaaag

171 241 165 514 206 241 355 300

Oxidative stress Oxidative stress Oxidative stress Alcohol metabolism Alcohol metabolism Alcohol metabolism Alcohol metabolism Internal standard

ENSORLT00000002176 GenBank X95200 ENSORLT00000000771 GenBank AY512892 GenBank AY682722 GenBank KC122763 GenBank HQ206521 GenBank NM_001104662

All the sequences except aldh2 were published previously (reviewed by Haron et al., 2012).

2.4. Quantitative real-time RT-PCR (qPCR) The mRNA content of alcohol metabolizing enzymes (adh5, adh8, aldh2, and aldh9a) and the oxidative stress related enzymes (catalase, GR and GST) were determined by qPCR (Hu et al., 2008; Wu et al., 2008). In brief, the total RNA of group A embryos were extracted on 6 dpf by TRIzol reagent (Invitrogen, Carlsbad, CA, USA) following the manufacturer's instruction and the genomic DNA was removed from the RNA by treating DNase I (Dasmahapatra et al., 2000). RNA was reverse transcribed to cDNA by superscript III (Invitrogen) and 1 μL of the cDNA was used for qPCR analysis. Gene-specific primers (Table 1) used for target gene amplification were verified previously (Hu et al., 2008; Wu et al., 2008) and the relative quantity was determined considering Elongation Factor α 1 (EFα1) as an internal control. 2.5. Cartilage staining Embryos at 6 dpf (A group) or 7 dpf (B group) were used for cartilage staining including neurocranium and trabecular cartilages (TC) in 0.1% Alcian blue as described previously (Hu et al., 2009) with modifications. In brief, the embryos were fixed in 4% paraformaldehyde in 10 mM PBS with 0.1% Tween 20 (PBT) for 4 h at room temperature and the chorion was removed under a dissecting microscope. The chorion-less embryos were fixed again in 4% PBT at 4 °C overnight. Fixed samples were washed twice in water and then transferred to 10% H2O2 solution for 10 min. After brief washing in water the embryos were stained 1–2 days in

0.01% Alcian blue (Sigma-Aldrich, St. Louis, MO, USA). The embryos were transferred to graded alcohol in a descending order and finally transferred to water. The washed embryos were treated with 1% trypsin (Sigma-Aldrich) in 1.75% sodium borate solution and left at 4 °C until the muscles were completely digested or transparent. The embryos were washed in water and digital images of neurocranium and TC were captured on an Olympus B-Max 40 microscope with Optimus 6 image analysis software (Media Cybernetics, Silver Spring, MD, USA). The linear length of neurocranium and TC (an average of two sides) was determined (Hu et al., 2009). 2.6. Statistics Each experiment was repeated 3–4 times and the data were analyzed by two-way ANOVA followed by post hoc Bonferroni's multiple comparison tests and p b 0.05 was considered as significant. 3. Results 3.1. Lethality of ginseng root extract on medaka embryogenesis A methanolic extract of ginseng (P. ginseng) root (PG) was prepared at the NCNPR, the University of Mississippi (voucher no: 66). The purity of the mixture was tested by HPLC chromatograms (Fig. 1). It was observed that most of the ginseng saponins (ginsenosides such as Rb1, Rb2, Rc, Rd, Rg1, Re and Rf) are present in the extract. Although

Fig. 1. Typical HPLC chromatograms of plant material (A group) and plant extract (B group) using UV detector at 205 nm (1) ginsenoside Rg1, (2) ginsenoside Re, (3) ginsenoside Rf, (4) ginsenoside Rb1, (5) ginsenoside Rc, (6) ginsenoside rb2, and (7) ginsenoside rd.

M.H. Haron et al. / Comparative Biochemistry and Physiology, Part C 157 (2013) 287–297

Embryo Survivability 150

Survival (%)

Group A

50

Fig. 3. Effect of simultaneous exposure of PG and ethanol on mortality of medaka embryos during development. Group A embryos were treated 0–48 hpf and group B embryos were treated 24–72 hpf. Mortality was examined on 10 dpf. Each bar is the mean±SEM of 5–10 observations and asterisks (*) or pound symbols (#) on the bar head indicate the significant difference (pb 0.05) with corresponding controls. PG=Panax ginseng; al=ethanol.

IC50 (B group: 10dpf) 100

80

80

Survival (%)

60 40 20

60 40 20

0 1.5

2.0

2.5

3.0

0 1.5

3.5

2.0

Log PG concentration (µg/ml)

2.5

3.0

3.5

Log PG concentration (µg/ml)

2.1

2.2

Hatching efficiency: A group (10 dpf)

Hatching efficiency-B group (10 dpf) 100

Embryo Hatched (%)

150

100

50

80 60 40

* *

20

* 0

* 00 10

0 75

0 50

0 25

co

nt

5

l ro

0 50

0 25

5 12

co nt

ro l

0 12

Survival (%)

#

* * *

0

100

Embryos hatched (%)

#

*

100

IC50 (A group: 10dpf)

PG (µg/ml)

PG (µg/ml)

2.3

Group B

on tr al ol PG 300 -2 PG 0 -2 PG 0 Pg 00 -10 + -1 al 0 0 -3 Pg 0+a 00 50 l 3 +a 00 l3 co 00 nt r al ol -3 Pg P 0 2 g 0 Pg 00 20 + -1 al 0 0 3 Pg 0+a 00 50 l 30 +a 0 l3 00

we did not detect the actual concentration of the ginsenosides in the extract, from the spectrum data it was observed that most of the major ginseng saponins were detectable in the PG extract (Fig. 1). To determine the lethal concentration of PG on medaka embryogenesis, fertilized medaka eggs (Iwamatsu stages 9–10, group A or Iwamatsu stages 17–18, group B) were exposed to different concentrations of PG (0–2000 μg/mL) for 48 h and then transferred to a clean hatching solution. Mortality was evaluated on 10 dpf. The calculated EC50 values for PG to cause 50% mortality in embryos at 10 dpf as determined from three independent experiments were 355.5 ±1.12 μg/mL in group A and 679.6 ± 1.6 μg/mL in group B with 0–48 hpf (group A) or 24– 72 hpf (group B) constant exposure followed by a clean hatching solution. Embryo survivability and hatching were severely affected at concentration >500 μg/mL with 100% mortality for group A and >750 μg/mL for group B (Fig. 2.1 and 2.2). Removal of PG from the media allowed the survived embryos to initiate vessel circulation which was found to be dose-dependent. The majority of the embryos exposed to 250 μg/mL PG were late in the initiation of vessel circulation (~3 dpf) compared to the controls and 125 μg/mL (~2 dpf) groups. However, all the surviving embryos (≤250 μg/mL) were able to start vessel circulation on 6 dpf. Hatching of the survived embryos was also affected by PG in a dose-dependent manner (Fig. 2.3 and 2.4) and

C

290

2.4

Fig. 2. PG-mediated mortality (2.1=A group, 2.2=B group) and hatching efficiency (2.3=A group; 2.4=B group) in medaka embryos. Fertilized eggs of medaka within 2 hpf (A group) or one-day post fertilization (B group) were exposed to PG (0–2000 μg/mL PG) for 48 h and the effect on mortality was assessed at 10 dpf. Each group consists of eight embryos. The experiment was repeated three times. The IC50 was calculated 355.5±1.12 μg/mL with an r2 of 0.9088 for group A and 679.6±1.6 μg/mL with an r2 0.8438 for group B by log-transformed data using nonlinear regression (curve-fit) (GraphPad Prism). Each point represents the mean mortality percentage±SEM (n=3). Hatching of the embryos started in our laboratory conditions by 7+ dpf. Hatching efficiency as % was determined by using the following formula: number of embryos hatched from 7 to 10 dpf/total number of embryos used in the experiment×100. Each bar is the mean±SEM of three observations and asterisks (*) on the bar head indicate the significant difference (pb 0.05) with corresponding controls. PG=Panax ginseng.

M.H. Haron et al. / Comparative Biochemistry and Physiology, Part C 157 (2013) 287–297

related to the vessel circulation status of the embryos. In our laboratory conditions the embryos generally started to hatch on 7+ dpf (~175 hpf) and if the embryos were unable to hatch by 14 dpf, we considered them as unhatched. The HE of the embryos as determined on 10 dpf was dependent upon the concentration of PG in the medium, especially in B groups (Fig. 2.4). Those embryos that were able to initiate vessel circulation by 6 dpf majority of them in both A and B groups were hatched by 10 dpf (the concentration of PG≤250 μg/mL). Only 5–20% of the survived embryos in B groups treated with 500–750 μg/mL PG were able to hatch if they have vessel circulation (Fig. 2.4). From these initial experimental data we set up the maximum limit of PG concentration to 200 μg/mL in all other experiments. 3.2. Effects of PG as a supplement to ethanol teratogenesis Medaka embryos at two stages of development (group A: Iwamatsu stages 9–10, and group B: Iwamatsu stages 17–18) were exposed to ethanol (300 mM) at 26± 1 °C with 16L:8D light cycle with or without

291

sub-lethal concentrations of PG (50–200 μg/mL) for 48 h and then transferred to clean hatching solution with no ethanol or PG. Parallel controls were maintained in clean hatching solutions with or without PG (100 and 200 μg/mL for A and 200 μg/mL for B groups). In these experimental conditions, compared to controls, embryo survivability was reduced significantly in both A and B groups in 10 dpf when exposed to only ethanol (300 mM). PG (100–200 μg/mL for A group and 200 μg/mL for B group) alone was ineffective, however, able to enhance mortality in the presence of ethanol (300 mM) (Fig. 3). Group A embryos when exposed to ethanol (300 mM) simultaneously with 200 μg/mL PG, almost all of them died by 2 dpf. When PG concentration was reduced to 50–100 μg/mL with 300 mM ethanol embryo survivability enhanced and more than 50% of these embryos (group A) were viable (Fig. 3) even though the viability was significantly less than the corresponding control and only PG (100 μg/mL)-treated groups. In B groups, the embryo survivability in these conditions (300 mM of ethanol+50–100 μg/mL PG) was equal to the embryos maintained in a clean (controls) hatching solution (not significantly different from controls). However, reduced

Group A

B-group 150

*

100

* *

50

% circulation

*

100

0

*

50

Treatment groups

PG

00 -1

-5

+

0+

A

A

l3

l3

00

00

00 l-3 +A

Treatment groups

4.2

4.1

PG

PG

A

A

l3

-2

A

00

+ 00

00 -2 PG

co

00

nt

m

ro

M

l

0 PG

PG + 00 l3

A

10

50

00 -1 PG

l-3

co

00

nt

m

ro

M

l

0

l-3

% circulation

150

Hatching efficiency-A group

Hatching efficiency-B group 150

100

* 50

*

*

Embryos hatched (%)

0

*

*

50

l-3 00 10 0+ A l-3 00 P50 + al 30 0

A

P-

M

20 0 P-

20 0+

ol oh lc A

P-

+ 50 P-

m

co n

tr

30 al

l-3 A 0+

10 P-

ol

0

00

0 10 P-

M m

A

lc o

ho

l-3

co

00

nt

ro l

0

Treatment groups

4.3

100

-3 00

Embryos hatched (%)

150

Treatment groups

4.4

Fig. 4. Effect of simultaneous exposure of PG and ethanol on circulation status (4.1 = A group and 4.2 = B group) and hatching efficiency (4.3 = A group and 4.4 = B group) of medaka embryos during development. Group A embryos were treated 0–48 hpf and group B embryos were treated 24–72 hpf. Circulation status was examined on 6 dpf and hatching efficiency was determined on 10 dpf. Each bar is the mean±SEM of 5–10 observations and asterisks (*) on the bar head indicate the significant difference (pb 0.05) with corresponding controls. PG=Panax ginseng; Al=ethanol.

292

M.H. Haron et al. / Comparative Biochemistry and Physiology, Part C 157 (2013) 287–297

significantly when PG concentration increased to 200 μg/mL in the presence of ethanol (300 mM) even more than 50% of the embryos in these conditions (300 mM ethanol+200 μg/mL) were viable (Fig. 3).

The vessel circulations of the survived embryos were examined on 6 dpf and are presented in Fig. 4 (4.1 and 4.2). It was observed that group A embryos when exposed to ethanol (300 mM) alone or in

Trabecular cartilage

Polar Cartilage

5.2

Control

5.1

PG (100µg/ml)

Ethmoid plate

5.3

5.4

Ethanol (300 mM)

PG (100µg/ml) + Ethanol (300 mM)

TC-group B

Neurocranium- B group 800

200

*

600

linear length (µm)

400

200

150

*

*

100

50

-5 0

+A

l 00

Treatment groups

5.6

PG

+A

l 00 -2

PG

A

Pg -2

ug

m 00

on tr C

/m

M

ol

50

l3 A

A

l3

00

+P

+P

G

G

20

0

20 0 00

m 00 l-3

PG

M

l ro A

co nt

Treatment groups

5.5

l

0

0

l-3

Length (µm)

*

*

M.H. Haron et al. / Comparative Biochemistry and Physiology, Part C 157 (2013) 287–297

Determination of embryonic ethanol

A340 /min/embryo

0.02

control

P-100

al-300

al 300+P-100 0.01 0.00 -0.01 -0.02

6.1 embryonic ethanol concentration

mg alcohol/egg

0.006

0.004

0.002

0.000 Ethanol

6.2

Ethanol+P100

Treatment groups

Fig. 6. Embryonic ethanol determination of medaka embryos. The embryonic ethanol concentration after 300 mM or 300 mM+100 μg/mL waterborne exposure for 48 h was estimated using an ADH-dependent kinetic assay following Reimers et al. (2004). At each point four embryos were pooled for extraction of embryonic ethanol. The volume of the embryos was calculated on the basis of an average embryonic diameter 1200 μm. The results were expressed as the mean±SEM of 3–4 observations. PG=Panax ginseng; Al=ethanol.

combination of PG (50 and 100 μg/mL + 300 mM of ethanol), the vessel circulation was found to reduce significantly in comparison to controls or with the embryos maintained only in PG (100 μg/mL). Further comparison of the A group embryos treated with ethanol (300 mM) and ethanol + PG (ethanol 300 mM+ 50 or 100 μg/mL PG) did not establish any significant difference (Fig. 4.1). However, in B groups the results were slightly different. Similar to A groups, compared to controls or the embryos exposed to only PG (200 μg/mL), B group embryos showed reduced vessel circulation when exposed only to ethanol (300 mM). However, combinations of PG (50–200 μg/mL) with ethanol (300 mM) showed dose-dependent effect. When B group embryos were exposed to PG (200 μg/mL) and ethanol (300 mM) significant reduction in vessel circulation status than the controls or those exposed to only PG (200 μg/mL) was observed. Reduction of PG concentration to 50 or 100 μg/mL in combination with ethanol (300 mM), vessel circulation of the embryos was at the same level as in controls or in the embryos exposed to only PG (200 μg/mL) (Fig. 4.2). We have further examined the HE of the embryos 10 dpf in these culture conditions (Fig. 4.3 and 4.4). It was observed that like vessel circulation, A group embryos when

293

exposed to only ethanol (300 mM) or in a combination of PG and ethanol (Pg 50–100 μg/mL+300 mM ethanol) HE was reduced significantly when compared with the controls or with the embryos exposed to only PG (100 μg/mL) (Fig. 4.3). In B groups, significant hatching reduction compared to control embryos was noticed in those embryos that have received a combination of ethanol (300 mM) and PG (200 or 50 μg/mL). Other B group embryos (ethanol only or ethanol+PG 100 μg/mL) did not show any significant difference when compared with the corresponding controls (Fig. 4.4). Embryos belonging to A group on 6 dpf were further examined for TC development after staining with Alcian blue (Fig. 5.1–5.4). It was observed that control embryos have paired TC located between the anterior end of the hyosymplectic and the rostral end of the parasphenoid bone (nonspecifically stained in Alcian blue) with extended distal ends lying just above the proximal end of the polar cartilages. The embryos exposed to only PG (100 μg/mL) have well developed TC, however, the distal ends of TC are comparatively shorter than controls and remained further above from the proximal ends of the polar cartilages. The embryos exposed either to only ethanol (300 mM) or in combination with PG (100 μg/mL) have developed tiny TC structures on 6 dpf (Fig. 4.3–4.4), and remained adjacent to ethmoid plate. Further examination indicated that the linear length of TC of ethanol+PG group embryos was comparatively longer than those exposed to ethanol alone. The linear length of neurocranium and TC of B group embryos 7 dpf exposed to ethanol (300 mM), PG (200 μg/mL), and various combinations of PG (50–200 μg/mL)+ethanol (300 mM) 1–3 dpf were measured and compared with B group embryos 7 dpf exposed to clean hatching solution (Fig. 5.5 and 5.6). It was observed that the linear length of neurocranium was significantly reduced in all treatment groups other than only PG (200 μg/mL) when compared with control embryos (Fig. 5.5). Moreover, in case of TC, treatment of only ethanol (300 mM) and ethanol (300 mM) + PG (200 μg/mL) showed significant reduction in linear length when compared with controls; however, embryos exposed to ethanol (300 mM) with a PG concentration 50 μg/mL were unable to establish any significant difference with the controls (Fig. 5.6). 3.2.1. PG is unable to alter embryonic ethanol concentration in medaka embryos To determine whether PG could enhance the ethanol permeability of chorion in Japanese ricefish embryogenesis, we measured the embryonic ethanol concentration of the A group embryos after exposing them to ethanol (300 mM) with or without PG (100 μg/mL) for 48 hpf. Parallel embryos were run without ethanol (control) or with PG (100 μg/mL) and used as negative controls. It was observed that the embryos absorbed a substantial amount of ethanol if it was added to the medium; however, negative data (A340) were obtained in the absence of ethanol (Fig. 6.1) which might be a result of post enzyme–substrate reactions. The average calculated ethanol concentration in embryos exposed to only ethanol is 95 mM, which is approximately 32% of the ethanol concentration added to the medium. Addition of 100 μg/mL PG to the medium did not significantly change the embryonic ethanol concentration (average ethanol concentration is 84 mM which is almost 28% of the ethanol added to the medium) of the embryos when compared with the embryos exposed to only ethanol (Fig. 6.2). 3.2.2. PG is unable to modulate adh5, adh8, aldh2, aldh9a, catalase, GR, and GST mRNA contents in medaka embryos Group A embryos were further examined for the concentration of alcohol metabolizing enzyme (adh5, adh8, aldh2 and aldh9A) and oxidative stress-related enzyme (catalase, GR, GST) mRNAs by quantitative

Fig. 5. Representative photomicrographs of Alcian blue stained group A medaka embryos showing trabecular cartilage development in the neurocranium on 6 dpf (5.1–5.4). The photomicrograms were taken in an Olympus B-max 40 microscope at constant magnification. Both control and PG treated embryos showed well-developed trabecular cartilages (TC) and polar cartilages in the neurocranium, whereas ethanol (300 mM) or ethanol (300 mM) and PG (100 μg/mL) treated embryos had tiny TC. Histograms of linear length of neurocranium (5.5) and trabecular cartilages (TC) of medaka embryos (B groups) (5.6). Each bar is the mean ± SEM of 4–6 embryos measured by using software and asterisks (*) indicate the data are significantly different from the corresponding controls. PG = Panax ginseng; al = ethanol.

294

M.H. Haron et al. / Comparative Biochemistry and Physiology, Part C 157 (2013) 287–297

RT-PCR (qPCR) on 6 dpf. It was observed that among alcohol metabolizing enzymes adh5 remained unaltered in all the treatment groups compared to the controls (Fig. 7.1); however, adh8 mRNA was significantly reduced in the embryos exposed to ethanol or ethanol and PG (Fig. 7.2). PG (100 μg/mL) alone or in combination with ethanol (300 mM) had no effect in altering aldehyde dehydrogenase enzyme mRNAs such as aldh2, and aldh9A measured in this study (Fig. 7.3 and 7.4). With the oxidative stress enzymes catalase and GR remained unaltered in all treatment groups including ethanol (300 mM), PG (100 μg/mL), and PG + ethanol (50–100 μg/mL PG + 300 mM ethanol) when compared with controls (Fig. 7.5 and 7.6). On the other hand, GST mRNA content of the embryos in ethanol only (300 mM) or in combination of PG at 100 μg/mL concentration was able to reduce significantly when compared with the controls. PG at 50 μg/mL concentration when used in combination with ethanol (300 mM) was unable to alter GST mRNA content with regard to controls (Fig. 7.6). 4. Discussion Reports of phytotherapy of alcohol intoxication were published in Chinese Materia Medica, “Ben Chao Gang Mu” in 1590–1596 AD, describing the use of the combination of certain plant extracts including

P. ginseng, in the treatment of alcoholism (Bracken et al., 2011; Tomczyk et al., 2012). Since then many plants were used for the treatment of alcoholism; however, the preparation of these plant extracts vary widely with regard to their chemical composition which may affect the reproducibility of the data. A recent report has shown that black ginseng is able to attenuate ethanol teratogenesis in mouse embryos in vitro (Lee et al., 2009) which prompted us to evaluate the efficacy of ginseng as a preventive agent of FASD, a disorder often observed in the babies of alcoholic mothers who consumed alcohol during pregnancy. One of the potential problems in studying ethanol teratogenesis is finding a suitable animal model for experimental use. Due to ethical issues, human studies of FASD are very limited and several animal models from nonhuman primates to invertebrates have been used to understand the molecular mechanism of FASD. Every animal model is different and it is also very difficult to find a single animal model that can mimic human conditions. Therefore, to understand the molecular mechanism of ethanol toxicity, studies in multiple animal models are necessary. For many years, we have been using Japanese ricefish embryogenesis as an animal model to study the teratogenic effects of ethanol (Dasmahapatra et al., 2005; Wang et al., 2006, 2007a,b; Hu et al., 2008; Wu et al., 2008; Hu et al., 2009; Wu et al., 2011) which has later been used by others and considered as a unique fish model

Adh8 2.5

Adh8 mRNA [Adh8 Ct-Ef 1 Ct]

1.5 1.0

2.0 1.5 1.0 0.5

0.5

l3

00

P-

10

P5

0+

0+

A

A

l3

10 P-

m 00 A

A 0+

Treatment groups

7.2

Aldh9a

Aldh2 3

Aldh9a mRNA (Aldh9a Ct-EF- 1 Ct)

2.0 1.5 1.0 0.5

2

1

P5 0+

A

l-3

00

00 +A

l3

0 P1 00

P10

ol co n

+a l3 50

A 0+

tr

00

00 l3

10 0 10

l-3 00

PP-

M m

ol tr on C

A

P-

7.4

l-3 00

0

0.0

A

Aldh2 mRNA (Aldh2 Ct-EF 1 Ct)

0

M

l ro nt

l3

co

00

00 +A

P1

P5

00

A

P-

l3

10

00 l-3

0

l ro nt co

Treatment groups

7.1

00

0.0 0.0

7.3

*

*

*

l-3

Adh5 mRNA [Adh5 Ct- EF- 1 Ct]

Adh5 2.0

Treatment groups

Fig. 7. Effect of PG (100 μg/mL), ethanol (300 mM) and PG (50–100 μg/mL) + ethanol (300 mM) on adh5 (7.1), adh8 (7.2), aldh2 (7.3), adh9a (7.4), catalase (7.5), glutathione reductase (GR) (7.6) and glutathione-S-transferase (GST) (7.7) mRNA content of medaka embryos (group A) 6 dpf. Total RNA was prepared from 6 to 8 pooled embryos and reverse transcribed and analyzed by qPCR. For each sample, the threshold cycle for internal standard (EFα1) amplification (Ct, EFα1) was subtracted from the threshold cycle of the corresponding enzyme mRNA amplification (Ct, enzyme) to yield ΔCt. For each treatment group, the data are the mean of ΔCt of control samples which was subtracted from each individual sample to yield individual ΔΔCt. Fold induction relative to control samples was calculated as 2−ΔΔCt. Each data is the mean of 3–4 separate experiments. Bar head with asterisks (*) indicates that the mean data is significantly different from the controls. P = Panax ginseng; Al = ethanol.

M.H. Haron et al. / Comparative Biochemistry and Physiology, Part C 157 (2013) 287–297

GR

Catalase 2.0

GR mRNA (GR Ct-EF 1 Ct)

2.5 2.0 1.5 1.0 0.5

0.5

)

0.0

7.6

00

l3

l-3

00

0

P5

0+

A

A P1

00

+

00

10 P-

on C

l3 0+ A P5

P

l-3

tr ol

(N 00

al 0+ 10

l-3 A

7.5

1.0

C

0 30

0 10 P-

00

co

nt

m

ro

M

l

0.0

1.5

A

Catalase mRNA (catalase Ct- EF 1Ct)

295

GST

GST mRNA (GST Ct-EF 1-Ct)

1.5

1.0

*

*

0.5

A 0+ P5

00

+

A

l-3

l-3

00

00

0 10 PP1

A

lc

oh

ol

(3

co

00

nt

m

ro

l

M

)

0.0

7.7

Treatment groups Fig. 7 (continued).

to study ethanol teratogenesis (Oxendine et al., 2006a,b). Our previous studies showed that ethanol is able to induce teratogenic features in medaka embryos that might be considered analogous to human FASD phenotypes (reviewed in Haron et al., 2012). We observed that fertilized medaka embryos exposed to different concentrations of ethanol affect the embryogenesis by forming thrombus in many regions of the body including the brain, delayed to initiate the vessel circulation (flow of blood inside the blood vessel), microcephaly (small head), malformed neurocranial and splanchnocranial cartilages and alteration in oxidative stress. These observations prompted us to utilize Japanese medaka embryogenesis model for screening potential drugs that can attenuate/prevent FASD or any other alcohol-related disorders. We have a unique resource of authenticated plant materials at the NCNPR repository that can provide us novel plant materials which may eliminate the probable variations in chemical composition of plant products originated from multiple sources. The PG (voucher number 66) used in the present experiments was collected from China and the chemical analyses were made at NCNPR facilities (Fig. 1) which showed that the root extract (PG) contained all the major ginsenosides reported in the literature as well as in black ginseng (Lee et al., 2009; Popovich et al., 2012). The determination of IC50 showed that the toxic effects of PG in medaka were specific to the developmental stages of the embryos (Fig. 2.1 and 2.2), because, the blastulae (Iwamatsu stages 9–10, group A embryos) were almost twice as sensitive to PG (355.5 μg/mL in group A v/s 679.6 μg/mL in group B) than that of the embryos at neurula stages (Iwamatsu stages 17–18, group B embryos). Moreover, hatching

efficiencies of the embryos were also affected by PG in a development and dose-dependent manner (Fig. 2.3 and 2.4). We previously found that Japanese ricefish embryos at early stages of development were more sensitive to the root extract of other plants such as blue cohosh (Caulophyllum thalictroides), which is also a potential teratogen, than the embryos at late stages (Wu et al., 2010). Moreover, ethanol, a known teratogen, is also able to induce teratogenic effects in a developmental stage-specific manner in Japanese ricefish embryogenesis (Hu et al., 2009). Therefore, although we have concentrated our observations in group A embryos, to verify the toxic potentials of PG and to demonstrate developmental stage-specific effects we have repeated several of the same experiments in group B embryos. We used sub-lethal concentrations of PG (50–200 μg/mL) as an antagonist of ethanol toxicity which were added simultaneously with ethanol (300 mM) during embryo culture. Some of the embryos were also maintained only in PG containing medium (50–200 μg/mL) and used for comparison. By these experimental designs we have been able to modulate ethanol toxicity with regard to embryo mortality in a dose and developmental stage-specific manner (Fig. 3). In A groups, supplementation of PG at 50–100 μg/mL with ethanol (300 mM) is unable to protect the embryos and maintained the mortality at the same level as in only ethanol (300 mM) group. Moreover, when PG concentration is increased to 200 μg/mL, toxic effects of ethanol are more pronounced and almost all of the A group embryos died (Fig. 3). On the other hand, in B groups, when PG at 50–100 μg/mL is added simultaneously with ethanol (300 mM) embryo survivability remained at the

296

M.H. Haron et al. / Comparative Biochemistry and Physiology, Part C 157 (2013) 287–297

same level as in corresponding controls (not significantly different from the corresponding controls), however, when PG concentration increased to 200 μg/mL, significant ethanol toxicity observed and embryo survivability reduced to ~60% (Fig. 3.2). Therefore, the present studies indicate that PG (50–200 μg/mL) is unable to protect Japanese ricefish embryos from ethanol toxicity at blastula stages; however, partial protection with regard to embryo survivability has been observed in neurula stages. One of the hallmarks of medaka embryogenesis is the onset of vessel circulation (flow of blood through blood vessels) which is generally initiated ~50 hpf (Iwamatsu stage 25) in normal embryogenesis. Moreover, vessel circulation is an indication of the successful progression of morphogenesis. Embryos that failed to initiate vessel circulation in ovo generally failed to hatch spontaneously. When Japanese ricefish embryos are exposed to only PG containing media (50–200 μg/mL), the onset of vessel circulation delayed in a dose-dependent manner; however, all the survived embryos are able to initiate vessel circulation in 6 dpf (after 4 days removal from PG treatments in group A and 3 days in group B embryos). In contrast, all the circulating embryos specifically in B groups exposed to 500 μg/mL and above are unable to hatch by 10 dpf (Fig. 2.4). When PG at sub-lethal concentrations (50–100 μg/mL in group A and 50–200 μg/mL in B groups) is added to the medium simultaneously with ethanol (300 mM) both vessel circulation and hatching are affected in a dose-dependent manner (Fig. 4.2). We therefore examined the TC development in embryos which is also a potential target of ethanol toxicity in medaka embryogenesis (Hu et al., 2009) in addition to vessel circulation (Hu et al., 2008) and hatching. Previously we have observed that Japanese ricefish embryos exposed to 300 mM ethanol 0–48 hpf are able to induce microcephaly (small head) with deformed TC (Hu et al., 2009). We are particularly interested in TC because by using Alcian blue staining, TCs are visible by 4–5 dpf in normal development. These cartilages arise as two C-shaped rods at the anterolateral border of the head and curve backward and inward to lie adjacent to each other along the midline (Langille and Hall, 1987). The anterior end of TC fused with the ethmoid plate and the caudal ends unlike zebrafish (where they are fused with PC) remained adjacent to the anterior ends of the polar cartilages without any fusion. We therefore examined the development of TC in group A embryos 6 dpf (Fig. 4.1–4.4). It has been observed that the development of TC in control and only PG-treated (100 μg/mL) embryos appears to be normal, while the embryos exposed to ethanol (300 mM) only or simultaneously with PG (100 μg/mL) have reduced TC compared to control embryos or the embryos exposed to only PG (100 μg/mL). These data indicate that PG is unable to antagonize ethanol toxicity in Japanese medaka embryogenesis also at this target site (TC) if the treatment initiates in blastula stages. For this, as a follow up to this observation, we have measured the linear length of neurocranium and TC in hatchlings of B groups 7 dpf after staining with Alcian blue and capturing the image by digital photography (Hu et al., 2009). The embryos are exposed 1–3 dpf in PG (50 and 200 μg/mL) with and without ethanol (300 mM). Our data indicate that significant reduction in linear length of neurocranium (Fig. 5.5) has been observed in all treatment groups (ethanol and ethanol + PG), however, antagonistic effect of PG is observed in TC (Fig. 5.6). Therefore, these studies are also in agreement with our previous observation that ethanol disrupted TC early during development in a dose- and developmental stage-specific manner; however, a PG supplement at sub-lethal concentrations is either unable or partially attenuate the effects. Although the mechanism of antagonistic effects of PG on ethanol toxicity in Japanese medaka embryogenesis is unknown to us, we predict that PG either enhanced or reduced ethanol permeability of chorion of Japanese ricefish embryos and increasing embryonic ethanol concentration to toxic levels or vice versa. Therefore, we have analyzed the ethanol concentration of the embryos 2 dpf after exposing them with 300 mM of ethanol with and without PG (100 μg/mL) to see whether PG supplementation altered ethanol concentration in the embryos.

The embryonic ethanol concentration is determined by following the same procedures as we did before (Wang et al., 2006); however, to reduce evaporative ethanol loss from the medium, the embryos are exposed in 2 mL tubes tightly capped (previously in 48-well culture plates). With this modification we have observed that the average embryonic ethanol concentration is significantly higher (34% of the media concentration) than that of our previous observations by Wang et al. (2006) (15–20% of the media concentration). However, supplementation of PG with ethanol in the medium does not enhance the ethanol concentration of the embryos (which are ~ 28% of the media concentration) which indicate that PG may have another target site in Japanese ricefish embryogenesis that is different from ethanol. One of the potential mechanisms of ethanol toxicity is the induction of oxidative stress due to ethanol metabolism. We therefore have focused on mRNAs of ethanol metabolizing enzymes (adh5, adh8, aldh2, aldh9a) and the enzymes which are related to oxidative stress (catalase, GR, GST1). Moreover, among these enzymes adh8, aldh9a, and GST1 are developmentally regulated and ethanol alone disrupted the expression of these enzyme mRNAs in Japanese ricefish embryogenesis (Dasmahapatra et al., 2005; Wang et al., 2007a,b; Wu et al., 2011). In the present experiment we observed that ethanol alone or simultaneously with PG (100 μg/mL) significantly reduced the mRNA content of adh8 and GST1 in comparison to the controls; however, other mRNAs remained unaltered (Fig. 6). These observations are also in agreement with our previous reports that ethanol metabolism and oxidative stress played very insignificant roles in inducing teratogenesis (Wu et al., 2011). Moreover, sublethal concentrations of PG if added in blastula stages are unable to completely antagonize the effect even though it has the potential to augment antioxidative activities (Lee et al., 2009). Taken together, our studies indicate that PG is able to modulate ethanol teratogenesis in Japanese ricefish embryogenesis in a developmental stage-specific manner by potentiaing the toxicity in early stages (blastula), and a dose-dependent protection in late stages (neurula). Moreover, the neurocranial deformities by ethanol were also partially attenuated by PG in B group embryos. Therefore our studies are in agreement with the studies made by Lee et al. (2009) in mouse embryos where they have observed that black ginseng (red ginseng passed through 9 cycles of 95–100 °C for 2–3 h) at 1–100 μg/mL concentration is able to inhibit ethanol-induced teratogenesis in mouse embryos in vitro. Although the mechanisms of inhibition are not fully explored in the studies, the authors predicted that the protective effects of black ginseng are mediated through the augmentation of antioxidative activity of the embryos. Our studies are mainly concentrated on methanolic extracts of ginseng which also contain major ginsenosides (Fig. 1). The differences also exist in the animal model (Japanese ricefish) which is lower in the evolutionary order than mice and also in the concentration of ethanol (1 μL/mL vs. 300 mM which is equivalent to ~16 μL/mL) used by us. Reduction in adh8 and GST1 mRNA expression by ethanol alone or in combination with PG indicated that the toxic effects of ethanol in Japanese rice fish embryogenesis are mediated by the generation of oxidative stress, however, PG failed to antagonize the effect in blastula or neurula. Despite differences in experimental conditions, our data indicate that there must be a different mechanism rather than targeting oxidative stress in Japanese ricefish embryogenesis by which ginseng saponins mediate ethanol antagonism.

Acknowledgments We are thankful to Professor Larry Walker, Director, NCNPR, and Professor of the Department of Pharmacology, of the University of Mississippi, UM, for his kind interest and generous support to the work. This work was supported in part by the United States Food and Drug Administration (FDA) (FD-U-002071-01, and 1UO1FD004246).

M.H. Haron et al. / Comparative Biochemistry and Physiology, Part C 157 (2013) 287–297

References Abel, E.L., Hannigan, J.H., 1995. Maternal risk factors in fetal alcohol syndrome: provocative and permissive influences. Neurotoxicol. Teratol. 17, 445–462. Autti-Ramo, I., Fagerlund, A., Ervalahti, N., Loimu, L., Korkman, M., Hoyme, H.E., 2006. Fetal alcohol spectrum disorder in Finland: clinical delineation of 77 older children and adolescents. Am. J. Med. Genet. A 140, 137–143. Back, N.I., Kim, D.S., Lee, Y.H., Park, J.D., Lee, C.B., Kim, S.I., 1996. Ginsenosides Rh4, a genuine dammarane glycoside from Korean red ginseng. Planta Med. 62, 86–87. Blumenthal, M., 2001. Herb sales down 15 percent in mainstream market. HerbalGram 51, 69. Bracken, B.K., Penetar, D.M., Maclean, R.R., Lukas, S.E., 2011. Kudzu root extract does not perturb the sleep/wake cycle of moderate drinkers. J. Altern. Complement. Med. 17, 961–966. Burd, L., Moffatt, M.E., 1994. Epidemiology of fetal alcohol syndrome in American Indians, Alaskan Natives, and Canadian Aboriginal peoples: a review of the literature. Public Health Rep. 109, 688–693. Carai, A.M., Agabio, R., Bombardelli, E., Bourov, I., Gessa, G.L., Lobina, C., Morazzoni, P., Pani, M., Reali, R., Vacca, G., Colombo, G., 2000. Potential use of medicinal plants in the treatment of alcoholism. Fitoterapia 71, s38–s42. Collins, G.B., McAllister, M.S., Adury, K., 2006. Drug adjuncts for treating alcohol dependence. Cleve. Clin. J. Med. 73, 641–652. Cook, P.S., Petersen, R.C., Moore, D.T., 1990. Alcohol, tobacco and other drugs may harm the unborn. Publication No ADM 90-1711. US Department of Health and Human Services, Bethesda, MD, p. 17. Cudd, T.A., 2005. Animal model systems for the study of alcohol teratology. Exp. Biol. Med. 230, 389–393. Dasmahapatra, A.K., Wimpee, B.A.B., Trewin, A.L., Wimpee, C.F., Ghorai, J.K., Hutz, R.J., 2000. Demonstration of 2, 3, 7, 8-tetrachlorodibenzo-p-dioxin attenuation of P450 steroidogenic enzyme mRNAs in rat granulosa cells in vitro by competitive reverse transcriptase polymerase chain reaction assay. Mol. Cell. Endocrinol. 164, 5–18. Dasmahapatra, A.K., Wang, X., Haasch, M.L., 2005. Expression of Adh8 mRNA is developmentally regulated in Japanese medaka (Oryzias latipes). Comp. Biochem. Physiol. B 140, 657–664. Duimstra, C., Johnson, D., Kutsch, C., Wang, B., Zentner, M., Kellerman, S., Welty, T.A., 1993. Fetal alcohol syndrome surveillance pilot project in American Indian communities in the Northern Plains. Public Health Rep. 108, 225–229. Haron, M., Powe, D., Khan, I.A., Dasmahapatra, A.K., 2012. Feasibility ofmedaka (Oryzias latipes) as an animal mode to study fetal alcohol spectrum disorder. In: Fishben, J.C., Heilman, J.A. (Eds.), Advances in Molecular Toxicology, vol. 6. Elsevier, Amsterdam, The Netherlands, pp. 77–128 (Chapter 3). Hu, Y., Khan, I.A., Dasmahapatra, A.K., 2008. Disruption of circulation by ethanol promotes fetal alcohol spectrum disorder (FASD) in medaka (Oryzias latipes) embryogenesis. Comp. Biochem. Physiol. C 148, 273–280. Hu, Y., Willett, K.L., Khan, I.A., Scheffler, B.E., Dasmahapatra, A.K., 2009. Ethanol disrupts chondrification of the neurocranial cartilages in medaka embryos without affecting aldehyde dehydrogenase 1A2 (Aldh1A2) promoter methylation. Comp. Biochem. Physiol. C 150, 495–502. Langille, R.M., Hall, B.K., 1987. Development of the head skeleton of the Japanese medaka, Oryzias latipes (Teleostei). J. Morphol. 193, 135–158. Lee, Se-Ra, Kim, Mi-Ra, Yon, Jung-Min, Baek, In-Jeoung, Park, C.G., Lee, B.J., Yun, Y.W., Nam, Sang-Yoon, 2009. Black ginseng inhibits ethanol-induced teratogenesis in cultured mouse embryos through its effects on antioxidant activity. Toxicol. In Vitro 23, 47–52. Liberti, L.E., Der Mardersian, A., 1978. Evaluation of commercial ginseng products. J. Pharmacol. Sci. 10, 1487–1489. Liu, C.-X., Xiao, P.-G., 1992. Recent advances in ginseng research in China. J. Ethnopharmacol. 36, 27–38. Manning, M.A., Eugene, H.H., 2007. Fetal alcohol spectrum disorders: a practical clinical approach to diagnosis. Neurosci. Biobehav. Rev. 31, 230–238. May, P.A., Gossage, J.P., White-Country, M., Goodhart, K., Decoteau, S., Trujillo, P.M., Kalberg, W.O., Viljeon, D.L., Hoyme, H.E., 2004. Alcohol consumption and other maternal risk factors for fetal alcohol syndrome among three distinct samples of women before, during, and after pregnancy: the risk is relative. Am. J. Med. Genet. 127, 10–20. McGregor, N.R., 2007. Pueraria lobata (Kudzu root) hangover remedies and acetaldehydeassociated neoplasm risk. Alcohol 41, 469–478.

297

Overstreet, D.H., Keung, W.-M., Rezvani, A.H., Massi, M., Lee, D.Y.W., 2003. Herbal remedies for alcoholism: promises and possible pitfalls. Alcohol. Clin. Exp. Res. 27, 177–185. Oxendine, S.L., Cowden, J., Hinton, D.E., Padilla, S., 2006a. Adapting the medaka embryo assay to a high-throughput approach for developmental toxicity testing. Neurotoxicology 27, 480–485. Oxendine, S.L., Cowden, J., Hinton, D.E., Padilla, S., 2006b. Vulnerable windows for developmental ethanol toxicity in the Japanese medaka fish (Oryzias latipes). Aquat. Toxicol. 80, 396–404. Phillipson, J.D., Anderson, L.A., 1984. Ginseng-quality safety and efficacy? Pharm. J. 232, 161–165. Popovich, D.G., Yeo, C.-R., Zhang, W., 2012. Ginsenosides derived from Asian (Panax ginseng), American ginseng (Panax quinquefolius) and potential cytotoxicity. Int. J. Biomed. Pharm. Sci. 6, 56–62. Reimers, M.J., Flocktom, A.R., Tanguay, R.L., 2004. Ethanol- and acetaldehyde-mediated developmental toxicity in zebrafish. Neurotoxicol. Teratol. 26, 769–781. Rezvani, A.H., Overstreet, D.H., Perfumi, M., Massi, M., 2003. Plant derivatives in the treatment of alcohol dependency. Pharmacol. Biochem. Behav. 75, 593–606. Russo, D., Purohit, V., Foudin, L., Salin, M., 2004. Workshop on alcohol use and health disparities 2002: a call to arms. Alcohol 32, 37–43. Sampson, P.D., Streissguth, A.P., Bookstein, F.L., Little, R.E., Clarren, S.K., Dehaene, P., Hanson, J.W., Graham Jr., J.M., 1997. Incidence of fetal alcohol syndrome and prevalence of alcohol-related neurodevelopmental disorder. Teratology 56, 317–326. Sari, Y., Gozes, I., 2006. Brain deficits associated with fetal alcohol exposure may be protected, in part, by peptides derived from activity-dependent neurotrophic factor and activity-dependent neuroprotective protein. Brain Res. Rev. 52, 107–118. Seely, D., Dugoua, J.J., Perri, D., Mills, E., Koren, G., 2008. Safety and efficacy of Panax ginseng during pregnancy and lactation. Can. J. Clin. Pharmacol. 15, e87–e94. Smolinski, A.T., Pestka, J.J., 2003. Modulation of lipopolysaccharide-induced proinflammatory cytokine production in vitro and in vivo by the herbal constituents apigenin (chamomile), ginsenoside Rb1 (ginseng) and parthenolide. Food Chem. Toxicol. 41, 1381–1390. Streissguth, A.P., O'Malley, K., 2000. Neuropsychiatric implications and long-term consequences of fetal alcohol spectrum disorders. Semin. Clin. Neuropsychiatry 5, 177–190. Tomczyk, M., Zovko-Koncic, M., Chrostek, L., 2012. Phytotherapy of alcoholism. Nat. Prod. Commun. 7, 273–280. Wang, X., Williams, E., Haasch, M.L., Dasmahapatra, A.K., 2006. Japanese medaka (Oryzias latipes): developmental model for the study of alcohol teratology. Birth Defects Res. B Dev. Reprod. Toxicol. 77, 29–39. Wang, X., Zhu, S., Khan, I.A., Dasmahapatra, A.K., 2007a. Ethanol attenuates Aldh9 mRNA expression in Japanese medaka (Oryzias latipes) embryogenesis. Comp. Biochem. Physiol. B 146, 357–363. Wang, X., Khan, I.A., Dasmahapatra, A.K., 2007b. Developmental regulation of ethanol metabolizing enzyme mRNA expression in Japanese medaka (Oryzias latipes). In: Ostrovskiy, M.H. (Ed.), Leading-Edge Messenger RNA Research Communication. Nova Publishers, pp. 169–181 (Chapter 11). Williams, S.H., 2005. Medications for treating alcohol dependence. Am. Fam. Physician 72, 1775–1780. Wu, M., Chaudhury, A., Khan, I.A., Dasmahapatra, A.K., 2008. Ethanol teratogenesis in Japanese medaka: effects at the cellular level. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 149, 191–201. Wu, M., Hu, Y., Ali, Z., Khan, I.A., Verlangieri, A.J., Dasmahapatra, A.K., 2010. Teratogenic effects of blue cohosh (Caulophyllum thalictroides) in Japanese medaka (Oryzias latipes) are probably mediated through GATA2/EDN1 signaling pathways. Chem. Res. Toxicol. 23, 1405–1416. Wu, M., Shariat-Madar, B., Haron, M.H., Wu, M., Khan, I.A., Dasmahapatra, A.K., 2011. Ethanol-induced attenuation of oxidative stress is unable to alter mRNA expression pattern of catalase, glutathione reductase, glutathione-S-transferase (GST1A), and superoxide dismutase (SOD3) enzymes in Japanese rice fish (Oryzias latipes) embryogenesis. Comp. Biochem. Physiol. 153C, 159–167. Xu, B.J., Zheng, Y.N., Sung, C.K., 2005. Natural medicines for alcoholism treatment: a review. Drug Alcohol Rev. 24, 525–536. Zhou, F.C., Fang, Y., Goodlett, C., 2008. Peptidergic agonists of activity-dependent neurotrophic factor protect against prenatal alcohol-induced neural tube defects and serotonin neuron loss. Alcohol. Clin. Exp. Res. 32, 1361–1371.