Molecular cloning and characterization of three novel subtilisin-like serine protease genes from Hevea brasiliensis

Accepted Manuscript Molecular cloning and characterization of three novel subtilisin-like serine protease genes from Hevea brasiliensis Kitiya Ekchaweng, Uraiwan Khunjan, Nunta Churngchow PII:

S0885-5765(16)30147-3

DOI:

10.1016/j.pmpp.2016.12.007

Reference:

YPMPP 1228

To appear in:

Physiological and Molecular Plant Pathology

Received Date: 5 October 2016 Revised Date:

21 December 2016

Accepted Date: 26 December 2016

Please cite this article as: Ekchaweng K, Khunjan U, Churngchow N, Molecular cloning and characterization of three novel subtilisin-like serine protease genes from Hevea brasiliensis, Physiological and Molecular Plant Pathology (2017), doi: 10.1016/j.pmpp.2016.12.007. This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

ACCEPTED MANUSCRIPT Molecular cloning and characterization of three novel subtilisin-like serine protease genes from Hevea brasiliensis

RI PT

Kitiya Ekchaweng, Uraiwan Khunjan, Nunta Churngchow* Department of Biochemistry, Faculty of Science, Prince of Songkla University, Hat Yai, Songkhla, 90112, Thailand.

M AN U

SC

Subtilisin-like serine proteases play important roles in a variety of biological functions. In this study, three novel subtilisin-like serine protease genes (HbSPA, HbSPB, and HbSPC) were isolated from Hevea brasiliensis leaves treated with salicylic acid using RT-PCR followed by RACE. HbSPA, HbSPB and HbSPC genes encode polypeptides consisting of 766, 748, and 748 amino acids, respectively, which belong to members of the subtilisin-like serine protease family from plants. Semi-qRT-PCR revealed that HbSPA was expressed in Hevea leaf, stem, hypocotyl, and root, whereas HbSPB and HbSPC were also expressed in the latex. qRT-PCR demonstrated that the expression of HbSPA was significantly induced during P. palmivora infection and slightly induced by wounding, while the expression of HbSPB or HbSPC was notably suppressed during P. palmivora infection and highly induced by SA treatment. Our results implied that HbSPA might be involved in rubber tree defense mechanisms against P. palmivora.

TE D

Keywords: subtilisin-like serine protease, Hevea brasiliensis, Phytophthora palmivora, defense responses

EP

Abbreviations: Hevea brasiliensis subtilisin-like serine protease A (HbSPA), Hevea brasiliensis subtilisin-like serine protease B (HbSPB), Hevea brasiliensis subtilisin-like serine protease C (HbSPC), Reverse transcription polymerase chain reaction (RT-PCR), Rapid amplification of cDNA ends (RACE), Semi-quantitative reverse transcription polymerase chain reaction (Semi-qRT-PCR), Quantitative realtime polymerase chain reaction (qRT-PCR)

AC C

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48

*Corresponding author. Tel.: +66 74 288 261; Fax: +66 74 446 656 E-mail address: [email protected]

ACCEPTED MANUSCRIPT

EP

TE D

M AN U

SC

RI PT

1. Introduction Rubber tree (Hevea brasiliensis Muell. Arg) is the primary source for natural latex production and one of commercially important crops in Thailand. Phytophthora palmivora is known as an aggressive hemibiotrophic oomycete pathogen for rubber tree worldwide (Widmer, 2014). It causes leaf fall and black stripe diseases having disastrous effects on rubber tree cultivation and latex production leading to significant economic loss (Tsao et al., 1975; Kajornchaiyakol, 1977). To sustain basic cellular metabolisms and fight against pathogen attack, plants have to develop multitudinous active defense mechanisms that serve to antagonize the growth of encountered pathogens, as well as to manipulate affected plants to withstand subsequent pathogenic insults (Hammond-Kosack and Jones, 2000). The elevation of a characteristic group of proteins referred to pathogenesis-related (PR) proteins has been considered a part of the most important plant defense strategies against invading pathogens. PRproteins are plant species-specific soluble proteins induced and accumulated in response to invading pathogen such as viruses, bacteria, insects, fungi, or herbivores, as well as, stress situations (Rigden and Coutts, 1988). Additionally, their expressions are also induced by immune signals in the absence of pathogen challenge, such as the application of ethylene (ET), jasmonic acid (JA), salicylic acid (SA), or wounding that act in a similar way as pathogen infection (Lamb et al., 1989). Moreover, the high levels of PR gene expressions have been suggested as markers for local hypersensitive response (HR) and systemic acquired resistance (SAR). PR-proteins have been categorized into seventeen families on their properties and functions. One of them has antimicrobial activity (PR1) and most of them are hydrolytic enzymes, for example, PR2; β-1, 3-glucanases, PR3; chitinases, and PR7; endoproteases (van Loon et al., 2006). Subtilisin-like serine proteases (subtilases) are abundantly present in plants that play essential roles in multiple physiological, morphological and biochemical processes, programmed cell death, and also biotic and abiotic stress responses (Figueiredo et al., 2014). Several plant subtilases have been implicated in the defense mechanism against pathogen attack, such as pathogen interactions, pathogen recognition, signaling processes and immune priming (Tian et al., 2005; Ramirez et al., 2013; Figueiredo et al., 2014). Subtilase (EC 3.4.21.14) is one of the largest family of serine proteases with a highly conserved catalytic triad three amino acid residues, aspartate (Asp), histidine (His), and serine (Ser) (Dodson and Wlodawer, 1998). Based on MEROPS, the Peptidase Database (http://merops.sanger.ac.uk; Rawlings et al., 2014), eukaryotic subtilases are grouped under the S8 family within the SB clan of serine proteases. They are further subdivided into two subfamilies namely subtilisin subfamily (S8A) which consists of true subtilisin and kexin subfamily (S8B) which consists of proprotein-processing enzymes. Most mammalian subtilases belong to the S8B, whereas all plant subtilases correspond to the S8A (Tripathi and Sowdhamini, 2006). The first subtilase cloned from a higher plant and characterized biochemically was cucumisin, an extracellular protease highly plentiful in the juice of melon fruits (Cucumis melo L.) (Yamagata et al., 1994). So far, subtilase genes have been annotated in numerous plant species, for example, 15 genes in tomato (Lycopersicon esculentum) (Meichtry et al., 1999), 56 genes in Arabidopsis (Arabidopsis thaliana) (Rautengarten et al., 2005), 63 genes in rice (Oryza sativa) (Tripathi and Sowdhamini, 2006), 82 genes in grape (Vitis vinifera) (Figueiredo et al., 2016) and, 74 genes in potato (Solanum tuberosum) genomes (Norero et al., 2016). Interestingly, plants possess large subtilase gene families than animals. The expansion of the subtilase gene family in plants is accompanied by functional diversification, specific physiological roles, or redundancies as important adaptation processes during their biological evolution (Page and Holmes, 1998; Cao et al., 2014). The potential role of plant subtilases in defense mechanisms was firstly reported in tomato. P69B and P69C, apoplastic subtilases identified as PR-proteins (PR-7 class), are induced by pathogen infections and salicylic acid (SA) treatment (Tornero et al., 1996a; Tornero et al., 1997; Jorda et al., 1999; Meichtry et al., 1999; Tian et al., 2004). Although there have been significant advances in the understanding of

AC C

49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96

ACCEPTED MANUSCRIPT plant subtilases in tomato and Arabidopsis plants, up to now, signature defense subtilase genes in woody plants such as rubber tree remains largely unexplored. In this study, three novel full-length cDNAs of H. brasiliensis subtilisin-like serine protease, designated HbSPA, HbSPB, and HbSPC, were isolated from rubber tree leaves treated with SA using RTPCR and RACE techniques and subsequently characterized. The accumulation and distribution of their transcripts were also examined in different tissues of the rubber tree using semi-qRT-PCR. Moreover, their transcript abundance changes in responses to P. palmivora challenge, SA treatment, and mechanical wounding were investigated using qRT-PCR. The achieved molecular basis of H. brasiliensis serine proteases provides a good opportunity to comprehensively elucidate the immunity role of H. brasiliensis serine proteases in the future research.

119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143

2.2. Plant materials and treatment conditions The rubber seeds (RRIM600 cultivar) used for the experiment were collected from rubber plantation in Satun province, Thailand. The rubber seeds were surface sterilized by immersion in 70% (v/v) ethanol for 1 min, and followed by air-drying. The seed coat was aseptically cracked open using a plier and then the embryo tissue was excised and cultured in the semi-solid Murashige and Skoog’s (MS) basal media supplemented with 1 mg.L-1 indole-3-acetic acid (IAA), 5.4 mg.L-1 6-benzylaminopurine (BAP), 1 mg.L1 myo-inositol, vitamin stock solution (1,000x), 30 g.L-1 sucrose, 2 g.L-1 activated charcoal, and 8 g.L-1 agar, pH 5.7. In-vitro H. brasiliensis cultures were maintained in a culture room programmed for a 16 h.d-1 photoperiod with 335 mmol.m-2.s-1 photosynthetic photon flux density at 25 °C. The young leaves, stem, hypocotyl, and root of the forty-five-day-old in-vitro H. brasiliensis plantlets were harvested. Fresh latex was collected from mature ten-year-old virgin H. brasiliensis (RRIM600 cultivar) by tapping. The first few drop of latex containing plentiful debris were discarded before harvesting latex sample. For treatments, twenty-two-day-bud-grafted rubber plants (RRIM600 cultivar), which were brought from agriculture rubber farm, were propagated in pots at 25 °C under 12 h.d-1 photoperiod. The rubber leaves at developmental B2C state of plantlets with uniform growth were either sprayed with P. palmivora zoospore suspension at the concentration of 2 x 105 zoospores.mL-1, 10 mM salicylic acid (SA) solution, or cut across inside the leaf for 1 cm. in length as mechanical wounding. The control plants were sprayed with sterile distilled water. The leaves of rubber plants were harvested for gene expression measurements at time points 0, 12, 24, 36, 48, and 60 h after treatments. All samples were flash-frozen in liquid nitrogen and transferred immediately to a -80 °C freezer until RNA extraction.

RI PT

97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118

AC C

EP

TE D

M AN U

SC

2. Materials and methods 2.1. Phytophthora palmivora culture Phytophthora palmivora, isolated from a diseased rubber tree was kindly provided by the Songkhla Rubber Research Center, Songkhla, Thailand. P. palmivora was routinely maintained on potato dextrose agar (PDA) plate at 25 °C. For zoospore preparation, P. palmivora was transferred to V-8 juice agar and cultured for 1 week at 25 °C under fluorescent light. Ten mL of sterile cold distilled water was added onto the growing P. palmivora mycelium. The flooding plate was incubated at 4°C for 15 min and further incubated at 25°C in a orbital shaker for 15 min to release zoospores from sporangia. Zoospore suspensions were counted in a haemocytometer under light microscope to quantify zoospore concentration before being used as inoculum.

2.3. Total RNA isolation and first-strand cDNA synthesis The rubber tree tissues (young leaves, stem, hypocotyl and root) were immediately frozen in liquid nitrogen and ground to a fine powder with a mortar and pestle. Total RNA was isolated from ground samples using the RNeasy Plant Mini Kit (Qiagen, Valencia, CA, USA) according to the manufacturer’s

ACCEPTED MANUSCRIPT

RI PT

instructions. For isolation of total RNA from latex, it was extracted with Trizol reagent (Invitrogen, Carlsbad, CA, USA) and chloroform reagent (Sigma-Aldrich, St. Louis, MO, USA). The total RNA of latex in the upper aqueous phase was further purified with the RNeasy Plant Mini Kit (Qiagen, Valencia, CA, USA) according to the manufacturer’s instructions. The contaminating genomic DNA was eliminated during total RNA extraction using an on-column RNase-free DNase I digestion set (Qiagen, Valencia, CA, USA) according to the procedure of the RNeasy Plant Mini Kit. The quality and concentration of the extracted total RNA was analyzed by agarose gel electrophoresis and measured by a spectrophotometer (MaestroGen, Hsinchu, Taiwan), respectively. Total RNA was served as template for the first-strand cDNA synthesis using the SuperscriptTM III (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions. The remaining RNA was removed from the cDNA products by treatment with RNase H (Invitrogen, Carlsbad, CA, USA). The obtained first-strand cDNAs were kept at -20 °C until use.

EP

TE D

M AN U

SC

2.4. Isolation of Hevea brasiliensis serine proteases The cDNA fragment of H. brasiliensis serine protease (HbSP) was obtained by PCR amplification using degenerate primers (Table 1) designed based on the highly conserved region of the available published sequences of subtilisin-like serine protease genes from fourteen plants, Arabidopsis thaliana (GenBank accession no. AAK59595.1), Solanum lycopersicum (CAA67429.1), Nicotiana tabacum (ABG37022.1), Oryza sativa (BAB03290.1), Glycine max (AAD02075.4), Isatis tinctoria (ABD64827.1), Carica papaya (ACP18876.1), Coffea arabica (ADZ55305.1), Zea mays (NP_001151755.1), Alnus glutinosa (CAA59964.1), Phaseolus vulgaris (ADW11233.1), Vitis vinifera (XP_002275381.1), Brachypodium distachyon (XP_003579422.1), Musa acuminata (ABF70004.1), in GenBank. The reaction containing Emerald Amp® GT PCR Master mix (Takara, Otsu, Shiga, Japan), 0.5 µM of each the degenerate primers, and about 100 ng the first-strand cDNA of H. brasiliensis leaves which were treated with 10 mM SA for 24 h as a template were performed with a thermal cycler followed by preheating at 94 ºC for 5 min, 35 cycles of denaturing at 94 ºC for 1 min, annealing at a temperature range of 50-61 ºC for 1 min and extension at 72 ºC for 1 min, and a final extension step at 72 ºC for 10 min. The RT-PCR products (an approximate size of 1.2 kb and 1.1 kb) were analyzed by electrophoresis on a 1.5% (w/v) agarose gel, and visualized under the UV transilluminator and photographed by a Gel Document (UVP BioSpectrum® MultiSpectral Imaging System™, Cambridge, UK). The gene-specific primers (Table 1) were designed based on verified partial sequences of HbSPA and HbSPB to generate the complete full-length cDNA fragments using the SMARTerTM RACE cDNA Amplification Kit following the manufacturer’s instructions (Clontech, Mountain View, CA, USA). The 5′-, 3′-ends and partial middle nucleotide sequences of HbSPA and HbSPB were aligned and assembled for constructing a full-length cDNA. The full-length of HbSPA and HbSPB were verified by PCR using the gene-full-length primers (Table 1). PCR amplification was performed using the Phusion Flash HighFidelity PCR Master Mix following the manufacturer’s instructions (Thermo Fisher Scientific, Waltham, MA, USA).

AC C

144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 166 167 168 169 170 171 172 173 174 175 176 177 178 179 180 181 182 183 184 185 186 187 188 189 190

2.5. Cloning and sequencing of RT-PCR and RACE products All RT-PCR and RACE products were analyzed by electrophoresis on 1.5% (w/v) agarose gel and visualized under the UV transilluminator. The desired DNA fragment was gel-purified using the Gel/PCR DNA Fragments Extraction Kit (Geneaid, New Taipei City, Taiwan), ligated into pGEM-T vector (Promega, Madison, WI, USA) or pJET 1.2 vector (Thermo Fisher Scientific, Waltham, MA, USA) and transformed into E.coli JM109 competent cells (Promega, Madison, WI, USA). The transformants were selected on MacConkey plates containing 50 µg. mL-1 ampicillin. The recombinant plasmid was isolated from 3 mL of bacterial culture using the AccuPrep®plasmid DNA extraction kit (Bioneer, Alameda, CA,

ACCEPTED MANUSCRIPT USA). The purified plasmid DNA was used as a template for PCR analysis to verify the presence of the inserted DNA fragment before being subjected to sequencing by the Macrogen DNA sequencing service (Seoul, South Korea).

TE D

M AN U

SC

RI PT

2.6. Bioinformatics analyses Sequence comparison with other databases was conducted by the NCBI (http:// www.ncbi.nlm.nih.gov) via the basic alignment search tool (BLAST; Altschul et al., 1997). Multiple sequence alignments were generated using ClustalW (Thompson et al., 1997). Protein translation was conducted using the Translate tool (ExPASy; http://web.expasy.org/translate/). Signal peptide prediction was performed using SignalP version 4.1 (http://www.cbs.dtu.dk/services/SignalP/) (Petersen et al., 2011). Prediction of signal sequences to organelles and subcellular localizations was performed using TargetP version 1.1 (http://www.cbs.dtu.dk/services/TargetP/) (Emanuelsson et al., 2000) and ProtComp version 9.0 from Softberry (http://linux1.softberry.com/). Prediction of chloroplast transit peptide was performed using ChloroP version 1.1 (http://www.cbs.dtu.dk/services/ChloroP/) (Emanuelsson et al., 1999). Protein molecular weight (MW) and isoelectric point (pI) were calculated using the Compute PI/MW tool (ExPASy; http://web.expasy.org/compute_pi/) (Gasteiger et al., 2005). Domain prediction and protein family classification were identified by the InterPro databases (Mitchell et al., 2015). Potential N- and O-glycosylation sites were predicted using NetNGlyc version 1.0 (www.cbs.dtu.dk/services/NetNGlyc/) (Gupta et al., 2004), and DictyOGlyc version 1.1 (http://www.cbs.dtu.dk/services/DictyOGlyc/) (Gupta et al., 1999), respectively. Phosphorylation sites were achieved using NetPhos version 2.0 (www.cbs.dtu.dk/services/NetPhos/) (Blom et al., 1999). Identity percentage between two sequences was performed using LALIGN (http://embnet.vitalit.ch/software/LALIGN_form.html) (Huang and Miller, 1991). Phylogenetic analysis of protein sequences was constructed using the BLOSUM series matrix of ClustalW alignments and the neighborjoining method (Saitou and Nei, 1987) with 1,000 bootstrap replicates implemented in the Molecular Evolutionary Genetics Analysis (MEGA) version 6.0 software program (Tamura et al., 2013).

EP

2.7. Semi-quantitative reverse transcription polymerase chain reaction (Semi-qRT-PCR) To determine the expressions of HbSPA and HbSPB or HbSPC in different rubber tree tissues using Semi-qRT-PCR, total RNA extracted from the young leaves, stem, hypocotyl, and root of forty-five-dayold in-vitro H. brasiliensis plantlets including the latex collected from mature ten-year-old virgin H. brasiliensis (RRIM600 cultivar) were served as template for the first strand cDNA synthesis as described above. The RT-PCR product of HbSPA (623 bp) and HbSPB or HbSPC (653 bp) were amplified by PCR using the SPA-semi primers, which are specific for the amplification of HbSPA isoform, and the SPB/SPC-semi primers, which are specific for amplification of both HbSPB and HbSPC isoforms, respectively (Table 1). The expressions of HbSPA and HbSPB or HbSPC was controlled with the expression of H. brasiliensis mitosis protein YLS8 (GenBank accession no. HQ323250), housekeeping gene stably expressed in the rubber tree (Li et al., 2011). The RT-PCR product of mitosis protein YLS8 (577 bp) was amplified using the Mito-semi primers (Table 1). Two µL of the first-strand cDNA was used as a template in a 50-µL PCR reaction containing Emerald Amp® GT PCR Master mix (Takara, Otsu, Shiga, Japan), 0.3 µM of each gene-specific primer. The amplification was performed in a thermal cycler by preheating at 94 ºC for 5 min, 30 cycles of denaturing at 94 ºC for 1 min, annealing at 60 °C for 30 sec and extension at 72 ºC for 1 min, and a final extension step at 72 ºC for 10 min. The RT-PCR products were analyzed by electrophoresis on a 1.5% (w/v) agarose gel, and visualized under the UV transilluminator and photographed by a Gel Document (UVP BioSpectrum® MultiSpectral Imaging System™; Cambridge, UK).

AC C

191 192 193 194 195 196 197 198 199 200 201 202 203 204 205 206 207 208 209 210 211 212 213 214 215 216 217 218 219 220 221 222 223 224 225 226 227 228 229 230 231 232 233 234 235 236 237

ACCEPTED MANUSCRIPT

Table 1 Primers used in this study Primer name

TE D

M AN U

SC

RI PT

2.8. Quantitative real-time polymerase chain reaction (qRT-PCR) Transcript abundances of HbSPA and HbSPB or HbSPC were examined in the rubber tree leaves after inoculation with zoospores of P. palmivora, exogenous treatment of SA, and mechanical wounding using qRT-PCR in accordance with the manual of Luminaris Color HiGreen Low ROX qPCR Master Mix (Thermo Fisher Scientific, Waltham, MA, USA) in the Stratagene™ Mx3005P qPCR System (Agilent Technologies Santa Clara, CA, USA). The housekeeping gene H. brasiliensis mitosis protein YLS8, stably expressed in the rubber tree was used as an internal reference gene (Li et al., 2011). The primers used in qRT-PCR are listed in Table 1. To validate the specificity of each primer set and amplifications, melting curves of all amplified qPCR products were identified as a single peak and a single band appeared with correct size in agarose gel electrophoresis. The percentage of amplification efficiency (E) of each primer set and correlation coefficient (R2) were calculated using standard curves generated from plasmids containing cloned target sequences (Whelan et al., 2003). The thermal cycling program started at 50°C for 2 min, initial denaturation cycle of 95 ºC for 10 min, 40 cycles of denaturing at 95 ºC for 15 s, annealing at 60 °C for 30 s, and extension at 72 ºC for 30 s. The PCR efficiency was calculated by the equation; E% = (101/slope-1) x 100 (Pfaffl, 2004). The slope was obtained from linear regression of standard curve. The E% and R2 values of a standard curve of HbSPA was 90.8%, 0.99; HbSPB or HbSPC was 84.2%, 0.998; Hbmitosis was 86.3%, 0.998, respectively. The transcript amount of target genes and endogenous reference gene of each samples were calculated from the linearized plasmid standard curves. The obtained transcript amount of HbSPA and HbSPB or HbSPC were normalized against the transcript amount of Hbmitosis protein YLS8. Normalized gene expression data of the control treatment was defined as one fold expression level. The experiments were performed at three independent biological replicates (three individual plants/ replicate). Each biological replicate was carried out in three technical replicates. The values were presented as mean value plus standard error (S.E.) from the result of three biological replicates as shown a fold-change over the control. Statistical analysis was performed using SPSS Statistics 17.0 software by the one-way analysis of variance (ANOVA) according to Tukey’s HSD test to determine significance with P ≤ 0.05.

EP

238 239 240 241 242 243 244 245 246 247 248 249 250 251 252 253 254 255 256 257 258 259 260 261 262 263 264 265 266 267

Sequence (5′→3′)

Application

SP-degenerate-F

TGCAAYARVAARCTYATYGG

Amplification of HbSP

269

SP-degenerate-R

GCWGTDGTCATVAKKGCDGA

Amplification of HbSP

270

SPA-specific-F

TCCTGGAGTCGATATTTTAGCTGCCTATAC

Identification 3′end of HbSPA

271

SPA-specific-R

GGCTGAACCCAAGAAATTAGCTCCTGAAAC

Identification 5′end of HbSPA

272

SPB-specific-F

GGAACTGTAACTGGTGTACCGGCTGC

Identification 3′end of HbSPB

273

SPB-specific-R

CAGATGATCATACTACCAACAGGTTTGG

Identification 5′end of HbSPB

274

SPA-full-length-F

TCAGCTGAAAGATGAGGATCCGTAGCC

ORF verification of HbSPA

275

SPA-full-length-R

AAGCTGAACCTGCATCTTTCTTCTTCACCAC

ORF verification of HbSPA

276

SPB-full-length-F

CTCCAGCATTTTCTATTCCTTCCAACAATATGG

ORF verification of HbSPB

277

SPB full-length-R

CATATCCATATCCAATTACATTTATGCCTGCCTATT

ORF verification of HbSPB

AC C

268

ACCEPTED MANUSCRIPT SPA-semi-F

CTTCAGGGCCTACTTCTCAATCATTTGAC

Semi-qRT-PCR for HbSPA

279

SPA-semi-R

GTCGCTTGCATTTTCCTCAGCCCTTAG

Semi-qRT-PCR for HbSPA

280

SPB/SPC-semi-F

TAACAAGGCCGGCGAGAGTGAGATAC

Semi-qRT-PCR for HbSPB or HbSPC

281

SPB/SPC-semi-R

CCGGTACACCAGTTACAGTTCCTTT

Semi-qRT-PCR for HbSPB or HbSPC

282

Mito-semi-F

TGGGCTGTTGATCAGGCAATCTTGGC

Semi-qRT-PCR for Hbmitosis

283

Mito-semi-R

TGTCAGATACATTGCTGCACACAAGGC

Semi-qRT-PCR for Hbmitosis

284

SPA-qRT-F

GCCACTGATTTTCTTCAAGAGTCAAACC

285

SPA-qRT-R

TTGGATGGACAGTTGTATGGCTTATCAG

286

SPB/SPC-qRT-F

AGAGCTAMATGGCGAATCTCTTATTCAG

287

SPB/SPC-qRT-R

CTCTTTGCCTTYGGAAACTGTTTCAGAC

288

Mito-qRT-F

CAAGCAAGAGTTCATTGACATTATTGAGACTG

qRT-PCR for Hbmitosis

289

Mito-qRT-R

ATCACAGGTTCTTACATAGTCGGATAGTC

qRT-PCR for Hbmitosis

qRT-PCR for HbSPA

qRT-PCR for HbSPB or HbSPC

SC

qRT-PCR for HbSPB or HbSPC

EP

TE D

3. Results 3.1. Identification and characterization of HbSPA, HbSPB and HbSPC genes Two partial nucleotide sequences obtained from RT-PCR revealed a 1,191-bp and a 1,161-bp DNA fragments. Both sequences showed similarities to subtilisin-like serine protease genes of other plants, which were designated as H. brasiliensis serine protease A (HbSPA) and H. brasiliensis serine protease B (HbSPB), respectively. The 5′ and 3′ RACE products for HbSPA were 825 bp and 750 bp, respectively. By overlapping and assembling, a full-length cDNA of HbSPA was 2,455 bp. The 5′ and 3′ RACE products for HbSPB were 800 bp and 850 bp, respectively. By overlapping and assembling, a full-length of HbSPB was 2,404 bp. After verification of a full-length cDNA of HbSPB, we obtained another DNA fragment consisted of 2,404 bp unintentionally. This nucleotide sequence showed similarities to subtilisin-like serine protease genes of other plants, which was designated as H. brasiliensis serine protease C (HbSPC). The full-length cDNA of HbSPA, HbSPB and HbSPC have been deposited in the National Center of Biotechnology Information GenBank under the accession no. KU845302, KU845303 and KU845304, respectively. The full-length cDNA of HbSPA consisted of 2,455 bp, possessing a 41-bp 5′-UTR from the start codon, a 113-bp 3′-UTR from the stop codon and a 2,301-bp open reading frame (ORF) starting with an initiation (methionine) codon (ATG) at nucleotide position 42-44, ending with a termination codon (TAA) at nucleotide position 2,340-2,342 and the polyadenylation signal (AATAAA) at nucleotide position 2,360-2,366 of the cDNA (Fig. 1). Sequence analysis with the BLAST algorithm of the deduced HbSPA amino acid sequence exhibited a high homology with Jatropha curcas PREDICTED: subtilisinlike protease SBT5.3 at 78 % (GenBank accession no. XP_012075010), Ricinus communis Xylem serine proteinase 1 precursor at 78 % (GenBank accession no. XP_002525023), and Populus euphratica PREDICTED: subtilisin-like protease SBT5.3 at 74 % (GenBank accession no. XP_011013366), respectively. The ORF of HbSPA encoding a putative serine protease precursor consisted of 766 amino acid residues. SignalP 4.1 analysis of the deduced amino acid sequence identified a hydrophobic signal peptide at the N-terminal with the signal sequence cleavage site located between amino acid position Ala27 and Ala28 showing the significant mean S value of 0.859. Prediction of the subcellular location based on the predicted presence of its N-terminal sequence using TargetP and ProtComp indicated that

AC C

291 292 293 294 295 296 297 298 299 300 301 302 303 304 305 306 307 308 309 310 311 312 313 314 315 316 317 318 319

qRT-PCR for HbSPA

M AN U

290

RI PT

278

ACCEPTED MANUSCRIPT

EP

TE D

M AN U

SC

RI PT

the protein HbSPA was targeted to the secretory pathway via the endoplasmic reticulum (ER) by virtue of its N-terminal signal peptides. Besides, ChloroP1.1 analysis of the deduced amino acid sequence revealed a presence of chloroplast transit peptide at the N-terminal with the cleavage site at position located between amino acid position Gln26 and Ala27 showing CS-score of 6.549. Based on these predictions, HbSPA could either be an extracellular protease (secreted enzyme) or a chloroplast processing protease. The appearance of the signal peptide and propeptide domain in the N-terminal deduced amino acid assumed that HbSPA was synthesized as a preproenzyme with a 27-amino acid signal peptide, a 87amino acid propeptide, and a 649-amino acid mature polypeptide. A putative HbSPA protein exhibited a calculated theoretical molecular weight (MW) of 69.043 kDa and isoelectric point (pI) of 8.50, predicted by the Compute PI/MW tool. According to NetNGlyc 1.0 and DictyOGlyc 1.1, there are seven potential sites of N-linked glycosylation (Asn-Xaa-(Ser/Thr)) (NXS/T) and two potential sites of O-linked glycosylation (Ser174 and Ser253). According to NetPhos 2.0, a carboxy-terminal rich in the phosphorylation sites (31 residues of Ser, 7 residues of Thr, and 5 residues of Tyr) present in the sequence of HbSPA (Fig. 1, Table 2).

AC C

320 321 322 323 324 325 326 327 328 329 330 331 332 333 334

AC C

EP

TE D

M AN U

SC

RI PT

ACCEPTED MANUSCRIPT

335 336 337

EP

Fig. 1. Nucleotide and deduced amino acid sequences of H. brasiliensis serine protease A. The nucleotide sequence of H. brasiliensis serine protease A is shown with the derived amino acid sequence presented below the corresponding codons in capital letters. The nucleotide and/or amino acid sequence is numbered on the right. The position of the start (ATG) and stop codon (TAA) are underlined. The polyadenylation signal (AATAAA) is dot-underlined. The predicted hydrophobic signal peptide (position 1-27) are highlighted in grey. The propeptide (position 31-117) are boxed. The catalytic triad (Asp154, His223, Ser551) and the highly conserved Asn324 residues are highlighted in black. Seven positions of potential consensus sequences for asparagine-linked glycosylation (NXS/T) are underlined twice.

AC C

338 339 340 341 342 343 344 345 346 347 348 349 350 351 352 353 354 355

TE D

M AN U

SC

RI PT

ACCEPTED MANUSCRIPT

The full-length cDNA of HbSPB and HbSPC consisted of 2,404 bp, possessing a 29-bp 5′-UTR from the start codon, a 128-bp 3′-UTR from the stop codon and a 2,247-bp ORF starting with an initiation (methionine) codon (ATG) at nucleotide position 30-32, ending with a termination codon (TAG) at nucleotide position 2,274-2,276 and the polyadenylation signal (AATAAA) at nucleotide position 2,3742,379 of the cDNA (Fig. 2 and 3). The ORF of HbSPB encoding a putative serine protease precursor consisted of 748 amino acid residues with the signal sequence cleavage site located between amino acid position Val29 and Ile30 showing the significant mean S value of 0.844. Prediction of the subcellular

ACCEPTED MANUSCRIPT

EP

TE D

M AN U

SC

RI PT

location based on the predicted presence of its N-terminal sequence using TargetP and ProtComp indicated that HbSPB could be an extracellular protease (secreted enzyme). The presence of the signal peptide and propeptide domain assumed that HbSPB was synthesized as a preproenzyme with a 29-amino acid signal peptide, a 81-amino acid propeptide, and a 616-amino acid mature polypeptide. A putative HbSPB protein exhibited a calculated theoretical MW of 65.474 kDa and pI of 9.23. There are likely six potential sites of N-linked glycosylation sites (Asn-Xaa-(Ser/Thr)) (NXS/T) and two potential sites of Olinked glycosylation (Ser406 and Ser 466) and a carboxy-terminal rich in the phosphorylation sites (22 residues of Ser, 4 residues of Thr, and 4 residues of Tyr) present in the sequence of HbSPB (Fig. 2, Table 2).

AC C

356 357 358 359 360 361 362 363 364 365 366

AC C

EP

TE D

M AN U

SC

RI PT

ACCEPTED MANUSCRIPT

367 368 369

ACCEPTED MANUSCRIPT

EP

Fig. 2. Nucleotide and deduced amino acid sequences of H. brasiliensis serine protease B. The nucleotide sequence of H. brasiliensis serine protease B is shown with the derived amino acid sequence presented below the corresponding codons in capital letters. The nucleotide and/or amino acid sequence is numbered on the right. The position of the start (ATG) and stop codon (TAA) are underlined. The polyadenylation signal (AATAAA) is dot-underlined. The predicted hydrophobic signal peptide (position 1-29) are highlighted in grey. The propeptide (position 52-132) are boxed. The catalytic triad (Asp164, His220, Ser535) and the highly conserved Asn323 residues are highlighted in black. Six positions of potential consensus sequences for asparagine-linked glycosylation (NXS/T) are underlined twice.

AC C

371 372 373 374 375 376 377 378 379 380 381 382 383 384 385 386 387 388 389 390

TE D

M AN U

SC

RI PT

370

The ORF of HbSPC encoding a putative serine protease precursor consisted of 748 amino acid residues with the signal sequence cleavage site located between amino acid position Ala29 and Ile30 showing the significant mean S value of 0.899. Prediction of the subcellular location based on the predicted presence of its N-terminal sequence using TargetP and ProtComp indicated that HbSPC could be an extracellular protease (secreted enzyme). The presence of the signal peptide and propeptide domain assumed that HbSPC was synthesized as a preproenzyme with a 29-amino acid signal peptide, a 81amino acid propeptide, and a 616-amino acid mature polypeptide. A putative HbSPC protein exhibited a calculated theoretical MW of 65.09 kDa and pI of 9.04. There are likely seven potential sites of N-linked glycosylation sites (Asn-Xaa-(Ser/Thr)) (NXS/T) and two potential sites of O-linked glycosylation

ACCEPTED MANUSCRIPT

EP

TE D

M AN U

SC

RI PT

(Ser406 and Ser 466) and a carboxy-terminal rich in the phosphorylation sites (24 residues of Ser, 3 residues of Thr, and 5 residues of Tyr) present in the sequence of HbSPC (Fig. 3, Table 2).

AC C

391 392 393

AC C

EP

TE D

M AN U

SC

RI PT

ACCEPTED MANUSCRIPT

394

EP

Fig. 3. Nucleotide and deduced amino acid sequences of H. brasiliensis serine protease C. The nucleotide sequence of H. brasiliensis serine protease C is shown with the derived amino acid sequence presented below the corresponding codons in capital letters. The nucleotide and/or amino acid sequence is numbered on the right. The position of the start (ATG) and stop codon (TAA) are underlined. The polyadenylation signal (AATAAA) is dot-underlined. The predicted hydrophobic signal peptide (position 1-29) are highlighted in grey. The propeptide (position 52-132) are boxed. The catalytic triad (Asp164, His220, Ser535) and the highly conserved Asn-323 residues are highlighted in black. Seven positions of potential consensus sequences for asparagine-linked glycosylation (NXS/T) are underlined twice.

AC C

395 396 397 398 399 400 401 402 403 404 405 406 407 408 409 410 411 412 413 414 415

TE D

M AN U

SC

RI PT

ACCEPTED MANUSCRIPT

Sequence similarity searches with members of the subtilisin-like serine proteases indicated that HbSPA, HbSPB and HbSPC belong to the subtilisin-like proteases family (S8A subfamily, clan SB) based on MEROPS peptidase database (http://merops.sanger.ac.uk), with the highly conserved protease catalytic triad residues (HbSPA, Asp154, His223, Ser551; HbSPB and HbSPC, Asp164, His220, Ser535) and the catalytically important residue (HbSPA, Asn324; HbSPB and HbSPC, Asn323), which is responsible for the stabilization of the oxyanion tetrahedral transition state (Fig. 4).

TE D

M AN U

SC

Fig. 4. HbSPA, HbSPB and HbSPC are predicted to be members of the subtilisin-like serine proteases. Alignment of amino acid sequences surrounding the catalytic residues residues (D, aspatate; H, histidine; and S, serine) and the conserved amino acid residue (N, asparagine) of HbSPA, HbSPB and HbSPC with other plant serine proteases, including Arabidopsis thaliana (GenBank accession number AEE33956), Solanum lycopersicum (GenBank accession number CAA76724), Solanum lycopersicum (GenBank accession number CAA76725), Triticum urartu (GenBank accession number EMS61069), Medicago truncatula (GenBank accession number KEH42928), Oryza sativa Japonica Group (GenBank accession number BAB03290), Carica papaya (GenBank accession number ACP18876), Coffea arabica (GenBank accession number ADZ55305), Glycine max (GenBank accession number AAD02075), Cucumis melo var. cantalupo Cucumisin (GenBank accession number BAA06905.1), Picea abies (GenBank accession number BAA13135), Ricinus communis (GenBank accession number XP_002525023), and Zea mays (GenBank accession number NP_001151755). The relative position of the amino acid segment within each protease is indicated by the numbers from the precursor sequence. Amino acid residues that define the highly conserved serine protease catalytic triad residues (Asp, His, and Ser) and the catalytically important residue (Asn) of each plants are marked with asterisks (*).

EP

Multiple amino acid sequence alignment among the predicted ORF of H. brasiliensis serine protease A, B and C indicated that the HbSPB and HbSPC were closely similar, while the HbSPA was obviously distinct (Fig. 5). In addition, pairwise amino acid sequence alignment using LALIGN showed that the HbSPA was 39.8 % and 39.4 % identical to the HbSPB and HbSPC, respectively, whereas the HbSPB was 95.1 % identical to the HbSPC (Fig. 6A). Domain search and protein family classification performed with InterPro programs suggested the presence of three domains highly conserved in premature of subtilisin-like serine proteases in all three isozyme HbSP proteins: N-terminal peptidase S8 propeptide (peptidase inhibitor I9), C-terminal peptidase S8 family domain and the protease associated (PA) domain inserted in the peptidase S8 domain (Fig. 6B). The bioinformatic characterizations of three putative Hevea subtilisin-like serine proteases are summarized in Table 2

AC C

416 417 418 419 420 421 422 423 424 425 426 427 428 429 430 431 432 433 434 435 436 437 438 439 440 441 442 443

RI PT

ACCEPTED MANUSCRIPT

AC C

EP

TE D

M AN U

SC

RI PT

ACCEPTED MANUSCRIPT

444

ACCEPTED MANUSCRIPT Fig. 5. Amino acid sequence alignment of H. brasiliensis serine protease A, B and C using Clustal algorithm. Conserved amino residues are shaded dark, while highly conserved amino residues are shaded grey. The dash represents a gap in the alignment. The catalytically important Asp, His, Asn, and Ser residues are shown with an asterisk.

EP

Fig. 6. Schematic representations of the domain structures and the deduced amino acid sequence homology of HbSPA, HbSPB, and HbSPC. (A) Identity percentages among three Hevea serine proteases. (B) The signal peptide sequence (SP) is marked with the red box. The putative domains: peptidase S8 propeptide (peptidase inhibitor I9), peptidase S8 domain, and protease associated (PA) domain are presented in the individual boxes. The catalytic triad in the active site (Asp, aspartate; His, histidine; Ser, serine) and the highly conserved residue (Asn, asparagine) are indicated by arrows (↑). The position of the amino acid residues starting from the N terminus are shown by numbers.

AC C

450 451 452 453 454 455 456 457 458 459 460 461 462 463 464 465 466 467 468 469 470 471

TE D

M AN U

SC

RI PT

445 446 447 448 449

ACCEPTED MANUSCRIPT Table 2 Bioinformatics information of three putative Hevea subtilisin-like serine proteases HbSPA

HbSPB

HbSPC

Mature polypeptide length

649 aa

616 aa

616 aa

Molecular weight of preproenzyme

69.04 kDa

65.47 kDa

65.09 kDa

Isoelectric point (pI)

8.50

9.23

9.04

Signal peptide and cleavage site

Yes (Ala27−Ala28)

Yes (Val29−Ile30)

Chloroplast transit peptide and cleavage site

Yes (Gln26−Ala27)

O-glycosylation site

2 sites (Ser174, Ser253)

N-glycosylation site (Asn-X-Ser/Thr)

7 sites (246NGT, 391NVS,

6 sites (193NAT, 387NGS,

7 sites (193NAT, 243NGT,

641NAT, 659NSS, 674NLS,

462NST, 554NWS,

387NGS, 462NST, 554NWS,

716NKT, 733NAS)

598NPS, 642NDS)

598NPS, 642 NDS)

31 Ser residues (at positions

22 Ser residues (at positions

24 Ser residues (at positions

5, 7, 23, 40, 43, 45, 47, 52,

38, 48, 73, 165, 211, 261,

48, 73, 165, 175, 211, 231,

57, 68, 82,100, 121, 161,

332, 344, 384, 389, 410,

261, 290, 344, 384, 389, 410,

163, 165, 253, 294, 345,

450, 466, 495, 535, 603,

450, 466, 495, 535, 600, 603,

401, 404, 448, 460, 501,

604, 657, 687, 701, 724,

644, 657, 687, 699, 724, 741)

534, 551, 588, 615, 661,

741)

TE D

Phosphorylation site

SC

RI PT

Information

Yes (Ala29−Ile30)

No

No

2 sites (Ser406, Ser466)

2 sites (Ser406, Ser466)

M AN U

472 473 474

475 476 477 478 479 480 481 482 483 484 485

AC C

EP

676, 723)

7 Thr residues (at positions

4 Thr residues (at positions

3Thr residues (at positions

90, 216, 225, 346, 627, 705,

107, 345, 478, 672

107, 345, 672)

5 Tyr residues (at positions

4 Tyr residues (at positions

5 Tyr residues (at positions

32, 58, 83, 179, 738)

43, 299, 616, 625)

43, 75, 299, 616, 625)

727

3.2. Phylogenetic relationships among Hevea serine proteases To investigate the evolutionary relationship of the HbSPA, HbSPB, HbSPC proteins with other plant serine proteases, a phylogenetic tree was constructed based on comparison of their deduced amino acid sequences with other serine protease retrieved from GenBank using the neighbor-joining method (Fig. 7). The phylogenetic dendrogram revealed that HbSPA was most closely related to the serine protease of Ricinus communi, which belongs to the same family (Euphobiaceae) as H. brasiliensis, and also closely related to the serine protease of Theobroma cacao, Carica papaya, and Populus trichocarpa. In contrast, the closest relative of HbSPB and HbSPC was the serine protease of Lotus japonicas, which belongs to the Fabaceae family, and also closely related to the serine protease of Coffea arabica, Nicotiana tabacum, and P69 protease (P69A, P69B, P69C, P69D, P69E, P69F) of Solanum lycopersicum.

486 487 488 489 490 491 492 493 494

AC C

EP

TE D

M AN U

SC

RI PT

ACCEPTED MANUSCRIPT

Fig. 7. Phylogenetic analyses of HbSPA, HbSPB, HbSPC with other plant serine proteases retrieved from the GenBank database including Arabidopsis thaliana (GenBank accession no. AEE33956), Solanum lycopersicum (GenBank accession no. CAA76724), Solanum lycopersicum (GenBank accession no. CAA76725), Triticum urartu (GenBank accession no. EMS61069), Medicago truncatula (GenBank accession no. KEH42928), Solanum lycopersicum (GenBank accession no. CAA67429), Solanum lycopersicum (GenBank accession no. CAA67430), Nicotiana tabacum (GenBank accession no. ABG37022), Oryza sativa Japonica Group (GenBank accession no. BAB03290), Carica papaya (GenBank accession no. ACP18876), Coffea arabica (GenBank accession no. ADZ55305), Glycine max

ACCEPTED MANUSCRIPT

533 534

M AN U

SC

RI PT

(GenBank accession no. AAD02075), Zea mays (GenBank accession no. NP_001151755), Alnus glutinosa (GenBank accession no. CAA59964), Phaseolus vulgaris (GenBank accession no. ADW11233), Musa acuminate (GenBank accession no. ABF70004), Ricinus communis (GenBank accession no. XP_002525023), Populus trichocarpa (GenBank accession no. XP_002320540), Picea abies (GenBank accession no. BAA13135), Cucumis melo var. cantalupo (GenBank accession no. BAA06905), Solanum lycopersicum (GenBank accession no. CAA06412), Solanum lycopersicum (GenBank accession no. CAA76727), Solanum lycopersicum (GenBank accession no. CAA06413), Solanum lycopersicum (GenBank accession no. CAA06414), Genlisea aurea (GenBank accession no. EPS63009), Oryza brachyantha (GenBank accession no. ACN85315), Oryza alta (GenBank accession no. ACN85256), Oryza officinalis (GenBank accession no. ACN85243), Oryza punctata (GenBank accession no. ACN85215), Oryza rufipogon (GenBank accession no. ACN85182), Oryza glaberrima (GenBank accession no. ACN85198), Lotus japonicus (GenBank accession no. BAF95753), Siraitia grosvenorii cucumisin (GenBank accession no. AEM42989), and Theobroma cacao (GenBank accession no. XP_007020377). Construction of the phylogenetic tree was performed with the bootstrapped consensus neighbor-joining (NJ) method using the MEGA version 6.0. Bootstrap values were obtained with 1,000 replicates, and are indicated at nodes presenting the probability of reproducibility when performs random sampling. The scale bar represents the evolutionary distance (0.1 amino acid substitution per site).

EP

TE D

3.3. Expression analysis of HbSPA, and HbSPB or HbSPC The expression of HbSPA was detected in the young leaf, stem, hypocotyl, and root tissues, but not appeared in the latex of the rubber tree, while HbSPB or HbSPC were found to be expressed ubiquitously in all tissues investigated (Fig. 8A). After inoculation with P. palmivora, the relative expression level of HbSPA was continuously increased at 12 h to 24 h and reached the highest level at 36 h (~2 fold) when compared to the control, and abruptly declined to below the level of control thereafter. For SA treatment, the relative expression level of HbSPA was notably decreased to below the level of the control at 12 h (~0.5 fold) and then up-regulated to the level of the control at 24 h, but decreased rapidly to below the level of control at 36 h to 48 h. For wounding treatment, the relative expression level of HbSPA was gradually elevated at 24 h to 36 h and reached the highest level at 48 h (~1.4 fold) when compared to the control (Fig. 8B). On the contrary, the relative expression level of HbSPB or HbSPC was significantly decreased after inoculation with P. palmivora at 12 h till 24 h and exhibited the lowest level at 36 h (~0.18 fold) when compared to the control, then subsequently below the level of control until 60 h. For SA treatment, the relative expression level of HbSPB or HbSPC was significantly increased at 12 h (~2 fold), then greatly declined at 24 h and further below the level of control at 36 h, and turned to be increased at 48 h (~1.2 fold) and obviously decreased at 60 h. For mechanical wounding treatment, the relative expression level of HbSPB or HbSPC was merely decreased from 12 h to 36 h, subsequently remained at the same level of the control at 48 h (~1 fold) then turned to be decreased at 60 h (Fig. 8C).

AC C

495 496 497 498 499 500 501 502 503 504 505 506 507 508 509 510 511 512 513 514 515 516 517 518 519 520 521 522 523 524 525 526 527 528 529 530 531 532

SC

RI PT

ACCEPTED MANUSCRIPT

536 537 538 539 540 541 542 543 544 545 546 547

AC C

EP

TE D

M AN U

535

Fig. 8. Expression patterns of HbSPA and HbSPB or HbSPC. (A) The expression of HbSPA and HbSPB, or HbSPC in young leaf; L, stem; S, hypocotyl; H, root; R, and latex; La of H. brasiliensis. Amplification of H. brasiliensis’s mitosis protein YLS8 gene was used as an internal control. (B) Time course of the relative expression levels of HbSPA and (C) HbSPB, or HbSPC in the rubber tree leaves either inoculated with P. palmivora zoospores suspension at the concentration of 2 x 105 zoospores.mL-1, spayed with 10 mM SA solution, or cut across inside the leaf for 1 cm. in length as mechanical wounding. The expressions of HbSPA and HbSPB, or HbSPC in each treatment are expressed as a relative transcript fold change to their controls. The data are statistically analyzed using SPSS Statistics 17.0 software by the one-way analysis of variance (ANOVA) method according to Tukey’s HSD test (Sokal and Rohlf, 1981). The columns and vertical bars represent a mean

ACCEPTED MANUSCRIPT and standard error (± SE) of three replications. Columns with different letters above them are significantly different from each other (p-value ≤ 0.05).

EP

TE D

M AN U

SC

RI PT

4. Discussion In this study, we described the identification and structural characterization of HbSPA, HbSPB, and HbSPC, and investigation of their expression patterns in different rubber tree tissues and under various stress conditions. The DNA sequence of HbSPA revealed a 2,301-bp ORF encoding a protein of 766 amino acids and the DNA sequences of HbSPB and HbSPC revealed a 2,247-bp ORF encoding a protein of 748 amino acids. Homology comparison analysis of the deduced amino acid sequences of HbSPA, HbSPB, and HbSPC with other published gene sequences indicated that these enzymes were classified into the subtilisin-like serine protease family (EC 3.4.21.14) defined by the catalytic triad (aspartate, histidine, and serine) and the stabilizing amino acid residue (asparagine) in an arrangement shared with subtilisins from Bacillus species (Dodson and Wlodawer, 1998). The analysis of the predicted primary structure of HbSPA, HbSPB, and HbSPC revealed that all of them appeared to be translated as a preproenzyme consisting of three distinct conserved domains: a hydrophobic signal peptide at the N-terminus responsible for delivering the enzyme precursor to its final destination, a propeptide domain (peptidase inhibitor I9) which is important for modulation of proper protein folding (Shinde et al., 1995) and for inhibiting the activation of the enzyme, and a mature domain characteristic of a catalytic peptidase S8 domain in which a conserved protease-associated (PA) domain is localized. The insertion of PA domain in the catalytic domain was a unique structural feature that distinguishes subtilases in plants from those in mammalian and bacterial organisms (Cedzich et al., 2009). The PA domain might play a potential role in substrate specificity determination of protease and protein-protein interactions (Rautengarten et al., 2005). The beginning of putative NH2-terminal sequences of the mature HbSPA, HbSPB, and HbSPC proteins is a pair of threonine residues (Thr118 and Thr119 in HbSPA and Thr133 and Thr134 in both of HbSPA and HbSPC) corresponding to the amino terminus of the catalytic domain, which appears to be highly conserved in other plant subtilisin-like proteases, such as cucumisin (Yamagata et al., 1994), P69 (Tornero et al., 1996a, 1997), and LeSBT1 (Janzik et al., 2000). Predictions of subcellular localization of a primary protein structure can provide hypothesis about its function involvement (Rautengarten et al., 2005; Cao et al., 2014). The presence of predicted signal peptide sequences for targeting to the secretory pathway via endoplasmic reticulum (ER) and glycosylation sites in HbSPA, HbSPB, and HbSPC sequences suggests that all three Hevea serine proteases might be glycosylated and be secreted to the plant extracellular space, where they supposedly accumulate and exert their biological functions. Considering that the extracellular space is where the hostpathogen interaction, pathogen recognition, and signaling transduction occur, the accumulation of subtilases here may reinforce an important role during pathogenesis (Dixon and Lamb, 1990). Several plant subtilases are induced during pathogen attack and predominantly accumulated in the extracellular space, for example, P69B and P69C (Tornero et al., 1996a, 1997), Arabidopsis thaliana subtilase (AtSBT3.3) (Ramirez et al., 2013), and Gossypium babardense subtilase (GbSBT1) (Duan et al., 2016). Moreover, P69B is defined to interact with Phytophthora infestans effectors (EPI1 and EPI10) at the apoplast of the tomato leaf during infection, pointing to a potential role in plant defense response (Tian et al., 2004, 2005). Likewise, the result also indicated that HbSPA consisted of a predicted chloroplast transit peptide sequence for targeting to the chloroplast, suggesting that HbSPA could play a specific function in the chloroplast. Coincident with what has been described in the Arabidopsis (Beers et al., 2004), grape (Cao et al., 2014) and potato genomes (Norero et al., 2016), only one gene product encoded from a member of the subtilase gene family is predicted to localize to chloroplast.

AC C

548 549 550 551 552 553 554 555 556 557 558 559 560 561 562 563 564 565 566 567 568 569 570 571 572 573 574 575 576 577 578 579 580 581 582 583 584 585 586 587 588 589 590 591 592 593

ACCEPTED MANUSCRIPT

EP

TE D

M AN U

SC

RI PT

Developmental and tissue-specific expressions of plant subtilase genes have been found to correlate with their different physiological functions (Rautengarten et al., 2005; Cao et al., 2014). Expression of tomato subtilase genes have been found to be tissue-specific manner and regulated by developmental stages (Meichtry et al., 1999; Jorda et al., 1999). For example, the LeSBT1 transcript is detectable in tomato cultured cells, cotyledon, leaves, flowers and roots while the LeSBT2 transcript is not found in flowers and roots (Meichtry et al., 1999). Likewise, the tmp is found to be expressed only in anthers during late stages of pollen development, hypothesizing its role in microsporogenesis (Riggs and Horsch, 1995; Taylor et al., 1997). As results, the expression of HbSPA was detected in Hevea young leaf, stem, hypocotyl, and root, whereas the expression of HbSPB or HbSPC was also found in the latex of the rubber tree, implying their different physiological functions in rubber tree. The latex-specific expression of HbSPB or HbSPC was postulated that they could have some biological functions related to latex biosynthesis, protein metabolism, or stress/defense in rubber tree. Although, it has been identified and characterized three serine proteases; hevain a (69 kDa), hevain b (58 kDa), and hevain l (80 kDa) in the latex of rubber tree (Lynn and Clevette-Radford, 1984, 1986), their biological significance still remain speculative. The specific function of HbSPB and HbSPC proteins in the latex of rubber tree needs further investigation. Subtilases have highly specific functions either in plant developmental processes or other stressrelated situations (Figueiredo et al., 2014). Several evidences have highlighted the involvement of plant subtilases in pathogen recognition and immune priming. For instance, P69C is implicated in signaling events by processing an extracellular matrix associated leucine-rich repeat protein (LRP) in tomato that mediate molecular recognition to initiate immune signaling processes (Tornero et al., 1996b). Also, AtSBT3.3, homologous P69C, is hypothesized to serve as a receptor located in the plasma membrane initiating a durable auto-induction mechanism through the activation of the SA-dependent expression of defense-related genes for enhanced immunity (Ramirez et al., 2013). Moreover, there is indirect evidence that plant subtilases participate in the regulation of the wound response. A Kex2p-like protease from tomato have been identified in the processing of systemin, a mobile peptide hormone responsible for mediating signal transduction in respond to wounding stress in tomato (Schaller and Ryan, 1994). In this study, the expression profiles of Hevea serine proteases genes were examined in the rubber tree leaves under different stresses, including P. palmivora infection, SA treatment, and mechanical wounding. In marked contrast, the expression of HbSPA was significantly induced by P. palmivora at 36 h post infection, slightly induced by wounding, and not induced by SA (Fig. 9A), while the expression of HbSPB or HbSPC was dramatically decreased since the earliest time period of P. palmivora infection, and notably increased by exogenous application of SA (Fig. 9B). It implied that HbSPA might be involved in rubber tree defense responses against P. palmivora and wound responses, whereas HbSPB and HbSPC might be SA-responsive genes and involved in SA-dependent signaling system. The notably elevated HbSPA transcript by P. palmivara but not SA was contrary to that previously reported for the expressions of P69B and P69C that are significantly induced by the hemibiotrophic bacterium, Pseudomonas syringae, and SA treatment in Arabidopsis and tomato plants (Tornero et al., 1966a; Jorda et al., 1999). Even though, our results were in contrast to the elevated AtSBT3.3 expression by P. syringae DC3000, the necrotrophic fungus Botrytis cinerea, as well as, pathogen-related stress signals, such as SA, methyl jasmonate (MeJA), and abscisic acid (ABA) in the Arabidopsis plants, the AtSBT3.3 activation found to be SA-independent during pathogenesis (Ramirez et al., 2013). Furthermore, it has recently been reported that the expression of GbSBT1 is induced by the necrotrophic fungus Verticillium dahlia, JA and ET treatments instead of SA stimulus (Duan et al., 2016). Besides, the increased HbSPA expression by mechanical wounding was similar to the induction of the tomato subtilase 3 (SBT3) in the wounded leaf of tomato plants (Meyer et al., 2016). It has been proposed that the involvement of SBT3 in systemin processing and wound signaling contributes to insect resistance in tomato (Meyer et al., 2016). It is therefore possible that in rubber tree the role of HbSPA in pathogen

AC C

594 595 596 597 598 599 600 601 602 603 604 605 606 607 608 609 610 611 612 613 614 615 616 617 618 619 620 621 622 623 624 625 626 627 628 629 630 631 632 633 634 635 636 637 638 639 640 641

ACCEPTED MANUSCRIPT defense could differ from what has been known in Arabidopsis and tomato plants. The other plant defense hormones; ABA, ET, JA, and other factors that are responsible for the induction of HbSPA are needed to clarify. More investigations must be conducted to define the precise functions of three Hevea serine protease genes and the defensive role of HbSPA in H. brasiliensis-P. palmivora interactions.

SC

RI PT

5. Conclusion In summary, this is the first identification and structural characterization of three novel subtilisin-like serine protease genes from H. brasiliensis. Subcellular localization analysis revealed that the putative mature HbSPA, HbSPB, and HbSPC proteins might be extracellular proteases, and HbSPA protein might also be a chloroplast protease. According to bioinformatics information and the analyses of their expression profiles revealed the differences among the characteristic of three subtilisin-like serine protease genes in tissue distribution, subcellular localization, unique induction, which might be associated with their different physiological functions in rubber tree. Our findings provide valuable information for functional analysis of three Hevea subtilisin-like serine proteases in future studies.

M AN U

Contributions NC and KE designed and planned the experiments. KE and UK performed the experiments, measurements and analyzed the data. KE and NC wrote the manuscript and performed editing and corrections. NC and KE revised and approved the final version of the manuscript.

TE D

Acknowledgements This work was financially supported in part by the Thailand Research Fund (TRF) through the Royal Golden Jubilee Ph.D. Program (RGJ-PHD) to Miss Kitiya Ekchaweng (Grant No. PHD/0030/2555); the University Academic Excellence Strengthening Program in Biochemistry of Prince of Songkla University, Thailand; the Graduate School of Prince of Songkla University, Thailand.

EP

References Altschul, S.F., Madden, T.L., Schaffer, A.A., Zhang, J., Zhang, Z., Miller, W., Lipman, D.J., 1997. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 25 (17), 3389-3402. Beers, E.P., Jones, A.M., Dickerman, A.W., 2004. The S8 serine, C1A cysteine and A1 aspartic protease families in Arabidopsis. Phytochemistry. 65, 43-58. Blom, N., Gammeltoft, S., Brunak, S., 1999. Sequence and structure-based prediction of eukaryotic protein phosphorylation sites. J. Mol. Biol. 294 (5), 1351-1362. Cao, J., Han, X., Zhang, T., Yang, Y., Huang, J., Hu, X., 2014. Genome-wide and molecular evolution analysis of the subtilase gene family in Vitis vinifera. BMC Genomics. 15, 1116. Cedzich, A., Huttenlocher, F., Kuhn, B.M., Pfannstiel, J., Gabler, L., Stintzi, A., Schaller, A., 2009. The protease-associated domain and C-terminal extension are required for zymogen processing, sorting within the secretory pathway, and activity of tomato subtilase 3 (SlSBT3). J. Biol. Chem. 284 (21), 14068-14078. Dixon, R.A., Lamb, C.J., 1990. Molecular communication in interaction between plants and microbial pathogens. Ann. Rev. Plant Physiol. Plant Mol. Biol. 41, 339-367. Dodson, G., Wlodawer, A., 1998. Catalytic triads and their relatives. Trends Biochem. Sci. 23 (9), 347352. Duan, X., Zhang, Z., Wang, J., Zuo, K., 2016. Characterization of a novel cotton subtilase gene GbSBT1 in response to extracellular stimulations and its role in Verticillium resistance. PLoS One. 11 (4), e0153988.

AC C

642 643 644 645 646 647 648 649 650 651 652 653 654 655 656 657 658 659 660 661 662 663 664 665 666 667 668 669 670 671 672 673 674 675 676 677 678 679 680 681 682 683 684 685 686 687 688

ACCEPTED MANUSCRIPT

EP

TE D

M AN U

SC

RI PT

Emanuelsson, O., Nielsen, H., Brunak, S., von Heijne, G., 2000. Predicting subcellular localization of proteins based on their N-terminal amino acid sequence. J. Mol. Biol. 300 (4), 1005-1016. Emanuelsson, O., Nielsen, H., von Heijne, G., 1999. ChloroP, a neural network-based method for predicting chloroplast transit peptides and their cleavage sites. Protein Sci. 8(5), 978-984. Figueiredo, A., Monteiro, F., Sebastiana, M., 2014. Subtilisin-like proteases in plant-pathogen recognition and immune priming: a perspective. Front. Plant Sci. 5, 739. Figueiredo, J., Costa, G.J., Maia, M., Paulo, O.S., Malhó, R., Sousa Silva, M., Figueiredo, A., 2016. Revisiting Vitis vinifera subtilase gene family: a possible role in grapevine resistance against Plasmopara viticola. Front. Plant Sci. 7, 1783. Gasteiger, E.H.C., Gattiker, A., Duvaud, S., Wilkins, M.R., Appel, R.D., Bairoch, A., 2005. Protein identification and analysis tools on the ExPASy Server, in: Walker, J.M. (Ed.), The Proteomics Protocols Handbook, New York, pp. 571-607. Gupta, R., Jung, E., Brunak, S., 2004. Prediction of N-glycosylation sites in human proteins. In preparation. Gupta, R., Jung, E., Gooley, A.A., Williams, K.L., Brunak, S., Hansen, J., 1999. Scanning the available Dictyostelium discoideum proteome for O-linked GlcNAc glycosylation sites using neural networks. Glycobiology. 9 (10), 1009-1022. Hammond-Kosack, K.E., Jones, J.D.G., 2000. Responses to plant pathogens, in: Buchanan, B.B., Gruissem, W., Jones, R.L. (Eds.), Biochemistry and Molecular Biology of Plants. American Society of Plant Physiologists, Rockville, pp. 1102-1156. Huang, X., Miller, W., 1991. LALIGN finds the best local alignments between two sequences. Adv. Appl. Math. 12, 373-381. Janzik, I., Macheroux, P., Amrhein, N., Schaller, A., 2000. LeSBT1, a subtilase from tomato plants. Overexpression in insect cells, purification, and characterization. J. Biol. Chem. 275 (7), 5193-5199. Jorda, L., Coego, A., Conejero, V., Vera, P., 1999. A genomic cluster containing four differentially regulated subtilisin-like processing protease genes is in tomato plants. J. Biol. Chem. 274 (4), 23602365. Kajornchaiyakol, P., 1977. Survey of Phytophthora diseases in 1976. Thai J. Agric. Sci. 10, 427-436. Lamb, C.J., Lawton, M.A., Dron, M., Dixon, R.A., 1989. Signals and transduction mechanisms for activation of plant defenses against microbial attack. Cell 56 (2), 215-224. Li, H., Qin, Y., Xiao, X., Tang, C., 2011. Screening of valid reference genes for real-time RT-PCR data normalization in Hevea brasiliensis and expression validation of a sucrose transporter gene HbSUT3. Plant Sci. 181 (2), 132-139. Lynn, K.R. and Clevette-Radford, N.A., 1984. Purification, characterization of hevain, a serine protease from Hevea brasiliensis. Phytochemistry 23(5), 963-964. Lynn, K.R. and Clevette-Radford, N.A., 1986. Hevains: serine-centred proteases from the latex of Hevea brasiliensis. Phytochemistry 25(10), 2279-2282. Meichtry, J., Amrhein, N., Schaller, A., 1999. Characterization of the subtilase gene family in tomato (Lycopersicon esculentum Mill.). Plant Mol. Biol. 39 (4), 749-760. Mitchell, A., Chang, H.Y., Daugherty, L., Fraser, M., Hunter, S., Lopez, R., McAnulla, C., McMenamin, C., Nuka, G., Pesseat, S., Sangrador-Vegas, A., Scheremetjew, M., Rato, C., Yong, S.Y., Bateman, A., Punta, M., Attwood, T.K., Sigrist, C.J., Redaschi, N., Rivoire, C., Xenarios, I., Kahn, D., Guyot, D., Bork, P., Letunic, I., Gough, J., Oates, M., Haft, D., Huang, H., Natale, D.A., Wu, C.H., Orengo, C., Sillitoe, I., Mi, H., Thomas, P.D., Finn, R.D., 2015. The InterPro protein families database: the classification resource after 15 years. Nucleic Acids Res. 43 (D1), D213-D221. Norero, N.S., Castellote, M.A., de la Canal, L., Feingold, S.E., 2016. Genome-wide analyses of subtilisin-like serine proteases on Solanum tuberosum. Am. J. Potato Res. 93, 485-496.

AC C

689 690 691 692 693 694 695 696 697 698 699 700 701 702 703 704 705 706 707 708 709 710 711 712 713 714 715 716 717 718 719 720 721 722 723 724 725 726 727 728 729 730 731 732 733 734 735

ACCEPTED MANUSCRIPT Page, R.D.M. and Holmes, E.C., 1998. Molecular evolution: A phylogenetic approach. Blackwell Scientific, Oxford. Petersen, T.N., Brunak, S., von Heijne, G., Nielsen, H., 2011. SignalP 4.0: discriminating signal peptides from transmembrane regions. Nat. Methods. 8 (10), 785-786. Pfaffl, M.W., 2004. Quantification strategies in real-time PCR, in: Bustin, S.A. (Ed.), A-Z of Quantitative PCR. IUL Biotechnology Series, International University Line, La Jolla, California, pp. 87-120. Ramirez, V., Lopez, A., Mauch-Mani, B., Gil, M.J., Vera, P., 2013. An extracellular subtilase switch for immune priming in Arabidopsis. PLoS Pathog. 9 (6), e1003445. Rautengarten, C., Steinhauser, D., Bussis, D., Stintzi, A., Schaller, A., Kopka, J., Altmann, T., 2005. Inferring hypotheses on functional relationships of genes: Analysis of the Arabidopsis thaliana subtilase gene family. PLoS Comput. Biol. 1 (4), e40. Rawlings, N.D., Waller, M., Barrett, A.J., Bateman, A., 2014. MEROPS: the database of proteolytic enzymes, their substrates and inhibitors. Nucleic Acids Res. 42 (D1), D503-D509. Rigden, J., Coutts, R., 1988. Pathogenesis-related proteins in plants. Trends Genet. 4 (4), 87-89. Riggs, C.D., Horsch, A., 1995. Molecular cloning of an anther specific gene from tomato. Plant Physiol. 108, 117. Saitou, N., Nei, M., 1987. The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol. Biol. Evol. 4 (4), 406-425. Schaller, A.,Ryan, C.A., 1994. Identification of a 50-kDa systemin binding protein in tomato plasma membranes having Kex2p-like properties. Proc. Natl. Acad. Sci. USA. 91 (25), 11802-11806. Shinde, U., Li, Y., Inouye, M., 1995. Propeptide mediated protein folding: intramolecular chaperones, in: Shinde, U., Inouye, M. (Eds.), Intramolecular Chaperones and Protein Folding, R.G. Landes Company, Austin, Texas, pp. 1-9. Sokal, R.R., Rohlf, F.J., 1981. Biometry, in: Freeman W.H. (Ed.), The Principles and Practice of Statistics in Biological Research, California, pp. 1-859. Tamura, K., Stecher, G., Peterson, D., Filipski, A., Kumar, S., 2013. MEGA6: Molecular Evolutionary Genetics Analysis version 6.0. Mol. Biol. Evol. 30 (12), 2725-2729. Taylor, A.A., Horsch, A., Rzepczyk, A., Hasenkampf, C.A., Riggs, C.D., 1997. Maturation and secretion of a serine proteinase is associated with events of late microsporogenesis. Plant J. 12, 1261-1271. Thompson, J.D., Gibson, T.J., Plewniak, F., Jeanmougin, F., Higgins, D.G., 1997. The CLUSTAL_X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res. 25 (24), 4876-4882. Tian, M., Huitema, E., Da Cunha, L., Torto-Alalibo, T., Kamoun, S., 2004. A Kazal-like extracellular serine protease inhibitor from Phytophthora infestans targets the tomato pathogenesis-related protease P69B. J. Biol. Chem. 279 (25), 26370−26377. Tian, M., Benedetti, B., Kamoun, S., 2005. A Second Kazal-like protease inhibitor from Phytophthora infestans inhibits and interacts with the apoplastic pathogenesis-related protease P69B of tomato. Plant Physiol. 138 (3), 1785-1793. Tornero, P., Conejero, V., Vera, P., 1996a. Primary structure and expression of a pathogen-induced protease (PR-P69) in tomato plants: Similarity of functional domains to subtilisin-like endoproteases. Proc. Natl. Acad. Sci. U.S.A. 93 (13), 6332-6337. Tornero, P., Conejero, V., Vera, P., 1997. Identification of a new pathogen-induced member of the subtilisin-like processing protease family from plants. J. Biol. Chem. 272 (22), 14412-14419.

779 780 781

Tornero, P., Mayda, E., Gomez, M.D., Canas, L., Conejero, V., Vera, P., 1996b. Characterization of LRP, a leucine-rich repeat (LRR) protein from tomato plants that is processed during pathogenesis. Plant J. 10 (2), 315-330.

AC C

EP

TE D

M AN U

SC

RI PT

736 737 738 739 740 741 742 743 744 745 746 747 748 749 750 751 752 753 754 755 756 757 758 759 760 761 762 763 764 765 766 767 768 769 770 771 772 773 774 775 776 777 778

ACCEPTED MANUSCRIPT

EP

TE D

M AN U

SC

RI PT

Tripathi, L.P., Sowdhamini, R., 2006. Cross genome comparisons of serine proteases in Arabidopsis and rice. BMC Genomics 7, 200. Tsao, P.H., Chew-Chin, N., Syamananda, R., 1975. Occurrence of Phytophthora palmivora on Hevea rubber in Thailand. Plant Dis. Rep. 59 (12), 955-958. van Loon, L.C., Rep, M., Pieterse, C.M.J., 2006. Significance of inducible defense-related proteins in infected plants. Annu. Rev. Phytopathol. 44, 135-162. Whelan, J.A., Russell, N.B., Whelan, M.A., 2003. A method for the absolute quantification of cDNA using real-time PCR. J. Immunol. Methods. 278, 261-269. Widmer, T.L., 2014. Phytophthora palmivora. Forest Phytophthoras. 4 (1), 3557. Yamagata, H., Masuzawa, T., Nagaoka, Y., Ohnishi, T., Iwasaki, T., 1994. Cucumisin, a serine protease from melon fruits, shares structural homology with subtilisin and is generated from a large precursor. J. Biol. Chem. 269 (52), 32725-32731.

AC C

782 783 784 785 786 787 790 791 792 793 794 795

ACCEPTED MANUSCRIPT

Highlights

EP

TE D

M AN U

SC

RI PT

Characterization of subtilisin-like serine protease genes in Hevea brasiliensis. Expression analysis of Hevea serine protease genes in rubber tree under stresses. The HbSPA expression was highly induced during Phytophthora palmivora infection. The HbSPB/HbSPC expression was notably induced by salicylic acid treatment. HbSPA gene might be involved in rubber tree defense responses against P. palmivora.

AC C

• • • • •