- Email: [email protected]
Molecular cloning and characterization of a novel cold-active lipase from Pichia lynferdii NRRL Y-7723
Biocatalysis and Agricultural Biotechnology 11 (2017) 19–25
Contents lists available at ScienceDirect
Biocatalysis and Agricultural Biotechnology journal homepage: www.elsevier.com/locate/bab
Molecular cloning and characterization of a novel cold-active lipase from Pichia lynferdii NRRL Y-7723 Jae-Han Baea, In-Hwan Kimb, Ki-Teak Leec, Ching T. Houd, Hak-Ryul Kima,e,
MARK
⁎
a
School of Food Science and Biotechnology, Kyungpook National University, Daegu, South Korea Department of Food and Nutrition, Korea University, Seoul, South Korea c Department of Food Science and Technology, Chungnam National University, Daejeon, South Korea d Renewable Product Technology Research Unit, National Center for Agricultural Utilization Research, ARS, USDA, Peoria, IL, USA e Institute of Agricultural Science & Technology, Kyungpook National University, Daegu, South Korea b
A R T I C L E I N F O
A B S T R A C T
Keywords: Lipase Cold-active Cloning Pichia lynferdii
Lipase is one of the widely used biocatalysts, which is well studied for its application in industrial production. Recently, lipases with special characteristics such as thermo-stability, alkaline-, acidic nature, and cold-activity, have gained attention for effective applications in specific purposes. Previously, Pichia lynferdii NRRL Y-7723 was reported to produce high amounts of extracellular cold-active lipase (Kim et al., 2010). In this study, we report the identification of lip1 gene that encodes an extracellular cold-active lipase from P. lynferdii NRRL Y7723. The open reading frame of the gene consisted of 1122 bp of nucleotides that encoded a protein with 373 amino acids. The deduced molecular weight and isoelectric point were 41.8 kDa and pH 5.82, respectively. The lip1 gene was cloned into a bacterial expression vector, and the recombinant lipase was successfully expressed and purified. Several parameters of the recombinant lipase were analyzed, and Lip1 showed high activity at low temperature.
1. Introduction Lipases (triacylglycerol acylhydrolase, E.C.3.1.1.3) are enzymes that catalyze hydrolysis of triacylglycerides and other fatty acid esters. This activity is highly increased at the interface between water and lipids, known as interfacial activation. In addition, some lipases also catalyze ester synthesis by esterification and transesterification in non-aqueous conditions (Schmid and Verger, 1998; Stergiou et al., 2013). They are widely used biocatalysts in various industries: food, pharmaceutical, cosmetic, and fine chemical industries because of their useful characteristics, such as catalytic properties, chemoselectivity, regioselectivity, enantioselectivity, stability in organic solvents, broad range of substrate specificity, and ability to function without cofactors (Joseph et al., 2008; Reetz, 2002). Although lipases are produced in most of the living organisms, microbial lipases have gained special attention because of their high productivity and diversity (Bigey et al., 2003). The efficiency of lipase production from microorganisms is much higher than those from animals and plants. Therefore, most lipases have been produced from microorganisms in the form of wild type cultivation or recombinant protein production for industrial uses. Industrial processes often require harsh reaction conditions, such as high or low temperature, acidic or ⁎
basic pH, high salt concentration, and high pressure. These conditions may reduce or inhibit the catalytic activity of lipases (Demirjian et al., 2001). In other words, industrial application of lipase is highly dependent on the catalytic properties of lipases and the environmental conditions of its application. Therefore, there is high demand to exploit new lipases that are tolerant and highly active in these harsh reaction conditions to broaden their applications in industrial processes. Recently, researchers have gained great interest in cold-active lipases because of their increased application in detergent formulation, food processing, and synthesis of fine chemicals, owing to advantages in terms of lower energy cost, prevention of microbial contamination and chemical side-reactions, and stabilization of fragile products (Gerday et al., 1997; Joseph et al., 2007; Marshall, 1997). However, many difficulties persist in commercializing the cold-active lipases. In the past decades, several cold-active lipases were identified from psychrotrophic and psychrophilic microorganisms in polar regions, with slow growth rates even at an optimal temperature around 5 °C (Choo et al., 1998; Feller et al., 1991a, 1991b; Suzuki et al., 2001). Although higher temperatures may facilitate faster cell growth of these microorganisms, lipase expression may be reduced or inactivated because of cell stress (Feller et al., 1994). To eliminate these problems, a recombinant coldactive lipase, which originated from psychrotrophic bacteria, was
Corresponding author at: School of Food science and Biotechnology, Kyungpook National University, Daegu 702-701, South Korea. E-mail address: [email protected] (H.-R. Kim).
http://dx.doi.org/10.1016/j.bcab.2017.05.008 Received 18 April 2017; Received in revised form 26 May 2017; Accepted 26 May 2017 Available online 29 May 2017 1878-8181/ © 2017 Elsevier Ltd. All rights reserved.
Biocatalysis and Agricultural Biotechnology 11 (2017) 19–25
J.-H. Bae et al.
produced in mesophilic bacteria, E. coli, but its expression conditions were very unstable (Gerday et al., 1997; Feller et al., 1990, 1991a, 1991b). Previously, we produced a cold-active lipase from the mesophilic microorganisms, expecting improved productivity and stability of coldactive lipase at room temperature, as compared to lipases from psychrotrophic and psychrophilic microorganisms (Kim et al., 2010). Several mesophilic yeasts from the ARS Culture Collection were screened for the production of extracellular cold-active lipases. P. lynferdii NRRL Y-7723 produced high amounts of cold-active lipase and was selected for further studies (Kim et al., 2010). Lipase production was optimized and its potential for industrial application was studied by purification and characterization (Bae et al., 2014; Park et al., 2013). In this study we tried to clone a lipase gene from P. lynferdii NRRL Y-7723 and produce a recombinant protein with cold activity. Consequently we identified a lipase gene encoding a coldactive lipase in the genome of P. lynferdii NRRL Y-7723. The gene was cloned into a bacterial expression vector, and the recombinant coldactive lipase was successfully produced and purified.
Table 1 Primers used for identification and cloning of lip1 gene. Primers
Sequences (5ʹ–3ʹ)a
wclip1F wclip1R wclip2F wclip2R pllip1F pllip1R pllip2F
TGATCGTTACTGGTCACTCATTAGG TCACAAGGCCATGCAATTCTAATA AGTTTCTGATGCTTTCTGTGTTGC CACAGACTGGGGAATTTATCATACG TTAGGATCCATGAAGATTTTCACACTTGCTAA ATTGTCGACTCATGGAAATGGCATTTCTG TTAGGATCCCTGGTTATTGGTGATAAAGATAAAG
a
Restriction enzyme sites are underlined.
Yeast extract, malt extract, peptone, and Luria-Bertani (LB) broth were purchased from BD Science (Franklin lakes, NJ, USA), and polymerase and agarose were purchased from Bioneer Co. (Daejeon, South Korea). Restriction enzymes were purchased from Takara Bio (Shiga, Japan). All other chemicals were purchased from Sigma (St Louis, MO, USA), unless mentioned otherwise.
represents high sequence homology with P. lynferdii. The presence of lip1 gene in P. lynferdii NRRL Y-7723 was confirmed using PCR with Taq polymerase, primers of wclip1F and wclip1R, and genomic DNA of P. lynferdii NRRL Y-7723 as template. To elucidate the full length of ORF sequence of lip1 in P. lynferdii NRRL Y-7723, PCR was also conducted with a set of primers wclip2F and wclip2R, whose sequences are located in 5′ or 3′ flanking regions (Table 1). PCR products were analyzed using agarose gel electrophoresis, and the DNA bands were extracted from the gel. They were cloned into pGEM-Teasy plasmid (Promega, Fitchburg, Wisconsin, USA), according to manufacturer's instructions, and the plasmids were transformed into E. coli DH5α. After propagation and preparation of the plasmids with a plasmid mini-prep kit (Macrogen, Seoul, Korea), inserts in each vector were sequenced with primers for T7 promoter and SP6 promoter using automated sequencing equipment. Blast and Clustal Omega were used for DNA sequence alignment, and FGENESH-M was used for prediction of the presence of introns in the genomic DNA.
2.2. Microorganisms and medium
2.5. Plasmid construction for the expression of recombinant Lip1
Pichia lynferdii NRRL Y-7723 was obtained from the Culture Collection of National Center for Agricultural Utilization Research (Peoria, USA). The cell stocks were stored at −70 °C until use in cryogenic tubes containing equal volume of glycerol and YM medium (1% glucose, 0.3% yeast extract, 0.3% malt extract, 0.5% peptone, w/ v). P. lynferdii was cultured in YM medium at 25 °C and 200 rpm for genomic DNA extraction. E. coli DH5α and E. coli BL21 (DE3) were used for plasmid manipulation and production of recombinant proteins, respectively. Both strains were cultured at 37 °C and 200 rpm in LB medium containing appropriate antibiotics.
For the subcloning of lip1, gene-specific primers were designed based on the ORF sequence of lip1 in P. lynferdii NRRL Y-7723, including restriction enzyme sites: BamHI for pllip1F and SalI for pllip1R (Table 1). PCR was performed to amplify the lip1 using pfu polymerase and genomic DNA as template. The PCR product and pET28a(+) were treated with restriction enzymes, BamHI and SalI, separately, according to the manufacturer's instructions. The digested fragments were ligated overnight with T4 DNA ligase (New England Biolabs, Ipswich, Massachusetts) at 16 °C. The DNA was transformed into E. coli DH5o, and the cells were grown on LB agar medium containing 50 μg/mL of kanamycin. The transformants harboring lip1 gene were confirmed with colony PCR and sequencing of the plasmids. The lip1m gene does not contain the nucleotide sequence of signaling peptide in its N terminal amino acid sequence to express the mature form of Lip1. The signaling peptide region was predicted with SignalP4.1, and subcloning was performed following same procedure as that in subcloning for full length of lip1 except the primer set, utilizing pllip2F and pllip1R (Table 1). The prepared plasmids were designated pET28a-pllip1 and pET28a-pllip1m.
2. Materials and methods 2.1. Materials
2.3. Genomic DNA extraction P. lynferdii NRRL Y-7723 in the stock was inoculated in a small volume of YM medium and incubated for 24 h at 25 °C and 200 rpm. The cells were harvested by centrifugation for 10 min at 5000×g, and the supernatant was removed. The cells were treated with 200 units of lyticase in sorbitol buffer (1 M sorbitol, 100 mM sodium EDTA, 14 mM β–mercaptoethanol) at 37 °C for 2 h to prepare spheroplasts. After centrifugation and removal of the buffer, proteinase K (QIAGEN, Hilden, Germany) was added and incubated overnight at 55 °C. The genomic DNA was extracted by serial treatments of equal volume of phenol:chloroform:isoamyl alcohol (25:24:1), chloroform: isoamyl alcohol (24:1), and chloroform. The sample was centrifuged at 12,000×g for 5 min, and the aqueous phase was transferred to a new tube in each step. The extracted DNA was further purified by ethanol precipitation and dissolved in TE buffer (10 mM Tris-HCl, 1 mM EDTA, pH 8.0).
2.6. Expression and purification of recombinant Lip1 pET28a(+), pET28a-pllip1, and pET28a-pllip1m were transformed into E. coli BL21 (DE3), and the transformants were confirmed using colony PCR. To produce recombinant enzymes, each colony of transformants was inoculated in a small volume of LB medium containing 50 μg/ml of kanamycin and incubated at 37 °C and 200 rpm for 12 h for seed culture. The seed culture (0.5%) was inoculated into fresh LB medium containing Kanamycin and the cultures were incubated at 37 °C and 200 rpm. After the optical density at 600 nm of the culture reached 0.6, the production of recombinant protein was induced by adding 0.1 mM of isopropyl β-D-1-thiogalactopyranoside (IPTG), and incubated at 37 °C and 200 rpm for 4 h. The cultured cells were
2.4. Genomic sequence analysis of Lip1 gene in P. lynferdii NRRL Y-7723 The primers for identification of lip1 gene in P. lynferdii were designed, based on a lipase gene sequence in Wickerhamomyces ciferrii NRRL Y-1031 (accession number in GenBank: CAIF01000224) that 20
Biocatalysis and Agricultural Biotechnology 11 (2017) 19–25
J.-H. Bae et al.
wise.
harvested by centrifugation at 6000 rpm and 4 °C for 10 min. The cells were lysed with sonication in lysis buffer (50 mM sodium phosphate (pH 7.4) containing 1% Triton X-100), and centrifuged at 16,500×g and 4 °C for 20 min. The supernatant was transferred to a new tube and used as a crude extract fraction. After washing the pellet with lysis buffer, inclusion bodies in the pellet were dissolved under denaturing conditions using 8 M urea buffer (50 mM sodium phosphate (pH 7.4) containing 8 M urea) for 1 h at room temperature. After centrifugation at 16,500×g and 4 °C for 10 min, the supernatant was used as an inclusion body fraction. The urea from inclusion body fractions was removed by stepwise reduction of urea concentration (6 M, 4 M, 3 M, 2 M, 1 M, and 0 M) in each dialysis step. The His-tagged recombinant lipase, His-Lip1m was purified using Ni-NTA agarose (Qiagen, Hilden, Germany), according to manufacturer's recommendation. Briefly HisLip1m was applied to a column packed with Ni-NTA agarose for purification. After binding, the column was washed with 50 mM imidazole buffer, and the recombinant protein was eluted with 300 mM imidazole buffer. SDS-PAGE was performed to confirm each expression and purification step, using 10% polyacrylamide gel.
3. Results 3.1. Identification and analysis of Lip1 gene encoding a secreted lipase in P. lynferdii NRRL Y-7723 To identify the lipase genes in P. lynferdii NRRL Y-7723, we used the genome sequences from the strain which was phylogenetically close to P. lynferdii NRRL Y-7723. The sequence analysis in BLASTN with partial sequences of 18 S and 26 S ribosomal RNA genes from P. lynferdii NRRL Y-7723 showed that Wickerhamomyces ciferrii was closely related to P. lynferdii NRRL Y-7723 with over 99% identities (data not shown). In addition, the draft genome sequence of W. ciferrii NRRL Y-1031 was already reported, and used to identify the lipase gene in this study (Schneider et al., 2012). Three putatively secreted lipases were found in the genome sequence of W. ciferrii NRRL Y-1031, and PCR analysis was used to identify lipase genes in the genome of P. lynferdii NRRL Y-7723, using several primers based on the sequences from W. ciferrii NRRL Y1031. PCR products corresponding to partial product of the genes were produced for all of the three lipases, but only one of them, designated lip1 in this study, produced the PCR product including the full length open reading frame (ORF). This gene was cloned into pGEM-Teasy vector and sequenced. The result confirmed that Lip1 belongs to lipase class 3, and no intron was included in the sequence. Thus, the ORF is composed of 1122 bp encoding a putative protein with 373 amino acids (Fig. 1). The predicted molecular mass and isoelectric point of the protein were 41.8 kDa and pH 5.82, respectively. BLASTP analysis revealed that Lip1 contained a Gly-X-Ser-X-Gly motif, a highly conserved pentapeptide residue of lipase, known as nucleophilic elbow, catalytic triad and flap/lid structure organizing active site of lipase, and N-terminal signaling sequence, 22 amino acids in length was also included according to Signal P prediction. The presence of these domains in Lip1 suggested that it was a putative secreted lipase. The ORF sequence was deposited in GenBank database (accession number; KR007642).
2.7. Lipase assay Lipase activity was measured using p-nitrophenyl butyrate (p-NPB) as a substrate, using a spectrophotometer (Winkler and Stuckmann, 1979). Assay solution consisted of 100 μL of 10 mM p-NPB dissolved in ethanol, 100 μL of enzyme solution, and 800 μL of 50 mM sodium phosphate buffer (pH 7.0). The assay was conducted by measuring the increase in absorbance at 410 nm, caused by the release of p-nitrophenol from p-NPB, for 2.5 min at 15 °C, unless mentioned otherwise. One unit of enzyme activity represents the amount of enzyme that liberates 1 nmole of p-nitrophenol from p-NPB per min. Bradford method was used to determine protein concentration, using bovine serum albumin as a standard protein (Bradford, 1976). Tributyrin agar assay was conducted to examine the hydrolysis of triglycerides. The agar plate consisting of 1.5% agar in 50 mM sodium phosphate buffer (pH 7.0) was prepared using a microwave. After cooling down to 50 °C, 1% of filter-sterilized tributyrin was added and emulsified by sonication. Paper discs soaked in samples were placed on the surface of tributyrin agar plate and incubated at 15 °C for 12 h. To confirm the lipolytic activity of recombinant proteins on triglyceride, the enzyme was reacted with 1 mM of triolein at 15 °C and 200 rpm for 2 h. The product was extracted with hexane and analyzed by TLC (Lanser et al., 2002). A two-step solvent system was used to develop the TLC plate. The first development was performed in solvent system 1 (benzene:ethyl ether:ethyl acetate:acetic acid, 80:10:10:1, v/v) up to half of the TLC. After completely drying the plate, the second development was conducted in solvent system 2 (hexane:ethyl ether:formic acid, 80:20:2, v/v/v) up to top of the plate. Each spot was visualized by spraying 50% sulfuric acid, followed by baking the plate at 100 °C.
3.2. Expression and purification of recombinant Lip1 The full length lip1 and N-terminal signaling sequence-deleted lip1, which produce His-tagged Lip1 (His-Lip1) and His-tagged Lip1m (HisLip1m), respectively, were cloned into pET28a(+) plasmid. Each plasmid was transformed into E. coli BL21 (DE3) and recombinant proteins were induced by adding 0.1 mM IPTG. SDS-PAGE revealed that the both types of Lip1 were expressed in the form of inclusion bodies, which were dissolved in a denaturing buffer containing urea. After removal of urea by dialysis, the lipase activities of the refolded His-Lip1 and His-Lip1m were 560 and 2800.5 units/mg protein at 15 °C, respectively (Fig. 2A). His-Lip1m showed five times higher lipase activity than that of His-Lip1 at low temperature. The result means that it is necessary to remove N-terminal signaling sequence for its full activity at low temperature. His-Lip1m was applied to a column packed with Ni-NTA agarose, successfully purified, as verified from SDS-PAGE (Fig. 2B) and used for further study.
2.8. Characterization of His-Lip1m All lipase assays were conducted by the aforementioned spectrophotometric method, varying each parameter for characterization. To investigate the effect of temperature on the His-Lip1m, lipase assay was performed in a temperature range from 5 °C to 45 °C with an interval of 5 °C. Thermal stability was determined by assay of the residual activity after pre-incubation of the enzyme at temperature from 5 °C to 50 °C. The residual lipase activity was measured after cooling to 15 °C. The effect of pH on His-Lip1m was determined using 50 mM sodium phosphate buffer range from pH 6.0 to pH 8.0. Lipase assay was performed at 15 °C and pH 7.0 using varied concentrations of p-NPB (0.1–1.0 mM) as a substrate, and the enzyme kinetic values were calculated from the Lineweaver-Burk plot. All experiments were performed in duplicate and the data plotted were average values of the duplicate. Error ranges were within 10%, unless mentioned other-
3.3. Confirmation of hydrolytic activity for triacylglyceride Lipases catalyze hydrolysis of ester bonds in water-insoluble substrates containing medium to long chain fatty acyl groups, which esterase cannot hydrolyze. Generally, p-NPB was used as a substrate to determine the activity of lipase. However, this substrate was also used as a substrate for esterase. Therefore, it is necessary to confirm the practical hydrolytic activity of the recombinant lipase for triacylglycerides. For this purpose, tributyrin agar assay, and TLC analysis of the product from the reaction with triolein were used. Tributyrin agar plate 21
Biocatalysis and Agricultural Biotechnology 11 (2017) 19–25
J.-H. Bae et al.
Fig. 1. The ORF sequence of lip1 from P. lynferdii NRRL Y-7723. The N-terminal signaling sequence and flap/lid of active site are underlined with a solid line and a dashed line, respectively. The catalytic triad and GXSXG motif are marked with asterisks and a box, respectively.
showed the highest activity at pH 7.0 with a relative activity of 15% at pH 6.0 and 65% at pH 8.0 (Fig. 6).
consisting of 1% tributyrin, 1.5% agar in 50 mM sodium phosphate (pH 7.0) was prepared, and His-Lip1m and the sodium phosphate buffer were loaded on the plate. After incubation at 15 °C for 2 h, only HisLip1m produced a clear zone around the loading spot (Fig. 3A). Moreover, to identify the reaction product, TLC analysis was conducted with the extracted products from the reaction of His-Lip1m and triolein. After reaction, free fatty acid, monoolein, and diolein were newly produced (Fig. 3B). These results proved that His-Lip1m possessed the hydrolytic activity for triacylglycerol.
3.5. Kinetic analysis For determination of the kinetic values, Km and Vmax, His-Lip1m was assayed at 15 °C using p-NPB as a substrate ranging from 0.1 mM to 1.0 mM, following the standard assay conditions. Lineweaver-Burk plot was used to calculate Km and Vmax values. Km and Vmax values of the purified lipase were 0.48 mM and 2893.2 μmol min−1 mg−1, respectively.
3.4. Effect of temperature and pH on His-Lip1m
4. Discussion
The effect of temperature on the lipase activity of purified HisLip1m was studied at variable temperatures from 5 °C to 45 °C. HisLip1m showed a broad range of optimal temperatures between 5 °C and 25 °C, with over 90% activity, relative to the highest activity at 20 °C, and 82% even at 30 °C. The activity was inhibited to about half at 35 °C and completely inhibited over 40 °C (Fig. 4). In the thermal stability study, His-Lip1m exhibited stable activity for up to 1 h below 30 °C. However, the activity of His-Lip1m was reduced to the half after incubation for 1 h at 40 °C, and was inactivated completely in 10 min at 50 °C (Fig. 5). Consequently, His-Lip1m represented the typical characteristics of cold-active lipases, high activity at low temperature and low thermostability. Optimal pH of His-Lip1m was tested in the range of pH 6.0–8.0 with 50 mM sodium phosphate buffer at 15 °C. The lipase
This study reports a novel gene encoding a putative extracellular cold-active lipase from P. lynferdii NRRL Y-7723. The strain was proven to produce extracellular cold-active lipase in our previous studies (Bae et al., 2014; Kim et al., 2010; Park et al., 2013). For the industrial application of the enzyme, it is necessary to produce recombinant proteins by gene cloning because it makes possible to achieve mass production, cost reduction and stable production. Therefore, the purpose of this study is the production of recombinant cold-active lipase from P. lynferdii to accomplish industrial application of the enzyme. The genomic information of phylogenetically close strains was used to identify cold-active lipase genes from P. lynferdii. Search for the 22
Biocatalysis and Agricultural Biotechnology 11 (2017) 19–25
J.-H. Bae et al.
Fig. 2. Cloning, expression, and purification of recombinant lip1 E. coli BL21 (DE3). Full length (lip1) or signaling sequence-removed (lip1m) ORF was cloned into pET28a(+). (A) Relative lipase activity of the recombinant proteins. The lipase assay was performed at 15 °C to confirm cold-activity. (B) Expression and purification of recombinant protein, His-Lip1 and His-Lip1m. Lane 1: size marker, lane 2: crude extract of cells expressing His, lane 3: solubilized inclusion body of cells expressing His (in urea buffer), lane 4: crude extract of cells expressing His-Lip1, lane 5: solubilized inclusion body of cells expressing His-Lip1 (in urea buffer), lane 6: crude extract of cells expressing His-Lip1m, lane 7: solubilized inclusion body of cells expressing His-Lip1m (in urea buffer), and lane 8: purified His-Lip1m after removal of urea by dialysis.
Fig. 3. Confirmation of lipolytic activity of His-Lip1m for triacylglycerol. (A) Tributyrin agar plate assay. (B) TLC analysis of product from reactions of triolein with His-Lip1m. Lane 1: triolein, lane 2: 1,2-diolein, lane 3: 1,3-diolein, lane 4: monoolein, lane 5: oleic acid, and lane 6: triolein incubated with His-Lip1m.
homology of partial sequences of ribosomal RNA genes from P. lynferdii NRRL Y-7723 in BLASTN revealed that Wickerhamomyces edaphicus, Wickerhamomyces ciferrii, and Wickerhamomyces anomala have high sequence homology to those of P. lynferdii NRRL Y-7723. According to a recent publication, Pichia ciferrii, Pichia anomala, and Pichia lynferdii were reassigned to genus Wickerhamomyces (Kurtzman et al., 2008). In the search for extracellular lipase from the draft genome sequence of W. ciferrii NRRL Y-1031, three putative extracellular lipase genes were detected and the genes with high sequence homology to the three genes were identified in the genomic DNA of P. lynferdii NRRL Y7723 using PCR method. However, the full length ORF was revealed in only one of them, and the gene was designated by lip1. The predicted protein expressed from the gene is composed of 373 amino acids representing 41.8 kDa. The Lip1 included typical consensus pentapeptide residue (Gly-X-Ser-X-Gly) in common lipases and other structural sequences forming active site of lipase such as a catalytic triad and a flap/lid structure. In addition, the Lip1 has N-terminal signaling peptide comprised of 22 amino acids. The alignment of amino acid sequence of Lip1 showed high similarity with several putative or real triglyceride lipases from Wickerhamomyces species including W. ciferrii (28–77%) and W. anomalous (27–55%) and other species such as Yarrowia lipolytica (27–31%) and Candida deformans (30–33%) (Schneider et al., 2012; Song et al., 2006; Bigey et al., 2003). Therefore, all of the results in analysis of amino acid sequence of Lip1 proposed Lip1 is putative extracellular lipase. Cold-activity of Lip1 was well elucidated.
Fig. 4. Effect of temperature on Lip1m activity. Lipase activity was determined at the given temperatures.
The attempts to express the recombinant Lip1 in a yeast expression system were unsuccessful under variable culture conditions. As an alternative method, the E. coli expression system was used in this study. This system has been successfully used in the production of several recombinant enzymes from eukaryotes (Barnes et al., 1991; Brinkmann et al., 1989; Morton and Potter, 2000). The production of active recombinant enzymes in E. coli expression system has many advantages in their industrial production. The yields can be improved by inducing protein overexpression, combined with a much higher cell growth of E. 23
Biocatalysis and Agricultural Biotechnology 11 (2017) 19–25
J.-H. Bae et al.
et al., 2011). The activity was inhibited to half after incubation for 1 h at 40 °C and completely inhibited in 10 min at 50 °C. Consequently, HisLip1m exhibited typical thermal properties of the cold-active lipase representing high activity at low temperature and low thermal stability. The optimal pH of His-Lip1m was different from that of the purified lipase from P. lynferdii NRRL Y-7723 (Bae et al., 2014). While the optimal pH values of the purified lipase from P. lynferdii NRRL Y-7723 were 7.5–8.0, depending on the assay temperatures, His-Lip1m showed the highest activity at pH 7.0. This discrepancy was assumed to be caused by the presence of isoenzymes of lipase that exhibited different optimal temperature and pH. The Km value of His-Lip1m was similar to the value of Candida antarctica lipase B, a commercially produced lipase (Liu et al., 2012). Furthermore, the values are in the range (10−1–10−5 M) of Km values of most commercial lipases (Florczak et al., 2013). Therefore, the produced recombinant lipase, His-Lip1m, showed a potential for industrial applications. In conclusion, a novel gene encoding an extracellular cold-active lipase from P. lynferdii NRRL Y-7723 was cloned and a recombinant lipase from P. lynferdii NRRL Y-7723 was successfully expressed in its active form in mesophilic bacteria, E. coli BL21 (DE3). The recombinant lipase exhibited typical properties of the cold-active lipases, showing similar dependency on temperatures as that of partially purified lipase from the culture of P. lynferdii NRRL Y-7723. Thus, this study showed that recombinant Lip1m from P. lynferdii NRRL Y-7723 could be applied efficiently and economically to industrial processes that require low temperature reactions.
Fig. 5. Thermal stability of Lip1m. Lip1m was incubated at 5 °C (•), 10 °C (○), 20 °C (▼), 30 °C (△), 40 °C (■), and 50 °C (□). Residual lipase activities at a given time at varied temperature were determined at 15 °C.
Notes The authors declare no conflict of interest and this article does not contain any studies with human participants or animals performed by any of the authors. Acknowledgement This research was supported by the Basic Science Research Program through the National Research Foundation of Korea (NRF) funded by the Ministry of Education, Science and Technology (2010-0023701).
Fig. 6. Effect of pH on the activity of Lip1m.
coli than those of yeast, insect, and mammalian cells. Moreover, the purification step can be simplified by tagging fusion peptides (Morton and Potter, 2000). The two types of recombinant lipases from P. lynferdii NRRL Y-7723 were successfully expressed in their active forms in the E. coli BL21 (DE3). One of them includes N-terminal signaling sequence (His-Lip1) and the other form does not (His-Lip1m). HisLip1m exhibited five times higher activity than that of His-Lip1 at 15 °C. This means that the maturation of Lip1, the cleavage of Nterminal signaling sequence, is a mandatory requirement for its full catalytic activity at low temperature. Moreover, it was confirmed that His-Lip1m can hydrolyze triacylglyceride at 15 °C in the tributyrin agar assay and product analysis in the enzymatic hydrolysis of triolein. Thus, the results exhibited that Lip1 is a triacylglycerol lipase. The optimal temperature of His-Lip1m was 20 °C and the activity was sustained over 90% between 5 to 25 °C. This was in accordance with the results from partially purified cold-active lipase from Pichia lynferdii NRRL Y-7723 (Bae et al., 2014). Both of them exhibited the same range of optimal temperature between 5 °C and 25 °C, while most of the cold-active lipases reported so far showed relatively high optimal temperatures and over 30% activity at low temperatures from 5 °C to 20 °C (Jeon et al., 2009; Park et al., 2009; Zhang et al., 2007). For example, the recombinant lipases from Psychrobacter sp. 7195 and Pseudomonas sp. 7323 showed 35% and 37% of lipase activities at 10 °C, respectively, compared to their optimal activities at 30 °C. On the contrary, His-Lip1m sustained its activity over 90% at 10 °C. Therefore, His-Lip1m was proven as one of the most highly active lipase at low temperature. Compared to other cold-active lipases, the thermal stability of His-Lip1m was relatively low (Zhang et al., 2007; Lan
References Bae, J.H., Kwon, M.H., Kim, I.H., Hou, C.T., Kim, H.R., 2014. Purification and characterization of a cold-active lipase from Pichia lynferdii Y-7723: pH-dependant activity deviation. Biotechnol. Bioprocess Eng. 19, 851–857. Barnes, H.J., Arlotto, M.P., Waterman, M.R., 1991. Expression and enzymatic activity of recombinant cytochrome P450 17 alpha-hydroxylase in Escherichia coli. Proc. Natl. Acad. Sci. USA 88, 5597–5601. Bigey, F., Tuery, K., Bougard, D., Nicaud, J.M., Moulin, G., 2003. Identification of a triacylglycerol lipase gene family in Candida deformans: molecular cloning and functional expression. Yeast 20, 233–248. Bradford, M.M., 1976. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72, 248–254. Brinkmann, U., Mattes, R.E., Buckel, P., 1989. High-level expression of recombinant genes in Escherichia coli is dependent on the availability of the dnaY gene product. Gene 85, 109–114. Choo, D.W., Kurihara, T., Suzuki, T., Soda, K., Esaki, N.A., 1998. Cold-adapted lipase of an Alaskan psychrotroph, Pseudomonas sp. strain B11-1: gene cloning and enzyme purification and characterization. Appl. Environ. Microb. 64, 486–491. Demirjian, D.C., Moris-Varas, F., Cassidy, C.S., 2001. Enzymes from extremophiles. Curr. Opin. Chem. Biol. 5, 144–151. Feller, G., Thiry, M., Arpigny, J.L., Mergeay, M., Gerday, C., 1990. Lipases from psychrotrophic Antarctic bacteria. FEMS Microbiol. Lett. 66, 239–243. Feller, G., Thiry, M., Arpigny, J.L., Gerday, C., 1991a. Cloning and expression in Escherichia coli of three lipase-encoding genes from the psychrotrophic antarctic strain Moraxella TA144. Gene 102, 111–115. Feller, G., Thiry, M., Gerday, C., 1991b. Nucleotide sequence of the lipase gene lip2 from the Antarctic psychrotroph Moraxella TA 144 and site-specific mutagenesis of the conserved serine and histidine residues. DNA Cell Biol. 10, 381–388. Feller, G., Narinx, E., Arpigny, J.L., Zekhnini, Z., Swings, J., Gerday, C., 1994. Temperature dependence of growth, enzyme secretion and activity of psychrophilic Antarctic bacteria. Appl. Microbiol. Biot. 41, 477–479. Florczak, T., Daroch, M., Wilkinson, M.C., Bialkowska, A., Bates, A.D., Turkiewicz, M.,
24
Biocatalysis and Agricultural Biotechnology 11 (2017) 19–25
J.-H. Bae et al.
Morton, C.L., Potter, P.M., 2000. Comparison of Escherichia coli, Saccharomyces cerevisiae, Pichia pastoris, Spodoptera frugiperda, and COS7 cells for recombinant gene expression. Mol. Biotechnol. 16, 193–202. Park, I.H., Kim, S.H., Lee, Y.S., Lee, S.C., Zhou, Y., Kim, C.M., Ahn, S.C., Choi, Y.L., 2009. Gene cloning, purification, and characterization of a cold-adapted lipase produced by Acinetobacter baumannii BD5. J. Microbiol. Biotechnol. 19, 128–135. Park, S.Y., Kim, J.Y., Bae, J.H., Hou, C.T., Kim, H.R., 2013. Optimization of culture conditions for production of a novel cold-active lipase from Pichia lynferdii NRRL Y7723. J. Agr. Food Chem. 61, 882–886. Reetz, M.T., 2002. Lipases as practical biocatalysts. Curr. Opin. Chem. Biol. 6, 145–150. Schmid, R.D., Verger, R., 1998. Lipases: interfacial enzymes with attractive applications. Angew. Chem. Int. Ed. 37, 1608–1633. Schneider, J., Andrea, H., Blom, J., Jaenicke, S., Ruckert, C., Schorsch, C., Szczepanowski, R., Farwick, M., Goesmann, A., Puhler, A., Schaffer, S., Tauch, A., Kohler, T., Brinkrolf, K., 2012. Draft genome sequence of Wickerhamomyces ciferrii NRRL Y-1031 F-60-10. Eukaryot. Cell 11, 1582–1583. Song, H.T., Jiang, Z.B., Ma, L.X., 2006. Expression and purification of two lipases from Yarrowia lipolytica AS 2.1216. Protein Expr. Purif. 47, 393–397. Stergiou, P.Y., Foukis, A., Filippou, M., Koukouritaki, M., Parapouli, M., Theodorou, L.G., Hatziloukas, E., Afendra, A., Pandey, A., Papamichael, E.M., 2013. Advances in lipase-catalyzed esterification reactions. Biotechnol. Adv. 31, 1846–1859. Suzuki, T., Nakayama, T., Kurihara, T., Nishino, T., Esaki, N., 2001. Cold-active lipolytic activity of psychrotrophic Acinetobacter sp. strain no. 6. J. Biosci. Bioeng. 92, 144–148. Winkler, U.K., Stuckmann, M., 1979. Glycogen, hyaluronate, and some other polysaccharides greatly enhance the formation of exolipase by Serratia marcescens. J. Bacteriol. 138, 663–670. Zhang, J., Lin, S., Zeng, R., 2007. Cloning, expression, and characterization of a coldadapted lipase gene from an Antarctic deep-sea psychrotrophic bacterium Psychrobacter sp. 7195. J. Microbiol. Biotechnol. 17, 604–610.
Iwanejko, L.A., 2013. Purification, characterisation and expression in Saccharomyces cerevisiae of LipG7 an enantioselective, cold-adapted lipase from the Antarctic filamentous fungus Geomyces sp. P7 with unusual thermostability characteristics. Enzym. Microb. Technol. 53, 18–24. Gerday, C., Aittaleb, M., Arpigny, J.L., Baise, E., Chessa, J.P., Garsoux, G., Petrescu, I., Feller, G., 1997. Psychrophilic enzymes: a thermodynamic challenge. BBA-Protein Struct. Mol. 1342, 119–131. Jeon, J.H., Kim, J.T., Kim, Y.J., Kim, H.K., Lee, H.S., Kang, S.G., Kim, S.J., Lee, J.H., 2009. Cloning and characterization of a new cold-active lipase from a deep-sea sediment metagenome. Appl. Microbiol. Biot. 81, 865–874. Joseph, B., Ramteke, P.W., Thomas, G., Shrivastava, N., 2007. Standard review coldactive microbial lipases: a versatile tool for industrial applications. Biotechnol. Mol. Biol. Rev. 2, 39–48. Joseph, B., Ramteke, P.W., Thomas, G., 2008. Cold active microbial lipases: some hot issues and recent developments. Biotechnol. Adv. 26, 457–470. Kim, H.R., Kim, I.H, Hou, C.T., Kwon, K.I, Shin, B.S., 2010. Production of a novel coldactive lipase from Pichia lynferdii Y-7723. J. Agric. Food Chem. 58 (2), 1322–1326. http://dx.doi.org/10.1021/jf903430t. Kurtzman, C.P., Robnett, C.J., Basehoar-Powers, E., 2008. Phylogenetic relationships among species of Pichia, Issatchenkia and Williopsis determined from multigene sequence analysis, and the proposal of Barnettozyma gen. nov., Lindnera gen. nov. and Wickerhamomyces gen. nov. FEMS Yeast Res. 8, 939–954. Lan, D.M., Yang, N., Wang, W.K., Shen, Y.F., Yang, B., Wang, Y.H., 2011. A novel coldactive lipase from Candida albicans: cloning, expression and characterization of the recombinant enzyme. Int. J. Mol. Sci. 12, 3950–3965. Lanser, A.C., Manthey, L.K., Hou, C.T., 2002. Regioselectivity of new bacterial lipases determined by hydrolysis of triolein. Curr. Microbiol. 44, 336–340. Liu, Z.Q., Zheng, X.B., Zhang, S.P., Zheng, Y.G., 2012. Cloning, expression and characterization of a lipase gene from the Candida antarctica ZJB09193 and its application in biosynthesis of vitamin A esters. Microbiol. Res. 167, 452–460. Marshall, C.J., 1997. Cold-adapted enzymes. Trends Biotechnol. 15, 359–364.
25
Contents lists available at ScienceDirect
Biocatalysis and Agricultural Biotechnology journal homepage: www.elsevier.com/locate/bab
Molecular cloning and characterization of a novel cold-active lipase from Pichia lynferdii NRRL Y-7723 Jae-Han Baea, In-Hwan Kimb, Ki-Teak Leec, Ching T. Houd, Hak-Ryul Kima,e,
MARK
⁎
a
School of Food Science and Biotechnology, Kyungpook National University, Daegu, South Korea Department of Food and Nutrition, Korea University, Seoul, South Korea c Department of Food Science and Technology, Chungnam National University, Daejeon, South Korea d Renewable Product Technology Research Unit, National Center for Agricultural Utilization Research, ARS, USDA, Peoria, IL, USA e Institute of Agricultural Science & Technology, Kyungpook National University, Daegu, South Korea b
A R T I C L E I N F O
A B S T R A C T
Keywords: Lipase Cold-active Cloning Pichia lynferdii
Lipase is one of the widely used biocatalysts, which is well studied for its application in industrial production. Recently, lipases with special characteristics such as thermo-stability, alkaline-, acidic nature, and cold-activity, have gained attention for effective applications in specific purposes. Previously, Pichia lynferdii NRRL Y-7723 was reported to produce high amounts of extracellular cold-active lipase (Kim et al., 2010). In this study, we report the identification of lip1 gene that encodes an extracellular cold-active lipase from P. lynferdii NRRL Y7723. The open reading frame of the gene consisted of 1122 bp of nucleotides that encoded a protein with 373 amino acids. The deduced molecular weight and isoelectric point were 41.8 kDa and pH 5.82, respectively. The lip1 gene was cloned into a bacterial expression vector, and the recombinant lipase was successfully expressed and purified. Several parameters of the recombinant lipase were analyzed, and Lip1 showed high activity at low temperature.
1. Introduction Lipases (triacylglycerol acylhydrolase, E.C.3.1.1.3) are enzymes that catalyze hydrolysis of triacylglycerides and other fatty acid esters. This activity is highly increased at the interface between water and lipids, known as interfacial activation. In addition, some lipases also catalyze ester synthesis by esterification and transesterification in non-aqueous conditions (Schmid and Verger, 1998; Stergiou et al., 2013). They are widely used biocatalysts in various industries: food, pharmaceutical, cosmetic, and fine chemical industries because of their useful characteristics, such as catalytic properties, chemoselectivity, regioselectivity, enantioselectivity, stability in organic solvents, broad range of substrate specificity, and ability to function without cofactors (Joseph et al., 2008; Reetz, 2002). Although lipases are produced in most of the living organisms, microbial lipases have gained special attention because of their high productivity and diversity (Bigey et al., 2003). The efficiency of lipase production from microorganisms is much higher than those from animals and plants. Therefore, most lipases have been produced from microorganisms in the form of wild type cultivation or recombinant protein production for industrial uses. Industrial processes often require harsh reaction conditions, such as high or low temperature, acidic or ⁎
basic pH, high salt concentration, and high pressure. These conditions may reduce or inhibit the catalytic activity of lipases (Demirjian et al., 2001). In other words, industrial application of lipase is highly dependent on the catalytic properties of lipases and the environmental conditions of its application. Therefore, there is high demand to exploit new lipases that are tolerant and highly active in these harsh reaction conditions to broaden their applications in industrial processes. Recently, researchers have gained great interest in cold-active lipases because of their increased application in detergent formulation, food processing, and synthesis of fine chemicals, owing to advantages in terms of lower energy cost, prevention of microbial contamination and chemical side-reactions, and stabilization of fragile products (Gerday et al., 1997; Joseph et al., 2007; Marshall, 1997). However, many difficulties persist in commercializing the cold-active lipases. In the past decades, several cold-active lipases were identified from psychrotrophic and psychrophilic microorganisms in polar regions, with slow growth rates even at an optimal temperature around 5 °C (Choo et al., 1998; Feller et al., 1991a, 1991b; Suzuki et al., 2001). Although higher temperatures may facilitate faster cell growth of these microorganisms, lipase expression may be reduced or inactivated because of cell stress (Feller et al., 1994). To eliminate these problems, a recombinant coldactive lipase, which originated from psychrotrophic bacteria, was
Corresponding author at: School of Food science and Biotechnology, Kyungpook National University, Daegu 702-701, South Korea. E-mail address: [email protected] (H.-R. Kim).
http://dx.doi.org/10.1016/j.bcab.2017.05.008 Received 18 April 2017; Received in revised form 26 May 2017; Accepted 26 May 2017 Available online 29 May 2017 1878-8181/ © 2017 Elsevier Ltd. All rights reserved.
Biocatalysis and Agricultural Biotechnology 11 (2017) 19–25
J.-H. Bae et al.
produced in mesophilic bacteria, E. coli, but its expression conditions were very unstable (Gerday et al., 1997; Feller et al., 1990, 1991a, 1991b). Previously, we produced a cold-active lipase from the mesophilic microorganisms, expecting improved productivity and stability of coldactive lipase at room temperature, as compared to lipases from psychrotrophic and psychrophilic microorganisms (Kim et al., 2010). Several mesophilic yeasts from the ARS Culture Collection were screened for the production of extracellular cold-active lipases. P. lynferdii NRRL Y-7723 produced high amounts of cold-active lipase and was selected for further studies (Kim et al., 2010). Lipase production was optimized and its potential for industrial application was studied by purification and characterization (Bae et al., 2014; Park et al., 2013). In this study we tried to clone a lipase gene from P. lynferdii NRRL Y-7723 and produce a recombinant protein with cold activity. Consequently we identified a lipase gene encoding a coldactive lipase in the genome of P. lynferdii NRRL Y-7723. The gene was cloned into a bacterial expression vector, and the recombinant coldactive lipase was successfully produced and purified.
Table 1 Primers used for identification and cloning of lip1 gene. Primers
Sequences (5ʹ–3ʹ)a
wclip1F wclip1R wclip2F wclip2R pllip1F pllip1R pllip2F
TGATCGTTACTGGTCACTCATTAGG TCACAAGGCCATGCAATTCTAATA AGTTTCTGATGCTTTCTGTGTTGC CACAGACTGGGGAATTTATCATACG TTAGGATCCATGAAGATTTTCACACTTGCTAA ATTGTCGACTCATGGAAATGGCATTTCTG TTAGGATCCCTGGTTATTGGTGATAAAGATAAAG
a
Restriction enzyme sites are underlined.
Yeast extract, malt extract, peptone, and Luria-Bertani (LB) broth were purchased from BD Science (Franklin lakes, NJ, USA), and polymerase and agarose were purchased from Bioneer Co. (Daejeon, South Korea). Restriction enzymes were purchased from Takara Bio (Shiga, Japan). All other chemicals were purchased from Sigma (St Louis, MO, USA), unless mentioned otherwise.
represents high sequence homology with P. lynferdii. The presence of lip1 gene in P. lynferdii NRRL Y-7723 was confirmed using PCR with Taq polymerase, primers of wclip1F and wclip1R, and genomic DNA of P. lynferdii NRRL Y-7723 as template. To elucidate the full length of ORF sequence of lip1 in P. lynferdii NRRL Y-7723, PCR was also conducted with a set of primers wclip2F and wclip2R, whose sequences are located in 5′ or 3′ flanking regions (Table 1). PCR products were analyzed using agarose gel electrophoresis, and the DNA bands were extracted from the gel. They were cloned into pGEM-Teasy plasmid (Promega, Fitchburg, Wisconsin, USA), according to manufacturer's instructions, and the plasmids were transformed into E. coli DH5α. After propagation and preparation of the plasmids with a plasmid mini-prep kit (Macrogen, Seoul, Korea), inserts in each vector were sequenced with primers for T7 promoter and SP6 promoter using automated sequencing equipment. Blast and Clustal Omega were used for DNA sequence alignment, and FGENESH-M was used for prediction of the presence of introns in the genomic DNA.
2.2. Microorganisms and medium
2.5. Plasmid construction for the expression of recombinant Lip1
Pichia lynferdii NRRL Y-7723 was obtained from the Culture Collection of National Center for Agricultural Utilization Research (Peoria, USA). The cell stocks were stored at −70 °C until use in cryogenic tubes containing equal volume of glycerol and YM medium (1% glucose, 0.3% yeast extract, 0.3% malt extract, 0.5% peptone, w/ v). P. lynferdii was cultured in YM medium at 25 °C and 200 rpm for genomic DNA extraction. E. coli DH5α and E. coli BL21 (DE3) were used for plasmid manipulation and production of recombinant proteins, respectively. Both strains were cultured at 37 °C and 200 rpm in LB medium containing appropriate antibiotics.
For the subcloning of lip1, gene-specific primers were designed based on the ORF sequence of lip1 in P. lynferdii NRRL Y-7723, including restriction enzyme sites: BamHI for pllip1F and SalI for pllip1R (Table 1). PCR was performed to amplify the lip1 using pfu polymerase and genomic DNA as template. The PCR product and pET28a(+) were treated with restriction enzymes, BamHI and SalI, separately, according to the manufacturer's instructions. The digested fragments were ligated overnight with T4 DNA ligase (New England Biolabs, Ipswich, Massachusetts) at 16 °C. The DNA was transformed into E. coli DH5o, and the cells were grown on LB agar medium containing 50 μg/mL of kanamycin. The transformants harboring lip1 gene were confirmed with colony PCR and sequencing of the plasmids. The lip1m gene does not contain the nucleotide sequence of signaling peptide in its N terminal amino acid sequence to express the mature form of Lip1. The signaling peptide region was predicted with SignalP4.1, and subcloning was performed following same procedure as that in subcloning for full length of lip1 except the primer set, utilizing pllip2F and pllip1R (Table 1). The prepared plasmids were designated pET28a-pllip1 and pET28a-pllip1m.
2. Materials and methods 2.1. Materials
2.3. Genomic DNA extraction P. lynferdii NRRL Y-7723 in the stock was inoculated in a small volume of YM medium and incubated for 24 h at 25 °C and 200 rpm. The cells were harvested by centrifugation for 10 min at 5000×g, and the supernatant was removed. The cells were treated with 200 units of lyticase in sorbitol buffer (1 M sorbitol, 100 mM sodium EDTA, 14 mM β–mercaptoethanol) at 37 °C for 2 h to prepare spheroplasts. After centrifugation and removal of the buffer, proteinase K (QIAGEN, Hilden, Germany) was added and incubated overnight at 55 °C. The genomic DNA was extracted by serial treatments of equal volume of phenol:chloroform:isoamyl alcohol (25:24:1), chloroform: isoamyl alcohol (24:1), and chloroform. The sample was centrifuged at 12,000×g for 5 min, and the aqueous phase was transferred to a new tube in each step. The extracted DNA was further purified by ethanol precipitation and dissolved in TE buffer (10 mM Tris-HCl, 1 mM EDTA, pH 8.0).
2.6. Expression and purification of recombinant Lip1 pET28a(+), pET28a-pllip1, and pET28a-pllip1m were transformed into E. coli BL21 (DE3), and the transformants were confirmed using colony PCR. To produce recombinant enzymes, each colony of transformants was inoculated in a small volume of LB medium containing 50 μg/ml of kanamycin and incubated at 37 °C and 200 rpm for 12 h for seed culture. The seed culture (0.5%) was inoculated into fresh LB medium containing Kanamycin and the cultures were incubated at 37 °C and 200 rpm. After the optical density at 600 nm of the culture reached 0.6, the production of recombinant protein was induced by adding 0.1 mM of isopropyl β-D-1-thiogalactopyranoside (IPTG), and incubated at 37 °C and 200 rpm for 4 h. The cultured cells were
2.4. Genomic sequence analysis of Lip1 gene in P. lynferdii NRRL Y-7723 The primers for identification of lip1 gene in P. lynferdii were designed, based on a lipase gene sequence in Wickerhamomyces ciferrii NRRL Y-1031 (accession number in GenBank: CAIF01000224) that 20
Biocatalysis and Agricultural Biotechnology 11 (2017) 19–25
J.-H. Bae et al.
wise.
harvested by centrifugation at 6000 rpm and 4 °C for 10 min. The cells were lysed with sonication in lysis buffer (50 mM sodium phosphate (pH 7.4) containing 1% Triton X-100), and centrifuged at 16,500×g and 4 °C for 20 min. The supernatant was transferred to a new tube and used as a crude extract fraction. After washing the pellet with lysis buffer, inclusion bodies in the pellet were dissolved under denaturing conditions using 8 M urea buffer (50 mM sodium phosphate (pH 7.4) containing 8 M urea) for 1 h at room temperature. After centrifugation at 16,500×g and 4 °C for 10 min, the supernatant was used as an inclusion body fraction. The urea from inclusion body fractions was removed by stepwise reduction of urea concentration (6 M, 4 M, 3 M, 2 M, 1 M, and 0 M) in each dialysis step. The His-tagged recombinant lipase, His-Lip1m was purified using Ni-NTA agarose (Qiagen, Hilden, Germany), according to manufacturer's recommendation. Briefly HisLip1m was applied to a column packed with Ni-NTA agarose for purification. After binding, the column was washed with 50 mM imidazole buffer, and the recombinant protein was eluted with 300 mM imidazole buffer. SDS-PAGE was performed to confirm each expression and purification step, using 10% polyacrylamide gel.
3. Results 3.1. Identification and analysis of Lip1 gene encoding a secreted lipase in P. lynferdii NRRL Y-7723 To identify the lipase genes in P. lynferdii NRRL Y-7723, we used the genome sequences from the strain which was phylogenetically close to P. lynferdii NRRL Y-7723. The sequence analysis in BLASTN with partial sequences of 18 S and 26 S ribosomal RNA genes from P. lynferdii NRRL Y-7723 showed that Wickerhamomyces ciferrii was closely related to P. lynferdii NRRL Y-7723 with over 99% identities (data not shown). In addition, the draft genome sequence of W. ciferrii NRRL Y-1031 was already reported, and used to identify the lipase gene in this study (Schneider et al., 2012). Three putatively secreted lipases were found in the genome sequence of W. ciferrii NRRL Y-1031, and PCR analysis was used to identify lipase genes in the genome of P. lynferdii NRRL Y-7723, using several primers based on the sequences from W. ciferrii NRRL Y1031. PCR products corresponding to partial product of the genes were produced for all of the three lipases, but only one of them, designated lip1 in this study, produced the PCR product including the full length open reading frame (ORF). This gene was cloned into pGEM-Teasy vector and sequenced. The result confirmed that Lip1 belongs to lipase class 3, and no intron was included in the sequence. Thus, the ORF is composed of 1122 bp encoding a putative protein with 373 amino acids (Fig. 1). The predicted molecular mass and isoelectric point of the protein were 41.8 kDa and pH 5.82, respectively. BLASTP analysis revealed that Lip1 contained a Gly-X-Ser-X-Gly motif, a highly conserved pentapeptide residue of lipase, known as nucleophilic elbow, catalytic triad and flap/lid structure organizing active site of lipase, and N-terminal signaling sequence, 22 amino acids in length was also included according to Signal P prediction. The presence of these domains in Lip1 suggested that it was a putative secreted lipase. The ORF sequence was deposited in GenBank database (accession number; KR007642).
2.7. Lipase assay Lipase activity was measured using p-nitrophenyl butyrate (p-NPB) as a substrate, using a spectrophotometer (Winkler and Stuckmann, 1979). Assay solution consisted of 100 μL of 10 mM p-NPB dissolved in ethanol, 100 μL of enzyme solution, and 800 μL of 50 mM sodium phosphate buffer (pH 7.0). The assay was conducted by measuring the increase in absorbance at 410 nm, caused by the release of p-nitrophenol from p-NPB, for 2.5 min at 15 °C, unless mentioned otherwise. One unit of enzyme activity represents the amount of enzyme that liberates 1 nmole of p-nitrophenol from p-NPB per min. Bradford method was used to determine protein concentration, using bovine serum albumin as a standard protein (Bradford, 1976). Tributyrin agar assay was conducted to examine the hydrolysis of triglycerides. The agar plate consisting of 1.5% agar in 50 mM sodium phosphate buffer (pH 7.0) was prepared using a microwave. After cooling down to 50 °C, 1% of filter-sterilized tributyrin was added and emulsified by sonication. Paper discs soaked in samples were placed on the surface of tributyrin agar plate and incubated at 15 °C for 12 h. To confirm the lipolytic activity of recombinant proteins on triglyceride, the enzyme was reacted with 1 mM of triolein at 15 °C and 200 rpm for 2 h. The product was extracted with hexane and analyzed by TLC (Lanser et al., 2002). A two-step solvent system was used to develop the TLC plate. The first development was performed in solvent system 1 (benzene:ethyl ether:ethyl acetate:acetic acid, 80:10:10:1, v/v) up to half of the TLC. After completely drying the plate, the second development was conducted in solvent system 2 (hexane:ethyl ether:formic acid, 80:20:2, v/v/v) up to top of the plate. Each spot was visualized by spraying 50% sulfuric acid, followed by baking the plate at 100 °C.
3.2. Expression and purification of recombinant Lip1 The full length lip1 and N-terminal signaling sequence-deleted lip1, which produce His-tagged Lip1 (His-Lip1) and His-tagged Lip1m (HisLip1m), respectively, were cloned into pET28a(+) plasmid. Each plasmid was transformed into E. coli BL21 (DE3) and recombinant proteins were induced by adding 0.1 mM IPTG. SDS-PAGE revealed that the both types of Lip1 were expressed in the form of inclusion bodies, which were dissolved in a denaturing buffer containing urea. After removal of urea by dialysis, the lipase activities of the refolded His-Lip1 and His-Lip1m were 560 and 2800.5 units/mg protein at 15 °C, respectively (Fig. 2A). His-Lip1m showed five times higher lipase activity than that of His-Lip1 at low temperature. The result means that it is necessary to remove N-terminal signaling sequence for its full activity at low temperature. His-Lip1m was applied to a column packed with Ni-NTA agarose, successfully purified, as verified from SDS-PAGE (Fig. 2B) and used for further study.
2.8. Characterization of His-Lip1m All lipase assays were conducted by the aforementioned spectrophotometric method, varying each parameter for characterization. To investigate the effect of temperature on the His-Lip1m, lipase assay was performed in a temperature range from 5 °C to 45 °C with an interval of 5 °C. Thermal stability was determined by assay of the residual activity after pre-incubation of the enzyme at temperature from 5 °C to 50 °C. The residual lipase activity was measured after cooling to 15 °C. The effect of pH on His-Lip1m was determined using 50 mM sodium phosphate buffer range from pH 6.0 to pH 8.0. Lipase assay was performed at 15 °C and pH 7.0 using varied concentrations of p-NPB (0.1–1.0 mM) as a substrate, and the enzyme kinetic values were calculated from the Lineweaver-Burk plot. All experiments were performed in duplicate and the data plotted were average values of the duplicate. Error ranges were within 10%, unless mentioned other-
3.3. Confirmation of hydrolytic activity for triacylglyceride Lipases catalyze hydrolysis of ester bonds in water-insoluble substrates containing medium to long chain fatty acyl groups, which esterase cannot hydrolyze. Generally, p-NPB was used as a substrate to determine the activity of lipase. However, this substrate was also used as a substrate for esterase. Therefore, it is necessary to confirm the practical hydrolytic activity of the recombinant lipase for triacylglycerides. For this purpose, tributyrin agar assay, and TLC analysis of the product from the reaction with triolein were used. Tributyrin agar plate 21
Biocatalysis and Agricultural Biotechnology 11 (2017) 19–25
J.-H. Bae et al.
Fig. 1. The ORF sequence of lip1 from P. lynferdii NRRL Y-7723. The N-terminal signaling sequence and flap/lid of active site are underlined with a solid line and a dashed line, respectively. The catalytic triad and GXSXG motif are marked with asterisks and a box, respectively.
showed the highest activity at pH 7.0 with a relative activity of 15% at pH 6.0 and 65% at pH 8.0 (Fig. 6).
consisting of 1% tributyrin, 1.5% agar in 50 mM sodium phosphate (pH 7.0) was prepared, and His-Lip1m and the sodium phosphate buffer were loaded on the plate. After incubation at 15 °C for 2 h, only HisLip1m produced a clear zone around the loading spot (Fig. 3A). Moreover, to identify the reaction product, TLC analysis was conducted with the extracted products from the reaction of His-Lip1m and triolein. After reaction, free fatty acid, monoolein, and diolein were newly produced (Fig. 3B). These results proved that His-Lip1m possessed the hydrolytic activity for triacylglycerol.
3.5. Kinetic analysis For determination of the kinetic values, Km and Vmax, His-Lip1m was assayed at 15 °C using p-NPB as a substrate ranging from 0.1 mM to 1.0 mM, following the standard assay conditions. Lineweaver-Burk plot was used to calculate Km and Vmax values. Km and Vmax values of the purified lipase were 0.48 mM and 2893.2 μmol min−1 mg−1, respectively.
3.4. Effect of temperature and pH on His-Lip1m
4. Discussion
The effect of temperature on the lipase activity of purified HisLip1m was studied at variable temperatures from 5 °C to 45 °C. HisLip1m showed a broad range of optimal temperatures between 5 °C and 25 °C, with over 90% activity, relative to the highest activity at 20 °C, and 82% even at 30 °C. The activity was inhibited to about half at 35 °C and completely inhibited over 40 °C (Fig. 4). In the thermal stability study, His-Lip1m exhibited stable activity for up to 1 h below 30 °C. However, the activity of His-Lip1m was reduced to the half after incubation for 1 h at 40 °C, and was inactivated completely in 10 min at 50 °C (Fig. 5). Consequently, His-Lip1m represented the typical characteristics of cold-active lipases, high activity at low temperature and low thermostability. Optimal pH of His-Lip1m was tested in the range of pH 6.0–8.0 with 50 mM sodium phosphate buffer at 15 °C. The lipase
This study reports a novel gene encoding a putative extracellular cold-active lipase from P. lynferdii NRRL Y-7723. The strain was proven to produce extracellular cold-active lipase in our previous studies (Bae et al., 2014; Kim et al., 2010; Park et al., 2013). For the industrial application of the enzyme, it is necessary to produce recombinant proteins by gene cloning because it makes possible to achieve mass production, cost reduction and stable production. Therefore, the purpose of this study is the production of recombinant cold-active lipase from P. lynferdii to accomplish industrial application of the enzyme. The genomic information of phylogenetically close strains was used to identify cold-active lipase genes from P. lynferdii. Search for the 22
Biocatalysis and Agricultural Biotechnology 11 (2017) 19–25
J.-H. Bae et al.
Fig. 2. Cloning, expression, and purification of recombinant lip1 E. coli BL21 (DE3). Full length (lip1) or signaling sequence-removed (lip1m) ORF was cloned into pET28a(+). (A) Relative lipase activity of the recombinant proteins. The lipase assay was performed at 15 °C to confirm cold-activity. (B) Expression and purification of recombinant protein, His-Lip1 and His-Lip1m. Lane 1: size marker, lane 2: crude extract of cells expressing His, lane 3: solubilized inclusion body of cells expressing His (in urea buffer), lane 4: crude extract of cells expressing His-Lip1, lane 5: solubilized inclusion body of cells expressing His-Lip1 (in urea buffer), lane 6: crude extract of cells expressing His-Lip1m, lane 7: solubilized inclusion body of cells expressing His-Lip1m (in urea buffer), and lane 8: purified His-Lip1m after removal of urea by dialysis.
Fig. 3. Confirmation of lipolytic activity of His-Lip1m for triacylglycerol. (A) Tributyrin agar plate assay. (B) TLC analysis of product from reactions of triolein with His-Lip1m. Lane 1: triolein, lane 2: 1,2-diolein, lane 3: 1,3-diolein, lane 4: monoolein, lane 5: oleic acid, and lane 6: triolein incubated with His-Lip1m.
homology of partial sequences of ribosomal RNA genes from P. lynferdii NRRL Y-7723 in BLASTN revealed that Wickerhamomyces edaphicus, Wickerhamomyces ciferrii, and Wickerhamomyces anomala have high sequence homology to those of P. lynferdii NRRL Y-7723. According to a recent publication, Pichia ciferrii, Pichia anomala, and Pichia lynferdii were reassigned to genus Wickerhamomyces (Kurtzman et al., 2008). In the search for extracellular lipase from the draft genome sequence of W. ciferrii NRRL Y-1031, three putative extracellular lipase genes were detected and the genes with high sequence homology to the three genes were identified in the genomic DNA of P. lynferdii NRRL Y7723 using PCR method. However, the full length ORF was revealed in only one of them, and the gene was designated by lip1. The predicted protein expressed from the gene is composed of 373 amino acids representing 41.8 kDa. The Lip1 included typical consensus pentapeptide residue (Gly-X-Ser-X-Gly) in common lipases and other structural sequences forming active site of lipase such as a catalytic triad and a flap/lid structure. In addition, the Lip1 has N-terminal signaling peptide comprised of 22 amino acids. The alignment of amino acid sequence of Lip1 showed high similarity with several putative or real triglyceride lipases from Wickerhamomyces species including W. ciferrii (28–77%) and W. anomalous (27–55%) and other species such as Yarrowia lipolytica (27–31%) and Candida deformans (30–33%) (Schneider et al., 2012; Song et al., 2006; Bigey et al., 2003). Therefore, all of the results in analysis of amino acid sequence of Lip1 proposed Lip1 is putative extracellular lipase. Cold-activity of Lip1 was well elucidated.
Fig. 4. Effect of temperature on Lip1m activity. Lipase activity was determined at the given temperatures.
The attempts to express the recombinant Lip1 in a yeast expression system were unsuccessful under variable culture conditions. As an alternative method, the E. coli expression system was used in this study. This system has been successfully used in the production of several recombinant enzymes from eukaryotes (Barnes et al., 1991; Brinkmann et al., 1989; Morton and Potter, 2000). The production of active recombinant enzymes in E. coli expression system has many advantages in their industrial production. The yields can be improved by inducing protein overexpression, combined with a much higher cell growth of E. 23
Biocatalysis and Agricultural Biotechnology 11 (2017) 19–25
J.-H. Bae et al.
et al., 2011). The activity was inhibited to half after incubation for 1 h at 40 °C and completely inhibited in 10 min at 50 °C. Consequently, HisLip1m exhibited typical thermal properties of the cold-active lipase representing high activity at low temperature and low thermal stability. The optimal pH of His-Lip1m was different from that of the purified lipase from P. lynferdii NRRL Y-7723 (Bae et al., 2014). While the optimal pH values of the purified lipase from P. lynferdii NRRL Y-7723 were 7.5–8.0, depending on the assay temperatures, His-Lip1m showed the highest activity at pH 7.0. This discrepancy was assumed to be caused by the presence of isoenzymes of lipase that exhibited different optimal temperature and pH. The Km value of His-Lip1m was similar to the value of Candida antarctica lipase B, a commercially produced lipase (Liu et al., 2012). Furthermore, the values are in the range (10−1–10−5 M) of Km values of most commercial lipases (Florczak et al., 2013). Therefore, the produced recombinant lipase, His-Lip1m, showed a potential for industrial applications. In conclusion, a novel gene encoding an extracellular cold-active lipase from P. lynferdii NRRL Y-7723 was cloned and a recombinant lipase from P. lynferdii NRRL Y-7723 was successfully expressed in its active form in mesophilic bacteria, E. coli BL21 (DE3). The recombinant lipase exhibited typical properties of the cold-active lipases, showing similar dependency on temperatures as that of partially purified lipase from the culture of P. lynferdii NRRL Y-7723. Thus, this study showed that recombinant Lip1m from P. lynferdii NRRL Y-7723 could be applied efficiently and economically to industrial processes that require low temperature reactions.
Fig. 5. Thermal stability of Lip1m. Lip1m was incubated at 5 °C (•), 10 °C (○), 20 °C (▼), 30 °C (△), 40 °C (■), and 50 °C (□). Residual lipase activities at a given time at varied temperature were determined at 15 °C.
Notes The authors declare no conflict of interest and this article does not contain any studies with human participants or animals performed by any of the authors. Acknowledgement This research was supported by the Basic Science Research Program through the National Research Foundation of Korea (NRF) funded by the Ministry of Education, Science and Technology (2010-0023701).
Fig. 6. Effect of pH on the activity of Lip1m.
coli than those of yeast, insect, and mammalian cells. Moreover, the purification step can be simplified by tagging fusion peptides (Morton and Potter, 2000). The two types of recombinant lipases from P. lynferdii NRRL Y-7723 were successfully expressed in their active forms in the E. coli BL21 (DE3). One of them includes N-terminal signaling sequence (His-Lip1) and the other form does not (His-Lip1m). HisLip1m exhibited five times higher activity than that of His-Lip1 at 15 °C. This means that the maturation of Lip1, the cleavage of Nterminal signaling sequence, is a mandatory requirement for its full catalytic activity at low temperature. Moreover, it was confirmed that His-Lip1m can hydrolyze triacylglyceride at 15 °C in the tributyrin agar assay and product analysis in the enzymatic hydrolysis of triolein. Thus, the results exhibited that Lip1 is a triacylglycerol lipase. The optimal temperature of His-Lip1m was 20 °C and the activity was sustained over 90% between 5 to 25 °C. This was in accordance with the results from partially purified cold-active lipase from Pichia lynferdii NRRL Y-7723 (Bae et al., 2014). Both of them exhibited the same range of optimal temperature between 5 °C and 25 °C, while most of the cold-active lipases reported so far showed relatively high optimal temperatures and over 30% activity at low temperatures from 5 °C to 20 °C (Jeon et al., 2009; Park et al., 2009; Zhang et al., 2007). For example, the recombinant lipases from Psychrobacter sp. 7195 and Pseudomonas sp. 7323 showed 35% and 37% of lipase activities at 10 °C, respectively, compared to their optimal activities at 30 °C. On the contrary, His-Lip1m sustained its activity over 90% at 10 °C. Therefore, His-Lip1m was proven as one of the most highly active lipase at low temperature. Compared to other cold-active lipases, the thermal stability of His-Lip1m was relatively low (Zhang et al., 2007; Lan
References Bae, J.H., Kwon, M.H., Kim, I.H., Hou, C.T., Kim, H.R., 2014. Purification and characterization of a cold-active lipase from Pichia lynferdii Y-7723: pH-dependant activity deviation. Biotechnol. Bioprocess Eng. 19, 851–857. Barnes, H.J., Arlotto, M.P., Waterman, M.R., 1991. Expression and enzymatic activity of recombinant cytochrome P450 17 alpha-hydroxylase in Escherichia coli. Proc. Natl. Acad. Sci. USA 88, 5597–5601. Bigey, F., Tuery, K., Bougard, D., Nicaud, J.M., Moulin, G., 2003. Identification of a triacylglycerol lipase gene family in Candida deformans: molecular cloning and functional expression. Yeast 20, 233–248. Bradford, M.M., 1976. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72, 248–254. Brinkmann, U., Mattes, R.E., Buckel, P., 1989. High-level expression of recombinant genes in Escherichia coli is dependent on the availability of the dnaY gene product. Gene 85, 109–114. Choo, D.W., Kurihara, T., Suzuki, T., Soda, K., Esaki, N.A., 1998. Cold-adapted lipase of an Alaskan psychrotroph, Pseudomonas sp. strain B11-1: gene cloning and enzyme purification and characterization. Appl. Environ. Microb. 64, 486–491. Demirjian, D.C., Moris-Varas, F., Cassidy, C.S., 2001. Enzymes from extremophiles. Curr. Opin. Chem. Biol. 5, 144–151. Feller, G., Thiry, M., Arpigny, J.L., Mergeay, M., Gerday, C., 1990. Lipases from psychrotrophic Antarctic bacteria. FEMS Microbiol. Lett. 66, 239–243. Feller, G., Thiry, M., Arpigny, J.L., Gerday, C., 1991a. Cloning and expression in Escherichia coli of three lipase-encoding genes from the psychrotrophic antarctic strain Moraxella TA144. Gene 102, 111–115. Feller, G., Thiry, M., Gerday, C., 1991b. Nucleotide sequence of the lipase gene lip2 from the Antarctic psychrotroph Moraxella TA 144 and site-specific mutagenesis of the conserved serine and histidine residues. DNA Cell Biol. 10, 381–388. Feller, G., Narinx, E., Arpigny, J.L., Zekhnini, Z., Swings, J., Gerday, C., 1994. Temperature dependence of growth, enzyme secretion and activity of psychrophilic Antarctic bacteria. Appl. Microbiol. Biot. 41, 477–479. Florczak, T., Daroch, M., Wilkinson, M.C., Bialkowska, A., Bates, A.D., Turkiewicz, M.,
24
Biocatalysis and Agricultural Biotechnology 11 (2017) 19–25
J.-H. Bae et al.
Morton, C.L., Potter, P.M., 2000. Comparison of Escherichia coli, Saccharomyces cerevisiae, Pichia pastoris, Spodoptera frugiperda, and COS7 cells for recombinant gene expression. Mol. Biotechnol. 16, 193–202. Park, I.H., Kim, S.H., Lee, Y.S., Lee, S.C., Zhou, Y., Kim, C.M., Ahn, S.C., Choi, Y.L., 2009. Gene cloning, purification, and characterization of a cold-adapted lipase produced by Acinetobacter baumannii BD5. J. Microbiol. Biotechnol. 19, 128–135. Park, S.Y., Kim, J.Y., Bae, J.H., Hou, C.T., Kim, H.R., 2013. Optimization of culture conditions for production of a novel cold-active lipase from Pichia lynferdii NRRL Y7723. J. Agr. Food Chem. 61, 882–886. Reetz, M.T., 2002. Lipases as practical biocatalysts. Curr. Opin. Chem. Biol. 6, 145–150. Schmid, R.D., Verger, R., 1998. Lipases: interfacial enzymes with attractive applications. Angew. Chem. Int. Ed. 37, 1608–1633. Schneider, J., Andrea, H., Blom, J., Jaenicke, S., Ruckert, C., Schorsch, C., Szczepanowski, R., Farwick, M., Goesmann, A., Puhler, A., Schaffer, S., Tauch, A., Kohler, T., Brinkrolf, K., 2012. Draft genome sequence of Wickerhamomyces ciferrii NRRL Y-1031 F-60-10. Eukaryot. Cell 11, 1582–1583. Song, H.T., Jiang, Z.B., Ma, L.X., 2006. Expression and purification of two lipases from Yarrowia lipolytica AS 2.1216. Protein Expr. Purif. 47, 393–397. Stergiou, P.Y., Foukis, A., Filippou, M., Koukouritaki, M., Parapouli, M., Theodorou, L.G., Hatziloukas, E., Afendra, A., Pandey, A., Papamichael, E.M., 2013. Advances in lipase-catalyzed esterification reactions. Biotechnol. Adv. 31, 1846–1859. Suzuki, T., Nakayama, T., Kurihara, T., Nishino, T., Esaki, N., 2001. Cold-active lipolytic activity of psychrotrophic Acinetobacter sp. strain no. 6. J. Biosci. Bioeng. 92, 144–148. Winkler, U.K., Stuckmann, M., 1979. Glycogen, hyaluronate, and some other polysaccharides greatly enhance the formation of exolipase by Serratia marcescens. J. Bacteriol. 138, 663–670. Zhang, J., Lin, S., Zeng, R., 2007. Cloning, expression, and characterization of a coldadapted lipase gene from an Antarctic deep-sea psychrotrophic bacterium Psychrobacter sp. 7195. J. Microbiol. Biotechnol. 17, 604–610.
Iwanejko, L.A., 2013. Purification, characterisation and expression in Saccharomyces cerevisiae of LipG7 an enantioselective, cold-adapted lipase from the Antarctic filamentous fungus Geomyces sp. P7 with unusual thermostability characteristics. Enzym. Microb. Technol. 53, 18–24. Gerday, C., Aittaleb, M., Arpigny, J.L., Baise, E., Chessa, J.P., Garsoux, G., Petrescu, I., Feller, G., 1997. Psychrophilic enzymes: a thermodynamic challenge. BBA-Protein Struct. Mol. 1342, 119–131. Jeon, J.H., Kim, J.T., Kim, Y.J., Kim, H.K., Lee, H.S., Kang, S.G., Kim, S.J., Lee, J.H., 2009. Cloning and characterization of a new cold-active lipase from a deep-sea sediment metagenome. Appl. Microbiol. Biot. 81, 865–874. Joseph, B., Ramteke, P.W., Thomas, G., Shrivastava, N., 2007. Standard review coldactive microbial lipases: a versatile tool for industrial applications. Biotechnol. Mol. Biol. Rev. 2, 39–48. Joseph, B., Ramteke, P.W., Thomas, G., 2008. Cold active microbial lipases: some hot issues and recent developments. Biotechnol. Adv. 26, 457–470. Kim, H.R., Kim, I.H, Hou, C.T., Kwon, K.I, Shin, B.S., 2010. Production of a novel coldactive lipase from Pichia lynferdii Y-7723. J. Agric. Food Chem. 58 (2), 1322–1326. http://dx.doi.org/10.1021/jf903430t. Kurtzman, C.P., Robnett, C.J., Basehoar-Powers, E., 2008. Phylogenetic relationships among species of Pichia, Issatchenkia and Williopsis determined from multigene sequence analysis, and the proposal of Barnettozyma gen. nov., Lindnera gen. nov. and Wickerhamomyces gen. nov. FEMS Yeast Res. 8, 939–954. Lan, D.M., Yang, N., Wang, W.K., Shen, Y.F., Yang, B., Wang, Y.H., 2011. A novel coldactive lipase from Candida albicans: cloning, expression and characterization of the recombinant enzyme. Int. J. Mol. Sci. 12, 3950–3965. Lanser, A.C., Manthey, L.K., Hou, C.T., 2002. Regioselectivity of new bacterial lipases determined by hydrolysis of triolein. Curr. Microbiol. 44, 336–340. Liu, Z.Q., Zheng, X.B., Zhang, S.P., Zheng, Y.G., 2012. Cloning, expression and characterization of a lipase gene from the Candida antarctica ZJB09193 and its application in biosynthesis of vitamin A esters. Microbiol. Res. 167, 452–460. Marshall, C.J., 1997. Cold-adapted enzymes. Trends Biotechnol. 15, 359–364.
25