- Email: [email protected]
Molecular Characterization of the Porcine Endogenous Retrovirus Subclass A and B Envelope Gene From Pigs
Molecular Characterization of the Porcine Endogenous Retrovirus Subclass A and B Envelope Gene From Pigs D. Lee, J. Lee, S.J. Uhm, Y.S. Lee, M.J. Park, H.Y. Park, M. Kwon, H.T. Lee, and Y.B. Kim
ABSTRACT Xenotransplantation of porcine organs has the potential to overcome the current critical shortage of allogenic organs for transplantation in humans. However, the existence of porcine endogenous retroviruses (PERVs) presents a problem for the clinical use of xenografts from pigs. In an attempt to understand the molecular characteristics of PERVs, we cloned the PERV env gene from six pig breeds (ie, Berkshire, Duroc, Landrace, Yorkshire, and two types of miniature pigs) in Korea. A total of 141 env clones were isolated and their sequences were analyzed. Phylogenetic analyses of these genes revealed the presence of PERVs, from both classes A and B, in 54% and 46% of the env clones, respectively. Among these clones, 37 isolates had the correct open reading frame (ORF; 27 clones in subclass A and 10 clones in subclass B), while the others had premature termination. These PERV nucleotide sequences can be used in a database for comparisons of PERV distribution among different pig breeds and for monitoring PERV infection using isolates with functional ORFs. Recombinant envelope of subclass A and B with functional ORF was expressed by vaccinia virus systems. Additionally isolated env clones can be used for various experiments, such as PERV control and infectivity tests, and may enhance the understanding of molecular mechanisms through pseudotyped PERV viruses.
O
VER THE PAST DECADE, xenotransplantation has generated much interest in overcoming the current critical shortage of human organs for allogenic transplantation.1 One of the potentional zoonotic viruses, porcine endogenous retrovirus (PERV), is of particular concern because it integrates into the genome of all pigs and is stably transmitted through pig germ lines.2 The PERV is a Gammaretrovirus that includes the oncogenic gibbon, feline, and murine leukemia viruses3 whose envelope proteins are synthesized as polyproteins that are proteolytically processed into surface and transmembrane glycoprotein. Three distinct classes of infectious endogenous retroviruses, designated PERV-A, -B, and -C, were found in the pig genome.4 These viruses were classified by their env sequence differences.5 PERV-A and -B have wide host ranges in vitro. In contrast, PERV-C infects only two pig cell lines and one human cell line.5,6 Here, we cloned a fragment of the PERV env gene that includes gp70 and part of p15E from four domestic pig breeds and two types of miniature pigs in Korea and analyzed their molecular characteristics.
MATERIALS AND METHODS Isolation of Pig Genomic DNA Genomic DNA was prepared from pig hair roots and peripheral blood mononuclear cells (PBMCs) using the QIAamp Mini Kit (Qiagen). Hair roots were collected from four domestic pig breeds (five pigs each of Berkshire, Duroc, Landrace, and Yorkshire breeds) and PBMCs were obtained from two types of miniature pigs (Middle; M and Tiny; T) in Korea.
From the Department of Animal Biotechnology, College of Animal Bioscience & Technology, Konkuk University, Seoul, Korea. Supported by the Research Project on the Production of Bio-organs (No. 200508030701) Ministry of Agriculture and Forestry and Korea Research Foundation (KRF-2005-F00008100015), Republic of Korea. This work was supported by the faculty research fund of Konkuk University in 1999. Address reprint requests to Prof Young Bong Kim, PhD, Department of Animal Biotechnology, College of Animal Bioscience & Technology, Konkuk University, Seoul, Korea, 143701. E-mail: [email protected]
0041-1345/06/$–see front matter doi:10.1016/j.transproceed.2006.08.144
© 2006 by Elsevier Inc. All rights reserved. 360 Park Avenue South, New York, NY 10010-1710
3066
Transplantation Proceedings, 38, 3066 –3069 (2006)
PORCINE ENDOGENOUS RETROVIRUS
3067
Polymerase Chain Reaction and Cloning of the PERV env Gene Polymerase chain reaction (PCR) was performed with forward primer: 5=-ACCTGGATCCATGCATCCCACGTTAA-3= and reverse primer: 5=-(A/G)TCTGAAGTGGTTCTACAGAAC(A/C) G(A/G)A-3=. PCR conditions were one cycle of 94°C for 3 minutes, 30 cycles of 94°C for 30 seconds, 55°C for 30 seconds, and 72°C for 1 minute, and one cycle of 72°C for 7 minutes. Approximately 1.6 kb of PCR products were purified and cloned into a pCR2.1TOPO vector (Invitrogen).
Analysis of env Sequences and Their Molecular Characteristics All clones were sequenced using an ABI sequencer. To estimate the level of divergence between PERVs, their nucleotide sequences were aligned using CLUSTAL X 1.8. Genetic distances between sequences were calculated using the Kimura, two-parameter model with gamma distribution, and phylogenetic trees were constructed using the neighbor-joining method in TREECON 1.3b. The reliability of the neighbor-joining topologies was estimated by performing 100 bootstrap replicates. The following sequences were used as references, with Genbank accession numbers in parentheses: PERV-A (AF130444, AY312527, AF507940), PERV-B (AJ133818, AJ288587, AJ288589), PERV-C (AF038600 and AF402661), and PERV-E (AF356698). The nucleotide sequences of the cloned env genes were submitted to Genbank with accession numbers DQ011693–DQ011834.
Expression of PERV-A, -B Glycoproteins His-tagged PERV-A, -B gp70 were amplified from correct open reading frame (ORF) clones and cloned into a pTM-1 vector. Vaccinia virus system was used for recombinant envelope protein expression.7 Expressed PERV gp70 envelope proteins were detected by immunoblotting using an anti-His monoclonal antibody.
RESULTS Cloning of the PERV env Gene and Its Distribution
A total of 141 PERV env clones were isolated and their sequences were analyzed. Before phylogenetic analysis of the isolates, we could divide the subclasses by the alignment of their sequences with those of reference strains (Table 1). Analysis of an intersubclass distribution revealed that PERV-A accounted for 54% of all clones while PERV-B accounted for 46%. This distribution was 59% and 41% in the case of domestic pigs and 45% and 55% in the case of miniature pigs, for PERV-A and PERV-B, respectively. Minor distribution differences between PERV-A and -B in individual breeds were observed, but there were no signif-
icant variations between pigs. Our data showed that there was a similar distribution of PERV-A and -B in all pigs examined.
Sequence Analyses of Envelope Genes
Analyses of deduced amino acid sequences revealed that isolates were primarily nonfunctional clones due to mutations. However, 37 of 141 had correct ORFs. We analyzed inter- and intranucleotide and amino acid sequence homologies between the clones with correct ORFs (data not shown). Intrasubclass nucleotide sequences had high homologies between 97.1% and 99.9%. Intersubclass nucleotide sequences showed remarkable differences, with homology values between 65.2% and 66.4% identity. Inter- and intrasubclass amino acid sequence homologies were similar to those of the corresponding nucleotide sequences. The PERV envelope protein that surrounds the viral core is a type of surface glycoprotein that has a cleavage site in its transmembrane domain. In particular, the PERV envelope protein is divided into gp70, which is analogous to gp120 in HIV-1, and a transmembrane domain (p15E) that is buried in the lipid bilayer. It was reported that gp70 has a glycosylation site that affects the infectivity of PERVs.8 We deduced amino acid sequences of the representative ORFs of the PERV-A and -B isolates. Potential glycosylation sites (Asn-X-Thr/Ser) were observed in the PERV-A and B envs with ten and five, respectively. The cleavage site, which is divided into gp70 and p15E, is positioned at amino acids 458 to 462 in PERV-A and at 455 to 459 in PERV-B, with a conserved sequence motif of Arg/Lys-X-Lys-Arg. Similar to other RNA viruses, PERV sequences that were analyzed in the present study showed many mutations in the env gene. Of the 27 PERV-A clones with correct ORFs, three isolates (L9, T3, and T8) had point mutations at cleavage sites (ie, a Trp instead of Arg/Lys). In the 10 potential glycosylation sites (GS) in PERV-A, the D12, D15, and Y24 clones had Ser mutations at the second GS. Also, five isolates (L9, T3, T8, T10, and T21) had mutations at the sixth GS and the D8 isolate had a mutation at the eighth GS. Strangely, both cleavage and glycosylation site mutants with correct ORFs were found only in PERV-A isolates. The proline-rich region, spanning amino acids 253 to 294 in PERV-A and 247 to 294 in PERV-B, had 10 or 11 prolines in PERV-A and 13 prolines in PERV-B. The neutralizing epitopes p15E (Gly-Pro-Gln-Arg-Glu-Lys) were highly conserved.
Table 1. PERV env Clones of Domestic Pigs and Miniature Pigs From Korea Domestic Pigs Berkshire Subgroup
Number of clones Total
A
B
10 (4)* 6 (1) 17 (5)
Duroc A
10 (3)
B
10 (4) 21 (7)
Miniature Pigs
Landrace C
1
A
B
14 (6) 8 (2) 22 (8)
*Number of clones with a correct open reading frame shown in parentheses.
Yorkshire A
B
18 (6) 13 (2) 31 (8)
M A
T B
10 (1) 14 24 (1)
A
Total B
13 (7) 14 (1) 27 (8)
A
B
75 (27) 65 (10) 141 (37)
C
1
3068
Fig 1. Neighbor-joining tree based on the 1.6 kb nucleotide sequences of the PERV env gene obtained from domestic pigs and miniature pigs from Korea. The tree was generated using the method of Kimura, based on the env sequences using TREECON 1.3b. Numbers at the nodes indicate the bootstrap value of 100 resampled datasets.
Phylogenetic Analysis
Molecular phylogenetic analyses were performed with 141 PERV isolates and nine reference samples. After a final drawing of the tree, 36 representative isolates were selected and are shown in Fig 1. PERV-A, -B, and -C were separately grouped with 100% bootstrap value. Expression of PERV-A, -B gp70 by Recombinant Vaccinia Virus System
PERV-A and -B gp70 were expressed in eukaryotic system using vaccinia virus expression system. Expressed gp70 of PERV-B had shown the downshift compared to PERV-A, because of differences of glysosylations (potential glycosylation site PERV-A, 10; PERV-B, five; Fig 2). DISCUSSION
In the present study, we sought to sequence and characterize PERV envelope genes from four breeds of domestic pig
LEE, LEE, UHM ET AL
and two types of miniature pig in Korea. According to previous reports, the pig genome contains at least 10 to 50 copies of proviral PERVs; among these PERVs, three types are infectious.10 The primers used for these experiments were designed from the conserved envelope sequences of all three PERV subclasses. However, PERV-C was detected only one case in Duroc. A possible explanation for this observation may be that the reverse amplification primer of the PERVs had two mismatched bases for PERV-C compared to PERV-A and -B. Although it is not critical for PCR, two mismatched bases in the middle of the reverse primer sequence might decrease annealing fidelity. PERV-C could also arise due to low copies of PERV-C compared to other subclasses in Korean pig breeds; however, this hypothesis was excluded by amplification of env fragments using PERV-C-specific primers11 from the same genomic DNA (data not shown). Considering the distribution of PERVs, PERV-A and -B were present at nearly equal levels. In both Berkshire and Landrace breeds, PERV-A accounted for a higher proportion (58%). Such a result could be the result of interindividual differences. Also, the standard error might be significant due to the insufficiency of the number of clones. The PERV provirus, positioned in the pig genome, generally cannot produce functional virus particles due to deletions, insertions, or point mutations. The analyzed clones in our study were primarily nonfunctional clones as described above, and only 26% (37 clones out of 142) had correct ORFs. Similar results have been reported for the BAC library of Large White specific pathogen-free pigs, wherein 25% had correct PERV env ORFs.12 If we consider the glycosylation or cleavage mutants, our data suggest that less than 26% of proviral PERVs have the potential to generate functional envelope proteins. Glycosylation mutant env clones, D8, D12, L9, Y24, and T3, had correct ORFs, suggesting that receptor binding and anti-host immune response might be influenced by changes in structure. To confirm such possibilities, interactions with receptors and the influence of host range on such glycosylation mutants should be further studied. These two types of mutants may allow the study of the function of PERV env genes and their receptors. The PERV nucleotide sequences can be used as a database for both comparisons of PERV subclass distribution among different pig breeds and for monitoring PERV infectivity of isolates
Fig 2. Expression of PERV-A and -B gp70 by recombinant vaccinia virus system. (A) Schematic representation of a full-length PERV envelope protein. The functional sites of env are shown at the top. SU, surface unit; PRR, Pro-rich region; TM, transmembrane. Dark arrow indicates potential glycosylation site. (B) Immunoblotting analysis of the expression of PERV gp70. Recombinant PERV envelope proteins were detected by anti-His monoclonal antibody.
PORCINE ENDOGENOUS RETROVIRUS
with functional ORFs. Additionally, isolated env clones can be used for various experiments, such as PERV regulation and infectivity tests, and may enhance the understanding of the molecular mechanisms through pseudotyped PERV viruses. REFERENCES 1. White SA, Nicholson ML: Br J Surg 86, 1999 2. Swindle MM: Ann N Y Acad Sci 862, 1998
3069 3. Breese SS, Jr: Arch Gesamte Virusforsch 30, 1970 4. Patience C, Takeuchi Y, Weiss RA: Nat Med 3, 1997 5. Takeuchi Y, Patience C, Magre S, et al: J Virol 72, 1998 6. Czauderna F, Fischer N, Boller K, et al: J Virol 74, 2000 7. Kim YB, Han DP, Cao C, et al: Virology 305, 2003 8. Oldmixon BA, Wood JC, Ericsson TA, et al: J Virol 76, 2002 9. Fiebig U, Stephan O, Kurth R, et al: Virology 307, 2003 10. Akiyoshi DE, Denaro M, Zhu H, et al: J Virol 72, 1998 11. Mang R, Maas J, Chen X, et al: J Gen Virol 82, 2001 12. Bosch S, Arnauld C, Jestin A: J Virol 74, 2000
ABSTRACT Xenotransplantation of porcine organs has the potential to overcome the current critical shortage of allogenic organs for transplantation in humans. However, the existence of porcine endogenous retroviruses (PERVs) presents a problem for the clinical use of xenografts from pigs. In an attempt to understand the molecular characteristics of PERVs, we cloned the PERV env gene from six pig breeds (ie, Berkshire, Duroc, Landrace, Yorkshire, and two types of miniature pigs) in Korea. A total of 141 env clones were isolated and their sequences were analyzed. Phylogenetic analyses of these genes revealed the presence of PERVs, from both classes A and B, in 54% and 46% of the env clones, respectively. Among these clones, 37 isolates had the correct open reading frame (ORF; 27 clones in subclass A and 10 clones in subclass B), while the others had premature termination. These PERV nucleotide sequences can be used in a database for comparisons of PERV distribution among different pig breeds and for monitoring PERV infection using isolates with functional ORFs. Recombinant envelope of subclass A and B with functional ORF was expressed by vaccinia virus systems. Additionally isolated env clones can be used for various experiments, such as PERV control and infectivity tests, and may enhance the understanding of molecular mechanisms through pseudotyped PERV viruses.
O
VER THE PAST DECADE, xenotransplantation has generated much interest in overcoming the current critical shortage of human organs for allogenic transplantation.1 One of the potentional zoonotic viruses, porcine endogenous retrovirus (PERV), is of particular concern because it integrates into the genome of all pigs and is stably transmitted through pig germ lines.2 The PERV is a Gammaretrovirus that includes the oncogenic gibbon, feline, and murine leukemia viruses3 whose envelope proteins are synthesized as polyproteins that are proteolytically processed into surface and transmembrane glycoprotein. Three distinct classes of infectious endogenous retroviruses, designated PERV-A, -B, and -C, were found in the pig genome.4 These viruses were classified by their env sequence differences.5 PERV-A and -B have wide host ranges in vitro. In contrast, PERV-C infects only two pig cell lines and one human cell line.5,6 Here, we cloned a fragment of the PERV env gene that includes gp70 and part of p15E from four domestic pig breeds and two types of miniature pigs in Korea and analyzed their molecular characteristics.
MATERIALS AND METHODS Isolation of Pig Genomic DNA Genomic DNA was prepared from pig hair roots and peripheral blood mononuclear cells (PBMCs) using the QIAamp Mini Kit (Qiagen). Hair roots were collected from four domestic pig breeds (five pigs each of Berkshire, Duroc, Landrace, and Yorkshire breeds) and PBMCs were obtained from two types of miniature pigs (Middle; M and Tiny; T) in Korea.
From the Department of Animal Biotechnology, College of Animal Bioscience & Technology, Konkuk University, Seoul, Korea. Supported by the Research Project on the Production of Bio-organs (No. 200508030701) Ministry of Agriculture and Forestry and Korea Research Foundation (KRF-2005-F00008100015), Republic of Korea. This work was supported by the faculty research fund of Konkuk University in 1999. Address reprint requests to Prof Young Bong Kim, PhD, Department of Animal Biotechnology, College of Animal Bioscience & Technology, Konkuk University, Seoul, Korea, 143701. E-mail: [email protected]
0041-1345/06/$–see front matter doi:10.1016/j.transproceed.2006.08.144
© 2006 by Elsevier Inc. All rights reserved. 360 Park Avenue South, New York, NY 10010-1710
3066
Transplantation Proceedings, 38, 3066 –3069 (2006)
PORCINE ENDOGENOUS RETROVIRUS
3067
Polymerase Chain Reaction and Cloning of the PERV env Gene Polymerase chain reaction (PCR) was performed with forward primer: 5=-ACCTGGATCCATGCATCCCACGTTAA-3= and reverse primer: 5=-(A/G)TCTGAAGTGGTTCTACAGAAC(A/C) G(A/G)A-3=. PCR conditions were one cycle of 94°C for 3 minutes, 30 cycles of 94°C for 30 seconds, 55°C for 30 seconds, and 72°C for 1 minute, and one cycle of 72°C for 7 minutes. Approximately 1.6 kb of PCR products were purified and cloned into a pCR2.1TOPO vector (Invitrogen).
Analysis of env Sequences and Their Molecular Characteristics All clones were sequenced using an ABI sequencer. To estimate the level of divergence between PERVs, their nucleotide sequences were aligned using CLUSTAL X 1.8. Genetic distances between sequences were calculated using the Kimura, two-parameter model with gamma distribution, and phylogenetic trees were constructed using the neighbor-joining method in TREECON 1.3b. The reliability of the neighbor-joining topologies was estimated by performing 100 bootstrap replicates. The following sequences were used as references, with Genbank accession numbers in parentheses: PERV-A (AF130444, AY312527, AF507940), PERV-B (AJ133818, AJ288587, AJ288589), PERV-C (AF038600 and AF402661), and PERV-E (AF356698). The nucleotide sequences of the cloned env genes were submitted to Genbank with accession numbers DQ011693–DQ011834.
Expression of PERV-A, -B Glycoproteins His-tagged PERV-A, -B gp70 were amplified from correct open reading frame (ORF) clones and cloned into a pTM-1 vector. Vaccinia virus system was used for recombinant envelope protein expression.7 Expressed PERV gp70 envelope proteins were detected by immunoblotting using an anti-His monoclonal antibody.
RESULTS Cloning of the PERV env Gene and Its Distribution
A total of 141 PERV env clones were isolated and their sequences were analyzed. Before phylogenetic analysis of the isolates, we could divide the subclasses by the alignment of their sequences with those of reference strains (Table 1). Analysis of an intersubclass distribution revealed that PERV-A accounted for 54% of all clones while PERV-B accounted for 46%. This distribution was 59% and 41% in the case of domestic pigs and 45% and 55% in the case of miniature pigs, for PERV-A and PERV-B, respectively. Minor distribution differences between PERV-A and -B in individual breeds were observed, but there were no signif-
icant variations between pigs. Our data showed that there was a similar distribution of PERV-A and -B in all pigs examined.
Sequence Analyses of Envelope Genes
Analyses of deduced amino acid sequences revealed that isolates were primarily nonfunctional clones due to mutations. However, 37 of 141 had correct ORFs. We analyzed inter- and intranucleotide and amino acid sequence homologies between the clones with correct ORFs (data not shown). Intrasubclass nucleotide sequences had high homologies between 97.1% and 99.9%. Intersubclass nucleotide sequences showed remarkable differences, with homology values between 65.2% and 66.4% identity. Inter- and intrasubclass amino acid sequence homologies were similar to those of the corresponding nucleotide sequences. The PERV envelope protein that surrounds the viral core is a type of surface glycoprotein that has a cleavage site in its transmembrane domain. In particular, the PERV envelope protein is divided into gp70, which is analogous to gp120 in HIV-1, and a transmembrane domain (p15E) that is buried in the lipid bilayer. It was reported that gp70 has a glycosylation site that affects the infectivity of PERVs.8 We deduced amino acid sequences of the representative ORFs of the PERV-A and -B isolates. Potential glycosylation sites (Asn-X-Thr/Ser) were observed in the PERV-A and B envs with ten and five, respectively. The cleavage site, which is divided into gp70 and p15E, is positioned at amino acids 458 to 462 in PERV-A and at 455 to 459 in PERV-B, with a conserved sequence motif of Arg/Lys-X-Lys-Arg. Similar to other RNA viruses, PERV sequences that were analyzed in the present study showed many mutations in the env gene. Of the 27 PERV-A clones with correct ORFs, three isolates (L9, T3, and T8) had point mutations at cleavage sites (ie, a Trp instead of Arg/Lys). In the 10 potential glycosylation sites (GS) in PERV-A, the D12, D15, and Y24 clones had Ser mutations at the second GS. Also, five isolates (L9, T3, T8, T10, and T21) had mutations at the sixth GS and the D8 isolate had a mutation at the eighth GS. Strangely, both cleavage and glycosylation site mutants with correct ORFs were found only in PERV-A isolates. The proline-rich region, spanning amino acids 253 to 294 in PERV-A and 247 to 294 in PERV-B, had 10 or 11 prolines in PERV-A and 13 prolines in PERV-B. The neutralizing epitopes p15E (Gly-Pro-Gln-Arg-Glu-Lys) were highly conserved.
Table 1. PERV env Clones of Domestic Pigs and Miniature Pigs From Korea Domestic Pigs Berkshire Subgroup
Number of clones Total
A
B
10 (4)* 6 (1) 17 (5)
Duroc A
10 (3)
B
10 (4) 21 (7)
Miniature Pigs
Landrace C
1
A
B
14 (6) 8 (2) 22 (8)
*Number of clones with a correct open reading frame shown in parentheses.
Yorkshire A
B
18 (6) 13 (2) 31 (8)
M A
T B
10 (1) 14 24 (1)
A
Total B
13 (7) 14 (1) 27 (8)
A
B
75 (27) 65 (10) 141 (37)
C
1
3068
Fig 1. Neighbor-joining tree based on the 1.6 kb nucleotide sequences of the PERV env gene obtained from domestic pigs and miniature pigs from Korea. The tree was generated using the method of Kimura, based on the env sequences using TREECON 1.3b. Numbers at the nodes indicate the bootstrap value of 100 resampled datasets.
Phylogenetic Analysis
Molecular phylogenetic analyses were performed with 141 PERV isolates and nine reference samples. After a final drawing of the tree, 36 representative isolates were selected and are shown in Fig 1. PERV-A, -B, and -C were separately grouped with 100% bootstrap value. Expression of PERV-A, -B gp70 by Recombinant Vaccinia Virus System
PERV-A and -B gp70 were expressed in eukaryotic system using vaccinia virus expression system. Expressed gp70 of PERV-B had shown the downshift compared to PERV-A, because of differences of glysosylations (potential glycosylation site PERV-A, 10; PERV-B, five; Fig 2). DISCUSSION
In the present study, we sought to sequence and characterize PERV envelope genes from four breeds of domestic pig
LEE, LEE, UHM ET AL
and two types of miniature pig in Korea. According to previous reports, the pig genome contains at least 10 to 50 copies of proviral PERVs; among these PERVs, three types are infectious.10 The primers used for these experiments were designed from the conserved envelope sequences of all three PERV subclasses. However, PERV-C was detected only one case in Duroc. A possible explanation for this observation may be that the reverse amplification primer of the PERVs had two mismatched bases for PERV-C compared to PERV-A and -B. Although it is not critical for PCR, two mismatched bases in the middle of the reverse primer sequence might decrease annealing fidelity. PERV-C could also arise due to low copies of PERV-C compared to other subclasses in Korean pig breeds; however, this hypothesis was excluded by amplification of env fragments using PERV-C-specific primers11 from the same genomic DNA (data not shown). Considering the distribution of PERVs, PERV-A and -B were present at nearly equal levels. In both Berkshire and Landrace breeds, PERV-A accounted for a higher proportion (58%). Such a result could be the result of interindividual differences. Also, the standard error might be significant due to the insufficiency of the number of clones. The PERV provirus, positioned in the pig genome, generally cannot produce functional virus particles due to deletions, insertions, or point mutations. The analyzed clones in our study were primarily nonfunctional clones as described above, and only 26% (37 clones out of 142) had correct ORFs. Similar results have been reported for the BAC library of Large White specific pathogen-free pigs, wherein 25% had correct PERV env ORFs.12 If we consider the glycosylation or cleavage mutants, our data suggest that less than 26% of proviral PERVs have the potential to generate functional envelope proteins. Glycosylation mutant env clones, D8, D12, L9, Y24, and T3, had correct ORFs, suggesting that receptor binding and anti-host immune response might be influenced by changes in structure. To confirm such possibilities, interactions with receptors and the influence of host range on such glycosylation mutants should be further studied. These two types of mutants may allow the study of the function of PERV env genes and their receptors. The PERV nucleotide sequences can be used as a database for both comparisons of PERV subclass distribution among different pig breeds and for monitoring PERV infectivity of isolates
Fig 2. Expression of PERV-A and -B gp70 by recombinant vaccinia virus system. (A) Schematic representation of a full-length PERV envelope protein. The functional sites of env are shown at the top. SU, surface unit; PRR, Pro-rich region; TM, transmembrane. Dark arrow indicates potential glycosylation site. (B) Immunoblotting analysis of the expression of PERV gp70. Recombinant PERV envelope proteins were detected by anti-His monoclonal antibody.
PORCINE ENDOGENOUS RETROVIRUS
with functional ORFs. Additionally, isolated env clones can be used for various experiments, such as PERV regulation and infectivity tests, and may enhance the understanding of the molecular mechanisms through pseudotyped PERV viruses. REFERENCES 1. White SA, Nicholson ML: Br J Surg 86, 1999 2. Swindle MM: Ann N Y Acad Sci 862, 1998
3069 3. Breese SS, Jr: Arch Gesamte Virusforsch 30, 1970 4. Patience C, Takeuchi Y, Weiss RA: Nat Med 3, 1997 5. Takeuchi Y, Patience C, Magre S, et al: J Virol 72, 1998 6. Czauderna F, Fischer N, Boller K, et al: J Virol 74, 2000 7. Kim YB, Han DP, Cao C, et al: Virology 305, 2003 8. Oldmixon BA, Wood JC, Ericsson TA, et al: J Virol 76, 2002 9. Fiebig U, Stephan O, Kurth R, et al: Virology 307, 2003 10. Akiyoshi DE, Denaro M, Zhu H, et al: J Virol 72, 1998 11. Mang R, Maas J, Chen X, et al: J Gen Virol 82, 2001 12. Bosch S, Arnauld C, Jestin A: J Virol 74, 2000