Molecular characterization of heat shock protein 70 (HSP 70) promoter in Japanese flounder (Paralichthys olivaceus), and the association of Pohsp70 SNPs with heat-resistant trait

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54

YFSIM3010_proof ■ 12 June 2014 ■ 1/9

Fish & Shellfish Immunology xxx (2014) 1e9

Contents lists available at ScienceDirect

Fish & Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi

Full length article

Molecular characterization of heat shock protein 70 (HSP 70) promoter in Japanese flounder (Paralichthys olivaceus), and the association of Pohsp70 SNPs with heat-resistant trait Q1

J. Qi, X.D. Liu, J.X. Liu, H.Y. Yu, W.J. Wang, Z.G. Wang, Q.Q. Zhang* Key Laboratory of Marine Genetics and Breeding, Ocean University of China, 266003 Qingdao, Shandong, China

a r t i c l e i n f o

a b s t r a c t

Article history: Received 4 February 2014 Received in revised form 29 May 2014 Accepted 30 May 2014 Available online xxx

Ambient temperature is one of the major abiotic environmental factors determining the main parameters of fish vital activity. HSP70 plays an essential role in heat response. In this investigation, the promoter and structure of Paralichthys olivaceus hsp70 (Pohsp70) gene was cloned and predicted. 2558 bp upstream regulatory region of Pohsp70 was annotated with four potential promoter elements and four putative binding sites of transcription factors heat shock elements (HSE, nGAAn) in the upstream of the transcription start site. In addition, one intron with 454 bp in the 5'-noncoding region was found. Quantitative Real Time PCR analysis indicated that the transcript level of Pohsp70 was raised markedly after 1 h by heat shocked. Furthermore, 25 SNPs were identified in Pohsp70 by resequencing, seven of which was associated with heat resistance. In addition, two of the seven SNPs, namely SNP14 and SNP16, were observed in strong linkage disequilibrium. The haplotype with association analysis showed TAGGAG haplotype was more represented in heat susceptible group while (DEL/T) GAATA haplotype was more frequent in heat resistant group. The heat resistant SNPs and haplotype could be candidate markers potentially serving for selective breeding programs of Japanese flounder aimed at improving anti-stress and production. © 2014 Published by Elsevier Ltd.

Keywords: Japanese flounder Heat-resistant traits hsp70 SNPs

1. Introduction Japanese flounder (Paralichthys olivaceus) is an economically important flatfish that is mainly distributed on the Yellow sea, Bohai sea, the south China sea and East of Japan, North Korea and Russia. Industrial culture of Japanese flounder has been booming quickly since 1980s because of its delicious flavor and high nutrition. However, a serial of problems was raised, such as deteriorating of culture environment, serious of inbreeding in parental lines and diminishing of crossover rate among breeding groups. All of these caused a rapid decline of the genetic diversity, which resulted in the flounders vulnerable to be infected, poor stress resistance and the massive death. It urges the industry to breed flounders with high resistance of diseases and stresses. Heat shock proteins (HSPs) are a family of ubiquitous and highly conserved proteins, which could be a molecular biomarker of

* Corresponding author. No. 5 Yushan Road, College of Marine Life Science, Ocean University of China, 266003 Qingdao, Shandong, China. Tel.: þ86 532 82031806; fax: þ86 532 82031809. E-mail addresses: [email protected], [email protected] (Q.Q. Zhang).

stress, such as bacterial infection, temperature stress and food deprivation [1e4]. Among of these HSPs, heat shock protein 70 (HSP70) plays a key role in the immune response by functioning both as chaperones and inducers of proinflammatory cytokine secretion [5]. Studies showed that the expression level of hsp70 was increased not only upon acute heat shock and chronic acclimation [4] or infected by bacteria [6,7], but also was distinct under heat stress and cold stress [8].Currently, several cDNAs encoding HSP70 in fish were identified, such as zebrafish [9], medaka [10], tilapia [11], silver sea bream [4], grass carp [12,13], goldfish [14], Atlantic salmon [15], Wuchang bream [16], Korean rockfish [17] and Japanese flounder [18]. After the first Japanese flounder hsp70 (Pohsp70) was cloned, several studies in Japanese flounder have shown that changes in water temperature, osmotic stress or the supplemented diet of bovine lactoferrin and bacterial infection all could initiate the increase of hsp70 mRNA expression [19e21]. Furthermore, PoHSP70 is an effective adjuvant and the adjuvanticity of PoHSP70 requires the intrinsic ATPase activity [22]. Interesting is that the recombinant HSP70 used as a subunit vaccine could induce protection in Japanese flounder against Vibrio harveyi infection [23].

http://dx.doi.org/10.1016/j.fsi.2014.05.038 1050-4648/© 2014 Published by Elsevier Ltd.

Please cite this article in press as: Qi J, et al., Molecular characterization of heat shock protein 70 (HSP 70) promoter in Japanese flounder (Paralichthys olivaceus), and the association of Pohsp70 SNPs with heat-resistant trait, Fish & Shellfish Immunology (2014), http://dx.doi.org/ 10.1016/j.fsi.2014.05.038

55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65

YFSIM3010_proof ■ 12 June 2014 ■ 2/9

2

J. Qi et al. / Fish & Shellfish Immunology xxx (2014) 1e9

Table 1 Primers used for amplification of UTRs, qRT-PCR and resequencing the full length sequence of Pohsp70. Primer name

Primer sequence (5'e3')

PCR annealing temperature and time

Usage

Position

hsp-1-Rv hsp-2-Rv hsp-1-Fw NUP hsprt-Fw hsprt-Rv 18Srt-Fw 18S-Rv hsp-3-Fw hsp-3-Rv hsp-4-Fw hsp-4-Rv hsp-5-Fw hsp-5-Rv hsp-6-Fw hsp-6-Rv hsp-7-Fw hsp-7-Rv hsp-8-Fw hsp-8-Rv

GTTCTTGGCAGCATCTCCAATGAGCCTCTC GTCCTGTTGCCCTGGTCGTT CGAGTATGAGCACCAGCAGAAGGAAC AAGCAGTGGTATCAACGCAGAGT TTCAATGATTCTCAGAGGCAAGC TTATCTAAGCCGTAGGCAATCGC GGTCTGTGATGCCCTTAGATGTC AGTGGGGTTCAGCGGGTTAC CGGGGATGAGTTTCAGACGA ATGTTTGTAGTGCCATTATTTGT CACAAATAATGGCACTACAAA TATTGTATTGGTGGGGTTCAT CCATGAACCCCACCAATACAA TGAGCACGTTGCGCTCTCCTC AGCAGCGATTGCCTACG TGTCCTTGGTCATGGCTCT TTCACCACCTACTCAGATAACC CAAACATCATAGCCATGTGAA TGAGGAGGTGGACTAATAACA AGGAAAAGTGAACAAAGCAG

60  C 1 min 60  C 1 min 60  C 40 s 60  C 40 s 55  C 1 min 55  C 1 min 55  C 1 min 58  C 1 min 58  C 1 min 58  C 1 min

5'-RACE 5'-RACE 3'-RACE 3'-RACE Real time PCR Real time PCR Real time PCR Real time PCR Resequencing Resequencing Resequencing Resequencing Resequencing Resequencing Resequencing Resequencing Resequencing Resequencing Resequencing Resequencing

703e732 652e671 2231e2256

Some evidences showed that hsp70 gene single-nucleotide polymorphisms (SNPs) play a role in the immune response and pathogenesis of human [24e26]. In marine species, hsp70 SNPs were discovered and applied as novel markers for Mytilus taxa on a large European scale and the different populations of miiuy croaker [27,28], or distinguish traits variants at the early developmental stage for sea cucumber [29]. Recently, linkage disequilibrium (LD), haplotype analysis and SNP identification have been proved to be powerful approach in association analysis, which contain haplotype maps [30], evaluation of population [31] and the variation in important traits [32]. To elite germplasm, it is expected to have extensive LD in breeding. But the information about the structure of hsp70 promoter and the association of hsp70 genetic polymorphisms with stress were rarely investigated in fish [33], and there was no report about the association of possible polymorphisms with heat tolerance and the heat-related SNPs with LD in Japanese flounder so far. In this study, we reported the predicted structure of P. olivaceus hsp70 (Pohsp70) and its promoter region. In addition, 25 SNPs of Pohsp70 were identified and their association with heat resistance was evaluated. Furthermore, the linkage disequilibrium between Pohsp70 SNPs, heat susceptible and heat resistant haplotypes was investigated. These heat resistant SNPs could potentially serve as candidate markers for selective breeding programs of Japanese flounder aimed at improving anti-stress and production.

2. Material and method 2.1. Fish materials Japanese flounders used in the heat shock treatments ranged in mass from approximately 300e500 g were purchased from the Yellow Sea Aquatic Product CO., Ltd and maintained at 22  C. For the experiment of gene expression, 90 healthy Japanese flounder adults were divided among three 1000-L tanks, each with 30 individuals. All samples were placed directly into water at the exposure temperature (28  C). Three fishes were sampled at time 0 h, 1 h, 2 h, 3 h, 5 h and 8 h from each of the 3 tanks of post-heat shock samples. Then, the heart of anesthetized fishes were dissected and immediately frozen in liquid nitrogen and stored at 80  C. For the association analysis of SNPs and heat resistant, fish (N ¼ 430) from 17 families were exposed to 22  C first, and up to 31  C gradually by

1009e1031 1099e1031

5e14 394e416 393e413 742e762 740e760 1130e1150 1095e1111 1900e1918 1843e1864 2502e2522 2463e2483 2576e2595

increasing 1  C per day. During the treatment, the survival time of each individual fish was recorded. 60 individuals from 12 families were divided into two groups by their surviving days (6.36 ± 1.43 d for heat resistant group; 3.157 ± 0.62 d for heat susceptible group). The muscle of fish was sampled and stored at 20  C. 2.2. DNA extraction, RNA isolation and cDNA synthesis Genomic DNA was extracted from gill by Phenol/Chloroform/ Isoamyl alcohol as standard method [34]. Total RNA was isolated from heart using Trizol reagent (Invitrogen, CA, USA) according to the manufacturer’ protocol. A total of 1 mg total RNA from each sample was reverse-transcript using PrimeScript™ RT reagent kit with gDNA Eraser (Takara, Dalian, China). The cDNA was diluted to 1:10 and stored at 20  C. 2.3. Molecular cloning of Pohsp70 gene and its promoter region The homogeneous primers were designed based on the available sequence of Pohsp70 (GenBank accession number AB010871) using the Primer Premier 5.0 software. SMARTer™ RACE cDNA Amplification Kit (Clontech, USA) was used to amplify 5'-UTR and 3'-UTR of Pohsp70 cDNA. These primers were presented in Table 1. The promoter region of Pohsp70 was searched from our genomic library sequenced by the 454 FLX Titanium sequencing platform (Shanghai OE Biotech. Co. Ltd., unpublished) using the cDNA sequence of Pohsp70. The Transcription Factor Binding Sites of upstream regulatory region of Pohsp70 was analyzed using TFSEARCH (http://www.cbrc.jp/research/db/TFSEARCH. html). The parameters are as follows: Classification, vertebrate; Threshold score, 85.0. The potential promoter elements were annotated by Neural Network Promoter Prediction (http://smartnote.miraibio. com/bioinformatics/neural_network_promoter_prediction). 2.4. Quantitative expression analysis of Pohsp70 The expression levels of Pohsp70 were analyzed using real-time quantitative reverse transcription PCR (qRT-PCR). qRT-PCR was carried out using iQ_ SYBR Green Supermix (Takara, Japan) performing on Multicolor Real-Time PCR Detection System (Roche Lightcycler480, German) with triplicates for each PCR reaction. The qPCR programs were as follows: 95  C for 2 min, 40 cycles of 95  C

Please cite this article in press as: Qi J, et al., Molecular characterization of heat shock protein 70 (HSP 70) promoter in Japanese flounder (Paralichthys olivaceus), and the association of Pohsp70 SNPs with heat-resistant trait, Fish & Shellfish Immunology (2014), http://dx.doi.org/ 10.1016/j.fsi.2014.05.038

66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65

YFSIM3010_proof ■ 12 June 2014 ■ 3/9

J. Qi et al. / Fish & Shellfish Immunology xxx (2014) 1e9

3

Fig. 1. The nucleotide sequence of the Pohsp70 with potential upstream regulatory region and the ORF region. Four predicted HSEs (bold and italics), one predicated STRE (bold and box), four predicated promoters (bold and underlined), two predicated CpG islands (box) are indicated. Three HSP70 protein family signatures (bold and italics) and two potential nuclear location signal (bold) were shown (predicated amino acid were listed on the top of triplets codon). Intron 1 of Pohsp70 was indicated by low case. The SNPs were marked “_” at the bottom with the alternative allele beneath them; The asterisk “*” in the 3'-UTR region represented 7 nucleotides deletion compared to the reported Japanese flounder hsp70 (GenBank accession number AB010871); The canonical polyadenylation signal sequence AATAAA was labeled in bold.

Please cite this article in press as: Qi J, et al., Molecular characterization of heat shock protein 70 (HSP 70) promoter in Japanese flounder (Paralichthys olivaceus), and the association of Pohsp70 SNPs with heat-resistant trait, Fish & Shellfish Immunology (2014), http://dx.doi.org/ 10.1016/j.fsi.2014.05.038

66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65

YFSIM3010_proof ■ 12 June 2014 ■ 4/9

4

J. Qi et al. / Fish & Shellfish Immunology xxx (2014) 1e9

15 s, 60  C 45 s. The fragment of 113 bp was amplified from cDNA template. The 18 S rRNA gene was used as the reference gene [35]. The primers and annealing temperatures were shown in Table 1. The results of qPCR were analyzed by 2DDCt.

2.5. Resequencing and SNP genotyping of Pohsp70 60 individuals were used for resequencing and genotyping. A set of primers were designed to amplify and resequence the full length of Pohsp70 sequence (Table 1). PCR was performed in a 20 mL reaction mixture consisted of 10 ng cDNA, 2 mL 10  PCR Buffer (20 mM TriseHCl pH 8.3, 500 mM KCl, 15 mM MgCl2), 0.4 mL dNTP (0.05 mmol/L), 0.8 mL of each primer (5 mmol/L), and 1 U GoTaq DNA polymerase (Promega). PCR reactions were performed using standard procedures as follows: 95  C for 5 min; 35 cycles of 94  C for 1 min, annealing temperature depending on different primers for 1 min, and 72  C for 1 min; and a final extension at 72  C for 10 min. PCR products were purified and then sequenced on an ABI 3730 analyzer (Applied Biosystems). The sequencing results were analyzed using Seqman II (DNAstar Inc.). The Mutation Surveyor was used to investigate the SNPs of Pohsp70 (the mutation with frequency <0.03 was treated as sequencing error). All SNPs of Pohsp70 gene in 60 individuals were genotyped and characterized by the resequencing results.

3.2. Characterization of Pohsp70 promoter structure Only one scaffold, 2558 bp upstream genomic sequence of Pohsp70, was returned from blasting genomic sequences. Four putative binding sites of transcription factors heat shock elements (HSE, nGAAn) in the upstream of the transcription start site were predicted. A search for promoters using the Neural Network Promoter Predicted software revealed four putative promoter sequences (Fig. 1). Predicated promoter 1 occurred between HSE1 and Pohsp70 coding region; while predicated promoter 2 was between HSE1 and HSE2, and predicated promoter 3 and 4 appeared between HSE3 and HSE4 (Fig. 1). A stress response element (STRE, CCCCT) was found at 2129 bp. Additionally, Pohsp70 contained one intron of 454 bp consistent with GT-AG rule in the 5'-noncoding region, and the translation start site located in the 2nd exon (Figs. 1 and 2). 3.3. Expression of Pohsp70 in the myocardial cells after heat shock Myocardial protection can be accomplished by induction of the stress protein hsp70 through the use of elevated temperature (heat shock) [41]. qRT-PCR analysis indicated that the transcript level of Pohsp70 increased markedly after one hour heat treatment, which showed significant difference in comparison with 0 h post heat shock, and then decreased gradually until 8 h in the heart muscle (Fig.3).

2.6. Statistical analysis Chi-square tests were performed for the association of variants with heat resistance using SPSS 13.0 and EXCEL. HardyeWeinberg equilibrium (HWE) was checked for the 7 SNPs using a chi-squared test for goodness-of-fit (HWE version 1.2). The soft SHEsis (http:// analysis.bio-x.cn/SHEsisMain.htm) was used to calculate the D' and R2 value for linkage analysis. DnaSP5.10 [36] was used for haplotype analysis.

3. Result 3.1. Isolation and characterization of Pohsp70 cDNA The full length cDNA of Pohsp70 with promoter region was registered in GenBank accession number KF740533. The cDNA was 2160 bp containing 90 bp 5'-UTR, 1923 bp ORF and 147 bp 3'UTR (Fig.1). In the 3'-UTR, there was a seven-nucleotide deletion comparing to the reported Japanese flounder hsp70 (GenBank accession number AB010871), followed by a canonical polyadenylation signal sequence AATAAA. The ORF encoded a putative protein of 641amino acids with a predicted molecular mass of 70.61 kDa and a theoretical isoelectric point of 5.23. It contained three hsp70 protein family signatures (amino acid No.11e18 IDLGTTYS, No.199e212 IFDLGGGTFDVSIL and No.336e350 IVLVGGSTRIPKIQK), a potential nuclear location signal (amino acid 248e264 KRKYKKDISQNKRAVRR) which was described by Kim WJ (1999) [37], and a putative partial nuclear localization signal (amino acid 259e275 KRAVRRLRTACERAKRT) (Fig. 1) [28]. Over the entire sequence of Pohsp70, the conservation of N-terminus was higher than the C-terminus although the EEVD motif is highly conserved through the majority members of HSP70 family [38]. Amino acid sequence analysis indicated that Pohsp70 contained an ATPase domain (from the first amino acid to No. 373 amino acid) and substrate binding domain (from No. 397 amino acid to No. 542 amino acid) (Fig. 2) according to reports in bacteria [39,40].

3.4. SNPs of Pohsp70 and their associations with heat resistance in Japanese flounder A total of 25 SNPs was detected from 60 individuals in two groups (heat resistant group and heat susceptible group). Among of these SNPs, 2 SNPs located in 5'-UTR, 9 SNPs in intron and the rest of 12 SNPs located in the 1923 bp ORF region where 11 SNPs were synonymous and only one SNP was nonsynonymous with the amino acid change from Ser to Thr in SNP24 (Table 2). The Dn/Ds (non-synonymous: synonymous) ratio was 0.09, which suggested the high conservation of Pohsp70 gene. Chi-square test showed significant difference (P < 0.01) in SNP1, 2, 3, 5, 8, 14 and 16 between two groups (Table 2). 2 SNPs out of 7 located in 5'-UTR, 3 SNPs in intron and the rest of 2 SNPs located in the ORF region. The frequency of AA genotype of SNP1 was 93.33% in heat resistant group instead of 46.67% in heat susceptible group. For SNP2, SNP8 and SNP16, genotype TT were more frequent in heat resistant samples (83.33%, 93.33% and 16.67%, respectively) compared to heat susceptible samples (33.33%, 60.00% and 0.00%), whereas genotype CC (16.67% and 10.00% in SNP2 and SNP16) and AA (86.67% in SNP16) were more frequent in the heat susceptible subjects. For SNP3, SNP5 and SNP14, genotype CC appeared more often in heat resistant samples (60.00%, 23.33% and 20.00%, respectively), whereas the heat susceptible subjects were more likely to be TT homozygous (10.00%, 33.33% and 93.33%, respectively). In the whole sample, except moderate-strong linkage disequilibrium (LD) was observed between SNP1 and SNP3, SNP2 and SNP3, SNP3 and SNP4 according to D' value (33 < D' values <80), most of SNPs showed strong LD, such as between SNP1 and SNP2, SNP3, SNP8, SNP14, SNP16; SNP2 and SNP8; SNP5 and SNP8, SNP14 SNP16; SNP14 and SNP3, SNP5, SNP8, SNP16; SNP16 and SNP3, SNP5, SNP8 (D' values > 80) (Fig. 4A). A significant different pattern was observed according to the R2 values: only SNP14 and SNP16 was in strong LD (R2 values >80). Moderate-strong LD was in SNP1 and SNP2, SNP1 and SNP8 (33 < R2 values <80). No LD was observed in other SNPs combinations (R2 values <33) (Fig. 4B).

Please cite this article in press as: Qi J, et al., Molecular characterization of heat shock protein 70 (HSP 70) promoter in Japanese flounder (Paralichthys olivaceus), and the association of Pohsp70 SNPs with heat-resistant trait, Fish & Shellfish Immunology (2014), http://dx.doi.org/ 10.1016/j.fsi.2014.05.038

66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65

YFSIM3010_proof ■ 12 June 2014 ■ 5/9

J. Qi et al. / Fish & Shellfish Immunology xxx (2014) 1e9

5

Fig. 2. The scheme of Pohsp70 gene and protein in Japanese flounder. The Pohsp70 gene contains 1 intron and 2 exons. The coding region starts from 2nd exon. Start in 3'-UTR represents the 7 bp deletion (AATTTAT) portion comparison with that published (AB010871).

Fig. 3. Expression of Pohsp70 mRNA in heart under heat shock stress. 18S rRNA was used as an internal control for qRT-PCR and the relative expression level of 0 h post-heat shock was set to one. Deviation bars represented the standard errors of three experiments at each temperature point. The comparison among different time shocked by heat was performed by one way ANOVA with post hoc test. Bars with different superscripts indicated significant differences (P < 0.05).

3.5. Haplotype and association analysis Haplotypes were inferred based on observed genotypes. SNP 1, 2, 3, 5, 8, 14 were chosen for association analysis of halpotypes with heat resistance. The result showed that there was a significant correlation (P < 0.005) between TAGGAG haplotype in heat susceptible group and (DEL/T) GAATA haplotype in heat resistance group (Table 3). 4. Discussion 4.1. Role of promoter structure in heat induced gene expression HSEs provided an excellent demonstration of the importance of promoter structure. According to Uffenbeck et al. (2006), heatinducible transcriptional regulation is mediated by the heat shock transcription factor (HSF) that binds to HSEs found upstream of all stress protein genes [42]. There were 3 types of HSEs: perfect, gapped, and stepped [43]. 5'-nnTTCnnGAAnnTTCn-3' consisted of all 3 inverted repeats in a contiguous array was a perfect HSE [44]. Gapped HSEs had 2 consecutive inverted sequences with the third sequence separated by a 5 bp gap and all 3 sequences in stepped HSEs were separated by 5 bp gap [45,46]. The three types had different impacts on Hsf1 binding affinity. A typical HSE (nGAAn)

was bound by Hsf1 with high affinity. Selective changes in the sequence of the HSEs or the presence of the appropriate bases (TA, TC, or GA) in per element would dramatically reduce promoter activity sufficient or produce a strong regulatory element [44]. Four cis-acting HSEs were found in the upstream of Pohsp70 in this survey. The HSE2 and HSE3 shared the typical HSE characterization (nGAAn). HSE2 was perfect HSE, which was consisted of 5'nnTTCnnGAAnnTTCn-3'. The change from “A” to “G” in the third position of HSE1 and HSE4 might decrease the binding affinity to Hsf1. At the initial stage of heat shock stress, the HSFs bound to the HSE and started the transcription of the hsp genes (1 h post heat shock in this study, Fig. 3). When the hsps reached high abundance, the HSFs lost the DNA binding activity to the HSEs, so the expression of hsp genes decreased gradually to the normal level. In this report, Pohsp70 was observed to be intronless in ORF, which is a striking characteristic in inducible hsp70 gene [47], although Pohsp70 owned an intron in 5' noncoding region. It was implied that Pohsp70 gene could avoid RNA slicing and prior expression under stress [48]. A stress response element (STRE, CCCCT) was found in this survey. STRE-mediated expression occurs in response to a variety of stressors, including heat shock, oxidative stress, toxicity, and nutritional depletion [49]. In general, two kinds of stress pathways

Please cite this article in press as: Qi J, et al., Molecular characterization of heat shock protein 70 (HSP 70) promoter in Japanese flounder (Paralichthys olivaceus), and the association of Pohsp70 SNPs with heat-resistant trait, Fish & Shellfish Immunology (2014), http://dx.doi.org/ 10.1016/j.fsi.2014.05.038

66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65

YFSIM3010_proof ■ 12 June 2014 ■ 6/9

6

J. Qi et al. / Fish & Shellfish Immunology xxx (2014) 1e9

Table 2 Characterization of SNPs of Pohsp70 and association analysis with heat-resistance in Japanese flounder. P-values are from chi-square test of heat resistant and susceptible frequencies. ID

Position

1

38/39

2

57

3

177

4

203

5

252

6

290

7

295

8

297

9

315

10

326

11

408

12

466

13

551

14

592

15

768

16

807

17

1218

18

1415

19

1524

20

1746

21

1755

22

1971

23

2046

24

2170

25

2319

Genotype

AA AA/DEL DEL/DEL TT C/T CC CC C/T TT GG A/G TT C/T CC AA A/T TT C/T CC TT A/T AA C/T TT CC A/G TT AA CC GG TT C/T CC TT C/T CC AA A/G GG TT C/T CC CC C/T CC C/T TT AA A/G TT C/T AA A/T CC C/T CC C/T CC C/T CC C/T TT A/T GG G/A

Amino acid

e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e e Leu Leu Leu Asp Asp Ile Ile Ile Val Val Ile Ile Leu Leu Asp Asp Pro Pro Gly Gly Thr Thr Thr Ser/Thr Leu Leu

Heat-susceptible (N ¼ 30)

Heat-resistant (N ¼ 30) Allele

Frequency (%)

Allele

Frequency (%)

28 2 0 25 5 0 18 12 0 24 6 2 21 7 19 11 13 17 0 28 2 0 8 22 0 8 3 7 3 9 15 15 0 21 9 0 21 3 6 15 9 6 22 8 14 11 5 25 5 29 1 20 10 26 4 28 2 24 6 14 16 1 29 15 15

93.33 6.67 0.00 83.33 16.67 0.00 60.00 40.00 0.00 80.00 20.00 6.67 70.00 23.33 63.33 36.67 43.33 56.67 0.00 93.33 6.67 0.00 26.67 73.33 0.00 26.67 10.00 23.33 10.00 30.00 50.00 50.00 0.00 70.00 30.00 0.00 70.00 10.00 20.00 50.00 30.00 20.00 73.33 26.67 46.67 36.67 16.67 83.33 16.67 96.67 3.33 66.67 33.33 86.67 13.33 93.33 6.67 80.00 20.00 46.67 53.33 3.33 96.67 53.33 50.00

14 10 6 10 15 5 7 20 3 21 9 10 20 0 22 8 8 18 4 18 9 3 6 18 6 10 2 4 6 8 12 14 4 13 13 4 27 3 0 28 2 0 20 10 26 4 0 26 4 23 7 14 16 19 11 23 7 23 7 14 16 5 25 16 14

46.67 33.33 20.00 33.33 50.00 16.67 23.33 66.67 10.00 70.00 30.00 33.33 66.67 0.00 73.33 26.67 26.67 60.00 13.33 60.00 30.00 10.00 20.00 60.00 20.00 33.33 6.67 13.33 20.00 26.67 40.00 46.67 13.33 43.33 43.33 13.33 90.00 10.00 0.00 93.33 6.67 0.00 66.67 33.33 86.67 13.33 0.00 86.67 13.33 76.67 23.33 46.67 53.33 63.33 36.67 76.67 23.33 76.67 23.33 46.67 53.33 16.67 83.33 46.67 53.33

c2

P

16.00

＜0.01

16.43

＜0.01

9.84

＜0.01

0.80

0.37

12.36

＜0.01

0.69

0.41

5.22

0.07

9.63

＜0.01

6.00

0.20

8.00

0.33

4.37

0.11

6.61

0.04

6.75

0.03

14.38

＜0.01

0.32

0.57

11.87

＜0.01

0.13

0.72

5.19

0.02

2.44

0.12

4.36

0.04

3.27

0.07

0.10

0.75

0.00

1.00

2.96

0.09

0.07

0.80

Note: All the SNPs were counted and chi-square test was calculated by SPSS 13.0. 7 SNPs were identified to be associated with heat resistance (P < 0.01, significant results were showed in bold).

Please cite this article in press as: Qi J, et al., Molecular characterization of heat shock protein 70 (HSP 70) promoter in Japanese flounder (Paralichthys olivaceus), and the association of Pohsp70 SNPs with heat-resistant trait, Fish & Shellfish Immunology (2014), http://dx.doi.org/ 10.1016/j.fsi.2014.05.038

66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65

YFSIM3010_proof ■ 12 June 2014 ■ 7/9

J. Qi et al. / Fish & Shellfish Immunology xxx (2014) 1e9

7

have overlapping functions although the combination might be various because many stress-response genes possess both STREs and HSEs in their promoter regions [50]. The different combinations of regulatory elements results in more precise responses to stress. 4.2. SNPs of Pohsp70 12 synonmous SNPs and 1 nonsynonmous SNP were identified in Pohsp70 ORF, which means that hsp70 gene was a relatively conserved gene since synonmous SNP was much more frequent than nonsynonmous SNP in coding region [51]. Pohsp70 gene contained 12 SNPs in the coding region and 13 SNPs in the noncoding regions, corresponding to about one SNP per 105 bp, which is consistent with the frequencies in the Atlantic cod (Gadus morhua) at one SNP per 111 bp where a candidate gene approach was also used [52]. A previous study in the sole (Solea solea L.) of many genes about growth and development reported 86 SNPs were distributed over 7244 bp, representing an average of one SNP per 84 bp, which is also comparable to our results [53].

4.3. Association of SNPs with heat resistance

Fig. 4. The analysis of linkage disequilibrium of 7 SNPs in Pohsp70 (A) the value of D' in linkage disequilibrium analysis; (B) the value of R2 in linkage disequilibrium analysis.

Table 3 Haplotype analyses in the heat resistant and heat susceptible sample sets. P-values are from chi-square test of heat resistance and susceptible frequencies. Haplotype ID 1

2

3

5

8

14

T T T T T DEL T DEL DEL

A A A A G G A A G

G G G A A A G G G

A G G G G A A A A

A A A A A T T A A

A A G A A A A A A

Heat-resistant (freq)

Heat susceptible (freq)

P

18.00 4.81 0.00 7.00 4.00 10.81 2.13 2.00 6.00

22.50 4.50 21.00 5.75 3.00 1.25 0.00 0.00 0.00

0.51 0.84 <0.001 0.63 0.64 0.0025 0.13 0.14 0.01

Hsp70 is a sensitive factor to temperature. It is essential to improve the heat resistance of Japanese flounder with the global warmer and fading of heat resistant traits. By genotyping SNP 1, 2, 3, 5, 8, 14, 16 of Pohsp70 in heat resistance and heat susceptible groups, the evidences showed that variation at Pohsp70 is associated with heat resistance in Japanese flounder. The A allele at SNP1 and SNP8, T allele at SNP 2, 3, 5, 14 and C allele at SNP16 was significantly higher in frequency in heat resistance group. Thus, it is likely that these SNPs are associated with heat resistance. 2 synonymous SNPs were found to be associated with heat resistance in this investigation. Although they could not change the sequence of amino acid, they might influence the expression of protein, such as translational rate, the stability of mRNA and splicing of intron. It was also probably that they were associated with the functional polymorphisms in other regulatory regions, such as intron, 5' regulatory region, or even the coding sequences. Some evidences show that variants of hsp70 are associated with heat resistance in Chinese Holstein where BB genotype of SNPs in 3'-UTR of hsp70, showed better heat resistance [54]. Haplotype and association analysis suggested that the correlation of TAAGGAG type with heat susceptible group and (DEL T) GAATA with heat resistant group was significant (P < 0.005). At haplotype of TAAGGAG and (DEL T) GAATTA, the genotypes of Japanese flounder population were not in HWE. To better understand the association of the selected SNPs with heat resistance, we should use more family pairs, like normal families versus heat resistant families and even wild population pairs, such as low temperature living population versus high temperature living population to verify. In that way, the most important SNP related with heat resistance might be identified eventually.

5. Conclusions (0.300) (0.080) (0.000) (0.117) (0.067) (0.180) (0.036) (0.033) (0.100)

(0.375) (0.075) (0.350) (0.096) (0.050) (0.021) (0.000) (0.000) (0.000)

We first reported Pohsp70 promoter, and predicated its structure in regulatory region. We identified 7 SNPs of Pohsp70 that were potentially associated with heat resistance in Japanese flounder. This study benefits our understanding in the genetic mechanism regulating Japanese flounder heat resistance, and provides candidate markers for the selective breeding of Japanese flounder aimed at anti-stress and production.

Please cite this article in press as: Qi J, et al., Molecular characterization of heat shock protein 70 (HSP 70) promoter in Japanese flounder (Paralichthys olivaceus), and the association of Pohsp70 SNPs with heat-resistant trait, Fish & Shellfish Immunology (2014), http://dx.doi.org/ 10.1016/j.fsi.2014.05.038

66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65

YFSIM3010_proof ■ 12 June 2014 ■ 8/9

8

J. Qi et al. / Fish & Shellfish Immunology xxx (2014) 1e9

Author contributions Conceived and designed the experiments: J. Qi, X.D. Liu and Q.Q. Zhang. Performed the experiments: J. Qi, X.D. Liu, H.Y. Yu, Z.G. Wang. Analyzed the data: W.J. Wang, J.X. Liu. Contributed reagents/ materials: Q.Q. Zhang. Wrote the paper: J. Qi, H.Y. Yu and J.X. Liu.

[22]

[23]

[24]

Acknowledgments The authors are thankful to Dr. He Yan's reversion for this manuscript. This study was supported by National High Technology Research and Development Program of China (2012AA10A408). References [1] Cara JB, Aluru N, Moyano FJ, Vijayan MM. Food-deprivation induces HSP70 and HSP90 protein expression in larval gilthead sea bream and rainbow trout. Comp Biochem Physiol Part B Biochem Mol Biol 2005;142:426e31. [2] Dang W, Hu YH, Zhang M, Sun L. Identification and molecular analysis of a stress-inducible Hsp70 from sciaenops ocellatus. Fish Shellfish Immunol 2010;29:600e7. [3] Iwama GK, Afonso LO, Todgham A, Ackerman P, Nakano K. Are hsps suitable for indicating stressed states in fish? J Exp Biol 2004;207:15e9. [4] Deane EE, Woo NY. Cloning and characterization of the hsp70 multigene family from silver sea bream: modulated gene expression between warm and cold temperature acclimation. Biochem Biophys Res Commun 2005;330: 776e83. [5] Tsan MF, Gao B. Heat shock proteins and immune system. J Leukoc Biol 2009;85:905e10. [6] Forsyth R, Candido E, Babich S, Iwama G. Stress protein expression in coho salmon with bacterial kidney disease. J Aquat Animal Health 1997;9:18e25. [7] Ackerman PA, Iwama GK. Physiological and cellular stress responses of juvenile rainbow trout to vibriosis. J Aquat Animal Health 2001;13:173e80. [8] Airaksinen S, Jokilehto T, Rabergh CM, Nikinmaa M. Heat- and cold-inducible regulation of HSP70 expression in zebrafish ZF4 cells. Comp Biochem Physiol Part B Biochem Mol Biol 2003;136:275e82. [9] Lele Z, Engel S, Krone PH. hsp47 and hsp70 gene expression is differentially regulated in a stress- and tissue-specific manner in zebrafish embryos. Dev Genet 1997;21:123e33. [10] Arai A, Naruse K, Mitani H, Shima A. Cloning and characterization of cDNAs for 70-kDa heat-shock proteins (Hsp70) from two fish species of the genus oryzias. Idengaku Zasshi 1995;70:423e33. [11] Molina A, Biemar F, Muller F, Iyengar A, Prunet P, Maclean N, et al. Cloning and expression analysis of an inducible HSP70 gene from tilapia fish. FEBS Lett 2000;474:5e10. [12] Zhang A, Zhou X, Wang X, Zhou H. Characterization of two heat shock proteins (Hsp70/Hsc70) from grass carp (Ctenopharyngodon idella): evidence for their differential gene expression, protein synthesis and secretion in LPSchallenged peripheral blood lymphocytes. Comp Biochem Physiol Part B Biochem Mol Bio 2011;159:109e14. [13] Ali KS, Dorgai L, Gazdag A, Abraham M, Hermesz E. Identification and induction of hsp70 gene by heat shock and cadmium exposure in carp. Acta Biol Hung 2003;54:323e34. [14] Kondo H, Watabe S. Temperature-dependent enhancement of cell proliferation and mRNA expression for type I collagen and HSP70 in primary cultured goldfish cells. Comp Biochem Physiol Part A Mol Integr Physiol 2004;138: 221e8. [15] Takle H, McLeod A, Andersen O. Cloning and characterization of the executioner caspases 3, 6, 7 and Hsp70 in hyperthermic Atlantic salmon (Salmo salar) embryos. Comp Biochem Physiol Part B Biochem Mol Biol 2006;144: 188e98. [16] Ming J, Xie J, Xu P, Liu W, Ge X, Liu B, et al. Molecular cloning and expression of two HSP70 genes in the Wuchang bream (Megalobrama amblycephala Yih). Fish Shellfish Immunol 2010;28:407e18. [17] Mu W, Wen H, Li J, He F. Cloning and expression analysis of a HSP70 gene from Korean rockfish (Sebastes schlegeli). Fish Shellfish Immunol 2013;35: 1111e21. [18] Yokoyama Y, Hashimoto H, Kubota S, Kinoshita M, Toyohara H, Sakaguchi M, et al. cDNA cloning of heat-inducible HSP70, a 70.6 kDa heat shock protein, in Japanese flounder Paralichtys olivaceus. Fish Sci 1998;64:964e8. [19] Yokoyama S, Koshio S, Takakura N, Oshida K, Ishikawa M, GallardoCigarroa FJ, et al. Dietary bovine lactoferrin enhances tolerance to high temperature stress in Japanese flounder Paralichthys olivaceus. Aquaculture 2005;249:367e73. [20] Choi CY. Environmental stress-related gene expression and blood physiological responses in olive flounder (Paralichthys olivaceus) exposed to osmotic and thermal stress. Animal Cells Syst 2010;14:17e23. [21] Cha IS, Kwon J, Park SB, Jang HB, Nho SW, Kim YK, et al. Heat shock protein profiles on the protein and gene expression levels in olive flounder kidney

[25]

[26]

[27]

[28]

[29]

[30] [31]

[32]

[33]

[34] [35]

[36] [37]

[38]

[39]

[40] [41]

[42] [43]

[44] [45]

[46]

[47]

[48] [49] [50]

infected with streptococcus parauberis. Fish Shellfish Immunol 2013;34: 1455e62. Hu Y-h, Dang W, Zhang M, Sun L. Japanese flounder (Paralichthys olivaceus) hsp70: adjuvant effect and its dependence on the intrinsic ATPase activity. Fish shellfish Immunol 2012;33:829e34. Sun B-g, Dang W, Sun L, Hua Y-h. Vibrio harveyi hsp70: immunogenicity and application in the development of an experimental vaccine against V. harveyi and streptococcus iniae. Aquaculture 2014;418:144e7. Konings A, Van Laer L, Michel S, Pawelczyk M, Carlsson PI, Bondeson ML, et al. Variations in HSP70 genes associated with noise-induced hearing loss in two independent populations. Eur J Hum Genet EJHG 2009;17:329e35. Kim JJ, Mandelli L, Lim S, Lim HK, Kwon OJ, Pae CU, et al. Association analysis of heat shock protein 70 gene polymorphisms in schizophrenia. Eur Arch Psychiatry Clin Neurosci 2008;258:239e44. Janardhanan J, Joseph Martin S, Astrup E, Veeramanikandan R, Aukrust P, Abraham OC, et al. Single-nucleotide polymorphisms in toll-like receptor (TLR)-2, TLR4 and heat shock protein 70 genes and susceptibility to scrub typhus. J Hum Genet 2013;58:707e10. Zbawicka M, Drywa A, Smietanka B, Wenne R. Identification and validation of novel SNP markers in European populations of marine mytilus mussels. Mar Biol 2012;159:1347e62. Wei T, Sun YN, Shi G, Wang RX, Xu TJ. Characterization and SNP variation analysis of a HSP70 gene from miiuy croaker and its expression as related to bacterial challenge and heat shock. Fish shellfish Immunol 2012;33:632e40. Kang JH, Yu KH, Park JY, An CM, Jun JC, Lee SJ. Allele-specific PCR genotyping of the hsp70 gene polymorphism discriminating the green and red color variants sea cucumber (Apostichopus japonicus). J Genet Genomics 2011;38: 351e5. Barrett JC, Fry B, Maller J, Daly MJ. Haploview: analysis and visualization of LD and haplotype maps. Bioinformatics 2005;21:263e5. Kim KJ, Lee HJ, Park MH, Cha SH, Kim KS, Kim HT, et al. SNP identification, linkage disequilibrium, and haplotype analysis for a 200-kb genomic region in a Korean population. Genomics 2006;88:535e40. Huang YZ, Sun YJ, Zhan ZY, Li MX, Wang J, Xue J, et al. Expression, SNP identification, linkage disequilibrium, and haplotype association analysis of the growth suppressor gene ZBED6 in qinchuan beef cattle. Anim Biotechnol 2014;25:35e54. Modisakeng KW, Jiwaji M, Pesce ER, Robert J, Amemiya CT, Dorrington RA, et al. Isolation of a latimeria menadoensis heat shock protein 70 (Lmhsp70) that has all the features of an inducible gene and encodes a functional molecular chaperone. Mol Genet Genomic MGG 2009;282:185e96. Maniatis T, Fritsch EF, Sambrook J. Molecular cloning: a laboratory manual. NY: Cold Spring Harbor; 1982. Zhong Q, Zhang Q, Wang Z, Qi J, Chen Y, Li S, et al. Expression profiling and validation of potential reference genes during paralichthys olivaceus embryogenesis. Mar Biotechnol 2008;10:310e8. Librado P, Rozas J. DnaSP v5: a software for comprehensive analysis of DNA polymorphism data. Bioinformatics 2009;25:1451e2. Kim JW, Lee JH, Kim KK, Lee SJ, Kang HS, Kim HD. Molecular cloning and characterization of a heat shock protein 70-related cDNA from olive flounder (Paralichthys olivaceus). J Aquac 1999;12:91e100. Freeman BC, Myers MP, Schumacher R, Morimoto RI. Identification of a regulatory motif in hsp70 that affects ATPase activity, substrate binding and interaction with HDJ-1. EMBO J 1995;14:2281e92. Bardwell JC, Craig EA. Major heat shock gene of drosophila and the escherichia coli heat-inducible dnaK gene are homologous. Proc Natl Acad Sci USA 1984;81:848e52. Bukau B, Horwich AL. The hsp70 and hsp60 chaperone machines. Cell 1998;92:351e66. Currie RW, Tanguay RM, Kingma Jr JG. Heat-shock response and limitation of tissue necrosis during occlusion/reperfusion in rabbit hearts. Circulation 1993;87:963e71. Wu C. Heat shock transcription factors: structure and regulation. Annu Rev Cell Dev Biol 1995;11:441e69. Uffenbeck SR, Krebs JE. The role of chromatin structure in regulating stressinduced transcription in saccharomyces cerevisiae. Biochem Cell Biol ¼ Biochimie Et Biologie Cell 2006;84:477e89. Amin J, Ananthan J, Voellmy R. Key features of heat shock regulatory elements. Mol Cell Biol 1988;8:3761e9. Santoro N, Johansson N, Thiele DJ. Heat shock element architecture is an important determinant in the temperature and transactivation domain requirements for heat shock transcription factor. Mol Cell Biol 1998;18: 6340e52. Yamamoto A, Mizukami Y, Sakurai H. Identification of a novel class of target genes and a novel type of binding sequence of heat shock transcription factor in saccharomyces cerevisiae. J Biol Chem 2005;280:11911e9. Franzellitti S, Fabbri E. Differential HSP70 gene expression in the mediterranean mussel exposed to various stressors. Biochem Biophys Res Commun 2005;336:1157e63. Huang Y, Wimler KM, Carmichael GG. Intronless mRNA transport elements may affect multiple steps of pre-mRNA processing. EMBO J 1999;18:1642e52. Mager WH, De Kruijff AJ. Stress-induced transcriptional activation. Microbiol Rev 1995;59:506e31. Susek RE, Lindquist S. Transcriptional derepression of the saccharomyces cerevisiae hsp26 gene during heat shock. Mol Cell Biol 1990;10:6362e73.

Please cite this article in press as: Qi J, et al., Molecular characterization of heat shock protein 70 (HSP 70) promoter in Japanese flounder (Paralichthys olivaceus), and the association of Pohsp70 SNPs with heat-resistant trait, Fish & Shellfish Immunology (2014), http://dx.doi.org/ 10.1016/j.fsi.2014.05.038

66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130

1 2 3 4 5 6

YFSIM3010_proof ■ 12 June 2014 ■ 9/9

J. Qi et al. / Fish & Shellfish Immunology xxx (2014) 1e9 [51] Nielsen R. Molecular signatures of natural selection. Annu Rev Genet 2005;39: 197e218. [52] Hemmer-Hansen J, Nielsen EE, Meldrup D, Mittelholzer C. Identification of single nucleotide polymorphisms in candidate genes for growth and reproduction in a nonmodel organism; the Atlantic cod, gadus morhua. Mol Ecol Resour 2011;11(Suppl. 1):71e80.

9

[53] Diopere E, Hellemans B, Volckaert FA, Maes GE. Identification and validation of single nucleotide polymorphisms in growth- and maturation-related candidate genes in sole (Solea solea L.). Mar genomics 2013;9:33e8. [54] FangLei D, QiuLing L, ChangFa W, HongMei W, TingRong Z, JinMing H, et al. Genetic variation at 3'-UTR of the heat shock protein 70 gene and its relationship with thermal tolerance in Holstein cows. J Agric Biotechnol 2010;18:296e301.

Please cite this article in press as: Qi J, et al., Molecular characterization of heat shock protein 70 (HSP 70) promoter in Japanese flounder (Paralichthys olivaceus), and the association of Pohsp70 SNPs with heat-resistant trait, Fish & Shellfish Immunology (2014), http://dx.doi.org/ 10.1016/j.fsi.2014.05.038

7 8 9 10 11 12