Molecular characterization and expression analysis of Toll-like receptor 21 cDNA from Paralichthys olivaceus

Fish & Shellfish Immunology 35 (2013) 1138e1145

Contents lists available at ScienceDirect

Fish & Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi

Molecular characterization and expression analysis of Toll-like receptor 21 cDNA from Paralichthys olivaceus Hong Gao a, Lian Wu a, Jin-Sheng Sun a, b, *, Xu-Yun Geng b, Bao-Ping Pan a a b

Tianjin Key Laboratory of Animal and Plant Resistance, College of Life Sciences, Tianjin Normal University, Tianjin 300387, PR China Tianjin Aquaculture Disease Prevention & Treatment Center, Tianjin 300221, PR China

a r t i c l e i n f o

a b s t r a c t

Article history: Received 15 March 2013 Received in revised form 30 June 2013 Accepted 14 July 2013 Available online 21 July 2013

Toll-like receptor (TLR) is believed to play crucial role in host defense of pathogenic microbes in innate immune system. In the present study, the full-length cDNA of Paralichthys olivaceus Toll-like receptor 21 (Po-TLR21) was cloned by homology cloning and rapid amplification of cDNA ends (RACE) technique. The Po-TLR21 cDNA sequence was 3687 bp, containing an open reading frame of 2922 bp encoding 973 amino acids. TMHMM and SMART program analysis indicated that protein contained one transmembrane domain, eighteen leucine-rich repeats (LRRs), and one Toll/IL-1 receptor homology domain (TIR). Multiple alignment analysis of the Po-TLR21 protein-coding sequence with other known TLR21 from grouper, pufferfish, zebrafish, cod, catfish, carp and chicken showed the homology of 67%, 63%, 54%, 52%, 51%, 49%, and 39%, respectively. The Po-TLR21 mRNA expression patterns were measured by realtime PCR. The results revealed that TLR21 is widely expressed in various tested healthy tissues, and highly expressed in spleen and gill. In vivo immunostimulation experiments revealed that expression of TLR21 is modulated by Vibrio anguillarum (V. anguillarum), CpG oligodeoxynucleotides (CpG ODN) and poly I:C. Moreover, the inhibitor of homodimerization of myeloid differentiation factor 88 (MyD88) could significantly reduce the up-regulation of TLR21, MyD88, and tumor necrosis factor (TNF) expression in CpG ODN or poly I:C-treated head kidney cells in vitro. These results indicate that TLR21 may be involved in the pathogen recognition in the early innate immune. Ó 2013 Elsevier Ltd. All rights reserved.

Keywords: Toll-like receptor 21 Paralichthys olivaceus Characterization Expression Teleost fish

1. Introduction The olive flounder (Paralichthys olivaceus) is native to the subtropical/temperate western pacific from the Sea of Okhotsk off south eastern Russia, along Japanese shores to the South China Sea. In the early 1990s, olive flounder became widely cultured in Korea, Japan and China. In recent years, with rapidly developing marine farming activities, outbreaks of diseases have affected the olive flounder aquaculture industry causing heavy economic losses [1]. Many serious diseases are caused by either bacterial or viral infections. Great effort has been made in preventing and controlling the disease. However, at present there is no treatment available to interfere with the unrestrained occurrence and spread of the disease. The recent progress in molecular biology techniques has made it possible to obtain information on mechanisms of fish * Corresponding author. Tianjin Key Laboratory of Animal and Plant Resistance, College of Life Sciences, Tianjin Normal University, Tianjin 300387, PR China. Tel.: þ86 22 88250781; fax: þ86 22 88254270. E-mail addresses: [email protected] (H. Gao), jssun1965@ yahoo.com.cn (J.-S. Sun). 1050-4648/$ e see front matter Ó 2013 Elsevier Ltd. All rights reserved. http://dx.doi.org/10.1016/j.fsi.2013.07.027

immune system [2e5]. Yet, further research is still required to fully understand olive flounder immune mechanisms and in order to develop new prevention strategies and treatment approaches. Innate immune system represents the first line of defense against foreign pathogens. The recent discovery and characterization of the Toll-like receptor (TLR) family have incited new interest in the field of innate immunity. It is already clear that these receptors have a vital role in microbial recognition, induction of antimicrobial genes and the control of adaptive immune responses [6]. To date, 17 TLR types (TLR1, 2, 3, 4, 5, 5S, 7, 8, 9, 13, 14, 18, 19, 20, 21, 22, 23) have been identified in more than a dozen different teleost species [7]. Eight members of TLRs (TLR5S, 14, 18, 19, 20, 21, 22, 23) were teleost specific, which have not been identified in mammals [8,9]. TLR21 was initially identified in the pufferfish (Fugu rubripes) [10] and zebrafish [11,12] genome database based on in silico studies. Phylogenetic analysis indicates that TLR21 is a member of the TLR11 subfamily, which includes mouse TLR12 and 13 and teleost TLR20 [13]. Orthologs of TLR21 have so far been identified in several fish species, such as channel catfish (Ictalurus punctatus) [14], common carp (Cyprinus carpio) [15], and orangespotted grouper (Epinephelus coioides) [16], They were also

H. Gao et al. / Fish & Shellfish Immunology 35 (2013) 1138e1145

identified in clawed frog (Xenopus laevis) [17] and chicken (Gallus gallus) [18]. TLR21 is widely expressed in various tissues, such as the liver, spleen, kidney, skin, and gill in the puffer fish [10], catfish [14] and orange-spotted grouper [16]. When channel catfish were acutely infected by Edwardsiella ictaluri through intraperitoneal injection, the transcriptional levels of TLR21 increased significantly at 6 h [19]. Post Cryptocaryon irritans infection, TLR21 expression of orange-spotted grouper was up-regulated in the locally infected sites (skin and gill), while suppressed in systemic immune organs (spleen and head kidney) [16]. The molecular component of microorganisms recognized by teleost TLR21 is still unknown. Recent studies have shown that chicken TLR21 acts as a functional homologue to mammalian TLR9 in the recognition of CpG ODN [18,20]. However, there is no evidence yet that fish TLR21, like TLR9 is function similar to mammalian TLR9. Here, we reported the characterization of putative protein and cDNA structure of TLR21 from olive flounder. The tissue specific expression and temporal expression profiles of the TLR21 and associated molecules genes after stimulation with CpG ODN, poly I:C and one of the main fish pathogens, Vibrio anguillarum, were examined and compared in order to better understand their potential roles in olive flounder immune responses. These results are essential to understand the innate immune system in olive flounder, whose additional aim was to obtain insights for further study of the immune mechanism in olive flounder and teleost.

1139

Table 1 Sequence of primers used in this study. Primers

Nucleotide sequences(50 e30 )

Use/function

TLR21-F1

TATCGTTACAACMGHATYCT

TLR21-R1

AAGATTYCCRAAAACMTC

TLR21-F2

AATBTGTCCTBTAACWACAT

TLR21-R2

GTTCCTCAAGCCTTCTCA

AP

CTGATCTAGAGGTACCGGATCC

Oligo(dT)16AP TLR21.3-F1 TLR21.3-F2 TLR21.5-R

CTGATCTAGAGGTACCGGATCC(T)16 GGAAACAACCTCAAACAC CTCACCAACAATAATCTCAA AGTGAGGGATGTGGGTAG

TLR21.5-R1 TLR21.5-R2 TLR21.q-F TLR21.q-R b-actin-F b-actin-R MyD88.q-F MyD88.q-R TNF.q-F TNF.q-R

GGTTAGATTGAGATTGGTAG GGGTCAGAGAGAGAAAGGT TAAACTTTGCCTACATCACA AACACGAGCAGAAGAACAT AGGTTCCGTTGTCCCG TGGTTCCTCCAGATAGCAC GTGACCCAGAGCCAACT CAACTTACCAGGACAGAGG CAGGGTATGGCTCTTCACG CCCAGGTAGATGGCATTGTA

Partial cDNA amplification Partial cDNA amplification Partial cDNA amplification Partial cDNA amplification Adaptor Primer for 30 RACE and 50 RACE 30 RACE, 50 RACE 30 RACE 30 RACE cDNA synthesis for 50 RACE 50 RACE 50 RACE Quantitative PCR Quantitative PCR Quantitative PCR Quantitative PCR Quantitative PCR Quantitative PCR Quantitative PCR Quantitative PCR

Letter nucleotide code: M ¼ A,C; H ¼ A,C,T; Y ¼ C,T; R ¼ A,G; B ¼ C,G,T; W ¼ A,T.

2. Materials and methods 2.1. Experimental animals The healthy olive flounder with three different weight classes were used in three different experiments respectively. Fish with the weight of about 400g purchased from local aquatic product trading market were used for experiment of cDNA cloning and tissue specific expression analysis. Fish with the weight of 32  2.1 g purchased from ShengYi Marine Fish Farm in Hangu district, Tianjin, China, were used for experiment of immunostimulation in vivo. Fish with the weight of about 700 g purchased from local aquatic product trading market were used for experiment of MyD88 inhibitor on genes expression in cultured head kidney leucocytes in vitro. In order to obtain the more head kidney leucocytes from one fish, the larger fish was chosen for this experiment. Fish were maintained in a laboratory re-circulating seawater system at 20  2  C and fed with commercial pellets once daily. Fish were sacrificed by cutting the neck with scissors. A series of tissue samples were dissected from the killed fish and immediately frozen by liquid nitrogen, followed by storage at 80  C until used. 2.2. cDNA cloning Total RNA was isolated from head kidney of V. anguillarum stimulated olive flounder using Trizol reagent (Invitrogen) following the manufacturer’s instructions. RNA quality was checked by electrophoresis on 1% agarose gel, and quantified with spectrophotometer. cDNA synthesis was carried out using Quantitect Reverse Transcription Kit (QIAGEN), according to the manufacturer’s instructions and stored at 20  C until using. Two pair of degenerate primers (TLR21-F1 and TLR21-R1, TLR21-F2 and TLR21-R2, see Table 1) for two fragments of TLR21 were designed based on conserved regions from the multiple alignment of TLR21 cDNA sequences from E. coioides (GU198366), Takifugu rubripes (AB101002), Danio rerio (BC163075), I. punctatus (DQ529277), and used to amplify partial cDNA sequences. The PCR products with the expected molecular weight were purified, cloned and sequenced. The

nucleotide sequences of PCR products were identified using the Blastx program in GenBank. To obtain the full-length cDNA sequences of TLR21, rapid amplification of cDNA ends (RACE) 50 and 30 was performed. Based on the partial TLR21 sequence obtained above, the gene-specific primers for RACE PCR were designed (see Table 1). For 30 RACEPCR, the previously isolated RNA was used to synthesize first strand cDNA with primer Oligo(dT)16AP (Table 1). The 30 terminal fragment was PCR amplified using TLR21.3-F1 and adaptor primer AP for first round PCR, followed by a second round PCR with TLR21.3-F2 and adaptor primer AP using the first round PCR products as template. For 50 RACE-PCR, the previously isolated RNA was used to synthesize first-strand cDNA with gene-specific primer TLR21.5-R (Table 1). The RNA strand in RNA-DNA hybrids was specifically degraded by RNase H. Subsequently, the first strand cDNA was tailed with poly(A) using terminal deoxynucleotidyl transferase. PCR amplification uses the following primers Oligo(dT)16AP and TLR21.5-R1 (Table 1) for first round PCR; AP and TLR21.5-R2 (Table 1) for nested PCR. The PCR products with the expected molecular weight were purified, cloned and sequenced. DNASTAR-SeqMan (6.0) software program was performed to obtain the complete cDNA sequence. Coding sequence was predicted by similarity with those of other TLR21 in the database using the multiple sequence alignment of BLAST (http://www.ncbi.nlm.nih. gov/blast). 2.3. Sequence analysis The amino acid sequence was deduced using DNAstar software. The molecular weight, theoretical pI and amino acid composition were computed using ProtParam tool (http://web.expasy.org/ protparam/). The signal peptide was predicted using SignalP 4.0 Server (http://www.cbs.dtu.dk/services/SignalP/) [21]. The transmembrane helice region in protein was predicted using TMHMM Server v. 2.0 (http://www.cbs.dtu.dk/services/TMHMM). LRRs and TIR domain were predicted with LRRfinder program (http://www. lrrfinder.com/lrrfinder.php). The protein sequence of olive flounder

1140

H. Gao et al. / Fish & Shellfish Immunology 35 (2013) 1138e1145

TLR21 was compared to its counterpart sequences currently available in GenBank, retrieved using the BLAST program (http://www.ncbi. nlm.nih.gov). Multiple amino acid sequences were aligned with the ClustalW2 program (http://www.ebi.ac.uk/Tools/msa/clustalw2/). The percentage of similarity and identity of the known TLR21 sequences was calculated by ClustalW2. The phylogenetic tree was founded by MEGA 4 software. 2.4. Tissue expression analysis of TLR21 To determine the tissue specific expression of TLR21 mRNA, total RNA samples were extracted from heart, liver, spleen, gill, head kidney, muscle, intestine, blood of the healthy P. olivaceus (about 400 g) using Trizol reagent, and treated with DNase I (Promega) according to the manufacturer’s instruction. cDNA was synthesized using 1st Strand cDNA Synthesis Kit (TaKaRa). cDNA mix was diluted to 1:5 and stored at 80  C for subsequent PCR or real-time PCR. Real-time PCR experiments were conducted using the primers TLR21.q-F and TLR21.q-R as described in Table 1 to amplify a 198 bp cDNA fragment. The primers b-actin F and b-actin R (Table 1) were used to amplify a 150 bp fragment of olive flounder b-actin gene which was used as the internal control. The quantitative PCR was performed in a Bio-Rad IQ5 Thermal Cycler using the Go TaqÒ qPCR Master Mix (promega). The thermal profile was 95  C for 2 min for an initial denaturation and followed by 40 amplification cycles at 95  C for 15 s, 60  C for 30 s and 72  C for 30 s. Melting curve analysis of amplification products was performed at the end of each PCR reaction to confirm that only one PCR product was amplified and detected. All analyses were based on the average cycle threshold (CT) values of the PCR products. RT-PCR was performed with cDNA templates of each tissue and specific primer under the following PCR conditions: initial denaturation at 95  C for 2 min, followed by 35 cycle of 95  C for 15 s, 60  C for 30 s, 72  C for 30 s and a final extension of 72  C for 5 min. The b-actin gene was used as an internal control. The PCR products were electrophoresed on 1.5% agarose gels.

on genes expression, head kidney leucocytes cultured on 96-well plates were pretreated for 2 h with 100 mM inhibitor, a permeating hepta-peptide inhibiting homodimerization of MyD88 (For control group, inhibitor was substituted by phosphate buffered saline, PBS). Then cells were stimulated with CpG ODN (10 mg/mL) or poly I:C (100 mg/mL). The samples were taken at 0, 0.5, 1, 2, 4 and 6 h post-exposure. From all samples, RNA was isolated, cDNA synthesized, and gene expression levels of TLR21, MyD88, and TNF were determined by means of real-time quantitative PCR. The primers of MyD88 and TNF gene were described in Table 1. 3. Results and discussion 3.1. Analysis of the TLR21 sequence and the predicted protein

All fish (weight 32 g  2.1 g) were acclimatized for 7 days prior to challenge. Thirty fish were intraperitoneally injected with 100 mL of 106 CFU/mL of V. anguillarum. Three fish per time point, were sampled at 0, 1, 2, 4, 6, 12, 24, 48, 72 and 120 h after challenge. All samples were flash frozen in liquid nitrogen and then stored at 80  C until RNA extraction. For CpG ODN and poly I:C immunostimulation, each fish was injected with 10 mg of CpG ODN or 100 mg of poly I:C (Invivogen). CpG ODN 1668 was synthesized by Sangon (Shanghai, China) with the sequence was: 50 -TCCATGACGTTCCTGATGCT-30 (CpG motif is underlined).

A full-length 3687 bp TLR21 of olive flounder was obtained by the procedures of reverse-transcription PCR and RACE, and the results were shown in Fig. 1. It contained an open reading frame (ORF) of 2922 bp, a 50 -untranslated region (50 UTR) of 282 bp, a 30 untranslated region (30 UTR) of 486 bp with a polyadenylation signal sequence “AATAAA” and a poly(A) tail. The olive flounder TLR21 cDNA sequence was deposited in GenBank with accession No.JQ411238. The open reading frame encoded a peptide of 973 amino acids with a molecular weight of 112.7 kDa and a theoretical isoelectric point (PI) of 8.91. The highest content of leucine (L) in the amino acid composition accounted for 17.2%; followed by serine (S) and asparagine (N), the content at about 9.4%; while the lowest content of tryptophan (W) accounted for only 0.8%. The signal sequence (Fig. 1) cleavage site was predicted to locate between amino acid residues 23 and 24. Removal of the putative leader sequence of 23 amino acids would result in a mature protein of 950 amino acids with predicted molecular weight of 110.2 kDa, and theoretical pI of 8.83. All TLRs have a common domain organization, with an extracellular recognition domain consisting of leucine-rich repeats (LRRs), a single transmembrane domain, and an intracellular Toll/IL-1 receptor homology (TIR) signaling domain. TMHMM program analysis showed that the putative protein was a potential transmembrane protein. It contains an N-terminal extracellular segment of 744 amino acids (No.1e744), a hydrophobic transmembrane stretch of 23 amino acids (No.745e767, Fig. 1), followed by a C-terminal cytoplasmic segment of 206 amino acids (No.768e793). LRRfinder program analysis indicated that Nterminal extracellular segment contained nineteen leucine-rich repeats (LRRs), which is the functional extracellular domain (Figs. 1 and. 2), and one Toll/IL-1 receptor homology domain (TIR), which is a cytoplasmic signaling domain (Fig. 1). These data showed the predicted protein domain organization was consistent with the characterization of TLRs.

2.6. Effects of MyD88 inhibitor on genes expression in vitro

3.2. Homology analysis

The healthy P. olivaceus weighing approximately 700 g were killed by cutting the neck with scissors. The anterior one-third of the kidney was removed and pressed through a sterile stainless steel screen (100 mesh) into 10 mL cold M199 medium supplemented with 2% foetal calf serum, 20 U/mL heparin, 100 mg/mL penicillin and 100 U/mL streptomycin. The cell suspension was repeatedly drawn into a syringe to create a single cell suspension and layered over a 51% Percoll (Sigma). After centrifugation at 400 g for 30 min at 4  C without brakes, the leucocytes fraction was removed from the Percoll-medium interface, washed twice, counted and adjusted to 1  107 cells/mL with culture medium. Then cells were dispensed into flat-bottomed 96-well plates and incubated over night at 20  C. To analyze the effects of MyD88 inhibitor

Complete cDNA sequences of TLR21 genes from seven species were obtained from the GenBank. An NCBI blastn of olive flounder TLR21 gene demonstrated similarities to TLR21 of several species including E. coioides, T. rubripes, D. rerio, Gadus morhua, I. punctatus, Ctenopharyngodon idella and G. gallus. The homologous comparison of the deduced amino acid sequence of TLR21 revealed that sequence of P. olivaceus TLR21 was closest to that of E. coioides (67% identity, See Table 2). The homologous of TLR21 were further confirmed by the phylogenetic analysis (Fig. 3). It is also found that TLR21 is relatively high conserved in the TIR domain (Table 2). These results indicated that TLR21 in fish and chicken contains relatively low homogeny, but share some regions with high homology. These regions are believed to be the functional sites.

2.5. Effects of immunostimulation on TLR21 expression in vivo

H. Gao et al. / Fish & Shellfish Immunology 35 (2013) 1138e1145

1141

Fig. 2. LRR sequence alignment for ectodomains of Po-TLR21. LRR was identified by LRRfinder program (http://www.lrrfinder.com/lrrfinder.php). Conserved amino acids typical of LRR of TLR are shaded in black, synonymous substitutions in gray.

Fig. 1. Nucleotide sequence of the cDNA clone and deduced amino acid sequence of P. olivaceus TLR21. Nucleotides are numbered from the first base at the 50 end. Amino acids are numbered from the initiating methionine. The signal sequence is enclosed by the dotted line. Nineteen highly conserved regions of leucine-rich repeats (LRRs) are underlined. One highly conserved regions of leucine-rich repeat C-terminal (LRRCT) is waved underlined. The hydrophobic transmembrane domain is boxed. The Toll/IL-1 receptor homology domain (TIR) is dotted underlined. The polyadenylation signal AATAAA is double underlined at the C-terminal part. The sequence had been deposited in GenBank with the accession No. JQ411238.

3.3. Tissue distribution of TLR21 in P. olivaceus The expression of Po-TLR21 was detected predominantly in the gill and spleen, slightly in boold, muscle, heart and intestine (Fig. 4 A). Relative expression level of Po-TLR21 was measured in eight tissues by quantitative real time PCR using the housekeeping gene,

b-actin, as a control. As shown in Fig. 4 B, Po-TLR21 was expr essed in all tested tissues of an apparently healthy fish (fresh weight 400 g), with the highest expression in spleen (81.29) and gill (76.2), followed by heart (25.49), muscle (15.07), intestine (6.71), blood (5.51), liver (2.23), and the lowest expression in head kidney (1.00). Results from previous studies showed fugu TLR21 was expressed in liver, spleen, kidney, skin, heart, gill, with the strong expression in gill and spleen, no detectable expression in muscle, digestive organs and brain Ref. [10]. Expression of catfish TLR21 was detected predominantly in spleen, intestine, stomach, liver, trunk kidney, ovary, brain and gill, slightly in head kidney and skin, no detectable expression in muscle [14]. Expression of orange-spotted grouper TLR21 was detected predominantly in the trunk kidney, head

Table 2 The sequence homology of cDNA, protein, LRRs, and TIR domain of Po-TLR21 with other known TLR21 sequences determined by NCBI Blast. Species

Accession number

Identity of the sequence (%) cDNA

Protein

LRRs

TIR

Epinephelus coioides Takifugu rubripes Danio rerio Gadus morhua Ictalurus punctatus Ctenopharyngodon idella Gallus gallus

GU198366 AB101002 BC163075 JX074771 NM_001200065 KC466564 JQ042911

80 72 76 68 66 65 68

67 63 54 52 51 49 39

62 56 46 45 45 43 34

84 84 68 81 69 70 58

1142

H. Gao et al. / Fish & Shellfish Immunology 35 (2013) 1138e1145

Fig. 3. Phylogenetic analysis of TLRs in vertebrates based on complete amino acid sequences. The phylogenetic tree was constructed using the neighbor-joining method within MEGA 4 software. The evolutionary distances were computed using the p-distance method. The bootstrap sampling was performed with 1000 replicates. The scale bar represents 10% amino acid difference.

kidney, spleen, heart, gill, liver, and thymus, slightly in skin and rhombencephalon, no detectable expression in muscle [16]. Zebrafish TLR21 was mainly expressed in spleen, gills and kidney, low transcript levels was found in muscle, gut, and skin Ref. [22]. These results indicate that teleost TLR21 are widely expressed in various healthy tissues. The strong expressions are commonly found in spleen and gill in all tested fish pieces, though there are some differences in their distribution profiles in different fish species. 3.4. Expression profiles of TLR21 after immunostimulation in vivo To examine whether TLR21 expression was modulated by immunostimulation of whole bacterial cells or a pathogenassociated molecular pattern (PAMP), quantitative RT-PCR analysis was used to examine the relative expression of the TLR21 in P. olivaceus head kidney after challenged with V. anguillarum, CpG ODN or poly I:C. CpG ODN and poly I:C are two synthetic chemicals that are similar to bacterial DNA and viral RNA, respectively. They are recognized in mammals mainly by the group of TLRs, which are expressed exclusively in intracellular vesicles. Recent research on localization of chicken TLR21 has indicated that chicken TLR21 is expressed mainly in the endoplasmic reticulum, and is functional in endolysosomes [20]. Cellular localization for fish TLR21 has not been identified. Ligands recognized by fish TLR21 is maintained unclear. Our studies revealed that Po-TLR21 expression could be up-regulated by stimulation of V. anguillarum, CpG ODN or poly I:C. As shown in Fig. 5, Po-TLR21 transcript was 73.8-fold induction

after 1 h of injecting V. anguillarum, and the transcript increased up to 173.6-fold at 4 h post-injection (hpi) then decreased to 1.35-fold at 12 hpi, then followed by a gradual increase in the next 12e120 h post-injection. The same changes were observed in tested groupers challenged with CpG ODN or poly I:C. The Po-TLR21 transcript level in P. olivaceus was significantly increased up to 139.22-fold and 121.9-fold at 1 h after injected with CpG ODN and poly I:C respectively, and then decreased to 1.62-fold and 0.24-fold at 12 hpi respectively, then followed by a gradual increase in the next 12e 120 h post-injection. These data suggested that Po-TLR21 was activated by V. anguillarum, CpG ODN and poly I:C, and may therefore be involved in pathogen recognition. TLRs are largely divided into two subgroups depending on their cellular localization and respective PAMP ligands. One group TLRs are expressed on cell surfaces and recognize mainly microbial membrane components; the other group TLRs are expressed in intracellular vesicles, where they recognize microbial nucleic acids. Recent studies [18,20] have proved that chicken TLR21 is an intracellular nucleotide receptor that senses synthetic CpG ODN and bacterial genomic DNA, but not senses LPS, poly I:C and flagellin. In mammals, the receptor for ODNs has been demonstrated to be TLR9. Chickens do not have a gene encoding TLR9. Chicken TLR21 is considered as a functional homologue to mammalian TLR9, although closer inspection of chicken TLR21 and mammalian TLR9 revealed only 38% similarity in amino acids between the two receptors. However, in teleost, not only TLR9 but also TLR21 genes have been found in some fish species. Moreover, our immunostimulation experiment revealed that both synthetic CpG ODN and

H. Gao et al. / Fish & Shellfish Immunology 35 (2013) 1138e1145

Fig. 4. Tissue distribution patterns of Po-TLR21 mRNA in adult healthy P. olivaceus. A: Electrophesis analysis of RT-PCR products of TLR21 from 8 different tissues. Amplification of b-actin in each tissue was also shown as an internal control. B: Expression was quantified by real-time PCR and normalized against b-actin mRNA levels as endogenous control. The expression level of TLR21 in head kidney was arbitrarily defined as 1. Data are expressed as a ratio to the expression of head kidney. Error bar ¼ SE, n ¼ 3. The experiment was executed in three biological replicates and repeated three times with similar results.

poly I:C could change the Po-TLR21 expression significantly in vivo. In zebrafish larvae, up to a 3-fold increase in TLR21 and TLR22 expression was detected after exposed to immunostimulants such as lipopolysaccharide, peptidoglycan or poly I:C [22]. Based on the similarity shared by chicken and teleost TLR21, it is plausible that the latter one also recognises CpG ODN but also responds to various microbial components. LRRs are found in a diverse set of proteins in which they are involved in ligand recognition and signal transduction [6]. In all LRR superfamily, the individual LRR module is generally 20e29 amino

Fig. 5. Expression variation of TLR21 after immunostimulation in vivo. The healthy P. olivaceus (weight 32  2.1 g) were intraperitoneally injected with V. anguillarum, CpG ODN or poly I:C. Expression changes in head kidney were determined by quantitative real-time PCR at 1, 2, 4, 6, 12, 24 48 72 and 120 h post-stimulation. The expression levels of b-actin were used as endogenous control. Error bar ¼ SE, n ¼ 3. The experiment was executed in three biological replicates and repeated three times with similar results. Asterisk and double asterisks indicate the values that are significantly different from the controls (P < 0.05 and 0.01, respectively).

1143

acids long and contains a conserved 11-residue segment with the consensus sequence LXXLXLXXNXL, in which X can be any amino acid; L (leucine) positions can also be occupied by hydrophobic residue including V (valine), I (isoleucine) and F (phenylalanine); and N (asparagine) position can be occupied by C (cysteine), T (threonine) and S (serine) [23,24]. In TLRs family, the extracellular domains of proteins contain 16-28 LRR modules [25,26]. The prevailing LRR module consensus sequence in TLRs is the 24-residue motif of LXXLXLXXNXLXXLXXXXFXXLXX [27,28]. TLR ligand specificity is due to different modes of LRRs assembly. Sequence and structure analyses demonstrate that TLR1, TLR2, TLR4, TLR6, and TLR10 belong to the three-subdomain subfamily of TLRs. Their ectodomain can be split into three distinctive subdomains: N-terminal, central, and C-terminal LRRs subdomains. The structurally important asparagine ladder and phenylalanine spine are conserved in N- and C-terminal LRR sequences, and absent from the central subdomain. These TLRs bind to and are activated by hydrophobic ligands such as lipoproteins, lipoteichoic acid (LTA), LPS, etc. Conversely, TLR3, TLR5, TLR7, TLR8, and TLR9 belong to the single-domain subfamily of TLRs. Their LRR modules have continuous asparagines ladders and relatively uniform module lengths. These TLRs interact with hydrophilic proteins or nucleic acids [25,26,29]. A structural analysis of Po-TLR21 ectodomain from the amino acid sequence was carried on. LRR sequences of Po-TLR21 ectodomain identified by LRRfinder program were aligned based on LRR motif. As shown in Fig. 2, Po-TLR21 ectodomain is composed of an LRRNT (an N-terminal non-LRR sequences); an LRRCT (a Cterminal regions with about 50 residues containing a highly conserved consensus sequence CXCX24e26CX18e21C); an undefined region with 53 residues; and 19 LRR modules. Remarkably, Po-TLR21 has an irregular specific segment is located before LRR8, which was described as an undefined region in TLR7/8/9. This unique structural character is absent in other TLRs [24,30]. In alignment of LRRs, the structurally important asparagine ladder is conserved, with the lengths of their LRR modules ranging from 23 to 28 amino acids. This analysis suggests that Po-TLR21 is belong to the single-domain subfamily of TLRs, and may be responsible for recognizing the ligands of hydrophilic proteins or nucleic acids. 3.5. Effects of MyD88 inhibitor on genes expression in vitro The intracellular endodomain TIR domain of TLR is responsible for signaling events which are mediated through adaptor molecules [31]. TLR signaling pathways can be largely classified as either MyD88-dependent pathway or TRIF-dependent pathway [32]. TLRs MyD88-dependent pathway activates nuclear-factor-kB (NF-kB) and subsequently results in the production of inflammatory cytokines [33], while TRIF-dependent pathway is related to transcriptional activation of type I interferons and also activates late phase NF-kB via TAK which is shared by MyD88-dependent pathway [34]. MyD88 is the universal adapter protein recruited by all TLRs except TLR3 [6]. To investigate the role of MyD88 in signaling of TLR21, a cell permeable MyD88 inhibitory peptide with the sequence of DRQIKIWFQNRRMKWKKRDVLPGT [35] (synthesized by ShangHai Mapbiotech Co., Ltd., China) was used to examine the effects of MyD88 on gene expression of TLR21. Homodimerization of MyD88 is a critical step in the signaling process. The inhibitor peptide contains a sequence of RDVLPGT which is from the MyD88 TIR homodimerization domain Ref. [35]. One MyD88 monomer binds to this inhibitor peptide, there by blocking MyD88 homodimerization. This inhibitor peptide has been validated for human, mouse, rabbit, xenopus and zebrafish [36]. A number of studies have confirmed the MyD88 inhibitory peptide inhibited MyD88-dependent event in different experimental settings [37e39].

A

B

Fig. 6. The MyD88 inhibitor suppresses up-regulation of TLR21, MyD88, and TNF expression in CpG ODN or poly I:C-treated head kidney cells in vitro. Freshly isolated head kidney lymphoid cells from healthy P. olivaceus (about 700 g) were incubated over night, and then incubated with or without 100 mM inhibitor, a permeating hepta-peptide inhibiting homodimerization of MyD88. Two hours later, cells were stimulated with CpG ODN or poly I:C. Quantitative RT-PCR was used to quantify mRNA expression of TLR21, MyD88, and TNF. The expression levels of b-actin were used as endogenous control. All the samples of zero time points were generated before adding inhibitor. Error bar ¼ SE, n ¼ 3. The experiment was executed in three biological replicates and repeated three times with similar results. Asterisk and double asterisks indicate values significantly different from zero time point (P < 0.05 and 0.01, respectively). y indicates values significantly different (P < 0.05) from the corresponding time points of the group without inhibitor.

H. Gao et al. / Fish & Shellfish Immunology 35 (2013) 1138e1145

We pretreated the cultured head kidney cells with the MyD88 inhibitory peptide before immunostimulation, and analyzed the inhibitor effects on mRNA expression of TLR21, MyD88 and proinflammatory TNF by RT-PCR. As shown in Fig. 6-A, the mRNA expressions in TLR21, MyD88, and TNF in head kidney cells with the absence of MyD88 inhibitor increased rapidly with a peak at 1 h after the CpG ODN challenge, followed by a decline to the relatively low levels at 4 h, and then increased quickly again to the highest levels at 6 h. In contrast, the mRNA expressions of TLR21, MyD88, and TNF in head kidney cells with the presence of MyD88 inhibitor were under the basal level at each time point tested after the CpG ODN challenge. Apparently, MyD88 inhibitor depressed TLR21, MyD88, and TNF mRNA up-regulation induced by CpG ODN. The similar inhibitory effects were observed in tested group challenged with poly I:C (Fig. 6-B). These results suggest that the CpG ODN or poly I:C-induced TLR21 mRNA expression in cultured head kidney cells could be suppressed by MyD88 inhibitor. In summary, we report the cloning and characteristics of the TLR21 gene from P. olivaceus. It contains an extracellular recognition domain consisting of LRRs, a single transmembrane domain, and an intracellular TIR signaling domain. Analysis of ectodomain structure from the amino acid sequence revealed that TLR21 might bind to the ligands of hydrophilic proteins or nucleic acids. We also described the expression and regulation of TLR21. TLR21 was widely expressed in all tested tissues, and was up-regulated by immunostimulation of V. anguillarum, CpG ODN and poly I:C. The increased expressions could be depressed by a specific inhibitor of homodimerization of MyD88. These findings are useful for understanding the mechanism of TLR21 gene regulation, and providing insight into the function of teleost TLR21 in the immune response to pathogen. Acknowledgments The authors are grateful for the financial support from the Applied Basic Research Programs of the Science and Technology Commission Foundation of Tianjin PR China (General Program 10JCYBJC09100, Key Program 12JCZDJC22800), Key Projects in the National Science and Technology Pillar Program (2011BAD13B07), National Basic Research Program of China (2012CB114405), Tianjin Normal University Research Fund for Ph.D (52XB1004), and Tianjin Normal University Research Fund for State Key Laboratory. References [1] Nho SW, Hikima J, Cha IS, Park SB, Jang HB, del Castillo CS, et al. Complete genome sequence and immunoproteomic analyses of the bacterial fish pathogen Streptococcus parauberis. J Bacteriol 2011;193:3356e66. [2] Avunje S, Kim WS, Park CS, Oh MJ, Jung SJ. Toll-like receptors and interferon associated immune factors in viral haemorrhagic septicaemia virus-infected olive flounder (Paralichthys olivaceus). Fish Shellfish Immunol 2011;31:407e14. [3] Tanekhy M, Matsuda S, Itano T, Kawakami H, Kono T, Sakai M. Expression of cytokine genes in head kidney and spleen cells of Japanese flounder (Paralichthys olivaceus) infected with Nocardia seriolae. Vet Immunol Immunopathol 2010;134:178e83. [4] Hwang SD, Ohtani M, Hikima J, Jung TS, Kondo H, Hirono I, et al. Molecular cloning and characterization of Toll-like receptor 3 in Japanese flounder, Paralichthys olivaceus. Dev Comp Immunol 2012;37:87e96. [5] Hwang SD, Kondo H, Hirono I, Aoki T. Molecular cloning and characterization of Toll-like receptor 14 in Japaneseflounder, Paralichthys olivaceus. Fish Shellfish Immunol 2011;30:425e9. [6] Medzhitov R. Toll-like receptors and innate immunity. Nat Rev Immunol 2001;1:135e45. [7] Rebl A, Goldammer T, Seyfert HM. Toll-like receptor signaling in bony fish. Vet Immunol Immunopathol 2010;134:139e50. [8] Coscia MR, Giacomelli S, Oreste U. Toll-like receptors: an overview from invertebrates to vertebrates. Invert Survival J 2011;8:210e26. [9] Palti Y. Toll-like receptors in bony fish: from genomics to function. Dev Comp Immunol 2011;35:1263e72.

1145

[10] Oshiumi H, Tsujita T, Shida K, Matsumoto M, Ikeo K, Seya T. Prediction of the prototype of the human Toll-like receptor gene family from the pufferfish, Fugu rubripes, genome. Immunogenetics 2003;54:791e800. [11] Jault C, Pichon L, Chluba J. Toll-like receptor gene family and TIR-domain adapters in Danio rerio. Mol Immunol 2004;40:759e71. [12] Meijer AH, Gabby Krens SF, Medina Rodriguez IA, He S, Bitter W, Ewa SnaarJagalska B, et al. Expression analysis of the Toll-like receptor and TIR domain adaptor families of zebrafish. Mol Immunol 2004;40:773e83. [13] Roach JC, Glusman G, Rowen L, Kaur A, Purcell MK, Smith KD, et al. The evolution of vertebrate Toll-like receptors. Proc Natl Acad Sci USA 2005;102: 9577e82. [14] Baoprasertkul P, Xu P, Peatman E, Kucuktas H, Liu Z. Divergent Toll-like receptors in catfish (Ictalurus punctatus): TLR5S, TLR20, TLR21. Fish Shellfish Immunol 2007;23:1218e30. [15] Kongchum P, Palti Y, Hallerman EM, Hulata G, David L. SNP discovery and development of genetic markers for mapping innate immune response genes in common carp (Cyprinus carpio). Fish Shellfish Immunol 2010;29: 356e61. [16] Li YW, Luo XC, Dan XM, Qiao W, Huang XZ, Li AX. Molecular cloning of orange-spotted grouper (Epinephelus coioides) TLR21 and expression analysis post Cryptocaryon irritans infection. Fish Shellfish Immunol 2012;32: 476e81. [17] Ishii A, Kawasaki M, Matsumoto M, Tochinai S, Seya T. Phylogenetic and expression analysis of amphibian Xenopus Toll-like receptors. Immunogenetics 2007;59:281e93. [18] Brownlie R, Zhu J, Allan B, Mutwiri GK, Babiuk LA, Potter A, et al. Chicken TLR21 acts as a functional homologue to mammalian TLR9 in the recognition of CpG oligodeoxynucleotides. Mol Immunol 2009;46:3163e70. [19] Pridgeon JW, Russo R, Shoemaker CA, Klesius PH. Expression profiles of toll-like receptors in anterior kidney of channel catfish, Ictalurus punctatus (Rafinesque), acutely infected by Edwardsiella ictaluri. J Fish Dis 2010;33:497e 505. [20] Keestra AM, de Zoete MR, Bouwman LI, van Putten JP. Chicken TLR21 is an innate CpG DNA receptor distinct from mammalian TLR9. J Immunol 2010;185:460e7. [21] Petersen TN, Brunak S, von Heijne G, Nielsen H. SignalP 4.0: discriminating signal peptides from transmembrane regions. Nat Methods 2011;8:785e6. [22] Sundaram AY, Consuegra S, Kiron V, Fernandes JM. Positive selection pressure within teleost toll-like receptors tlr21 and tlr22 subfamilies and their response to temperature stress and microbial components in zebrafish. Mol Biol Rep 2012;39:8965e75. [23] Kobe B, Kajva AV. The leucine-rich repeat as a protein recognition motif. Curr Opin Struct Biol 2001;11:725e32. [24] Matsushima N, Tanaka T, Enkhbayar P, Mikami T, Taga M, Yamada K, et al. Comparative sequence analysis of leucine-rich repeats (LRRs) within vertebrate toll-like receptors. BMC Genomics 2007;8:124e44. [25] Jin MS, Lee JO. Structures of TLR-ligand complexes. Curr Opin Immunol 2008;20:414e9. [26] Jin MS, Lee JO. Structures of the Toll-like receptor family and its ligand complexes. Immunity 2008;29:182e91. [27] Bell JK, Mullen GE, Leifer CA, Mazzoni A, Davies DR, Segal DM. Leucine-rich repeats and pathogen recognition in Toll-like receptors. Trends Immunol 2003;24:528e33. [28] Botos I, Segal DM, Davies DR. The structural biology of Toll-like receptors. Structure 2011;19:447e59. [29] Jin MS, Kim SE, Heo JY, Lee ME, Kim HM, Paik SG, et al. Crystal structure of the TLR1-TLR2 heterodimer induced by binding of a tri-acylated lipopeptide. Cell 2007;130:1071e82. [30] Wei T, Gong J, Jamitzky F, Heckl WM, Stark RW, Rossle SC. Homology modeling of human Toll-like receptors TLR7, 8, and 9 ligand-binding domains. Protein Sci 2009;18:1684e91. [31] Takeda K, Kaisho T, Akira S. Toll-like receptors. Annu Rev Immunol 2003;21: 335e76. [32] Brikos C, O’Neill LA. Signalling of Toll-like receptors. Handbook Exp Pharmacol 2008;183:21e50. [33] Kawai T, Akira S. Signaling to NF-kB by Toll-like receptors. Trends Mol Med 2007;13:460e9. [34] Takeda K, Akira S. TLR signaling pathways. Semin Immunol 2004;16:3e9. [35] Loiarro M, Sette C, Gallo G, Ciacci A, Fantò N, Mastroianni D, et al. Peptidemediated interference of TIR domain dimerization in MyD88 inhibits interleukin-1-dependent activation of NF-kB. J Biol Chem 2005;280: 15809e14. [36] http://www.imgenex.com/Tlr_pathway.php. [37] Liu Y, Yuan Y, Li Y, Zhang J, Xiao G, Vodovotz Y, et al. Interacting neuroendocrine, innate, and acquired immune pathways regulate neutrophil mobilization from bone marrow following hemorrhagic shock. J Immunol 2009;182:572e80. [38] Ahmad R, Sylvester J, Zafarullah M. MyD88, IRAK1 and TRAF6 knockdown in human chondrocytes inhibits interleukin-1-induced matrix metalloproteinase-13 gene expression and promoter activity by impairing MAP kinase activation. Cell Signal 2007;19:2549e57. [39] Funderburg N, Lederman MM, Feng Z, Drage MG, Jadlowsky J, Harding CV, et al. Human b-defensin-3 activates professional antigen-presenting cells via Toll-like receptors 1 and 2. Proc Natl Acad Sci USA 2007;104:18631e5.