Molecular characterization and functional analysis of two new lysozyme genes from soybean cyst nematode (Heterodera glycines)

Journal of Integrative Agriculture 2019, 18(12): 2806–2813 Available online at www.sciencedirect.com

ScienceDirect

RESEARCH ARTICLE

Molecular characterization and functional analysis of two new lysozyme genes from soybean cyst nematode (Heterodera glycines) WANG Ning1, PENG Huan1, LIU Shi-ming1, HUANG Wen-kun1, Ricardo Holgado2, Jihong Liu-Clarke2, PENG De-liang1 1

State Key Laboratory for Biology of Plant Diseases and Insect Pests, Institute of Plant Protection, Chinese Academy of Agricultural Sciences, Beijing 100193, P.R.China

2

NIBIO, Norwegian Institute of Bioeconomy Research, Pb 115, NO-1431 Ås, Norway

Abstract Soybean cyst nematode (SCN, Heterodera glycines (I.)) is one of the most important soil-borne pathogens for soybeans. In plant parasitic nematodes, including SCN, lysozyme plays important roles in the innate defense system. In this study, two new lysozyme genes (Hg-lys1 and Hg-lys2) from SCN were cloned and characterized. The in situ hybridization analyses indicated that the transcripts of both Hg-lys1 and Hg-lys2 accumulated in the intestine of SCN. The qRT-PCR analyses showed that both Hg-lys1 and Hg-lys2 were upregulated after SCN second stage juveniles (J2s) were exposed to the Grampositive bacteria Bacillus thuringiensis, Bacillus subtilis or Staphylococcus aureus. Knockdown of the identified lysozyme genes by in vitro RNA interference caused a significant decrease in the survival rate of SCN. All of the obtained results indicate that lysozyme is very important in the defense system and survival of SCN. Keywords: soybean cyst nematode, lysozyme, Hg-lys1, Hg-lys2, innate defense against bacteria

include resistant varieties, crop rotation and seed-coating

1. Introduction Soybean cyst nematode (SCN, Heterodera glycines) is an important nematode pathogen for soybean (Glycine max) worldwide. It can cause soybean yield losses of 10 to 30% on average, and in some cases 60 to 70% in seriously damaged areas. Measures to control this nematode

nematicide applications (Liu and Peng 2016). Nematodes lack a specific immune system, but they can combat the invasion of pathogenic microorganisms through innate immunity (Yu et al. 2012). DAF-2/DAF-16, TGF-beta, MARK and TLR are the four most common pathways associated with innate immunity in nematodes. The free-living nematode Caenorhabditis elegans has been demonstrated to have an inducible system of antibacterial defense (Kurz and Ewbank 2000). Caenorhabditis elegans activates the corresponding signal transduction pathways to produce

Received 25 April, 2019 Accepted 20 June, 2019 WANG Ning, E-mail: [email protected]; Correspondence Peng De-liang, E-mail: [email protected]

effector molecules for pathogen recognition and removal,

© 2019 CAAS. Published by Elsevier Ltd. This is an open access article under the CC BY-NC-ND license (http:// creativecommons.org/licenses/by-nc-nd/4.0/). doi: 10.1016/S2095-3119(19)62766-8

nematode resistance (Bu et al. 2006).

and generates lysozymes to lyse bacterial cell walls, reducing bacterial colonization in vivo, thereby enhancing Lysozyme, also known as cell wall degrading enzyme, is an alkaline enzyme that hydrolyzes mucopolysaccharides.

WANG Ning et al. Journal of Integrative Agriculture 2019, 18(12): 2806–2813

Lysozyme can destroy the β-1,4-glycoside bonds between N-acetylteichoic acid and N-acetylglucosamine in the cell wall, resulting in the release of the contents of bacterial cells and the death of bacteria (Ye et al. 2009). This function is also found in almost all groups of organisms including nematodes (Claudia et al. 2011). C-Lysozyme of Paralichthys olivacaeus can enhance the phagocytic ability and digestive functions of macrophages, thus acting similarly to immune defense systems (Minagawa et al. 2001). Human lysozyme can also directly interact with negatively charged viral proteins to form a complex that inactivates the virus (Lou amd Mao 1994). Fifteen lysozymes, including ten protoplasmic lysozymes (also known as Proteus lysozymes) and five invertebrate lysozymes, have been identified in C. elegans (Wohlkönig et al. 2010). Several studies have verified, by overexpression or RNA interference, that three protoplast lysozyme genes of C. elegans contribute to the pathogen resistance. Cellys-1 mainly provided resistance to Staphylococcus aureus and Serratia marcescens, Cel-lys-2 gave resistance to Pseudomonas aeruginosa, while Cel-lys-7 imparted resistance to P. aeruginosa and Salmonella typhimurium (O’Rourke et al. 2006; Kawli and Tan 2008; Nandakumar and Tan 2008; Marsh et al. 2011; Simonsen et al. 2011). Schulenburg and Boehnisch (2008) reported that C. briggsae and C. remanei contained two lysozyme genes, and three invertebrate lysozyme genes, respectively. All of them were similar to the lysozymes of C. elegans except that two genes Cel-ilys-1 and Cbr-ilys-4 showed unusual properties. Both lacked signal peptides and had an unusual amino terminus. Cel-ilys-1 contained a large insertion, which showed many nucleotide differences from other sequences. Fanelli et al. (2008) found that the lysozyme gene of Meloidogyne artiellia was induced by the Gram-negative bacterium S. marcescens. This suggests that lysozyme is a special chemically-induced signal that plays an important role in activating the defense system in the intestine. Moreover, nematodes can transduce specific signals to the tissues through the prosthetic cavity after sensing the pathogens (Fanelli et al. 2008). Caenorhabditis elegans has been broadly used as a model organism (Mallo et al. 2002). In contrast, the roles of SCN lysozymes in resistance to pathogens and environmental conditions are still relatively unknown. In this study, two open reading frames (ORFs) of SCN lysozyme genes, Hg-lys1 and Hg-lys2, were cloned and analyzed. The in situ hybridization analyses showed that the two lysozyme genes were both expressed in the intestine of soybean cyst nematode. The functions of lysozyme genes were analyzed by in vitro RNA interference, which indicated that suppression of either Hg-lys1 or Hg-lys2 decreased the survival of SCN. These results provide the basis for

2807

subsequent studies of the defensive functions of lysozyme in SCN and its interaction with pathogens such as bacteria.

2. Materials and methods 2.1. Nematode culture The SCN race 4 was isolated from the greenhouse of the Institute of Plant Protection, Chinese Academy of Agricultural Sciences. The soil samples were screened using a 60mesh sieve, and the collected residue was separated by centrifugation with 50% sucrose. Hatched SCN second stage juveniles (J2s) were collected by placing the cysts on a sieve in 3 mmol L–1 ZnCl2 at 25°C for several days. The freshly collected J2s were used directly for subsequent steps.

2.2. RNA extraction Total RNA was isolated from J2s of SCN using the Trizol reagent (Invitrogen, USA) according to the freeze-thaw method described by Peng et al. (2009). DNase (Ambion, USA) was used to remove DNA from total RNA to ensure that there was no DNA contamination. The synthesis of cDNA was carried out using the SuperscriptTM First-Strand Synthesis System for RT-PCR Kit (Invitrogen, USA).

2.3. Gene cloning and verification Nine sequences were obtained from the transcriptome, and two lysozyme sequences were verified. Specific primers for the targeted genes, Hg-lys1-F/Hg-lys1-R and Hglys2-F/Hg-lys2-R (Table 1), were designed using Primer 5 Software, and the PCR reactions were conducted in a 50-µL reaction containing 200 ng of cDNA. The PCR amplification conditions were as follows: denaturation at 94°C for 5 min, and 35 cycles of 94°C for 30 s, 55°C/57°C for 30 s and 72°C for 1 min, with a final incubation at 72°C for 10 min. The PCR products were cloned into pMD-19T vector (TaKaRa, Dalian, China) and sequenced after purified.

2.4. Phylogenetic analyses Alignment of cDNA sequences was performed using DNAman Software and NCBI Blast (Altschul et al. 1990). NCBI ORF Finder was used to find ORFs for genes and to translate them into proteins. Prediction of signal peptides for secretion was performed using SignalP ver. 4.0 according to Petersen et al. (2011). Prediction of protein molecular weights and isoelectric points was conducted using the pI/ Mw online tool. Gene structure analysis was performed using GSDS Software and WormBase Blast. The predicted

2808

WANG Ning et al. Journal of Integrative Agriculture 2019, 18(12): 2806–2813

Table 1 The PCR primer sequences Primer Hg-lys1-F Hg-lys1-R Hg-lys2-F Hg-lys2-F Hg-lys1tz-F Hg-lys1tz-R Hg-lys2tz-F Hg-lys2tz-R Hg-lys1q-F Hg-lys1q-R Hg-lys2q-F Hg-lys2q-R Hg-lys1-T7-F Hg-lys1-T7-R Hg-lys2-T7-F Hg-lys2-T7-R eGFP-T7F eGFP-T7R GAPDH-F GAPDH-R 1)

Sequence (5´→3´)1) ATGACCGTCCAATTGTCCGCCCT TTATGCCTTTTTCTCTGCTGATTTTGATGG ATGCCATACCATGGACGA TTATGCTTCCGGCTCGTATG TTATGCAATTTTGCGATGG TTCGTAGTCCTCCGAGCAG CCGGATCTATTGAGGATGG GAAGTGCTCCGCTTGCTCT GTCCGCCCTTTTGCTCCCT CGACAGTTCGCCAATCTCT ATGCCATACCATGGACGAT CAGCGGCCATCCTCAATAG TAATACGACTCACTATAGGGTCGCTGCTCGGAGGACTAC TAATACGACTCACTATAGGGTTATGCCTTTTTCTCTGCT TAATACGACTCACTATAGGGTCATTATTTTGAAGGGGGG TAATACGACTCACTATAGGGTGCAGGTCGACGATTCCAA TAATACGACTCACTATAGGGGAGTACAACTACAACAGCCAC TAATACGACTCACTATAGGGACGAACTCCAGCAGGACCAT CGCTGAACCCGAAGGCCAACAGA TTGATGTCACGGACGATCTCACG

Application Sequence amplification

Reference This study

In situ hybridization

qRT-PCR

RNA interference

Endogenous reference gene

Wang et al. (2014)

The primer sequences underlined are T7 promoter sequences.

amino acid sequences of lysozymes were aligned using ClustalW, and then the evolutionary analysis was conducted in MEGA6 with neighbor-joining method (Tamura et al. 2013).

2.5. In situ hybridization The in situ hybridization was carried out in accordance with the method of de Boer et al. (1998). Digoxigenin-labelled ssDNA probes were generated by amplification of the cloned cDNA fragment with the specific primers, Hg-lys1tz-F/ Hg-lys1tz-R and Hg-lys2tz-F/Hg-lys2tz-R (Table 1), using a PCR DIG Probe Synthesis Kit (Roche, USA). SCN J2s were fixed with 4% paraformaldehyde for 16–18 h and cut randomly on glass slides with a razor blade followed by partial digestion with proteinase K at 500 ng mL–1 at 37°C for 1 h. Specific steps were conducted per the instructions of the DIG High Prime DNA Labeling and Detection Starter Kit I Manual (Roche, Germany). Photos were taken using an Olympus BX53 Upright Microscope (Olympus, Japan).

2.6. qRT-PCR Specific primers for qPCR, Hg-lys1q-F/Hg-lys1q-R and Hg-lys2q-F/Hg-lys2q-R, were designed based on the full cDNA sequences of the lysozymes (Table 1). About 18 000 J2s were soaked in the bacterium cultures of either Bt, B. subtilis or S. aureus. Nematode treated with water was used as the control. The bacterial dilution concentration was 2×107 cfu mL–1. Then the J2s were collected at 12, 24

and 36 h after soaking, respectively. This procedure was used to study the effects of potential pathogens on lysozyme gene expression. The mRNA at each time point was isolated using a Dynabeads mRNA DIRECT Kit (Invitrogen, USA). The Superscript III First-Strand Synthesis System was used to synthesize cDNA for qRT-PCR (Invitrogen, USA). The analyses of gene expression in the nematodes were performed using the SYBR ® Select Master Mix (TaKaRa, Dalian, China) on the ABI 7500 Fast RT-PCR System (Applied Bio Systems Inc., USA) according to the manufacturer’s instructions. Quantification of the relative changes in gene expression was conducted using the 2–ΔΔCt method taking GAPDH as the endogenous control gene. The relative expression of the sample treated with water was used as the control. All reactions were run in triplicate, and average values were calculated.

2.7. In vitro RNAi soaking and survival rate assay Based on the full cDNA sequences of the lysozyme genes, specific primers for the target genes were designed using Primer Premier 5.0 Software. The T7 promoter sequence was added to the 5´-terminal of the specific primers Hglys1-T7-F/Hg-lys1-T7-R, Hg-lys2-T7-F/Hg-lys2-T7-R and eGFP-T7F /eGFP-T7R (Table 1). Using eGFP as a control, the lysozyme gene and GFP gene were amplified by using the SCN lysozyme gene cDNA or eGFP plasmid as the template. The amplification products were purified using a PCR Product Purification Kit (TaKaRa). The specific steps were performed as described in the kit, the purified product

WANG Ning et al. Journal of Integrative Agriculture 2019, 18(12): 2806–2813

concentration was measured by NanoDrop 2000, and the product was stored at –20°C. The purified DNA was used as the template and subjected to in vitro transcription using a Hiscribe T7 Quick High Yield RNA Synthesis Kit (NEB, USA). The above synthesized dsRNA was purified using a MEGAclearTM Purification Kit (Ambion, USA). About 36 000 J2s were soaked in 100 µL of solution containing 1.5 mg mL–1 dsRNA, 3 mmol L–1 spermidine, 50 mmol L–1 octopamine and 0.05% gelatin. Controls were soaked in solutions with dsRNA targeted against GFP (Urwin et al. 2002). For each reaction, approximately 18 000 nematodes were used for RT-PCR, and the remaining nematodes were used for the survival rate test. The SCN J2s were washed and then immersed in solutions of either Bt, B. subtilis or S. aureus to examine the effects of in vitro RNA interference of lysozyme genes on nematode survival rates. Each treatment was repeated three times. The results were then analyzed using Duncan’s multiple range test.

2809

Hg-lys1 and Hg-lys2 shared 50% identity. The identity of Hg-lys1 to lysozyme of Toxobacterium canis (KHN83586.1) was 56%, and to C. briggsae CBR-ILYS-4 protein (XP_002634350.1), it was 47.5%. The identity between Hg-lys2 and Pseudomonas lysozyme M1 (CRM94409.1) was 38.7%. The Hg-lys2 gene contained a conserved sequence of the 25th family of hydrolyzed glycosidase and belonged to the GHF25 family. The WormBase Blast results showed that the identity of Hg-lys1 to lysozyme of Globodera rostochiensis (GROS_g00082.t1) was 93%, and to lysozyme of Meloidogyne arenaria (M.Arenaria_Scaff764g014836) it was 83.1%. The identity between Hg-lys2 and G. rostochiensis lysozyme (GROS_g10645.t1) was 46.6%. The phylogenetic analyses (Fig. 2) indicated that Hg-lys1 was in the same clade with other invertebrate lysozymes of the nematodes. In contrast, Hg-lys2 was clustered with the protoplast lysozymes of nematodes and bacteria.

3.2. Tissue localization of Hg-lys1 and Hg-lys2 by in situ hybridization

3. Results 3.1. SCN lysozyme gene isolation and phylogenetic analysis Two lysozyme genes were successfully isolated from J2s of SCN, named Hg-lys1 (GenBank accession no. MK287994) and Hg-lys2 (GenBank accession no. MK287997). The Hg-lys1 gene’s ORF was 483 bp in length and it encoded a polypeptide of 160 amino acids. Its isoelectric point was 7.50 and its molecular weight was 18 403 kD. The ORF of Hg-lys2 gene was 618 bp in length, and it encoded 205 amino acids with an isoelectric point of 9.03 and a molecular weight of 23 413 kD (Fig. 1). Gene structure analysis showed that Hg-lys1 has 6 exons and Hg-lys2 has 4 exons. SignalP prediction indicated that a 24 N-terminal amino acid sequence forming a signal peptide was present in Hg-lys1, but absent in Hg-lys2. TMHMM results showed that Hg-lys1 had a transmembrane domain. The NCBI Blast results showed that the sequences of

bp

M

1

2

2 000

500

The negative-strand probes of the two genes had obvious hybridization signals in the intestinal cells of SCN J2s, while the hybridization signals were not observed in the positivestrand probe hybridization as a control, indicating that transcripts of both Hg-lys1 and Hg-lys2 were accumulated in the intestine of SCN (Fig. 3).

3.3. Quantifying expression of Hg-lys1 and Hg-lys2 by qRT-PCR The results of qRT-PCR showed that the expression of Hg-lys1 gene was significantly upregulated by 2.7 times after SCN was exposed with B. subtilis for 24 h. The expression of Hg-lys1 was remarkably upregulated by 7.5 times at 12 h and by 2.6 times at 24 h after SCN was exposed with Bt. However, the expression of Hg-lys1 was not upregulated or not significantly upregulated after SCN was exposed with S. aureus. On the other hand, after 24 h of exposure with S. aureus, the Hg-lys2 expression of SCN was significantly upregulated by 2.4 times. However, the expression of Hg-lys2 was not upregulated or not significantly upregulated after SCN was exposed with B. subtilis and Bt. The SCN lysozymes were most highly expressed at 24 h after exposure with bacteria, and then the expression gradually decreased (Fig. 4).

3.4. Effects of in vitro RNAi on Hg-lys1 and Hg-lys2 expression and nematode survival Fig. 1 The amplification of cDNA sequences of Hg-lys1 (1) and Hg-lys2 (2). M, DL 2 000.

After the lysozyme genes were silenced, the qPCR results indicated that the transcription levels of the lysozyme genes

2810

WANG Ning et al. Journal of Integrative Agriculture 2019, 18(12): 2806–2813

74 GROS_g00082.t1 Globodera_rostochiensis 98 GPLIN_000348100 Globodera_pallida 61 MK287994 Hg-lys1 87 BXY_1047700.1 Bursaphelenchus_xylophilus Db_04447 Ditylenchus_destructor 96 55 Minc3s00009g00632 Meloidogyne incognita 100 Genemark-nMf.1.1.scaf04044-processed-gene-0.2-mRNA-1 Meloidogyne_floridensis KHN83586.1 Toxocara canis 98 XP_002634350.1 Caenorhabditis briggsae 92 MhA1_Contig262.frz3.gene29 Meloidogyne hapla KRX09922.1 Pseudocohnilembus persalinus 57 44 NP_500470.2 Cel-ILYS6 Caenorhabditis elegans 72 CCD65530.1 Cel-ILYS2 Caenorhabditis elegans 72 NP_500206.1 Cel-ILYS3 Caenorhabditis elegans 96 100 CCD65531.1 Invertebrate LYSozyme Caenorhabditis elegans 48 KOY61189.1 Photorhabdus heterorhabditis EJY69068.1 Oxytricha trifallax 68 98 XP_004339529.1 Acanthamoeba castellaniistr.Neff KRX09922.1 Pseudocohnilembus persalinus1 AFM43653.1 Mytilus galloprovincialis 94 ACD76641.1 Penaeus stylirostris 83 ABC49680.1 Solea senegalensis 79 ADZ44620.1 Oplegnathus fasciatus 98 AHA85993.1 Hucho taimen 92 GROS_g10645.t1 Globodera_rostochiensis 100 46 GPLIN_000906800 Globodera_pallida 68 Minc3s00420g12035 Meloidogyne_incognita 94 MK287997 Hg-lys2 CRM94409.1 precursor Pseudomonas Db_06004 Ditylenchus_destructor XP_644284.1 Dictyostelium discoideum 42 ABN58658.1 Meloidogyne artiellia 100 87 CAA97801.1 Caenorhabditis elegans NP_505644.1 Lysozyme-like_protein_3_Caenorhabditis_elegans 94 NP_503972.1 Lysozyme-like_protein_7_Caenorhabditis_elegans 94 NP_505643.1 Lysozyme-like_protein_2_Caenorhabditis_elegans 72 NP_505642.1 Cel-LYS1 Caenorhabditis elegans 98

Invertebrate type

Chicken type

Protist type

0.2

Fig. 2 Phylogenetic tree of Hg-lys1 and Hg-lys2 with sequences of other similar proteins. The bootstrap values are indicated at each node and were calculated with 1 000 repetitions.

A

B

St

D

C

St

St St

In

In In

In

50 μm

50 μm

50 μm

50 μm

Fig. 3 Localization of lysozyme transcripts in second stage juveniles (J2s) of soybean cyst nematode (SCN) by in situ hybridization. SCN sections were hybridized with antisense (A, C) or sense (B, D) lysozyme DIG-labelled cDNA probe. A and B, Hg-lys1. C and D, Hg-lys2. The stylet (St) and intestine (In) are indicated with arrows. Scale bar=50 μm.

of SCN were significantly lower than those of eGFP dsRNA at 12 and 24 h after soaking with dsRNA (Fig. 5). On the other hand, the results from significant difference analyses

showed that the survival rates of SCN in Bt and B. subtilis were all significantly decreased after Hg-lys1 dsRNA soaking compared to the control. The survival rates of SCN in Bt

2811

WANG Ning et al. Journal of Integrative Agriculture 2019, 18(12): 2806–2813

CK

Hg-lys1

Hg-lys2

Relative expression level

4 b b

2 1

ab b

Relative expression level

12

Relative expression level

a

24 Time (h)

36

3 b b

2 a 1

0 C

a

10 9 8 7 6 5 4 3 2 1 0

ab

a a

a

12

a

a

24 Time (h)

36

b

c

b a

a 12

a

a

24 Time (h)

b

a 36

Fig. 4 Expression of Hg-lys1 and Hg-lys2 in soybean cyst nematode (SCN) with infection of different bacteria. Lysozyme gene expression profiles were determined using qRT-PCR at 12, 24 and 36 h after being immersed in solutions of bacteria Bacillus subtilis (A), Staphylococcus aureus (B) or Bacillus thuringiensis (C). The relative expression of the sample treated with water was used as the control. Data are mean±SD (n=3). Different letters indicate significant differences at P≤0.05.

and S. aureus were all significantly decreased after Hg-lys2 dsRNA soaking compared to the control (Fig. 6).

4. Discussion In this study, two lysozyme genes in SCN were identified and characterized. Both of them could impart resistance against bacteria. Although there have been many studies

Hg-lys2

eGFP

1.0

0.5

0 0

B

a ab

ab

Relative expression level

A

3

Hg-lys1

1.5

12

24 Time (h)

36

Fig. 5 The expression of the lysozyme genes in the soybean cyst nematode (SCN) fed with Hg-lys1 dsRNA, Hg-lys2 dsRNA, or eGFP dsRNA (control). The expression of lysozyme genes was assayed using qRT-PCR at 12, 24 and 36 h after soaking treatment. The relative expression was calculated with the 2–ΔΔCt method by normalization with the internal reference gene GAPDH. Data are mean±SD (n=3).

on the lysozymes in other species (Yue et al. 2011; Liu et al. 2016), this is the first report on lysozymes in the plantparasitic nematodes SCN. The in situ hybridization analyses indicated that the transcripts of both Hg-lys1 and Hg-lys2 accumulated in the SCN intestine, suggesting that both of them might have similar expression patterns. This is consistent with the others’ results showing that during the infection with pathogens such as S. marcescens, lysozyme proteins of C. elegans were expressed in intestinal epithelial cells and bacteria were destroyed (Ewbank 2002; Nicholas and Hodgkin 2004). Xia et al. (2000) have also described a similar mechanism in plant parasitic nematodes M. artiellia. The defense is typically activated in the intestine while a specific signal is transduced to the target tissues through the prosthetic lumen. In this study, Hg-Lys1 and Hg-Lys2 have different structures and belong to different types of lysozymes, so they may have different functions. Claudia et al (2011) reported that the lys-7 gene of C. elegans was upregulated under the induction by S. aureus. In addition, the expression of lys-1 and lys-8 were upregulated after myxosporosis induction. Recent reports have indicated that the lys-1 gene of Dictyostelium discoideum is upregulated upon infection by the Gram-negative bacterial pathogen S.  marcescens (Tarr et al. 2012). These findings clearly suggest that different bacteria may induce various genes due to the large differences in lysozyme gene sequences from different clades. In the present study, after bacterial induction, the lysozyme gene of SCN remained upregulated for 36 h. This is in accordance with the report of Gravato-Nobre et al. (2016) that prolonged induction of the lysozyme gene of

2812

WANG Ning et al. Journal of Integrative Agriculture 2019, 18(12): 2806–2813

Hg-lys1

Survival rate (%)

A

Survival rate (%)

B

100 90 80 70 60 50 40 30 20 10 0 100 90 80 70 60 50 40 30 20 10 0

Survival rate (%)

C 100 90 80 70 60 50 40 30 20 10 0

a

b

c

c b

b

a

eGFP

Hg-lys2

b b

a

b bb

a a

1

2

c b

a

c b

1

a

b

3

2

c

5

6

c

7

5. Conclusion

a

aa

3

b

b b a

4 Time (d)

b b a

5

b

6

b a

7

c a

c

b a

b

c ab

b a

1

a

b

c b

a

4 Time (d)

a

bb

2

3

that lys-2 imparted resistance to P. aeruginosa. The causes of the decline of nematode survival in bacteria solutions after gene interference are not yet clear. Niu et al. (2005) speculated that the silencing of lysozyme genes affected their recognition and binding to the corresponding receptors on the bacterial surface and promoted bacterial invasion in a sense, resulting in a decrease in the survival rate of Panagrellus redivivus. One consequence of these findings is we hypothesize that the presence of nematode lysozyme can disrupt the control of nematodes by biological control bacteria. However, the relationship between nematode lysozyme induced by bacteria and nematode resistance remains to be further studied.

4 Time (d)

c

c a

5

b 6

a

b

c

7

Fig. 6 Survival rate of soybean cyst nematode (SCN) in bacteria after lysozyme dsRNA soaking. A, B and C, SCN with infection by Bacillus subtilis, Staphylococcus aureus and Bacillus thuringiensis, respectively. Data are mean±SD (n=3). Different letters indicate significant differences at P≤0.05.

C. elegans indicated continuously high expression of this antibacterial agent, which was resistant to the persistence of the pathogens. To analyze the functions of lysozymes in SCN defense, in vitro RNAi was used in this study to knock down the target genes. Our results indicated that the nematodes were more sensitive to bacterial infection after gene silencing and that the nematodes had a lower survival rate. The lysozyme genes were involved in the defense responses of the nematodes. Others also have come to some conclusions using RNA interference. Claudia et al. (2011) reported that the gene lys-5 of C. elegans contributed to the physiological immunity against Bt. Nandakumar and Tan (2008) reported

In this study, two lysozymes from the SCN were isolated and identified. The identified lysozyme genes were expressed abundantly in the intestine of SCN, suggesting that these lysozyme genes might be associated with the interactions between nematodes and pathogens. The in vitro RNA interference analyses showed the survival rate of SCN was decreased significantly after suppression of either Hg-lys1 or Hg-lys2. The nematode induced defense-related genes respond to bacterial infection. The cloning and analyses of these two lysozyme genes lays the basis for subsequent studies of the biological control mechanisms of SCN.

Acknowledgements This research was supported the Central Public-Interest Scientific Institution Basal Research Fund, China (Y2019GH03), the Special Fund for Agro-Scientific Research in the Public Interest of China (210503114), and SINOGRAIN II (CHN-17/0019): Technological Innovation to Support Environmentally-Friendly Food Production and Food Safety Under a Changing Climate-Opportunities and Challenges for Norway-China Cooperation.

References Altschul S F, Gish W, Miller W, Myers E W, Lipman D J. 1990. Basic local alignment search tool. Journal of Molecular Biology, 215, 403–410. Bu X J. 2006. Comparison of the innate immune system between nematodes and fruit flies. Bulletin of Biology, 41, 11–12. (in Chinese) de Boer J M, Yan Y, Smant G, Davis E L, Baum T J. 1998. Insitu hybridization to messenger RNA in Heterodera glycines. Journal of Nematology, 30, 309–312. Claudia B, Daniel W, Michael H, Kerstin I, Michiels N K, Thomas R, May R C, Schulenburg H. 2011. Protist-type lysozymes of the nematode Caenorhabditis elegans contribute to

WANG Ning et al. Journal of Integrative Agriculture 2019, 18(12): 2806–2813

resistance against pathogenic Bacillus thuringiensis. PLoS ONE, 6, e24619. Ewbank J J. 2002. Tackling both sides of the host-pathogen equation with Caenorhabditis elegans. Microbes and Infection, 4, 247–256. Fanelli E, Dileo C, Di Vito M, De Giorgi C. 2008. Inducible antibacterial defense in the plant parasitic nematode Meloidogyne artiellia. International Journal for Parasitology, 38, 609–615. Gravato-Nobre M J, Vaz F, Filipe S, Chalmers R, Hodgkin J. 2016. The invertebrate lysozyme effector ILYS-3 is systemically activated in response to danger signals and confers antimicrobial protection in C. elegans. PLoS Pathogens, 12, e1005826. Kawli T, Tan M W. 2008. Neuroendocrine signals modulate the innate immunity of Caenorhabditis elegans through insulin signaling. Nature Immunology, 9, 1415–1424. Kurz C L, Ewbank J J. 2000. Caenorhabditis elegans for the study of host-pathogen interactions. Trends in Microbiology 8, 142–144. Liu H, Wang J, Mao Y, Liu M, Niu S F, Qiao Y, Su Y J, Wang C Z, Zheng Z P. 2016. Identification and expression analysis of a new invertebrate lysozyme in Kuruma shrimp (Marsupenaeus japonicus). Fish & Shellfish Immunology, 49, 336–343. Liu S M, Peng D L. 2016. New progress in the study of soybean nematode resistance in soybeans. Science China (Life Sciences), 46, 535–547. (in Chinese) Lou S X, Mao D L. 1994. Research progress of lysozyme. Chinese Journal of Clinical Oncology, 21, 709–711. Mallo G V, Kurz C L, Couillault C, Pujol N, Granjeaud S, Kohara Y, Ewbank J J. 2002. Inducible antibacterial defense system in C. elegans. Current Biology, 12, 1209–1214. Marsh E K, van den Berg M C W, May R C. 2011. A two-gene balance regulates Salmonella typhimurium tolerance in the nematode Caenorhabditis elegans. PLoS ONE, 6, e16839. Minagawa S, Hikima J I, Hirono I, Aoki T, Mori H. 2001. Expression of Japanese flounder c-type lysozyme cDNA in insect cells. Developmental & Comparative Immunology, 25, 439–445. Nandakumar M, Tan M W. 2008. Gamma-linolenic and stearidonic acids are required for basal immunity in Caenorhabditis elegans through their effects on p38 MAP kinase activity. PLoS Genetics, 4, e1000273. Nicholas H R, Hodgkin J. 2004. Responses to infection and possible recognition strategies in the innate immune system of Caenorhabditis elegans. Molecular Immunology, 41, 479–493. Niu Q H, Huang X W, Tian B Y, Yang J K, Liu J, Zhang L, Zhang K Q. 2005. Bacillus sp. B16 kills nematodes with a serine protease identified as a pathogenic factor. Applied Microbiology and Biotechnology, 69, 722–730. O’Rourke D, Baban D, Demidova M, Mott R, Hodgkin J. 2006. Genomic clusters, putative pathogen recognition molecules,

2813

and antimicrobial genes are induced by infection of C. elegans with M. nematophilum. Genome Research, 16, 1005–1016. Peng H, Peng D L, Huang W K. 2009. Cloning and sequence analysis of full-length cDNA of β-1,4-endoglucanase gene (Dd-eng-1b) from C. elegans. Journal of Agricultural Biotechnology, 17, 1035–1041. (in Chinese) Petersen T N, Brunak S, Von H G, Nielsen H. 2011. SIGNALP 4.0: Discriminating signal peptides from transmembrane regions. Nature Methods, 8, 785–786. Schulenburg H, Boehnisch C. 2008. Diversification and adaptive sequence evolution of Caenorhabditis lysozymes (Nematoda: Rhabditidae). BMC Evolutionary Biology, 8, 114. Simonsen K T, Moller-Jensen J, Kristensen A R, Andersen J S, Riddle D L. 2011. Quantitative proteomics identifies ferritin in the innate immune response of C. elegans. Virulence, 2, 120–130. Tamura K, Stecher G, Peterson D, Filipski A, Kumar S. 2013. MEGA6: Molecular evolutionary genetics analysis version 6.0. Molecular Biology and Evolution, 30, 2725–2729. Tarr D E K. 2012. Distribution and characteristics of ABFs, cecropins, nemapores, and lysozymes in nematodes. Developmental & Comparative Immunology, 36, 502–520. Urwin P E, Lilley C J, Atkinson H J. 2002. Ingestion of doublestranded RNA by preparasitic juvenile cyst nematodes leads to RNA interference. Molecular Plant-Microbe Interactions, 15, 747–752. Wang G F, Peng D L, Gao B L, Huang W K, Kong L, Long H B, Jane H. 2014. Differentially expressed genes at different ages of soybean cyst nematode No.3 and No.4 physiological races. In: Proceeding of 2014 Academic Annual Meeting published by Chinese Society of Plant Pathology. China Agricultural Science and Technology Press, Beijing. p. 438. (in Chinese) Wohlkönig A, Huet J, Looze Y, Wintjens R. 2010. Structural relationships in the lysozyme superfamily: Significant evidence for glycoside hydrolase signature motifs. PLoS ONE, 5, e15388. Xia Y, Spence H J, Moore J, Heaney N, McDermott L, Cooper A, Kennedy M W. 2000. The ABA-1 allergen of Ascaris lumbricoides: Sequence polymorphism, stage and tissuespecific expression, lipid binding function, and protein biophysical properties. Parasitology, 120, 211–224. Ye X, Gao F Y, Zheng Q M, Bai J J, Wang H, Lao H H, Jian Q. 2009. Cloning and characterization of the tiger shrimp lysozyme. Molecular Biology Reports, 36, 1239–1246. Yu Y, Yu L, Zhao M, Zhang K, Wang S. 2012. Advances in the innate immune mechanism of C. elegans. Journal of Huainan Teachers College, 14, 27–29. (in Chinese) Yue X, Liu B, Xue Q. 2011. An i-type lysozyme from the Asiatic hard clam Meretrix meretrix potentially functioning in host immunity. Fish & Shellfish Immunology, 30, 550–558.

Executive Editor-in-Chief WAN Fang-hao Managing editor ZHANG Juan