- Email: [email protected]
Molecular and functional characterization of an acetyl-CoA acetyltransferase from the adzuki bean borer moth Ostrinia scapulalis (Lepidoptera: Crambidae)
Insect Biochemistry and Molecular Biology 40 (2010) 74e78
Contents lists available at ScienceDirect
Insect Biochemistry and Molecular Biology journal homepage: www.elsevier.com/locate/ibmb
Molecular and functional characterization of an acetyl-CoA acetyltransferase from the adzuki bean borer moth Ostrinia scapulalis (Lepidoptera: Crambidae) Takeshi Fujii a, *, Katsuhiko Ito b, Susumu Katsuma b, Ryo Nakano a, Toru Shimada b, Yukio Ishikawa a a b
Laboratory of Applied Entomology, Graduate School of Agricultural and Life Sciences, University of Tokyo, Bunkyo-ku, Tokyo 113-8657, Japan Laboratory of Insect Genetics and Bioscience, Graduate School of Agricultural and Life Sciences, University of Tokyo, Bunkyo-ku, Tokyo 113-8657, Japan
a r t i c l e i n f o
a b s t r a c t
Article history: Received 14 September 2009 Received in revised form 7 December 2009 Accepted 9 December 2009
Two types of thiolases are involved in the synthesis and catabolism of fatty acids; acetyl-CoA acetyltransferase (AT) which catalyzes the formation of acetoacetyl-CoA from acetyl-CoA by transferring an acetyl group from one acetyl-CoA molecule to another, and 3-ketoacyl-CoA thiolase which catalyzes a reversible thiolytic cleavage of 3-ketoacyl-CoA into acetyl-CoA and acyl-CoA. Although many mammalian thiolases have been characterized in detail, no thiolases from insects have been functionally characterized to date. Here we report first characterization of an insect AT gene, Osat1, from the pheromone gland of the adzuki bean borer moth Ostrinia scapulalis (Lepidoptera; Crambidae). Osat1 encodes a 41.2 kDa protein comprising 396 amino acid residues (OsAT1), which possesses structural features of the thiolase family. An Osat1 homologue of Bombyx mori (Bmat1) was cloned through exploration of an EST library of the silkworm. Subsequent survey of the genome database revealed that B. mori has at least six Osat1 homologues, among which Bmat1 was most closely related to Osat1. We expressed recombinant OsAT1 using a baculovirus expression system, and verified that OsAT1 catalyzes the formation of acetoacetyl-CoA from acetyl-CoA. Osat1 was expressed in all adult tissues examined. These results indicate that OsAT1 is a functional AT ubiquitously expressed in O. scapulalis tissues. Ó 2009 Elsevier Ltd. All rights reserved.
Keywords: Acetyl-CoA acetyltransferase Thiolase Pheromone gland Baculovirus expression system Ostrinia scapulalis
1. Introduction Thiolases are crucial enzymes implicated in the synthesis and catabolism of fatty acyl-CoA in both prokaryotes and eukaryotes (Igual et al., 1992). In eukaryotes, different types of thiolases have been found in the cytosol, mitochondria, and peroxisomes (Miyazawa et al., 1980). Thiolases can be classified into two types based on the direction of the reactions they catalyze (Modis and Wierenga, 2000): one is a biosynthetic thiolase [acetyl-CoA acetyltransferase (EC2.3.1.9)], which catalyzes the biological Claisen condensation of acetyl-CoA, i.e., the formation of acetoacetyl-CoA from acetyl-CoA by transferring an acetyl group from one acetyl-CoA molecule to another (Clinkenbeard et al., 1973). The other is a degradative thiolase [3-ketoacyl-CoA thiolase (EC2.3.1.16)], which catalyzes the last reaction of the b-oxidation cycle, the thiolytic cleavage of 3-ketoacyl-CoA (Clinkenbeard et al.,
* Corresponding author at: Department of Agricultural and Environmental Biology, Graduate School of Agricultural and Life Sciences, The University of Tokyo, Yayoi 1-1-1, Bunkyo-ku, Tokyo 113-8657, Japan. Tel.: þ81 3 5841 5062; fax: þ81 3 5841 5061. E-mail address: [email protected] (T. Fujii). 0965-1748/$ e see front matter Ó 2009 Elsevier Ltd. All rights reserved. doi:10.1016/j.ibmb.2009.12.012
1973; Schiedel et al., 2004; Zeng and Li, 2004). The thiolase family commonly has a glycine-rich motif (G-rich motif; CIGXGXG), which is conserved in the C-terminal region (Arakawa et al., 1987). Furthermore, three amino acid residues, cysteine 89 (Cys89), Cys382 and histidine 352 (His352), are completely conserved among thiolases. Cys89 is involved in the formation of an acyl-enzyme intermediate (Thompson et al., 1989; Palmer et al., 1991), and Cys382 is the active center essential for the deprotonation step in the condensation reaction (Thompson et al., 1989; Palmer et al., 1991; Williams et al., 1992; Modis and Wierenga, 1999; Kursula et al., 2002). A study on rat mitochondrial thiolase revealed that His352 is also a catalytic residue of 3-ketoacyl-CoA thiolase (Zeng and Li, 2004). During the course of extensive studies on the genes expressed in the pheromone gland of the adzuki bean borer moth, Ostrinia scapulalis (Lepidoptera; Crambidae) (Antony et al., 2009; Sakai et al., 2009), we were able to clone a gene encoding a putative thiolase with a typical glycine-rich motif, CIGXGXG. Because we found that not a single thiolase gene from insects had been functionally characterized despite the importance of thiolases, we performed a functional assay of the newly cloned gene. In this paper, we report for the first time the functional characterization of an insect thiolase.
T. Fujii et al. / Insect Biochemistry and Molecular Biology 40 (2010) 74e78
2. Materials and methods 2.1. Insect and cell lines Female moths of O. scapulalis were collected at Matsudo, Japan (35.5 N, 139.6 E), and the offspring were reared as described previously (Takanashi et al., 2005). The Sf9 cells were maintained in TC-100 medium with 10% fetal bovine serum as described previously (Katsuma et al., 2006). 2.2. RNA extraction from pheromone gland and other tissues Pheromone gland (PG), flight muscle (FM), legs (Lg), epidermis (Ep), fat bodies (FB) and Eggs (Eg) were dissected from 1- to 3-dayold female moths in phosphate-buffered saline [PBS, 2.5 mM KCl, 141 mM NaCl, 8.1 mM Na2HPO4, and 2.5 mM KH2PO4 (pH 7.0)]. Total RNA was isolated from each tissue using RNAiso (Takara), treated with DNase I (Qiagen), and stored at 80 C prior to use. 2.3. Cloning of Osat1 (O. scapulalis acetyltransferase 1) cDNA One microgram of total RNA was reverse-transcribed with an oligo-dT adaptor primer using an RNA PCR Kit, Ver.3.0 (Takara). The resultant cDNA was used as a template for cloning of Osat1 cDNA. Degenerate primers (DPs in Table 1) were designed based on a putative acetyl-CoA acetyltransferase gene of Macaca fascicularis AB172715 and sequences of insects showing a high degree of similarity to this gene (Drosophila melanogaster AY089528 and Aedes aegypti DQ440481). PCR was performed with ExTaq polymerase (Takara) under the following conditions: 94 C for 2 min, 5 cycles of 94 C for 30 s, 37 C for 30 s, and 68 C for 60 s, 30 cycles of 94 C for 30 s, 42 C for 30 s, and 68 C for 60 s, and finally 72 C for 7 min. Based on the cDNA sequence obtained by the degenerate PCR, the full-length cDNA of Osat1 was cloned using a GeneRacerÔ Kit (Invitrogen) with gene-specific primer sets (see Fig. 1 and Table 1). 2.4. Expression profiling by RT-PCR A tissue-distribution analysis of Osat1 mRNA was performed by RT-PCR with a gene-specific primer set (RT_F and RT_R in Table 1) under the following conditions; 94 C for 2 min, and 30 cycles of 94 C for 30 s, 55 C for 30 s, and 68 C for 30 s cDNAs from adult tissues were prepared as described above (see Section 2.3). 2.5. Phylogenetic analysis
75
Table 1 Nucleotide sequences of primers used in this study. Primer name
Primer sequence from 50 to 30
DP
GCNTWYGGNACNTTYGG YTGNCCNCCNCCDATRC ATCTGCTCGTCCACCTCCTTCATGG CCTACTGTATCGACAACGAGGCCC GGAAGCCGGAGCCGCAGAGGCGG CATGTTTTCTACACCGCCGG GAACGGCGGCGCCACCGCGCTCGG GAGCACCCGCGGCCTCAGACCACC ATGTCTGTAGCTGTTAAAGG CCTTAGCGGCGCCGGTGAGGATGTCC ACTAGTCATGTCTGTAGCTGTTAAAGG GCATGCTTAATGGTGATGATGGTGATGGACGGCTTCAACCATGAGAGC
Tubulin NRP50 RP50 NRP30 RP30 RT F RT R SpeI-ATFwd AT-SphI/His(þ)
Bold types and the underline indicate restriction enzyme sites and the His-tag, respectively.
The coding region of OsAT1 with a His-tagged sequence at the C terminus was PCR-amplified with a set of gene-specific primers containing restriction enzyme sites [SpeI-ATFwd, and AT-SphI/His (þ)] as listed in Table 1. The PCR products were subcloned into the pGEM-T easy vector (Promega) and sequenced using an ABI3130xl genetic analyzer (Applied Biosystems). The Osat1 with a His-tag was then cloned into the vector pFastBac1 (Invitrogen). Recombinant AcNPVs were generated and propagated as described previously (Katsuma et al., 2006). The resultant AcNPV with the His-tagged OsAT1 was named OsAT1-His-AcNPV. 2.7. SDS-PAGE and Western blotting SDS-PAGE and Western blotting were performed as described previously (Katsuma et al., 2006). Briefly, Sf9 cells infected with OsAT1-His-AcNPV were rinsed with PBS, homogenized in 200 mL of buffer containing 20 mM TriseHCl (pH 7.4), 150 mM NaCl, 1% NP-40, and E64 (a cysteine protease inhibitor), and incubated on ice for 45 min. The homogenate was centrifuged at 12,000g for 10 min at 4 C and the supernatant was collected. After the addition of an SDS sample buffer, the samples were separated on 12% gels by SDS-PAGE, and transferred to polyvinylidene fluoride (PVDF) membranes (Immobilon-P, Millipore). Expression of recombinant OsAT1 in Sf9 cells was detected with an anti-His antibody (Qiagen, 1: 3000 dilution). We found that the preparation of the cell lysate without E64 resulted in a marked degradation of OsAT1 presumably due to activation of AcNPV cysteine proteinase (data not shown; Hom et al., 2002).
The amino acid sequences of putative thiolases were aligned using the Clustal W program and a phylogenetic tree was constructed by the neighbor-joining method. The following sequences, which showed high scores in a Blast P search of the NCBI database with OsAT1 (GenBank accession no. AB466326) as a query, were used for this analysis: Bombyx mori (BmAT1) AB516425; Caenorhabditis elegans, NP_499752; Apis mellifera XP_391843; Nasonia vitripennis XP_001606212; Acyrthosiphon pisum, XP_001950874; Tribolium castaneum, XP_968373; Culex quinquefasciatus, XP_001844011; A. aegypti, DQ440481; Drosophila simulans, XP_002078831; D. melanogaster, NP_523528; Drosophila sechellia XP_002036395; Drosophila yakuba, XP_002088990; Drosophila mojavensis, XP_002003078 and Drosophila virilis, XP_002052446. The KAIKO base (http://sgp.dna.affrc.go.jp/Kaikobase/) was explored for Osat1 homologues in the Bombyx genome.
2.8. Localization of recombinant OsAT1 in Sf9 cells
2.6. Construction of recombinant Baculoviruses
2.9. Thiolase assay
The recombinant Autographa californica nucleopolyhedrovirus (AcNPV) was constructed using a Bac-to-Bac system (Invitrogen).
Sf9 cells seeded in a cell culture dish (4 60 mm) were infected with OsAT1-His-AcNPV or Bac1-AcNPV (negative control). At 72 hours
Sf9 cells infected with OsAT1-His-AcNPV were homogenized in 200 ml of PBS containing E64 (30 mg/ml) by a motor-driven Teflon pestle. Unbroken cells and debris in the homogenate were removed by centrifugation at 300g for 15 min. The supernatant (fraction 0) was centrifuged at 800g for 15 min; the pellet, which consists primarily of nuclei and a significant amount of mitochondria, is referred to as fraction 1. The supernatant was centrifuged at 7,500g for 20 min; the pellet, which consists of mitochondria, is referred to as fraction 2. The supernatant was centrifuged at 20,000g for 90 min to roughly separate microsomes (pellet, Fraction 3) from the cytosol (supernatant, Fraction 4). The final volume of each fraction was adjusted to 200 ml and Western blotting was performed as described above (see Section 2.7).
76
T. Fujii et al. / Insect Biochemistry and Molecular Biology 40 (2010) 74e78
Fig. 1. Nucleotide and deduced amino acid sequences of Osat1. Three catalytic residues responsible for the thiolase activity are shaded, and a G-rich motif is boxed. All primer positions are indicated by arrows.
postinfection (hpi), infected cells were collected by centrifugation at 800g for 10 min, and the cell pellet was solubilized by TBS buffer containing 1% NP-40. The soluble fraction was concentrated using Amicon Ultra centrifugal filter devices (3000 NMWL membrane, Millipore) at 3000 g for 30 min and used as a recombinant OsAT1 solution. To characterize the enzymatic activity of OsAT1, a thiolase assay was performed as reported by Clinkenbeard et al. (1973). An inactivated recombinant OsAT1 solution (negative control) was prepared by heating the solution at 100 C for 1 h. The formation of acetoacetyl-CoA from acetyl-CoA was monitored at 303 nm with an ND 1000 spectrophotometer (Nano drop) in the presence of divalent magnesium ions at pH 8.8 (the Mg2þ-enolate complex of acetoacetylCoA is specifically detected as absorbance at 303 nm). We verified in preliminary experiments that (1) among free CoA, acetyl-CoA and acetoacetyl-CoA, only acetoacetyl-CoA forms a complex with Mg2þ which is detectable at 303 nm, and (2) Mg2þ did not form a complex with unknown factors in the recombinant OsAT1 solution when monitored at 303 nm. The reaction was initiated by addition of OsAT1-His-AcNPV solution containing ca. 90 mg of protein to a reaction mixture (100 mM TriseHCl, pH 8.8, 25 mM MgCl2 and 4 mM of substrate acetyl-CoA) held at 30 C. 2.10. Data deposition The nucleotide sequences of Osat1 and Bmat1 have been submitted to the EMBL/GenBank Data Libraries with accession nos. AB466326 and AB516425, respectively. Six Osat1 homologues found in Bombyx genome (BGIBMGA 012659, BGIBMGA 012660,
BGIBMGA 012661, BGIBMGA011029, BGIBMGA014181, BGIBMGA009103) were annotated as thiolases.
and
3. Results 3.1. Cloning and sequencing of Osat1 cDNA We cloned a w1000-bp cDNA fragment containing a G-rich motif from the first-strand cDNA prepared from the pheromone gland of O. scapulalis. Next, we performed 30 - and 50 -RACE and obtained the complete open reading frame (ORF) of this gene, Osat1 (O. scapulalis acetyl-CoA acetyltransferase 1). The Osat1 gene contained an ORF of 1188 bp encoding 396 amino acid residues with the predicted molecular mass of 41.2 kDa. An amino acid sequence analysis with the program SOSUI (http://bp.nuap.nagoya-u.ac.jp/ sosui/) revealed that OsAT1 has no trans-membrane domains. The three amino acid residues, Cys94, His352, and Cys382, which are essential to the enzymatic activity of the thiolase family (Zeng and Li, 2004), are conserved in OsAT1. 3.2. Homologues of Osat1 in B. mori We were able to find an Osat1 homologue in the EST database of the silkworm B. mori (SilkBase, http://morus.ab.a.u-tokyo.ac.jp/cgibin/index.cgi). We determined its sequence (AB516425), and named it Bmat1 (B. mori acetyltransferase 1). The deduced amino acid sequence of Bmat1 (BmAT1) had a G-rich motif, CIGGGQG, which is typical of thiolases. A phylogenetic analysis showed that OsAT1 and
T. Fujii et al. / Insect Biochemistry and Molecular Biology 40 (2010) 74e78
77
BmAT1 belong to the same clade in the phylogenetic tree of putative thiolases from insects (Fig. 2A). Subsequent exploration of the Bombyx genome revealed six Osat1 homologues including Bmat1 (Fig. 2B). While two of these homologues (Bmat1 and BGIMGA012660) had the motif CIGGGQG, two (BGIBMGA012661 and BGIMGA011029) had a variant motif, CNGGGGA, and the remaining two (BGIBMGA014181 and BGIMGA009103) had no G-rich motif (Fig. 2B). Interestingly, BGIMGA011029, which has the variant motif CNGGGGA, turned out to be equivalent to AB274998, which encodes a putative acetoacetyl thiolase (AACT_Bm) implicated in JH biosynthesis (Kinjoh et al., 2007).
with OsAT1-His-AcNPV and Bac1-AcNPV. The lysate from the cells infected with OsAT1-His-AcNPV had AT activity, and the formation of acetoacetyl-CoA proceeded in a time-dependent and dosedependent manner (Fig. 4). The apparent AT activity of the lysate from the cells infected with the control virus, relative to the heatinactivated lysate, presumably represents the endogenous thiolase activity in Sf9 cells (Fig. 4). Overall, these results indicate that OsAT1 is a functional AT.
3.3. Expression of recombinant OsAT1 by a baculovirus system
The expression profile of Osat1 mRNA was examined by RT-PCR. As shown in Fig. 5, Osat1 mRNA was ubiquitously expressed in 6 adult tissues including pheromone gland, suggesting that OsAT1 is not a pheromone gland-specific AT.
The recombinant OsAT1 was expressed by AcNPV (OsAT1-HisAcNPV) as a C-terminal His-tagged form. Sf9 cells were infected with OsAT1-His-AcNPV and collected at 72 hpi. Western blotting with the anti-His antibody showed that the His-tagged OsAT1 was expressed with a molecular mass of approximately 40 kDa (Fig. 3A). We next examined the distribution of the His-tagged OsAT1 protein in Sf9 cells. Western blotting of cell lysate fractions with the anti-His antibody showed that OsAT1 in Sf9 cells was strongly expressed in the cytosolic fraction (fraction 4), rather than nuclear and mitochondrial fractions (fractions 1 and 2, respectively) (Fig. 3B). This suggests that OsAT1 is mainly located in the cytosol.
3.5. Expression profile of Osat1 mRNA
4. Discussion
To examine the acetyl-CoA acetyltransferase (AT) activity of the recombinant OsAT1, we prepared cell lysate from Sf9 cells infected
In this study, we cloned a thiolase gene, Osat1, from the pheromone gland of O. scapulalis, and showed that the recombinant OsAT1 catalyzes formation of acetoacetyl-CoA from acetyl-CoA. Results of a Western blot analysis of OsAT1 in Sf9 cell fractions suggested that OsAT1 is a cytosolic enzyme (Fig. 3B). This type of thiolase is crucial to the biosynthesis of cholesterol and terpenoid (Middleton, 1973). Although many sequences of insects, such as Drosophila yippee interacting protein 2 (yip2, NP_523528), have been annotated as a “thiolase” or “acetyl-CoA acetyltransferase”, their thiolytic activities have not actually been investigated (Lindquist and Faye, 2001). To the best of our knowledge, this is the first
Fig. 2. Phylogenetic analysis of OsAT1 and its homologues. (A) Neighbor-joining tree of OsAT1 and sequences showing a high degree of identity to this protein. All insect sequences have the G-rich motif CIGGGQG. Genbank accession numbers are shown beside the species name. Bootstrap values with 1000 resamplings are shown near branches, and the genetic distance is drawn to scale. (B) Neighbor-joining tree of nucleotide sequences homologous to OsAT1 found in the Bombyx genome. The sequence of the G-rich motif is shown. The acetoacetyl-CoA thiolase (AACT_Bm, AB274998) suggested to be involved in juvenile hormone biosynthesis (Kinjoh et al., 2007) corresponds to BGIBMGA011029. BGIBMGA014181 and BGIBMGA009103 appear not to possess a G-rich motif.
Fig. 3. Expression of recombinant OsAT1 by a baculovirus expression system. (A) The cell lysate (Cell) and supernatant (Sup.) prepared from Sf9 cells infected with OsAT1-HisAcNPV were separated on a 12% acrylamide gel and stained with Coomassie brilliant blue (CBB, left panel). A Western blot analysis was performed with anti-His antibody (right panel). The molecular weights of protein standards are indicated on the left. (B) Subcellular distribution of OsAT1 in Sf9 cells. From the supernatant of the cell homogenate (Fraction 0), fractions rich in nuclei (1), mitochondria (2), microsomes (3) and cytosol (4) were prepared by the method described in Section 2.8 of Materials and methods.
3.4. Enzymatic activity of OsAT1
78
T. Fujii et al. / Insect Biochemistry and Molecular Biology 40 (2010) 74e78
expression level in the corpora allata suggested that AACT_Bm to be involved in the mevalonate pathway that is connected to juvenile hormone (JH) biosynthesis (Kinjoh et al., 2007). It is tempting to assume that a thiolase expressed in a specific tissue for a specific role differentiated from an ancestral thiolase, which is ubiquitously expressed in all cells, after duplication of the gene. Our study points to the necessity for further studies on the evolution of thiolases. Acknowledgements We thank Eiriki Sunamura for his helpful comments on this manuscript. This work was supported by grants from MEXT (Nos. 19208005 to Y.I. and 19688004 to S.K.). Fig. 4. Thiolase assay of OsAT1. Thiolase activity of cell lysate from Sf9 cells infected with OsAT1-His-AcNPV or Bac1-AcNPV. 0 min indicates the addition of cell lysate. Diluted OsAT1: the lysate was diluted to 1/8 of that used in OsAT1-His-AcNPV. Deactivated OsAT1: the lysate was treated at 100 C for 1 h prior to the assay.
report characterizing a biosynthetic thiolase (acetyl-CoA acetyltransferase; AT) from an insect. Two cysteines (Cys89 and Cys378) and one histidine (His348) are important for the catalytic activity of mammalian thiolases (Palmer et al., 1991; Zeng and Li, 2004). As shown in Fig. 1, these three residues are conserved in OsAT1 (Cys94, His352 and Cys382), suggesting that the catalytic mechanism of the insect thiolase is similar to that of thiolases from other organisms. AT catalyzes the formation of acetoacetyl-CoA from two acetylCoA molecules, or the reverse reaction, the thiolytic cleavage of acetoacetyl-CoA. The AT activity has been measured by spectrophotometric monitoring of the generation of the Mg2þ-enolate complex of actoacetyl-CoA (Clinkenbeard et al., 1973). According to the twostep ‘ping-pong’ mechanism proposed for the thiolase reaction (Modis and Wierenga, 1999), a degradative reaction and a biosynthetic reaction are interconnected via a covalent acetyl-enzyme intermediate, and the reactions are affected by the concentrations of acetyl-CoA and free CoA (Modis and Wierenga, 2000). We observed that the rate of formation of acetoacetyl-CoA decreased rapidly after a steep increase in acetoacetyl-CoA within 1 min (Fig. 4). Similar phenomena were observed when the amount of cell lysate was decreased (Fig. 4) or the concentration of the substrate (acetylCoA) was varied (data not shown). These phenomena might be ascribed to the use of lysates of Sf9 cells expressing OsAT1, which contain various endogenous enzymes that interact with the reaction product, acetoacetyl-CoA. In addition to Bmat1, which is most closely related to Osat1 and shares the common G-rich motif CIGGGQG, five Osat1 homologues were found in the B. mori genome (Fig. 2B). Among them, AACT_Bm (AB274988), was found to have amino acids (Cys75, His346 and Cys362) essential to thiolase activity, although its G-rich motif CNGGGGA was new to the thiolase family. AACT_Bm, annotated as acetoacetyl-CoA thiolase, is predominantly expressed in the corpora allata (Kinjoh et al., 2007). Developmental changes in its
Fig. 5. Tissue distribution of Osat1 mRNA. An RT-PCR analysis was performed using cDNA prepared from total RNA of adult virgin females (1-to 3-day-old). RT þ/ indicates the presence/absence (negative control) of reverse-transcriptase in the reaction. The O. scapulalis tubulin gene was used as a control. Flight muscle, FM; Legs, Lg; epidermis, Ep; fat body, FB; eggs, Eg; pheromone gland, PG.
References Antony, B., Fujii, T., Moto, K., Matsumoto, S., Fukuzawa, M., Nakano, R., Tatsuki, S., Ishikawa, Y., 2009. Pheromone-gland-specific fatty-acyl reductase in the adzuki bean borer, Ostrinia scapulalis (Lepidoptera: Crambidae). Insect Biochem. Mol. Biol. 39, 90e95. Arakawa, H., Takiguchi, M., Amaya, Y., Nagata, S., Hayashi, H., Mori, M., 1987. cDNAderived amino acid sequence of rat mitochondrial 3-oxoacyl CoA thiolase with no transient presequence: structural relationship with peroxisomal isozyme. EMBO J. 6, 1361e1366. Clinkenbeard, K.D., Sugiyama, T., Moss, J., Reed, W.D., Lane, M.D., 1973. Molecular and catalytic properties of cytosolic acetoacetyl CoA thiolase from avian liver. J. Biol. Chem. 218, 2275e2284. Hom, L.G., Ohkawa, T., Trudeau, D., Volkman, L.E., 2002. Autographa californica M Nucleopolyhedrovirus ProV-CATH is activated during infected cell death. Virology 277, 178e183. Igual, J.C., Gonzalezbosch, C., Dopazo, J., Perezortin, J.E., 1992. Phylogenetic analysis of the thiolase family -implications for the evolutionary origin of peroxisomes. J. Mol. Evol. 35, 147e155. Katsuma, S., Daimon, T., Mita, K., Shimada, T., 2006. Lepidopteran ortholog of Drosophila breathless is a receptor for the baculovirus fibroblast growth factor. J. Virol. 80, 5474e5481. Kinjoh, T., Kaneko, Y., Itoyama, K., Mita, K., Hiruma, K., Shinoda, T., 2007. Control of juvenile hormone biosynthesis in Bombyx mori: cloning of the enzymes in the mevalonate pathway and assessment of their developmental expression in the corpora allata. Insect Biochem. Mol. Biol. 37, 808e815. Kursula, P., Ojala, J., Lambeir, A.M., Wierenga, R.K., 2002. The catalytic cycle of biosynthetic thiolase: a conformational journey of an acetyl group through four binding modes and two oxyanion holes. Biochemistry 41, 15543e15556. Lindquist, K.R., Faye, I., 2001. The Drosophila gene yippee reveals a novel family of putative zinc binding proteins highly conserved among eukaryotes. Insect Mol. Biol. 10, 77e86. Middleton, B., 1973. The oxoacyl-coenzyme a thiolases of animal tissues. Biochem. J. 132, 717e730. Miyazawa, S., Osumi, T., Hashimoto, T., 1980. The presence of a new 3-oxoacyl-CoA thiolase in rat liver peroxisomes. Eur. J. Biochem. 103, 589e596. Modis, Y., Wierenga, R.K., 1999. A biosynthetic thiolase in complex with a reaction intermediate: the crystal structure provides new insights into the catalytic mechanism. Struct. Fold. Des 7, 1279e1290. Modis, Y., Wierenga, R.K., 2000. Crystallographic analysis of the reaction pathway of Zoogloea ramigera biosynthetic thiolase. J. Mol. Biol. 297, 1171e1182. Palmer, M.A.J., Differding, E., Gamboni, R., Williams, S.F., Peoples, O.P., Walsh, C.T., Sinskey, A.J., Masamune, S., 1991. Biosynthetic thiolase from Zoogloea ramigera. J. Biol. Chem. 266, 8369e8375. Sakai, R., Fukuzawa, M., Nakano, R., Tatsuki, S., Ishikawa, Y., 2009. Alternative suppression of transcription from two desaturase genes is the key for speciesspecific sex pheromone biosynthesis in two Ostrinia moths. Insect Biochem. Mol. Biol. 39, 62e67. Schiedel, A.C., Oeljeklaus, S., Minihan, P., Dyer, J.H., 2004. Cloning, expression, and purification of glyoxysomal 3-oxoacyl-CoA thiolase from sunflower cotyledons. Protein Expr. Purifi 33, 25e33. Takanashi, T., Huang, Y., Takahasi, R., Hoshizaki, S., Tatsuki, S., Ishikawa, Y., 2005. Genetic analysis and population survey of sex pheromone variation in the adzuki bean borer moth, Ostrinia scapulalis. Biol. J. Linn. Soc. 84, 143e160. Thompson, S., Mayerl, F., Pepoles, O.P., Masamune, S., Sinskey, A.J., Walsh, C.T., 1989. Mechanics studies on b-ketoacyl thiolase from Zoogloea ramigera: identification of the active-site nucleophile as Cys89, its mutation to Ser89, and kinetic and thermodynamic characterization of wild-type and mutant enzymes. Biochemistry 28, 5735e5742. Williams, S.F., Palmer, M.A.J., Peoples, O.P., Walsh, C.T., Sinskey, A.J., Masamune, S., 1992. Biosynthetic thiolase from Zoogloea ramigera. Mutagenesis of the putative active-site base Cys378 to Ser378 changes the partitioning of the acetyl S-enzyme intermediate. J. Biol. Chem. 267, 16041e16043. Zeng, J., Li, D., 2004. Expression and purification of His-tagged rat mitochondorial 3-ketoacyl-CoA thiolase wild-type and His352 mutant proteins. Protein Expr. Purifi 35, 320e326.
Contents lists available at ScienceDirect
Insect Biochemistry and Molecular Biology journal homepage: www.elsevier.com/locate/ibmb
Molecular and functional characterization of an acetyl-CoA acetyltransferase from the adzuki bean borer moth Ostrinia scapulalis (Lepidoptera: Crambidae) Takeshi Fujii a, *, Katsuhiko Ito b, Susumu Katsuma b, Ryo Nakano a, Toru Shimada b, Yukio Ishikawa a a b
Laboratory of Applied Entomology, Graduate School of Agricultural and Life Sciences, University of Tokyo, Bunkyo-ku, Tokyo 113-8657, Japan Laboratory of Insect Genetics and Bioscience, Graduate School of Agricultural and Life Sciences, University of Tokyo, Bunkyo-ku, Tokyo 113-8657, Japan
a r t i c l e i n f o
a b s t r a c t
Article history: Received 14 September 2009 Received in revised form 7 December 2009 Accepted 9 December 2009
Two types of thiolases are involved in the synthesis and catabolism of fatty acids; acetyl-CoA acetyltransferase (AT) which catalyzes the formation of acetoacetyl-CoA from acetyl-CoA by transferring an acetyl group from one acetyl-CoA molecule to another, and 3-ketoacyl-CoA thiolase which catalyzes a reversible thiolytic cleavage of 3-ketoacyl-CoA into acetyl-CoA and acyl-CoA. Although many mammalian thiolases have been characterized in detail, no thiolases from insects have been functionally characterized to date. Here we report first characterization of an insect AT gene, Osat1, from the pheromone gland of the adzuki bean borer moth Ostrinia scapulalis (Lepidoptera; Crambidae). Osat1 encodes a 41.2 kDa protein comprising 396 amino acid residues (OsAT1), which possesses structural features of the thiolase family. An Osat1 homologue of Bombyx mori (Bmat1) was cloned through exploration of an EST library of the silkworm. Subsequent survey of the genome database revealed that B. mori has at least six Osat1 homologues, among which Bmat1 was most closely related to Osat1. We expressed recombinant OsAT1 using a baculovirus expression system, and verified that OsAT1 catalyzes the formation of acetoacetyl-CoA from acetyl-CoA. Osat1 was expressed in all adult tissues examined. These results indicate that OsAT1 is a functional AT ubiquitously expressed in O. scapulalis tissues. Ó 2009 Elsevier Ltd. All rights reserved.
Keywords: Acetyl-CoA acetyltransferase Thiolase Pheromone gland Baculovirus expression system Ostrinia scapulalis
1. Introduction Thiolases are crucial enzymes implicated in the synthesis and catabolism of fatty acyl-CoA in both prokaryotes and eukaryotes (Igual et al., 1992). In eukaryotes, different types of thiolases have been found in the cytosol, mitochondria, and peroxisomes (Miyazawa et al., 1980). Thiolases can be classified into two types based on the direction of the reactions they catalyze (Modis and Wierenga, 2000): one is a biosynthetic thiolase [acetyl-CoA acetyltransferase (EC2.3.1.9)], which catalyzes the biological Claisen condensation of acetyl-CoA, i.e., the formation of acetoacetyl-CoA from acetyl-CoA by transferring an acetyl group from one acetyl-CoA molecule to another (Clinkenbeard et al., 1973). The other is a degradative thiolase [3-ketoacyl-CoA thiolase (EC2.3.1.16)], which catalyzes the last reaction of the b-oxidation cycle, the thiolytic cleavage of 3-ketoacyl-CoA (Clinkenbeard et al.,
* Corresponding author at: Department of Agricultural and Environmental Biology, Graduate School of Agricultural and Life Sciences, The University of Tokyo, Yayoi 1-1-1, Bunkyo-ku, Tokyo 113-8657, Japan. Tel.: þ81 3 5841 5062; fax: þ81 3 5841 5061. E-mail address: [email protected] (T. Fujii). 0965-1748/$ e see front matter Ó 2009 Elsevier Ltd. All rights reserved. doi:10.1016/j.ibmb.2009.12.012
1973; Schiedel et al., 2004; Zeng and Li, 2004). The thiolase family commonly has a glycine-rich motif (G-rich motif; CIGXGXG), which is conserved in the C-terminal region (Arakawa et al., 1987). Furthermore, three amino acid residues, cysteine 89 (Cys89), Cys382 and histidine 352 (His352), are completely conserved among thiolases. Cys89 is involved in the formation of an acyl-enzyme intermediate (Thompson et al., 1989; Palmer et al., 1991), and Cys382 is the active center essential for the deprotonation step in the condensation reaction (Thompson et al., 1989; Palmer et al., 1991; Williams et al., 1992; Modis and Wierenga, 1999; Kursula et al., 2002). A study on rat mitochondrial thiolase revealed that His352 is also a catalytic residue of 3-ketoacyl-CoA thiolase (Zeng and Li, 2004). During the course of extensive studies on the genes expressed in the pheromone gland of the adzuki bean borer moth, Ostrinia scapulalis (Lepidoptera; Crambidae) (Antony et al., 2009; Sakai et al., 2009), we were able to clone a gene encoding a putative thiolase with a typical glycine-rich motif, CIGXGXG. Because we found that not a single thiolase gene from insects had been functionally characterized despite the importance of thiolases, we performed a functional assay of the newly cloned gene. In this paper, we report for the first time the functional characterization of an insect thiolase.
T. Fujii et al. / Insect Biochemistry and Molecular Biology 40 (2010) 74e78
2. Materials and methods 2.1. Insect and cell lines Female moths of O. scapulalis were collected at Matsudo, Japan (35.5 N, 139.6 E), and the offspring were reared as described previously (Takanashi et al., 2005). The Sf9 cells were maintained in TC-100 medium with 10% fetal bovine serum as described previously (Katsuma et al., 2006). 2.2. RNA extraction from pheromone gland and other tissues Pheromone gland (PG), flight muscle (FM), legs (Lg), epidermis (Ep), fat bodies (FB) and Eggs (Eg) were dissected from 1- to 3-dayold female moths in phosphate-buffered saline [PBS, 2.5 mM KCl, 141 mM NaCl, 8.1 mM Na2HPO4, and 2.5 mM KH2PO4 (pH 7.0)]. Total RNA was isolated from each tissue using RNAiso (Takara), treated with DNase I (Qiagen), and stored at 80 C prior to use. 2.3. Cloning of Osat1 (O. scapulalis acetyltransferase 1) cDNA One microgram of total RNA was reverse-transcribed with an oligo-dT adaptor primer using an RNA PCR Kit, Ver.3.0 (Takara). The resultant cDNA was used as a template for cloning of Osat1 cDNA. Degenerate primers (DPs in Table 1) were designed based on a putative acetyl-CoA acetyltransferase gene of Macaca fascicularis AB172715 and sequences of insects showing a high degree of similarity to this gene (Drosophila melanogaster AY089528 and Aedes aegypti DQ440481). PCR was performed with ExTaq polymerase (Takara) under the following conditions: 94 C for 2 min, 5 cycles of 94 C for 30 s, 37 C for 30 s, and 68 C for 60 s, 30 cycles of 94 C for 30 s, 42 C for 30 s, and 68 C for 60 s, and finally 72 C for 7 min. Based on the cDNA sequence obtained by the degenerate PCR, the full-length cDNA of Osat1 was cloned using a GeneRacerÔ Kit (Invitrogen) with gene-specific primer sets (see Fig. 1 and Table 1). 2.4. Expression profiling by RT-PCR A tissue-distribution analysis of Osat1 mRNA was performed by RT-PCR with a gene-specific primer set (RT_F and RT_R in Table 1) under the following conditions; 94 C for 2 min, and 30 cycles of 94 C for 30 s, 55 C for 30 s, and 68 C for 30 s cDNAs from adult tissues were prepared as described above (see Section 2.3). 2.5. Phylogenetic analysis
75
Table 1 Nucleotide sequences of primers used in this study. Primer name
Primer sequence from 50 to 30
DP
GCNTWYGGNACNTTYGG YTGNCCNCCNCCDATRC ATCTGCTCGTCCACCTCCTTCATGG CCTACTGTATCGACAACGAGGCCC GGAAGCCGGAGCCGCAGAGGCGG CATGTTTTCTACACCGCCGG GAACGGCGGCGCCACCGCGCTCGG GAGCACCCGCGGCCTCAGACCACC ATGTCTGTAGCTGTTAAAGG CCTTAGCGGCGCCGGTGAGGATGTCC ACTAGTCATGTCTGTAGCTGTTAAAGG GCATGCTTAATGGTGATGATGGTGATGGACGGCTTCAACCATGAGAGC
Tubulin NRP50 RP50 NRP30 RP30 RT F RT R SpeI-ATFwd AT-SphI/His(þ)
Bold types and the underline indicate restriction enzyme sites and the His-tag, respectively.
The coding region of OsAT1 with a His-tagged sequence at the C terminus was PCR-amplified with a set of gene-specific primers containing restriction enzyme sites [SpeI-ATFwd, and AT-SphI/His (þ)] as listed in Table 1. The PCR products were subcloned into the pGEM-T easy vector (Promega) and sequenced using an ABI3130xl genetic analyzer (Applied Biosystems). The Osat1 with a His-tag was then cloned into the vector pFastBac1 (Invitrogen). Recombinant AcNPVs were generated and propagated as described previously (Katsuma et al., 2006). The resultant AcNPV with the His-tagged OsAT1 was named OsAT1-His-AcNPV. 2.7. SDS-PAGE and Western blotting SDS-PAGE and Western blotting were performed as described previously (Katsuma et al., 2006). Briefly, Sf9 cells infected with OsAT1-His-AcNPV were rinsed with PBS, homogenized in 200 mL of buffer containing 20 mM TriseHCl (pH 7.4), 150 mM NaCl, 1% NP-40, and E64 (a cysteine protease inhibitor), and incubated on ice for 45 min. The homogenate was centrifuged at 12,000g for 10 min at 4 C and the supernatant was collected. After the addition of an SDS sample buffer, the samples were separated on 12% gels by SDS-PAGE, and transferred to polyvinylidene fluoride (PVDF) membranes (Immobilon-P, Millipore). Expression of recombinant OsAT1 in Sf9 cells was detected with an anti-His antibody (Qiagen, 1: 3000 dilution). We found that the preparation of the cell lysate without E64 resulted in a marked degradation of OsAT1 presumably due to activation of AcNPV cysteine proteinase (data not shown; Hom et al., 2002).
The amino acid sequences of putative thiolases were aligned using the Clustal W program and a phylogenetic tree was constructed by the neighbor-joining method. The following sequences, which showed high scores in a Blast P search of the NCBI database with OsAT1 (GenBank accession no. AB466326) as a query, were used for this analysis: Bombyx mori (BmAT1) AB516425; Caenorhabditis elegans, NP_499752; Apis mellifera XP_391843; Nasonia vitripennis XP_001606212; Acyrthosiphon pisum, XP_001950874; Tribolium castaneum, XP_968373; Culex quinquefasciatus, XP_001844011; A. aegypti, DQ440481; Drosophila simulans, XP_002078831; D. melanogaster, NP_523528; Drosophila sechellia XP_002036395; Drosophila yakuba, XP_002088990; Drosophila mojavensis, XP_002003078 and Drosophila virilis, XP_002052446. The KAIKO base (http://sgp.dna.affrc.go.jp/Kaikobase/) was explored for Osat1 homologues in the Bombyx genome.
2.8. Localization of recombinant OsAT1 in Sf9 cells
2.6. Construction of recombinant Baculoviruses
2.9. Thiolase assay
The recombinant Autographa californica nucleopolyhedrovirus (AcNPV) was constructed using a Bac-to-Bac system (Invitrogen).
Sf9 cells seeded in a cell culture dish (4 60 mm) were infected with OsAT1-His-AcNPV or Bac1-AcNPV (negative control). At 72 hours
Sf9 cells infected with OsAT1-His-AcNPV were homogenized in 200 ml of PBS containing E64 (30 mg/ml) by a motor-driven Teflon pestle. Unbroken cells and debris in the homogenate were removed by centrifugation at 300g for 15 min. The supernatant (fraction 0) was centrifuged at 800g for 15 min; the pellet, which consists primarily of nuclei and a significant amount of mitochondria, is referred to as fraction 1. The supernatant was centrifuged at 7,500g for 20 min; the pellet, which consists of mitochondria, is referred to as fraction 2. The supernatant was centrifuged at 20,000g for 90 min to roughly separate microsomes (pellet, Fraction 3) from the cytosol (supernatant, Fraction 4). The final volume of each fraction was adjusted to 200 ml and Western blotting was performed as described above (see Section 2.7).
76
T. Fujii et al. / Insect Biochemistry and Molecular Biology 40 (2010) 74e78
Fig. 1. Nucleotide and deduced amino acid sequences of Osat1. Three catalytic residues responsible for the thiolase activity are shaded, and a G-rich motif is boxed. All primer positions are indicated by arrows.
postinfection (hpi), infected cells were collected by centrifugation at 800g for 10 min, and the cell pellet was solubilized by TBS buffer containing 1% NP-40. The soluble fraction was concentrated using Amicon Ultra centrifugal filter devices (3000 NMWL membrane, Millipore) at 3000 g for 30 min and used as a recombinant OsAT1 solution. To characterize the enzymatic activity of OsAT1, a thiolase assay was performed as reported by Clinkenbeard et al. (1973). An inactivated recombinant OsAT1 solution (negative control) was prepared by heating the solution at 100 C for 1 h. The formation of acetoacetyl-CoA from acetyl-CoA was monitored at 303 nm with an ND 1000 spectrophotometer (Nano drop) in the presence of divalent magnesium ions at pH 8.8 (the Mg2þ-enolate complex of acetoacetylCoA is specifically detected as absorbance at 303 nm). We verified in preliminary experiments that (1) among free CoA, acetyl-CoA and acetoacetyl-CoA, only acetoacetyl-CoA forms a complex with Mg2þ which is detectable at 303 nm, and (2) Mg2þ did not form a complex with unknown factors in the recombinant OsAT1 solution when monitored at 303 nm. The reaction was initiated by addition of OsAT1-His-AcNPV solution containing ca. 90 mg of protein to a reaction mixture (100 mM TriseHCl, pH 8.8, 25 mM MgCl2 and 4 mM of substrate acetyl-CoA) held at 30 C. 2.10. Data deposition The nucleotide sequences of Osat1 and Bmat1 have been submitted to the EMBL/GenBank Data Libraries with accession nos. AB466326 and AB516425, respectively. Six Osat1 homologues found in Bombyx genome (BGIBMGA 012659, BGIBMGA 012660,
BGIBMGA 012661, BGIBMGA011029, BGIBMGA014181, BGIBMGA009103) were annotated as thiolases.
and
3. Results 3.1. Cloning and sequencing of Osat1 cDNA We cloned a w1000-bp cDNA fragment containing a G-rich motif from the first-strand cDNA prepared from the pheromone gland of O. scapulalis. Next, we performed 30 - and 50 -RACE and obtained the complete open reading frame (ORF) of this gene, Osat1 (O. scapulalis acetyl-CoA acetyltransferase 1). The Osat1 gene contained an ORF of 1188 bp encoding 396 amino acid residues with the predicted molecular mass of 41.2 kDa. An amino acid sequence analysis with the program SOSUI (http://bp.nuap.nagoya-u.ac.jp/ sosui/) revealed that OsAT1 has no trans-membrane domains. The three amino acid residues, Cys94, His352, and Cys382, which are essential to the enzymatic activity of the thiolase family (Zeng and Li, 2004), are conserved in OsAT1. 3.2. Homologues of Osat1 in B. mori We were able to find an Osat1 homologue in the EST database of the silkworm B. mori (SilkBase, http://morus.ab.a.u-tokyo.ac.jp/cgibin/index.cgi). We determined its sequence (AB516425), and named it Bmat1 (B. mori acetyltransferase 1). The deduced amino acid sequence of Bmat1 (BmAT1) had a G-rich motif, CIGGGQG, which is typical of thiolases. A phylogenetic analysis showed that OsAT1 and
T. Fujii et al. / Insect Biochemistry and Molecular Biology 40 (2010) 74e78
77
BmAT1 belong to the same clade in the phylogenetic tree of putative thiolases from insects (Fig. 2A). Subsequent exploration of the Bombyx genome revealed six Osat1 homologues including Bmat1 (Fig. 2B). While two of these homologues (Bmat1 and BGIMGA012660) had the motif CIGGGQG, two (BGIBMGA012661 and BGIMGA011029) had a variant motif, CNGGGGA, and the remaining two (BGIBMGA014181 and BGIMGA009103) had no G-rich motif (Fig. 2B). Interestingly, BGIMGA011029, which has the variant motif CNGGGGA, turned out to be equivalent to AB274998, which encodes a putative acetoacetyl thiolase (AACT_Bm) implicated in JH biosynthesis (Kinjoh et al., 2007).
with OsAT1-His-AcNPV and Bac1-AcNPV. The lysate from the cells infected with OsAT1-His-AcNPV had AT activity, and the formation of acetoacetyl-CoA proceeded in a time-dependent and dosedependent manner (Fig. 4). The apparent AT activity of the lysate from the cells infected with the control virus, relative to the heatinactivated lysate, presumably represents the endogenous thiolase activity in Sf9 cells (Fig. 4). Overall, these results indicate that OsAT1 is a functional AT.
3.3. Expression of recombinant OsAT1 by a baculovirus system
The expression profile of Osat1 mRNA was examined by RT-PCR. As shown in Fig. 5, Osat1 mRNA was ubiquitously expressed in 6 adult tissues including pheromone gland, suggesting that OsAT1 is not a pheromone gland-specific AT.
The recombinant OsAT1 was expressed by AcNPV (OsAT1-HisAcNPV) as a C-terminal His-tagged form. Sf9 cells were infected with OsAT1-His-AcNPV and collected at 72 hpi. Western blotting with the anti-His antibody showed that the His-tagged OsAT1 was expressed with a molecular mass of approximately 40 kDa (Fig. 3A). We next examined the distribution of the His-tagged OsAT1 protein in Sf9 cells. Western blotting of cell lysate fractions with the anti-His antibody showed that OsAT1 in Sf9 cells was strongly expressed in the cytosolic fraction (fraction 4), rather than nuclear and mitochondrial fractions (fractions 1 and 2, respectively) (Fig. 3B). This suggests that OsAT1 is mainly located in the cytosol.
3.5. Expression profile of Osat1 mRNA
4. Discussion
To examine the acetyl-CoA acetyltransferase (AT) activity of the recombinant OsAT1, we prepared cell lysate from Sf9 cells infected
In this study, we cloned a thiolase gene, Osat1, from the pheromone gland of O. scapulalis, and showed that the recombinant OsAT1 catalyzes formation of acetoacetyl-CoA from acetyl-CoA. Results of a Western blot analysis of OsAT1 in Sf9 cell fractions suggested that OsAT1 is a cytosolic enzyme (Fig. 3B). This type of thiolase is crucial to the biosynthesis of cholesterol and terpenoid (Middleton, 1973). Although many sequences of insects, such as Drosophila yippee interacting protein 2 (yip2, NP_523528), have been annotated as a “thiolase” or “acetyl-CoA acetyltransferase”, their thiolytic activities have not actually been investigated (Lindquist and Faye, 2001). To the best of our knowledge, this is the first
Fig. 2. Phylogenetic analysis of OsAT1 and its homologues. (A) Neighbor-joining tree of OsAT1 and sequences showing a high degree of identity to this protein. All insect sequences have the G-rich motif CIGGGQG. Genbank accession numbers are shown beside the species name. Bootstrap values with 1000 resamplings are shown near branches, and the genetic distance is drawn to scale. (B) Neighbor-joining tree of nucleotide sequences homologous to OsAT1 found in the Bombyx genome. The sequence of the G-rich motif is shown. The acetoacetyl-CoA thiolase (AACT_Bm, AB274998) suggested to be involved in juvenile hormone biosynthesis (Kinjoh et al., 2007) corresponds to BGIBMGA011029. BGIBMGA014181 and BGIBMGA009103 appear not to possess a G-rich motif.
Fig. 3. Expression of recombinant OsAT1 by a baculovirus expression system. (A) The cell lysate (Cell) and supernatant (Sup.) prepared from Sf9 cells infected with OsAT1-HisAcNPV were separated on a 12% acrylamide gel and stained with Coomassie brilliant blue (CBB, left panel). A Western blot analysis was performed with anti-His antibody (right panel). The molecular weights of protein standards are indicated on the left. (B) Subcellular distribution of OsAT1 in Sf9 cells. From the supernatant of the cell homogenate (Fraction 0), fractions rich in nuclei (1), mitochondria (2), microsomes (3) and cytosol (4) were prepared by the method described in Section 2.8 of Materials and methods.
3.4. Enzymatic activity of OsAT1
78
T. Fujii et al. / Insect Biochemistry and Molecular Biology 40 (2010) 74e78
expression level in the corpora allata suggested that AACT_Bm to be involved in the mevalonate pathway that is connected to juvenile hormone (JH) biosynthesis (Kinjoh et al., 2007). It is tempting to assume that a thiolase expressed in a specific tissue for a specific role differentiated from an ancestral thiolase, which is ubiquitously expressed in all cells, after duplication of the gene. Our study points to the necessity for further studies on the evolution of thiolases. Acknowledgements We thank Eiriki Sunamura for his helpful comments on this manuscript. This work was supported by grants from MEXT (Nos. 19208005 to Y.I. and 19688004 to S.K.). Fig. 4. Thiolase assay of OsAT1. Thiolase activity of cell lysate from Sf9 cells infected with OsAT1-His-AcNPV or Bac1-AcNPV. 0 min indicates the addition of cell lysate. Diluted OsAT1: the lysate was diluted to 1/8 of that used in OsAT1-His-AcNPV. Deactivated OsAT1: the lysate was treated at 100 C for 1 h prior to the assay.
report characterizing a biosynthetic thiolase (acetyl-CoA acetyltransferase; AT) from an insect. Two cysteines (Cys89 and Cys378) and one histidine (His348) are important for the catalytic activity of mammalian thiolases (Palmer et al., 1991; Zeng and Li, 2004). As shown in Fig. 1, these three residues are conserved in OsAT1 (Cys94, His352 and Cys382), suggesting that the catalytic mechanism of the insect thiolase is similar to that of thiolases from other organisms. AT catalyzes the formation of acetoacetyl-CoA from two acetylCoA molecules, or the reverse reaction, the thiolytic cleavage of acetoacetyl-CoA. The AT activity has been measured by spectrophotometric monitoring of the generation of the Mg2þ-enolate complex of actoacetyl-CoA (Clinkenbeard et al., 1973). According to the twostep ‘ping-pong’ mechanism proposed for the thiolase reaction (Modis and Wierenga, 1999), a degradative reaction and a biosynthetic reaction are interconnected via a covalent acetyl-enzyme intermediate, and the reactions are affected by the concentrations of acetyl-CoA and free CoA (Modis and Wierenga, 2000). We observed that the rate of formation of acetoacetyl-CoA decreased rapidly after a steep increase in acetoacetyl-CoA within 1 min (Fig. 4). Similar phenomena were observed when the amount of cell lysate was decreased (Fig. 4) or the concentration of the substrate (acetylCoA) was varied (data not shown). These phenomena might be ascribed to the use of lysates of Sf9 cells expressing OsAT1, which contain various endogenous enzymes that interact with the reaction product, acetoacetyl-CoA. In addition to Bmat1, which is most closely related to Osat1 and shares the common G-rich motif CIGGGQG, five Osat1 homologues were found in the B. mori genome (Fig. 2B). Among them, AACT_Bm (AB274988), was found to have amino acids (Cys75, His346 and Cys362) essential to thiolase activity, although its G-rich motif CNGGGGA was new to the thiolase family. AACT_Bm, annotated as acetoacetyl-CoA thiolase, is predominantly expressed in the corpora allata (Kinjoh et al., 2007). Developmental changes in its
Fig. 5. Tissue distribution of Osat1 mRNA. An RT-PCR analysis was performed using cDNA prepared from total RNA of adult virgin females (1-to 3-day-old). RT þ/ indicates the presence/absence (negative control) of reverse-transcriptase in the reaction. The O. scapulalis tubulin gene was used as a control. Flight muscle, FM; Legs, Lg; epidermis, Ep; fat body, FB; eggs, Eg; pheromone gland, PG.
References Antony, B., Fujii, T., Moto, K., Matsumoto, S., Fukuzawa, M., Nakano, R., Tatsuki, S., Ishikawa, Y., 2009. Pheromone-gland-specific fatty-acyl reductase in the adzuki bean borer, Ostrinia scapulalis (Lepidoptera: Crambidae). Insect Biochem. Mol. Biol. 39, 90e95. Arakawa, H., Takiguchi, M., Amaya, Y., Nagata, S., Hayashi, H., Mori, M., 1987. cDNAderived amino acid sequence of rat mitochondrial 3-oxoacyl CoA thiolase with no transient presequence: structural relationship with peroxisomal isozyme. EMBO J. 6, 1361e1366. Clinkenbeard, K.D., Sugiyama, T., Moss, J., Reed, W.D., Lane, M.D., 1973. Molecular and catalytic properties of cytosolic acetoacetyl CoA thiolase from avian liver. J. Biol. Chem. 218, 2275e2284. Hom, L.G., Ohkawa, T., Trudeau, D., Volkman, L.E., 2002. Autographa californica M Nucleopolyhedrovirus ProV-CATH is activated during infected cell death. Virology 277, 178e183. Igual, J.C., Gonzalezbosch, C., Dopazo, J., Perezortin, J.E., 1992. Phylogenetic analysis of the thiolase family -implications for the evolutionary origin of peroxisomes. J. Mol. Evol. 35, 147e155. Katsuma, S., Daimon, T., Mita, K., Shimada, T., 2006. Lepidopteran ortholog of Drosophila breathless is a receptor for the baculovirus fibroblast growth factor. J. Virol. 80, 5474e5481. Kinjoh, T., Kaneko, Y., Itoyama, K., Mita, K., Hiruma, K., Shinoda, T., 2007. Control of juvenile hormone biosynthesis in Bombyx mori: cloning of the enzymes in the mevalonate pathway and assessment of their developmental expression in the corpora allata. Insect Biochem. Mol. Biol. 37, 808e815. Kursula, P., Ojala, J., Lambeir, A.M., Wierenga, R.K., 2002. The catalytic cycle of biosynthetic thiolase: a conformational journey of an acetyl group through four binding modes and two oxyanion holes. Biochemistry 41, 15543e15556. Lindquist, K.R., Faye, I., 2001. The Drosophila gene yippee reveals a novel family of putative zinc binding proteins highly conserved among eukaryotes. Insect Mol. Biol. 10, 77e86. Middleton, B., 1973. The oxoacyl-coenzyme a thiolases of animal tissues. Biochem. J. 132, 717e730. Miyazawa, S., Osumi, T., Hashimoto, T., 1980. The presence of a new 3-oxoacyl-CoA thiolase in rat liver peroxisomes. Eur. J. Biochem. 103, 589e596. Modis, Y., Wierenga, R.K., 1999. A biosynthetic thiolase in complex with a reaction intermediate: the crystal structure provides new insights into the catalytic mechanism. Struct. Fold. Des 7, 1279e1290. Modis, Y., Wierenga, R.K., 2000. Crystallographic analysis of the reaction pathway of Zoogloea ramigera biosynthetic thiolase. J. Mol. Biol. 297, 1171e1182. Palmer, M.A.J., Differding, E., Gamboni, R., Williams, S.F., Peoples, O.P., Walsh, C.T., Sinskey, A.J., Masamune, S., 1991. Biosynthetic thiolase from Zoogloea ramigera. J. Biol. Chem. 266, 8369e8375. Sakai, R., Fukuzawa, M., Nakano, R., Tatsuki, S., Ishikawa, Y., 2009. Alternative suppression of transcription from two desaturase genes is the key for speciesspecific sex pheromone biosynthesis in two Ostrinia moths. Insect Biochem. Mol. Biol. 39, 62e67. Schiedel, A.C., Oeljeklaus, S., Minihan, P., Dyer, J.H., 2004. Cloning, expression, and purification of glyoxysomal 3-oxoacyl-CoA thiolase from sunflower cotyledons. Protein Expr. Purifi 33, 25e33. Takanashi, T., Huang, Y., Takahasi, R., Hoshizaki, S., Tatsuki, S., Ishikawa, Y., 2005. Genetic analysis and population survey of sex pheromone variation in the adzuki bean borer moth, Ostrinia scapulalis. Biol. J. Linn. Soc. 84, 143e160. Thompson, S., Mayerl, F., Pepoles, O.P., Masamune, S., Sinskey, A.J., Walsh, C.T., 1989. Mechanics studies on b-ketoacyl thiolase from Zoogloea ramigera: identification of the active-site nucleophile as Cys89, its mutation to Ser89, and kinetic and thermodynamic characterization of wild-type and mutant enzymes. Biochemistry 28, 5735e5742. Williams, S.F., Palmer, M.A.J., Peoples, O.P., Walsh, C.T., Sinskey, A.J., Masamune, S., 1992. Biosynthetic thiolase from Zoogloea ramigera. Mutagenesis of the putative active-site base Cys378 to Ser378 changes the partitioning of the acetyl S-enzyme intermediate. J. Biol. Chem. 267, 16041e16043. Zeng, J., Li, D., 2004. Expression and purification of His-tagged rat mitochondorial 3-ketoacyl-CoA thiolase wild-type and His352 mutant proteins. Protein Expr. Purifi 35, 320e326.