Molecular and Functional Expression of Multidrug Resistance-Associated Protein-1 in Primary Cultured Rat Alveolar Epithelial Cells

Molecular and Functional Expression of Multidrug Resistance-Associated Protein-1 in Primary Cultured Rat Alveolar Epithelial Cells LEENA N. PATEL,1 TOMOMI UCHIYAMA,1 KWANG-JIN KIM,2,3 ZEA BOROK,2,3 EDWARD D. CRANDALL,2,3 WEI-CHIANG SHEN,1 VINCENT H.L. LEE1 1 Department of Pharmacology and Pharmaceutical Sciences, University of Southern California, Los Angeles, California 90089-9121 2

Department of Medicine, University of Southern California, Los Angeles, California 90089-9121

3

Will Rogers Institute Pulmonary Research Center, University of Southern California, Los Angeles, California 90089-9121

Received 14 March 2007; revised 1 June 2007; accepted 13 June 2007 Published online in Wiley InterScience (www.interscience.wiley.com). DOI 10.1002/jps.21134

ABSTRACT: Multidrug resistance-associated protein-1 (MRP1) is an integral membrane efflux protein that is implicated in multidrug resistance in cancer, but it is also expressed in normal tissues. The objective of this study was to determine the expression, localization and functional activity of MRP1 in primary cultured rat alveolar epithelial cells of types I- and II cell-like phenotypes. RT-PCR data showed 550-base pair fragments in both types I- and II-like pneumocytes that exhibited 99% identity to the rat MRP1 isoform. Significant levels of MRP1 protein were detected by western analysis of immunoprecipitates in both cell types, and immunofluorescence combined with confocal laser scanning microscopy indicated basolateral localization of MRP1. Indomethacin (0–100 mM) increased fluorescein basolateral-to-apical transport, and accumulation of fluorescein in the cells, in a dose-dependent manner. We therefore conclude that the MRP1 gene is present in primary cultured rat epithelial cells of both types I- and II-like phenotypes and its corresponding protein (MRP1) is localized in the basolateral membrane of these cells. Primary cultured monolayers of rat type II-like pneumocytes appear to be a useful tool for screening MRP1 substrates designed for pulmonary delivery/ targeting. ß 2007 Wiley-Liss, Inc. and the American Pharmacists Association J Pharm Sci 97:2340–2349, 2008

Keywords: MRP1; efflux pumps; cell culture; ABC transporters; pulmonary; multidrug resistance-associated proteins

INTRODUCTION Tomomi Uchiyama’s present address is First Department of Biochemistry, School of Pharmacy, Kyushu University of Health and Welfare, Nobeoka, Japan. Vincent H.L. Lee’s present address is Choh-Ming Li Basic Medical Science Building, Suite 626E. School of Pharmacy, The Chinese University of Hong Kong, Shatin, NT, Hong Kong. Correspondence to: Vincent H.L. Lee (Telephone: 852-26096862; Fax: 852-2603-5295; E-mail: [email protected]) Journal of Pharmaceutical Sciences, Vol. 97, 2340–2349 (2008) ß 2007 Wiley-Liss, Inc. and the American Pharmacists Association

2340

The pulmonary route is an attractive alternative for systemic delivery of protein/peptide drugs such as insulin, human growth hormone, and vasopressin due to their high bioavailability via this route.1 Small molecule drugs such as cromolyn, morphine, 9-tetrahydrocanabinnol, and rizatriptan also show significant systemic absorption when administered by inhalation and in some cases are transported by active mechanisms.2

JOURNAL OF PHARMACEUTICAL SCIENCES, VOL. 97, NO. 6, JUNE 2008

MOLECULAR AND FUNCTIONAL EXPRESSION OF MRP1

Inhaled glucocorticosteroids like fluticasone proprionate and budesonide, although intended for local pharmacological effect, exhibit complete systemic absorption after prolonged retention in the lungs.2–4 In particular, the lower respiratory tract that consists primarily of the alveoli lined by alveolar epithelium (types I and II pneumocytes) serves as the major systemic absorption site because it provides an expansive surface area (70–140 m2 in adult human lungs), has extensive vascularization and forms a relatively thin barrier to the systemic absorption of therapeutic agents. In contrast, the conducting airways of bronchi and trachea are lined by much taller epithelial cells, have comparatively a very small surface area, and receive a small fraction of lung blood flow. The conducting airways also exhibit mucociliary clearance activities for deposited exogenous materials.5 In order to exploit the lower respiratory tract for drug delivery purposes, it is crucial to understand the properties of the alveolar epithelium that serve as the rate-limiting barrier to systemic absorption. In vitro cell culture models have been utilized to study the barrier properties of pulmonary epithelia in recent years. For instance, Calu-3 (a human lung cancer bronchial epithelial cell line) serves as a useful cell culture model for the upper airway due to its ability to form well differentiated, polarized, and electrically resistant cell monolayers.6,7 However, such a reliable cell line for the lower respiratory tract is not yet available. Instead, Cheek et al.8 have established a primary culture model that exhibits phenotypic and morphologic characteristics of alveolar epithelium in vivo. The most crucial characteristic exhibited is the high transepithelial resistance (TEER, >2000 V cm2) with well-formed tight junctions. It has been demonstrated that freshly isolated type II cells can transdifferentiate in vitro into type I cell-like pneumocytes over time.9 The type I-like cells begin to express markers specific to type I alveolar epithelial cells with the concurrent loss of lamellar bodies and other hallmarks of type II cells. On the other hand, when freshly isolated rat type II cells are exposed to keratinocyte growth factor (KGF, 10 ng/mL), they do not transdifferentiate into type I cells but instead retain their type II cell phenotypic characteristics.10 This primary rat alveolar epithelial culture model consisting of types I or II cell-like pneumocytes has been extensively utilized for over two decades for mechanistic studies of peptide11,12 and protein transport DOI 10.1002/jps

2341

across the alveolar epithelial barrier.13,14 In addition, the expression and function of various transporters, receptors, and ion channels have been well studied.15–17 Since the cloning of the multidrug resistanceassociated protein-1 (MRP1) gene by Cole et al.,18 nine human MRP isoforms that show 30–56% homology have been reported.19 cDNAs for rat homologues of MRP1-6 have been cloned and characterized, wherein they show 66–94% homology to human isoforms. MRP1 is a 190 kDa membrane protein that belongs to the ATPbinding cassette (ABC) transporter superfamily and is known to cause cellular efflux of a wide variety of xenobiotics. Like the efflux pump Pglycoprotein (P-gp), MRP1 transports a structurally and pharmacologically diverse set of substrates. Apart from the overlap of certain oncolytic agents such as vincristine, daunorubicin, and doxorubicin, MRP1 substrates are organic anions and conjugates of glutathione (GSH), glucuronide or sulfates (products of phase II metabolism),20 whereas P-gp extrudes lipophilic, amphiphilic, and cationic substrates. To study the functional characteristics of MRP1, specific substrates such as leukotriene C,21 fluorescein dye,22,23 and 17bestradiol24 have been utilized for efflux measurements in the presence and absence of MRP1specific inhibitors such as indomethacin, probenecid, and MK571.22,25 In contrast to the apical localization of P-gp, MRP1 is localized primarily on the basolateral side of polarized cells. The putative role of MRP1 in lungs is that of protection against xenobiotics and endobiotics, but it is also likely to have other physiological functions such as regulating the redox state in the cells by cotransporting MRP1 substrates with glutathione or as glutathione conjugates. In addition, it has been demonstrated that pathological lung conditions such as chronic obstructive pulmonary disease (COPD) or antiasthma drugs like budesonide, modulate MRP1 expression.26,27 It is therefore imperative to study the MRP1 expression and functional relevance in the lungs. In the respiratory tract, basolateral expression of MRP1 has been shown in bronchial cells,25,28,29 whereas granular cytoplasmic staining was observed in human nasal respiratory epithelium.30 Expression of MRP1 has also been shown in the seromucinous glands and alveolar macrophages.29 However, a definitive investigation of MRP1 expression in the alveolar epithelium is lacking. The purpose of this study was to investigate the expression of MRP1 in the primary cultured rat JOURNAL OF PHARMACEUTICAL SCIENCES, VOL. 97, NO. 6, JUNE 2008

2342

PATEL ET AL.

alveolar epithelial cell model. We show that MRP1 is expressed at the gene and protein level in primary cultures of rat types I- and II-like pneumocytes. Confocal imaging studies confirm the basolateral membrane expression of MRP1 in both cell types. In contrast to type II-like cells, indomethacin rapidly destabilized the type I celllike monolayers, even at low concentrations by unknown mechanisms, precluding functional studies of MRP1 in type I-like cells. However, MRP1 is functionally active in type II-like cells as indicated by increased accumulation and B-A transport of fluorescein in the presence of MRP1 inhibitor indomethacin.

MATERIALS AND METHODS Chemicals Porcine pancreatic elastase was purchased from Worthington Biochemical (Freehold, NJ). Dulbecco’s modified eagle’s medium, indomethacin, fluorescein sodium, Sepharose CL-2B cross-linked beads, and Protein A Sepharose beads were obtained from Sigma Chemical (St. Louis, MO). KGF was purchased from Calbiochem (La Jolla, CA). Rabbit polyclonal anti-human MRP1 antibody (MRP1 H-70) was acquired from Santa Cruz Biotech (Santa Cruz, CA). Monoclonal antibody clone MRPr1 (Rat IgG2a isotype) was obtained from Kamiya Biomedical (Seattle, WA). Rabbit anti ZO-1 antibody was purchased from Zymed Laboratories (South San Fransisco, CA). Peroxidase conjugated Affinipure donkey anti-rabbit, rhodamine conjugated goat anti-rabbit and FITCconjugated donkey anti-rat antibodies were acquired from Jackson Immunoresearch Lab. (Westgrove, PA). Caco-2 and HEK293 cell line were obtained from ATCC (Manassas, VA).

Cell Isolation and Culture The procedure for type II cell isolation and culture has been described in detail previously.8 Briefly, lungs of specific pathogen-free male SpragueDawley rats were perfused via the pulmonary artery and lavaged with Ca2þ/Mg2þ-free Ringer’s solution. The lungs were then instilled with 2.0– 2.5 U/mL of porcine pancreatic elastase for 20 min at 378C. Minced lung tissues of 1 mm3 blocks were sequentially filtered through 100, 40, and 10 mm Nitex membranes (Tetko, Elmsford, NY), followed by panning on rat IgG-coated bacteriologic plates JOURNAL OF PHARMACEUTICAL SCIENCES, VOL. 97, NO. 6, JUNE 2008

for 1 h at 378C. The partially purified type II pneumocytes were plated onto tissue culturetreated 12 mm polycarbonate filters (Transwell, 0.4 mm pore size; Corning-Costar, Cambridge, MA) at a density of 106 cells/cm2 in a culture medium composed of a 1:1 mixture of MEM and Ham’s F-12 (Sigma) supplemented with 10% newborn bovine serum, 1.25 mg/mL bovine serum albumin (BSA), 100 U/mL penicillin and 100 ng/mL streptomycin. Monolayers were fed with fresh culture medium on day 3. KGF (10 ng/mL) was added on day 3 to the culture medium to retain type II cell-like phenotype, whereas culture medium without KGF was used throughout the culture period to allow differentiation to type I cell-like phenotype. All monolayers were utilized on days 5–7 in culture. Culture media were changed on day 5 for monolayers that were utilized on days 6 or 7. Transepithelial electrical resistance (TEER) was measured using a voltageohm meter (EVOM, World Precision Instruments, Sarasota, FL) to ascertain monolayer integrity. Caco-2 and HEK cell lines were obtained from ATCC and cultured according to published methods31,32 and were utilized as positive and negative controls, respectively, in immunoprecipitation and western analyses.

Reverse-Transcription Polymerase Chain Reaction (RT-PCR) Analysis Total RNA from cell monolayers of types I and II cell-like phenotypes was isolated using TRIzol1 Reagent (Invitrogen, Carlsbad, CA). RNA quantitation and purity were determined from spectrophotometric absorbance at 260 and 260/280 nm, respectively, and was subsequently utilized for the synthesis of first strand cDNA. Reverse transcription procedure involved incubation of 5 mg RNA at 708C for 10 min and at 48C for 5 min, followed by addition of cDNA reaction mixture that contained: 5 first strand buffer (MgCl2), 10 mM dNTP mix, oligo dT12–18 (500 mg/mL), 0.1 M DTT, reverse transcriptase (200 U) and DEPC treated water, incubated at 428C for 60 min and at 998C for 5 min. The cDNA product was held at 48C for immediate use or stored at 808C until required. One microliter of resultant cDNA was amplified by PCR using a GeneAmp PCR 2400 system (PerkinElmer, Norwalk, CT) in 20 mL reaction mixture consisting of: 10 PCR buffer, MgCl2 (50 mM), dNTP mix (10 mM), Taq polymerase (5 U/mL), and primers. Sequences of all primers used, along with the expected product DOI 10.1002/jps

MOLECULAR AND FUNCTIONAL EXPRESSION OF MRP1

size and accession numbers are shown in Table 1. The PCR cycle program consisted of one cycle of initial denaturation (948C, 4 min), followed by 30 cycles of denaturing (948C, 45 s), annealing (558C, 45 s), and extension (728C, 45 s), and then a final extension cycle at 728C for 7 min. For comparison, RT-PCR analysis of mdr-1b expression was also performed. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH), a housekeeping gene, was used for internal control. Amplified DNA products of MRP were resolved on a denaturing 1.5% agarose gel and extracted using the QIAquick Gel Extraction kit (Qiagen, Valencia, CA). The extracted cDNA fragments were ligated into pGEM1-T Easy vector (Promega, Madison, WI) which was expanded by transformation of Escherichia coli DH5a competent cells. Positive clones were selected and analyzed by endonuclease (EcoRI) restriction assay. The resultant plasmids were sequenced using infrared fluorescent dyelabeled M13 primers (Genemed Synthesis, South San Francisco, CA). The homology of amplified MRP1 fragments was verified by comparison with the partial or complete sequences of known rat MRP isoforms 1–6 using the basic local alignment search tool (BLAST) (www.ncbi.nlm.nih.gov). Immunoprecipitation and Western Analysis Confluent monolayers of types I and II cell-like phenotypes, and cultured Caco-2 cells (positive control) and HEK293 cells (negative control), were lysed at 378C with 1% Triton X-100. Cell lysates were precleared with 30% Sepharose CL-2B crosslinked beads (Sigma–Aldrich, St. Louis, MO). The supernatant was incubated in an end-over-end style rotation with rabbit polyclonal anti-human MRP1 antibody overnight at 48C in the presence of Protein A Sepharose (Sigma–Aldrich). Immunoprecipitates were fractionated on an 8% precast polyacrylamide electrophoresis gel (Gradipore, Hawthorne, NY). The gel was then electrotrans-

2343

ferred onto nitrocellulose membranes (TransBlot1, Bio-Rad Laboratories, Hercules, CA). The expression of MRP1 was probed with a rabbit polyclonal anti-MRP1 primary antibody (1:200 dilution) and visualized with peroxidase-conjugated affinipure donkey anti-rabbit secondary antibody (1:5000 dilution) using enhanced chemiluminescence (ECL) (Pierce, Rockford, IL). Confocal Microscopy Cell monolayers with either types I or II cell-like phenotypic and morphologic characteristics grown on permeable supports were incubated with 3.7% formaldehyde in phosphate buffered saline (PBS) at room temperature for 20 min. After washing three times with PBS, cells were permeabilized with 0.5% Triton X-100 for 15 min, washed once with PBS and blocked with 1% BSA in PBS for 30 min. After washing once with 0.05% Tween 20 in PBS (PBST), monolayers were further incubated with a monoclonal MRPr1 antibody at a dilution of 1:100 and rabbit anti ZO-1 antibody at 4 mg/mL for 2 h. After washing three times with PBST, cells were incubated with FITC-conjugated anti-rat secondary antibody and rhodamine-conjugated goat anti-rabbit secondary antibody, both at a dilution of 1:500 for 1 h. Control slides for both cell types were prepared similarly, but the primary antibodies were omitted. Propidium iodide was used as a nuclear stain. Monolayers were then washed twice with PBST and once with PBS before mounting onto slides with ProlongTM anti-fade medium (Molecular Probes, Eugene, OR). Slides were examined under a confocal microscope with a 450–490 nm wavelength filter. Efflux and Accumulation Studies Monolayers with type II cell-like characteristics were used for transport and uptake studies on

Table 1. Sequences of Primers Used for RT-PCR

Accession Number

Primer Sequence (50 –30 )

mdr-1b

AY082609

MRP1

AJ277881

ATTCGGGATGTTTCGCTATG (FP) TCCAAACGCAATCACAGTTC (RP) CCTGTTTTGTTCTCGGGTTC (FP) GTAGGTTTCCAGGGTTGCTG (RP) GCCAAAAGGGTCATCATCTC (FP) CTCAGTGTAGCCCAGGATGC (RP)

Gene

GAPDH

M17701

Expected Product Size (bp) 703 550 448

FP, forward primer; RP, reverse primer; bp, base pair. DOI 10.1002/jps

JOURNAL OF PHARMACEUTICAL SCIENCES, VOL. 97, NO. 6, JUNE 2008

2344

PATEL ET AL.

days 5–7 in culture. Monolayers were preequilibrated for 1 h with Ringer’s solution (116.4 mM NaCl, 5.4 mM KCl, 0.78 mM NaH2PO4, 25 mM NaHCO3, 1.80 mM CaCl2, 0.81 mM MgSO4, 5.55 mM glucose, 15 mM N-[2-hydroxyethyl]piperazine-N0 -[2-ethanesulfonic acid] (HEPES), and 0.075 mM BSA, pH 7.4) at 378C. Subsequently, monolayers were maintained for 1 h with or without various concentrations of basolateral indomethacin. Fluorescein sodium was added to the basolateral compartment for 1 h for both transport and accumulation studies. Monolayers were then rinsed twice with ice-cold PBS to stop uptake/transport and solubilized in 1% SDS in PBS. Protein content of each monolayer was determined using a bicinchoninic acid protein assay kit (Pierce). Fluorescence of cell lysates was measured at excitation/emission wavelengths of 485/530 nm spectrophotometrically (F-2000, Hitachi, Tokyo, Japan). Fluorescein uptake was expressed as pmole per milligram of cellular protein. TEER was measured before and after the 1-h incubation period with fluorescein to determine monolayer integrity. Statistical Analyses For comparisons among more than two groups, ANOVA was used with post hoc comparisons based on Bonferroni’s tests. p < 0.05 was considered statistically significant.

II-like pneumocytes (Lane 3) but not in type I-like pneumocytes (Lane 2), as evidenced by the 600 base pair fragment observed in Lane 3. MRP gene expression was observed in both types I- and IIlike pneumocytes, as seen by the 550 base pair (expected size based on the location of the designed primers) fragments in Lanes 4 and 5. In order to determine the sequence identity of these fragments, they were individually cut and extracted from the agarose gel, subcloned into the pGEM-T Easy vector and sequenced. The sequence was aligned separately with the partial or complete cDNA sequence of the six rat MRP isoforms using BLAST 2.2 (www.ncbi.nlm.nih.gov). As shown in Table 2, the sequenced fragment from both types of pneumocytes was 99% identical to the sequence of rat MRP1, 74% identical to rat MRP3, and did not resemble any of the other rat MRP isoforms (MRP 2, 4, 5, and 6). After confirming MRP1 gene expression in both types I- and II-like pneumocytes, we evaluated MRP1 protein expression in these cells using immunoprecipitation followed by western analysis. Results shown in Figure 1b clearly illustrate an approximately 190 kDa band, corresponding to the expected molecular weight of MRP1, in both types I- and II-like pneumocytes. A 190 kDa band is also observed in Caco-2 cell lysates, which were used as a positive control for MRP1,33 but is absent in HEK293 cell lysates that were used as negative controls.34

RESULTS Immunolocalization of MRP1 in Pneumocytes MRP1 Gene and Protein Expression in Pneumocytes We evaluated gene expression of mdr1 and MRP mRNA in both type I- and type II-like pneumocytes grown on filters for 5 days (Fig. 1a.) Messenger RNA for mdr1b was amplified in type

The cellular localization of MRP1 was studied by immunostaining and confocal laser scanning microscopy using an FITC-conjugated anti-MRP1 antibody, results of which are shown in Figures 2 and 3, respectively. The plasma membrane

Figure 1. (a) Expression of mdr and MRP1 genes in rat alveolar epithelial cell monolayers. Lane 1: 100-bp ladder; Lanes 2 and 3: mdr1b in alveolar types I- and IIlike cell monolayers, respectively; Lanes 4 and 5: MRP1 in types I- and II-like cell monolayers, respectively; and Lanes 6 and 7: GAPDH in types I-and II-like cell monolayers, respectively. (b) Immunoprecipitation and western analysis of MRP1. Lane 1: HEK293 cells (negative control); Lane 2: Caco-2 cells (positive control); Lane 3: type Ilike cell monolayers; and Lane 4: type II-like cell monolayers. JOURNAL OF PHARMACEUTICAL SCIENCES, VOL. 97, NO. 6, JUNE 2008

DOI 10.1002/jps

MOLECULAR AND FUNCTIONAL EXPRESSION OF MRP1

Table 2. Sequence Identity of Amplified Gene Product

Rat MRP Isoform MRP1 MRP2 MRP3 MRP4 MRP5 MRP6

Accession Number and Sequence Type

% Identity of Gene Fragment to MRP Isoform

AY170916 (complete) AF261713 (partial) AF072816 (complete) AF376781 (partial) AB020209 (complete) U73038 (complete)

99% NS 74% NS NS NS

NS, not significant.

localization of MRP1 in types II and I cell-like pneumocytes is evidenced by concentric green staining around the cell periphery in Figure 2a and e, respectively. No cytoplasmic staining is observed. Type II-like cells were also stained for ZO-1 protein that is expressed at tight junctions (Fig. 2b). No colocalization between MRP1 and ZO-1 protein was seen when images were merged (Fig. 2c). Figure 2d and f shows negative controls for types II- and I-like cells, respectively, in which the MRP1 primary antibody was omitted, but propidium iodide that stains the nucleus of the cell was included to provide a frame of reference. To determine the polarity of MRP1 expression, we performed progressive horizontal confocal laser scanning through the stained primary cultured cells (Fig. 3). It was observed that MRP1 localized primarily to the basolateral membrane of the type II-like pneumocytes (Fig. 3a). This is evident from the gradual

2345

appearance of FITC. Similarly, a progressive horizontal scan performed on type I-like pneumocytes demonstrates basolateral staining of MRP1 (Fig. 3b). Since the average thickness of type I pneumocytes (0.36 mm) is much smaller than type II cells (5 mm), the number of sections obtained by horizontal scanning is fewer in type I-like cells as compared to type II-like cells.

Fluorescein Efflux and Accumulation Studies Functional activity of MRP1 was determined by studying the efflux of an MRP1-specific substrate fluorescein across type II-like pneumocytes and evaluating whether the efflux activity could be inhibited by the MRP1-specific inhibitor indomethacin. Basolateral-to-apical (b-to-a) uptake and transport of fluorescein served as a marker for MRP1 activity. As shown in Figure 4, when fluorescein and indomethacin were both added to the basolateral compartment there was a dosedependent increase in b-to-a transport of fluorescein in type II-like cells in the presence of indomethacin at concentrations up to 100 mM. Increases in fluorescein uptake were also seen using the same concentrations of indomethacin (Fig. 4b). TEER of the cells did not change significantly during the entire course of the accumulation and efflux experiments for indomethacin exposure from 0 to 100 mM. However, TEER decreased significantly when concentrations of indomethacin exceeded 100 mM. Similar experiments in type I cell-like monolayers, were not possible because monolayers could not

Figure 2. Immunolocalization of MRP1. (a,b) Cell membrane localization of MRP1 and ZO-1, respectively, in type II-like cells. (c) A merged image of (a) and (b). (d) Negative control for type II-like cells, in which the primary antibody is omitted. Nuclei are stained with propidium iodide. (e,f) Type I-like cells, where (e) is stained for MRP1 and nuclei while (f) is negative control. DOI 10.1002/jps

JOURNAL OF PHARMACEUTICAL SCIENCES, VOL. 97, NO. 6, JUNE 2008

2346

PATEL ET AL.

Figure 3. Confocal microscopy for MRP1. (a) Z-sections of MRP1 in type II-like cells and (b) Z-sections of MRP1 in type I-like cells, progressively scanned from the apical to basolateral direction.

withstand indomethacin exposure even at low concentrations, indicated by a drastic decrease in TEER, and paracellular transport of fluorescein (data not shown).

DISCUSSION We report here, for the first time, molecular and functional expression of the efflux protein, MRP1 in primary cultured rat alveolar epithelial cells. MRP1 gene was present in both type I- and II-like pneumocytes as demonstrated by RT-PCR analy-

sis. Expression of the corresponding protein was confirmed using immunoprecipitation followed by western analysis using MRP1-specific antibody. Expression of MRP1 protein appeared to be higher in type I-like pneumocytes (Lane 3 of Fig. 1b) than in type II-like pneumocytes (Lane 4 of Fig. 1b). This implies that MRP1 expression increases as the pneumocytes differentiate from type II- to type I-like cells. Endter et al.35 observed a similar pattern for P-gp expression in human alveolar epithelial cell monolayers. Although the P-gp/ mdr1 gene product was present in freshly isolated type II cells as well as type I-like cells at day 8,

Figure 4. (a) Basolateral-to-apical transport of fluorescein (flu) across type II cell-like monolayers in the presence of various concentrations of indomethacin. Fluorescein transport was normalized to protein content of cell monolayers. Data represent mean  SD, n ¼ 3–4. Denotes statistical significance with p < 0.05 compared to control values. (b) Uptake of fluorescein into type II cell-like monolayers from basolateral fluid in the presence of various concentrations of indomethacin. Fluorescein uptake was normalized to protein content of the cell monolayers. Data represent mean  SD, n ¼ 3–4.  Denotes statistical significance with p < 0.05 and denoted statistical significance with p < 0.01 compared to control values. JOURNAL OF PHARMACEUTICAL SCIENCES, VOL. 97, NO. 6, JUNE 2008

DOI 10.1002/jps

MOLECULAR AND FUNCTIONAL EXPRESSION OF MRP1

only type I-like cells at day 8 expressed the corresponding protein product at detectable levels. Given that type I pneumocytes occupy 95% of the surface area36 and that the role of MRP1 is to efflux toxic substances,37 it is reasonable that type I cells express higher amounts of MRP1 than type II cells to protect against inhaled toxic substances. Nitrosoamines from cigarette smoke as well as heavy metals like arsenic, a major air pollutant are shown to be transported by MRP1 as conjugates of glutathione or glucoronide and therefore it is likely that type I cells play a role in minimizing their exposure.38,39 On the other hand, type II cells occupy a smaller surface area and thus MRP1 in these cells may not contribute in a physiological protective role of effluxing toxins to the same extent as type I cells. However, type II alveolar cells are shown to produce the inflammatory mediators leuokotrienes, including LTC4, which is an endogenous substrate of MRP1 and may therefore function as an LTC4 transporter during inflammation or oxidative stress.21,40 In addition, we also show expression of the multidrug resistance gene (mdr1b gene) in type IIlike pneumocytes but not in type I-like pneumocytes. This is consistent with the results of Weidauer et al., who reported the presence of mdr1b gene in 3-day cultures of rat alveolar type II cells. However, the lack of Mdr1b gene expression in type I-like pneumocytes in our findings is contradictory to the observations made by Campbell et al. who show that cultures of type I-like cells do express Mdr1b gene in the presence or absence of dexamethasone. We speculate that this discrepancy may be due to differences in culture conditions and further studies are needed to evaluate these differences. Using immunofluorescence and confocal microscopy, we demonstrated that expression of MRP1 in type I- and type II-like pneumocytes is on the basolateral membrane. In order to further strengthen these findings, we used the zona occludens (ZO-1) protein as a tight junction marker and performed colocalization studies. The 220 kDa ZO-1 protein is one of the many proteins present in the plaque or peripheral region of the tight junction complex that anchors transmembrane proteins to the tight junction structure and links them to the cell cytoskeleton and signaling pathways, essentially controlling the structure and function of tight junctions.41,42 We did not observe colocalization of MRP1 with ZO-1 protein as evidenced by distinct staining DOI 10.1002/jps

2347

patterns in Figure 2, confirming that MRP1 was localized to the basolateral membrane. This concurs with various other previously published findings that MRP1 is preferably expressed on the basolateral membrane of a variety of polarized cells.23,25,28,30 We also demonstrated that b-to-a transport and uptake of fluorescein (an MRP1-specific substrate) could be increased in the presence of increasing concentrations of an MRP1-specific inhibitor, indomethacin. Indomethacin has been shown to be MRP1-specific, with an IC50 of approximately 10 mM43 but we did not see complete inhibition of MRP1 activity at up to 100 mM indomethacin. Cell viability was completely preserved at concentrations of up to 100 mM indomethacin, but exceeding this concentration resulted in a drastic reduction in TEER (a measure of monolayer viability). Nevertheless, uptake and transport of fluorescein was clearly dependent on the dose of indomethacin and indicative of MRP1 activity on the basolateral membrane of the cells. In summary, we have demonstrated the molecular and functional expression of MRP1 on the basolateral membrane of primary cultured rat alveolar epithelial cells. This provides a potential screening tool for drug candidates intended for pulmonary delivery, which may also be substrates for MRP1. In addition, this finding should allow further characterization of this primary culture model with MRP1 expression and activities to support its utility and value in addressing drug delivery and basic biological questions.

ACKNOWLEDGMENTS This work was supported in part by the Hastings Foundation and National Institutes of Health research grants HL38578, HL38621, HL38658, HL62659 and HL64365. We would like to thank Ms. Michaela K. MacVeigh of the confocal microscopy subcore at the Center for Liver Diseases (NIH P30 DK48522), USC Keck School of Medicine, for her technical assistance. Edward D. Crandall is Kenneth T. Norris, Jr. Chair and Hastings Professor of Medicine.

REFERENCES 1. Patton JS, Fishburn CS, Weers JG. 2004. The lungs as a portal of entry for systemic drug delivery. Proc Am Thorac Soc 1:338–344. JOURNAL OF PHARMACEUTICAL SCIENCES, VOL. 97, NO. 6, JUNE 2008

2348

PATEL ET AL.

2. Patton JS, Byron PR. 2007. Inhaling medicines: Delivering drugs to the body through the lungs. Nat Rev Drug Discov 6:67–74. 3. Winkler J, Hochhaus G, Derendorf H. 2004. How the lung handles drugs: Pharmacokinetics and pharmacodynamics of inhaled corticosteroids. Proc Am Thorac Soc 1:356–363. 4. Thorsson L, Edsbacker S, Kallen A, Lofdahl CG. 2001. Pharmacokinetics and systemic activity of fluticasone via Diskus and pMDI, and of budesonide via Turbuhaler. Br J Clin Pharmacol 52:529–538. 5. Byron PR, Patton JS. 1994. Drug delivery via the respiratory tract. J Aerosol Med 7:49–75. 6. Foster KA, Avery ML, Yazdanian M, Audus KL. 2000. Characterization of the Calu-3 cell line as a tool to screen pulmonary drug delivery. Int J Pharm 208:1–11. 7. Shen BQ, Finkbeiner WE, Wine JJ, Mrsny RJ, Widdicombe JH. 1994. Calu-3: A human airway epithelial cell line that shows cAMP-dependent Cl-secretion. Am J Physiol 266 (5 Pt 1): L493–L501. 8. Cheek JM, Kim KJ, Crandall ED. 1989. Tight monolayers of rat alveolar epithelial cells: Bioelectric properties and active sodium transport. Am J Physiol 256 (3 Pt 1): C688–C693. 9. Cheek JM, Evans MJ, Crandall ED. 1989. Type I cell-like morphology in tight alveolar epithelial monolayers. Exp Cell Res 184:375–387. 10. Borok Z, Lubman RL, Danto SI, Zhang XL, Zabski SM, King LS, Lee DM, Agre P, Crandall ED. 1998. Keratinocyte growth factor modulates alveolar epithelial cell phenotype in vitro: Expression of aquaporin 5. Am J Respir Cell Mol Biol 18:554– 561. 11. Matsukawa Y, Yamahara H, Yamashita F, Lee VH, Crandall ED, Kim KJ. 2000. Rates of protein transport across rat alveolar epithelial cell monolayers. J Drug Target 7:335–342. 12. Morimoto K, Yamahara H, Lee VH, Kim KJ. 1993. Dipeptide transport across rat alveolar epithelial cell monolayers. Pharm Res 10:1668–1674. 13. Matsukawa Y, Yamahara H, Lee VH, Crandall ED, Kim KJ. 1996. Horseradish peroxidase transport across rat alveolar epithelial cell monolayers. Pharm Res 13:1331–1335. 14. Morimoto K, Yamahara H, Lee VH, Kim KJ. 1994. Transport of thyrotropin-releasing hormone across rat alveolar epithelial cell monolayers. Life Sci 54:2083–2092. 15. Kim KJ, Fandy TE, Lee VH, Ann DK, Borok Z, Crandall ED. 2004. Net absorption of IgG via FcRnmediated transcytosis across rat alveolar epithelial cell monolayers. Am J Physiol Lung Cell Mol Physiol 287:L616–L622. 16. Widera A, Beloussow K, Kim KJ, Crandall ED, Shen WC. 2003. Phenotype-dependent synthesis of transferrin receptor in rat alveolar epithelial cell monolayers. Cell Tissue Res 312:313–318.

JOURNAL OF PHARMACEUTICAL SCIENCES, VOL. 97, NO. 6, JUNE 2008

17. Kim KJ, Borok Z, Crandall ED. 2001. A useful in vitro model for transport studies of alveolar epithelial barrier. Pharm Res 18:253–255. 18. Cole SP, Bhardwaj G, Gerlach JH, Mackie JE, Grant CE, Almquist KC, Stewart AJ, Kurz EU, Duncan AM, Deeley RG. 1992. Overexpression of a transporter gene in a multidrug-resistant human lung cancer cell line. Science 258:1650–1654. 19. Kruh GD, Belinsky MG. 2003. The MRP family of drug efflux pumps. Oncogene 22:7537–7552. 20. Loe DW, Deeley RG, Cole SP. 1998. Characterization of vincristine transport by the M(r) 190,000 multidrug resistance protein (MRP): Evidence for cotransport with reduced glutathione. Cancer Res 58:5130–5136. 21. Leier I, Jedlitschky G, Buchholz U, Cole SP, Deeley RG, Keppler D. 1994. The MRP gene encodes an ATP-dependent export pump for leukotriene C4 and structurally related conjugates. J Biol Chem 269:27807–27810. 22. Sun H, Johnson DR, Finch RA, Sartorelli AC, Miller DW, Elmquist WF. 2001. Transport of fluorescein in MDCKII-MRP1 transfected cells and mrp1-knockout mice. Biochem Biophys Res Commun 284:863– 869. 23. Huai-Yun H, Secrest DT, Mark KS, Carney D, Brandquist C, Elmquist WF, Miller DW. 1998. Expression of multidrug resistance-associated protein (MRP) in brain microvessel endothelial cells. Biochem Biophys Res Commun 243:816–820. 24. Sugiyama D, Kusuhara H, Lee YJ, Sugiyama Y. 2003. Involvement of multidrug resistance associated protein 1 (Mrp1) in the efflux transport of 17beta estradiol-D-17beta-glucuronide (E217betaG) across the blood-brain barrier. Pharm Res 20:1394– 1400. 25. Hamilton KO, Topp E, Makagiansar I, Siahaan T, Yazdanian M, Audus KL. 2001. Multidrug resistance-associated protein-1 functional activity in Calu-3 cells. J Pharmacol Exp Ther 298:1199– 1205. 26. van der Deen M, Marks H, Willemse BW, Postma DS, Muller M, Smit EF, Scheffer GL, Scheper RJ, de Vries EG, Timens W. 2006. Diminished expression of multidrug resistance-associated protein 1 (MRP1) in bronchial epithelium of COPD patients. Virchows Arch 449:682–688. 27. Bandi N, Kompella UB. 2002. Budesonide reduces multidrug resistance-associated protein 1 expression in an airway epithelial cell line (Calu-1). Eur J Pharmacol 437:9–17. 28. Lehmann T, Kohler C, Weidauer E, Taege C, Foth H. 2001. Expression of MRP1 and related transporters in human lung cells in culture. Toxicology 167:59–72. 29. Flens MJ, Zaman GJ, van der Valk P, Izquierdo MA, Schroeijers AB, Scheffer GL, van der Groep P, de Haas M, Meijer CJ, Scheper RJ. 1996. Tissue

DOI 10.1002/jps

MOLECULAR AND FUNCTIONAL EXPRESSION OF MRP1

30.

31.

32.

33.

34.

35.

36.

distribution of the multidrug resistance protein. Am J Pathol 148:1237–1247. Wioland MA, Fleury-Feith J, Corlieu P, Commo F, Monceaux G, Lacau-St-Guily J, Bernaudin JF. 2000. CFTR, MDR1, and MRP1 immunolocalization in normal human nasal respiratory mucosa. J Histochem Cytochem 48:1215–1222. Yeung AK, Basu SK, Wu SK, Chu C, Okamoto CT, Hamm-Alvarez SF, von Grafenstein H, Shen WC, Kim KJ, Bolger MB, Haworth IS, Ann DK, Lee VH. 1998. Molecular identification of a role for tyrosine 167 in the function of the human intestinal protoncoupled dipeptide transporter (hPepT1). Biochem Biophys Res Commun 250:103–107. Shah D, Shen WC. 1996. Transcellular delivery of an insulin-transferrin conjugate in enterocyte-like Caco-2 cells. J Pharm Sci 85:1306–1311. Hirohashi T, Suzuki H, Chu XY, Tamai I, Tsuji A, Sugiyama Y. 2000. Function and expression of multidrug resistance-associated protein family in human colon adenocarcinoma cells (Caco-2). J Pharmacol Exp Ther 292:265–270. Stride BD, Grant CE, Loe DW, Hipfner DR, Cole SP, Deeley RG. 1997. Pharmacological characterization of the murine and human orthologs of multidrug-resistance protein in transfected human embryonic kidney cells. Mol Pharmacol 52:344– 353. Endter S, Becker U, Daum N, Huwer H, Lehr CM, Gumbleton M, Ehrhardt C. 2006. P-glycoprotein (MDR1) functional activity in human alveolar epithelial cell monolayers. Cell Tissue Res Crapo JD, Barry BE, Gehr P, Bachofen M, Weibel ER. 1982. Cell number and cell characteristics of

DOI 10.1002/jps

37.

38.

39.

40.

41.

42.

43.

2349

the normal human lung. Am Rev Respir Dis 126: 332–337. van der Deen M, de Vries EG, Timens W, Scheper RJ, Timmer-Bosscha H, Postma DS. 2005. ATPbinding cassette (ABC) transporters in normal and pathological lung. Respir Res 6:59. Leslie EM, Haimeur A, Waalkes MP. 2004. Arsenic transport by the human multidrug resistance protein 1 (MRP1/ABCC1). Evidence that a tri-glutathione conjugate is required. J Biol Chem 279:32700–32708. Leslie EM, Ito K, Upadhyaya P, Hecht SS, Deeley RG, Cole SP. 2001. Transport of the beta-O-glucuronide conjugate of the tobacco-specific carcinogen 4(methylnitrosamino)-1-(3-pyridyl)-1-butanol (NNAL) by the multidrug resistance protein 1 (MRP1). Requirement for glutathione or a non-sulfur-containing analog. J Biol Chem 276:27846–27854. Cott GR, Westcott JY, Voelkel NF. 1990. Prostaglandin and leukotriene production by alveolar type II cells in vitro. Am J Physiol 258 (4 Pt 1): L179–L187. Riesen FK, Rothen-Rutishauser B, Wunderli-Allenspach H. 2002. A ZO1-GFP fusion protein to study the dynamics of tight junctions in living cells. Histochem Cell Biol 117:307–315. Zahraoui A, Louvard D, Galli T. 2000. Tight junction, a platform for trafficking and signaling protein complexes. J Cell Biol 151:F31–F36. Bobrowska-Hagerstrand M, Wrobel A, Mrowczynska L, Soderstrom T, Shirataki Y, Motohashi N, Molnar J, Michalak K, Hagerstrand H. 2003. Flavonoids as inhibitors of MRP1-like efflux activity in human erythrocytes. A structure-activity relationship study. Oncol Res 13:463–469.

JOURNAL OF PHARMACEUTICAL SCIENCES, VOL. 97, NO. 6, JUNE 2008