Molecular Cloning and Expression of Squalene Epoxidase from a Medicinal Plant, Bupleurum chinense

Gao K et al. Chinese Herbal Medicines, 2016, 8(1): 67-74

67

Available online at SciVarse ScienceDirect

Chinese Herbal Medicines (CHM)  ISSN 1674-6384

Journal homepage: www.tiprpress.com

 

E-mail: [email protected]  

Original article

Molecular Cloning and Expression of Squalene Epoxidase from a Medicinal Plant, Bupleurum chinense Ke Gao, Jie-sen Xu, Jing Sun, Yan-hong Xu, Jian-he Wei, Chun Sui*   Institute of Medicinal Plant Development, Chinese Academy of Medical Sciences, Beijing 100193, China

   

ARTICLE INFO 

ABSTRACT    Objective

Article history Received: July 30, 2015 Revised: September 10, 2015 Accepted: October 8, 2015 Available online: January 15, 2016 

In plant, squalene epoxidase (SE) catalyzes the first oxygenation step in

the biosynthetic pathway of triterpenoid and phytosterol, representing one of the rate-limiting enzymes in this pathway. Bupleurum chinense is an important

medicinal herb with its major active constituents such as triterpenoid saponins and saikosaponins. In order to obtain the series of enzymatic genes involved in

saikosaponin biosynthesis, a cDNA of SE, designated BcSE1, was cloned from B. chinense. Methods The BcSE1 gene was cloned by homology-based PCR and 5’/3’ RACE methods from the adventitious roots of B. chinense. The physical and chemical parameters of BcSE1 protein were predicted by protparam. In order to

discover hints in amino acid sequences on the dominant functions in the

DOI: 10.1016/S1674-6384(16)60010-2

biosynthesis of saponin or phytosterol, sequences of SE from other plants were downloaded from NCBI for sequences alignment and phylogenetic analysis. BcSE1 was cloned into a yeast mutant KLN1 (MATa, erg1::URA3, leu2, ura3, and trp1) to

verify the enzyme activity of BcSE1. Additionally, the tissue-specific expression and

methyl jasmonate (MeJA) inducibility of BcSE1 were investigated using quantitative

real-time PCR. Results The predicted protein of BcSE1 is highly similar to SEs from other plants sharing amino acid sequence identities of up to 88%. The BcSE1 can

functionally complement with yeast SE gene (ERG1) when expressed in the KLN1 mutant (MATa, erg1::URA3, leu2, ura3, and trp1). Using as controls with β-amyrin

synthase (β-AS) which is presumed to catalyze the first committed step in

saikosaponin biosynthesis and a cycloartenol synthase (CAS) relating to the phytosterol biosynthesis, the transcript of BcSE1 was significantly elevated by MeJA

in adventitious roots of B. chinense and the transcript of BcSE1 was most abundant in the fruits and flowers of plants, followed by that in the leaves and roots, and least

in stems. Conclusion It is the first time to illustrate the molecular information of SE in B. chinense and to clone the full-length SE gene in plants of genus Bupleurum L.

Key words Bupleurum chinense; gene functional expression; methyl jasmonate; phytosterols; quantitative real time PCR; squalene epoxidase; triterpenoids; Umbelliferae

© 2016 published by TIPR press. All rights reserved.

______________________

 

*Corresponding author: Sui C

Tel/Fax: +86-10-5783 3363 E-mail: [email protected]; [email protected]

Fund: Open Research Fund of State Key Laboratory Breeding Base of Systematic Research, Development and Utilization of Chinese Medicine Resources 2014KFJJ05

68

Gao K et al. Chinese Herbal Medicines, 2016, 8(1): 67-74

1.    Introduction Squalene epoxidase (SE) is an important rate-limiting enzyme in biosynthesis of triterpenes and phytosterols, responsible for the oxidation of squalene, and results in the formation of 2,3-oxidosqualene. And 2,3-oxidosqualene is the last common precursor of triterpenes and phytosterols. After that, 2,3-oxidosqualene is separately catalyzed by β-amyrin synthase (β-AS) and cycloartenol synthase (CAS), directing to the biosynthesis of triterpenes and phytosterols, respectively (Haralampidis et al, 2002; Abe et al, 1993) (Figure 1). Triterpene saponins are known to be major bioactive components of many Chinese materia medica (CMM), so biosynthesis of triterpene saponins in the plants for medicinal uses would be attractive for large-scale production (Augusin et al, 2011). acetyl-CoA

GAP

pyruvate

MVA

MEP

IPP

squalene SE 2,3-oxidosqualene β-AS β-amyrin

triterpene saponins

CAS cycloartenol 

phytosterols

Figure 1 Biosynthesis pathways of triterpene saponins and phytosterols in plant Acetyl-CoA: acetyl coenzyme A; GAP: glyceraldehydes 3-phosphate; MVA: mevalonic acid; MEP: 2-C-methyl-D-erythrirtol-4-phosphate; IPP: isopentenyl pyrophosphate; CAS: cycloartenol synthase; β-AS: β-amyrin synthase.

The cDNA of SE has been determined in different plant species such as Arabidopsis thaliana (L.) Heynh. (Rasbery et al, 2007) and Medicago truncatula Gaertn. (Suzuki et al, 2002), and in some medicinal plants such as Panax ginseng C. A. Meyer (Han et al, 2010), Panax notoginseng (Burk.) F. H. Chen (He et al, 2008), Euphorbia tirucalli Linn. (Uchida et al, 2007), Nigella sativa Preyn. (Lipinski et al, 2009), and Withania somnifera (L.) Dunal. (Razdan et al, 2013; He et al, 2015). In vertebrate cells, squalene monooxygenase, the homolog of SE, serves as a flux-controlling enzyme and is a control point in cholesterol synthesis by the cholesterol-mediated degradation (Gill et al, 2011). In plant, SE is considered as one of the

rate-limiting enzymes in the triterpene saponins biosynthetic pathway (He et al, 2008). Southern-blotting analysis showed that the SE gene in E. tirucalli is single-copy type and prominently expressed on a parenchyma cell adjacent to primary laticifers that were located in a rosary orientation in the inner region of cortex (Uchida et al, 2007). While in M. truncatula, two SE genes, SE1 and SE2, were characterized which shared 76.6% sequence identity at the nucleic acid level and 82.1% amino acid identity (Suzuki et al, 2002). Both MtSE1 and MtSE2 may participate in sterols biosynthesis and SE2, but not SE1, may function specifically in the formation of triterpenoids based on the co-induction of SE2, not SE1, with β-AS by MeJA. In P. ginseng, silencing of PgSQE1 in RNA interference roots resulted in reduction of ginsenosides production and strong up-regulation of PgSQE2 and PNX (cycloartenol synthase) with enhanced phytosterols accumulation indicating that PgSQE1 will regulate ginsenosides biosynthesis, but not that of phytosterols in P. ginseng (Han et al, 2010). In A. thaliana, six SE homologs were identified within which three could epoxidize squalene. The presence of SE homologs hints that squalene epoxidation may represent an additional divergence point in triterpenoids biosynthesis (Rasbery et al, 2007). Bupleurum chinense DC. (Umbelliferae), a perennial herb native in China, has been worldwide used for medicinal purposes (Shan and She, 1979). Triterpenoid saponins, saikosaponins, are the major active constituent of B. chinense (Fang et al, 2015). In vitro and in vivo experiments showed that the isolated total or monomer saikosaponins exhibited potent anti-inflammatory, hepatoprotective, and immunomodulatory activities (Ashour and Wink, 2011; Sun et al, 2009; Zong et al, 1998; Wong et al, 2009; Shyu et al, 2004). Due to the important role of saikosaponins in plants of Bupleurum L., the biosynthesis of saikosaponins was studied more intensively than other bioactive constituents (Lin et al, 2013). The full-length cDNAs of enzymes involved in saikosaponin biosynthesis, such as isopentenyl diphosphate isomerase (IPPI), squalene synthetase (SS), and β-AS, have been isolated from different species of Bupleurum L., including B. chinense, B. falcatum, and B. kaoi (Kim et al, 2011; Lin et al, 2013; Sui et al, 2010a; 2010b). However, no sequences of SE have been identified in any species of Bupleurum L. yet, so our understanding about the structure and function of SE is quite limited. In this study, with the aim of exploring the SE regulatory function in the saikosaponins biosynthesis, an SE cDNA, BcSE1, was cloned and its sequence character was analyzed from B. chinense. BcSE1 was expressed in a yeast mutant KLN1 (MATa, erg1::URA3, leu2, ura3, and trp1). Additionally, the tissue-specific expression and MeJA inducibility of BcSE1 were investigated. This study will provide a basis for further studies on the regulation role of SE in triterpenoids biosynthesis in B. chinense.

  2.    Materials and methods    2.1    Plant materials    Plants of Bupleurum chinense DC. cv. Zhongchai No.2

Gao K et al. Chinese Herbal Medicines, 2016, 8(1): 67-74 were grown in the experimental field at Institute of Medicinal Plant Development, Chinese Academy of Medical Science, Beijing, China. They were identified by Prof. Chun-sheng Liu, Beijing University of Chinese Medicine. The voucher species (06Y07-CH27) is deposited at Institute of Medicinal Plant Development, Chinese Academy of Medical Science, China. MeJA-treated adventitious roots of B. chinense were used for cDNA cloning of SE and inducibility analyses of MeJA. The adventitious roots were cultivated using the two-step method (Kusakari et al, 2000). After the first step of 21-day cultivation, 200 µmol/L MeJA was added to the medium when transferring roots materials into the second step culture medium. MeJA non-treated adventitious roots were simultaneously cultured. After 8 and 24 h, the treated and controlled adventitious roots were collected and immediately frozen in liquid nitrogen, stored at –80 °C until RNA extraction. Five kinds of plant tissues, including roots, stems, leaves, flowers, and fruits, were collected from B. chinense grown in the natural conditions when the fruits and flowers simultaneously developed in the late flowering period. The collection and restoration of tissues materials were consistent with our previous report (Dong et al, 2010).

2.2    cDNA cloning of SE gene from B. chinense    Firstly, the cDNA core fragment of SE gene was cloned by homology-based PCR from the adventitious roots of B. chinense. Total RNA was extracted from MeJA-treated adventitious roots using RNA purification kit (Norgen, Canada). The cDNA was synthesized from approximate 1 µg total RNA in 20 µL using the SMARTTM RACE cDNA Amplification Kit (Clontech, USA) following the manufacturer’s protocol. Degenerate primers SECF5 and SECF3 were designed for cloning SE core fragment according to GenBank downloaded SE sequences from other plants. PCR was conducted with 200 nmol/L each of SECF5 and SECF3 primers, 0.5 μL 50 × Table 1

69

Advantage 2 Polymerase Mix (Advantage® 2 PCR kit, Clontech), 200 μmol/L each of dNTPs and about 10 ng of cDNA in a total volume of 25 μL. Amplifications were performed with the following program: 94 °C for 5 min, followed by 5 cycles of 94 °C for 30 s, 68 °C for 30 s, 72 °C for 3 min, 25 cycles of 94 °C for 30 s, 60 °C for 30 s, 72 °C for 3 min and a final 10-min extension at 72 °C. Then, the 5′ and 3′ ends of SE from B. chinense were obtained by rapid amplification of cDNA ends (RACE) method using SMARTTM RACE cDNA Amplification Kit (Clontech, USA) following the manufacturer’s protocol. The nested PCR was performed for 20 cycles of 94 °C, 30 s, 68 °C, 30 s, 72 °C, 3 min, and a final 10 min extension at 72 °C. All primers used for cloning in this study were listed in Table 1.

2.3    Sequence analysis of BcSE1 full‐length cDNA    The obtained cDNA clone of SE was nominated BcSE1. The open reading frame (ORF) of BcSE1 was deduced with the results of core fragment cloning and RACE PCR using DNAman software. The physical and chemical parameters of BcSE1 protein were predicted by Protparam (http:// www.expasy.ch/tools/protparam.html). The Prediction of transmembrane helices in BcSE1 was predicted by TMHMM Server v.2.0 (http://www.cbs.dtu.dk/services/TMHMM/). The amino acid sequence alignments of full-length BcSE1 cDNA were created in MEGA 4 using CLUSTALW with default settings. Phylogenetic neighbor-joining trees were constructed and bootstrapped with 1000 iterations in MEGA 4.   

  2.4    Functional  expression  of  BcSE1  in  yeast  mutant  KLN1    The Erg1 knockout yeast mutant KLN1 (MATα, erg1::URA3, leu2, ura3, and trp) (Landl et al, 1996) (kindly provided by Turnowsky F and Zisser G, Institute of Molecular

Primers used for cDNA cloning, qPCR, and yeast mutant complementation in this study

Purposes

Genes

Primers sequences (5’→3’)

Core fragment cloning

SE

SECF5: GA(G/A)GATTGTGTG(A/G)A(T/C/G/A)(G/A)AAAT(C/T/A)GATGC;

5’-RACE first run and nested PCR

SE

3’-RACE first run and nested PCR

SE

qPCR

β-tubulin

BT5: ATGTTCAGGCGCAAGGCTT; BT3: TCTGCAACCGGGTCATTCAT

Actin

AC5: TGCCCGATGGTCAAGTTATC;

β-AS

BA5: ACATGGCTTTCGATACTCGG;

SECF3: CAGGAACAAT(T/A/G)GC(A/T)GGGAAGAACAT(T/C)TG SE5GSP1: AGATGCTACGGGCTTGCGAAGGGTGTA; SE5GSP2: TGGCATAGGGTAGATGAATCGTGGAGGT SE3GSP1: TGCCAGCTAATCCTCATCCCACTCCG; SE3GSP2: CATTAACAGGTGGAGGAATGACGGTTGC

AC3: GGATTCCTGCAGCTTCCATTC BA3: ATTTTCGCTGGATGCATAGG SE

SE5: GGTGGAGGAATGACGGTTGC; SE3: TACGGGCTTGCGAAGGGTGT

 

CAS

Vector construction for complementation

SE

CA5: CTGGTATCGCCACATATCAAA; CA3: GTCGCTTAGTATCCAATGGTTCA

of yeast erg1 mutant 

YSE5-BamHI:  CTGGATCCACACAATGTCTATGAATATTTTTGTGCAAAATTG YSE3-XhoI: CGCTCGAGTTATTCACTTTGATTTGCAGTGG

70

Gao K et al. Chinese Herbal Medicines, 2016, 8(1): 67-74

Biosciences, Karl-Franzens-Universität Graz, Humboldtstrasse 50, A-8010 Graz, Austria) was used to explore the catalytic function of BcSE1. The PCR fragment with introduced BamHI and XhoI sites was amplified with primers (Table 1). The PCR product was purified, sub-cloned into pEASYTM Blunt Zero Cloning Vector (TransGen, China), sequenced, excised, and re-cloned between the BamHI and XhoI sites of the pAY3 vector, containing the Trp selectable marker, under the control of the constitutive ADH promoter. The pAY3BcSE1 construct was transformed into KLN1 competent cells using the Yeast Transformation Kit (FunGenome, China) following the supplier’s protocol. The transformants were selected on Trp-Minus Media (containing 2% glucose and 20 µg/mL ergosterol) in anaerobic conditions. Anaerobic conditions were achieved using Anaerojar 2.5 Litre Device (Oxoid, UK). Ergosterol was dissolved and used according to Suzuki et al (2002). To test the complementarily of BcSE1 to the yeast Erg1, KLN1, KLN1 harboring pAY3 and KLN1 harboring pAY3-BcSE1 were simultaneously cultured in three conditions: Trp Minus Media with ergosterol under anaerobic condition, complete YPDA media lacking ergosterol under anaerobic condition, and complete YPDA media lacking ergosterol under aerobic condition.

value was 8.96. Its total number of negatively charged residues (Asp + Glu) was 45 and total number of positively charged residues (Arg + Lys) was 56. Its formula was C2615H4145N707O739S25 with a total of 8231 atoms. It was predicted as an unstable protein. The amino acid sequences deduced from BcSE1 had the conserved putative flavin adenine dinucleotide (FAD) binding sequence motifs which was a key enzyme site in the sterol biosynthetic pathway (Sakakibara et al, 1995; Favre and Ryder, 1996) and it had three membrane spanning helices predicted by the TMHMM program (Figure 2). To confirm if any hints exist in amino acid sequences on the dominant functions in the biosynthesis of saponin or phytosterol, sequences of SE with verified functions from other plants were downloaded from NCBI for alignment. The Neighbor-joining (NJ) tree was constructed based on the alignment showing that BcSE1 is closely related to the SE2 from P. ginseng, which positively regulates sterol production (Han et al, 2010) (Figure 3). The sequence alignment of BcSE1, PgSQE1, and PgSQE2 was shown in Figure 4. The alignment of all sequences showed that the distinct difference was located in the N-terminal, however, no obvious clue was revealed being able to discriminate SEs participating in the biosynthesis of saponins or phytosterols.

  2.5    Quantitative PCR (qPCR) analysis of transcription  of β‐AS, BcSE1, and CAS in different tissues and MeJA‐  treated B. chinense adventitious roots   

  3.2    Catalyzing activity of BcSE1 in B. chinense   

Total RNA was isolated using an RNA purification kit (Norgen, Canada). The cDNA was synthesized using the PrimeScript RT Reagent Kit (TaKaRa, Japan). The qPCR was performed on iQ5 Real-time PCR Detection System (Bio-Rad, USA) using SYBR® Premix Ex TaqTM II (TaKaRa, Japan) with the condition of 95 °C for 3 min, 40 cycles of 95 °C for 30 s and 58 °C for 20 s. β-tubulin and actin were chosen as internal reference genes for transcription analysis in different tissues and MeJA-treated adventitious roots, respectively. More detailed protocol and primers of β-tubulin, actin, and β-AS followed Dong et al (2010). Each reaction was repeated for six times. The primers of BcSE1 were designed with the product from 1072 bp to 1203 bp of the ORF. The primers of CAS were designed according to the CAS mRNA sequences (AY514456.1) from B. kaoi. 2−∆Ct and 2−∆∆Ct were used to compare the gene expression between different tissues and between MeJA-treated and non-treated control, respectively.

 

To verify the enzyme activity of BcSE1 from B. chinense, we cloned the ORF region of BcSE1 into a yeast expression vector PAY3, pAY3-BcSE1, introduced into a yeast mutant KLN1, and the corresponding transformant was isolated. Selection of transformants for the Trp phenotype was made in SD medium supplied with ergosterol and tryptophan under anaerobic conditions (Figure 5). A BcSE1–PAY3 transformant grew on YPD medium without ergosterol, as did the positive control ScERG1–PAY3 transformant, in contrast to the vector control, which did not grow (Figure 5A). As expected, KLN1 did not grow because the medium was deprived of Trp. When plated in YPD (or SD + Trp) medium without ergosterol under anaerobic conditions, the transformants were not viable (Figure 5D), whereas under aerobic conditions, they exhibited strong growth (Figure 5E). The pWV3 transformants were not able to grow under either condition, showing that the SE inserts contributed to this growth. Thus, these data showed that the ergosterol biosynthetic pathway in the yeast erg1 knockout could be re-constituted by heterologous complementation with BcSE1.

3.    Results      3.1    Cloning and characterization of the BcSE1 cDNA    A full-length cDNA encoding SE in B. chinense was obtained by homology cloning and 5’/3’ RACE methods. The cDNA, named as BcSE1, was 1988 bp long including a 1593 bp ORF that encoded 530 deduced amino acid residues with a calculated molecular mass of 58.128 kD (GenBank Accession No. JX569788). The physical and chemical parameters of BcSE1 protein predicted by Protparam showed that its pI

3.3    Quantitative real‐time PCR analysis    Expression level of BcSE1 was investigated, along with saikosaponin-involved β-AS gene and phytosterol-involved CAS gene, in the five tissues of B. chinense (Figure 6). CAS had no significantly different expression among stems, fruits, and flowers. β-AS had a distinct tissue expression profile with exclusive higher level in roots than in other tissues, which was consistent with previous studies (Sui et al, 2011; Dong et al, 2010). Tissue specific expression of the transcripts for

Gao K et al. Chinese Herbal Medicines, 2016, 8(1): 67-74 BcSE1 revealed that it highly expressed in all of the five plant tissues in the order of fruits, flowers > leaves > roots > stems and the expression level in fruits was almost six-fold of that in stems. Usually, the increased accumulation of secondary metabolites was accompanied with the up-regulated expression of metabolites-related enzyme genes. For example, the expression of β-AS has been up-regulated when the accumulation of SSs increased in the hairy roots of B. falcatum using altered cultural media (Kim et al, 2006).

71

Therefore, in the present study, the expression of BcSE1, along with saikosaponin-involved β-AS and phytosterolinvolved CAS, was assayed in MeJA-treated adventitious roots of B. chinense. The result showed that the expression of BcSE1 was up-regulated along with β-AS, while CAS had scarcely changed (Figure 7). BcSE1 expression increased about double-folds in 24 h MeJA-treated adventitious roots compared with MeJA-treated for 8 h, and the expression of β-AS increased by about three fold.

  1.2

Probability

1.0 0.8 0.6 0.4 0.2 0.0 0

100

200

300

transmembrane

400

inside

500

outside

   

Figure 2 Transmembrane helices of BcSE1 predicted by TMHMM Server V2.0 Transmembrane helices of BcSE1 predicted by the TMHMM Server V2.0. Three membrane spanning helices and a possible N-term signal sequence were predicted existing 65 99 97 61 100

DQ386734 P. notoginseng SE (saponins) DQ457054 P. notoginseng SE1 (saponins) AB122078 P. ginseng SE1 (saponins) GU354314 A. elata SE1 (saponins) JF818129 E. senticosusSE1 (saponins)

100

JN228206 E. senticosus SE2 (saponins) JX569788 BcSE1

43

80

FJ393274 P. ginseng SE2 (sterols) AJ430608 M. truncatula SE2 (saponins, sterols)

29 99 53

AJ430609 M. truncatula SE1 (sterols) AB253602 E. tirucalli SE1 (sterols)

55

NM119938 A. thaliana SE3 (sterols) FJ232947 N. sativa SE1 (saponins) NM104624 A. thaliana SE1 (sterols) NM122319 A. thaliana SE2 (sterols)

Figure 3

Phylogenetic tree of several plants SE based on amino acid sequences downloaded from NCBI

Phylogenetic tree of several plants SE based on amino acid sequences downloaded from NCBI. Ruler represents genetic distance; numbers represent confidence level; GenBank numbers and plants scientific names are listed, respectively.

72

Gao K et al. Chinese Herbal Medicines, 2016, 8(1): 67-74

    Figure 4

Alignment of BcSE1 amino acid sequence of B. chinense with two SE polypeptides in P. ginseng

Alignment of BcSE1 amino acid sequence of B. chinense with two SE polypeptides in P. ginseng. The amino acid sequence identities between the PgSQE1 (AB122078), PgSQE2 (FJ393274), and BcSE1 (JX569788) are indicated in black and grey shading, respectively. Identical residues are boxed in black and similar residues in grey.

   Figure 5

Complementation of yeast erg1 mutant by B. chinense cDNA BcSE1

Complementation of yeast erg1 mutant by B. chinense cDNA BcSE1. A: Plating of yeast cells in YPDA medium under aerobic conditions. For no ergosterol added, only the transformants with pAY3- BcSE1 were viable. B: Growth of yeast cells in YPDA medium with ergosterol under aerobic conditions. C: Selection of transformants for the Trp+ phenotype in SD medium with ergosterol under anaerobic conditions. Only KLN1 was not viable. D: Plating of yeast cells in YPDA medium under anaerobic conditions. For the reaction catalyzed by squalene epoxidase need oxygen, no yeast was viable. E: Plating of yeast cells in SD medium under aerobic conditions. Without ergosterol, only the transformant with pAY3- BcSE1 was viable. a: KLN1 yeast transformed with pAY3-BcSE1; b: KLN1 yeast transformed with pAY3; c: KLN1 yeast

Gao K et al. Chinese Herbal Medicines, 2016, 8(1): 67-74 80

roots stems leaves flowers fruits

Relative expression fold

70 60 50 40 30 20 10 0 β-AS Figure 6

CAS 

BcSE1

 

Plant tissue specific expression profiles of β-AS, BcSE1,

and CAS Plant tissue specific expression profiles of β-AS, BcSE1, and CAS. BcSE1 and CAS transcripts were detectable in all tested organs with highest level in fruits and leaves, respectively. While β-AS dominantly expressed in roots in accordance with the fact that

MejA treated relative expression fold

saikosaponins were mainly biosynthesized in roots. 12

8h 24 h

10 8 6 4 2 0

β-AS

BcSE1

CAS 

 

Figure 7 Expression patterns of β-AS, BcSE1, and CAS induced by MeJA Expression patterns of β-AS, BcSE1 and CAS induced by MeJA. The expressions of BcSE1 and β-AS were induced by MeJA, while the expression of CAS was scarcely induced.

 

4.    Discussion    In this study, we cloned and analyzed the full-length cDNA, BcSE1. BLASTN and BLASTX searches of the NCBI database revealed that, to date, which is the first cloning of SE from the genus of Bupleurum. The deduced amino acid sequence showed high identity to SE sequences from different plant species, including P. ginseng, P. notoginseng, and Eleutherococcus senticosus, with the top hits to those of SEs from P. ginseng (ACJ24907.2) (84% identity and 77% query cover) and Aralia elata (ADC32655.1) (88% identity and 74% query cover). The phylogenetic analysis showed that BcSE1 was not clustered with SEs involved with the biosynthesis of saponins, but it

73

could not conclude that BcSE1 was not involved with the biosynthesis of saikosaponins. According to previous researches on different plant species, the difference existed in the homolog numbers of SE and its regulation styles on the biosynthesis of metabolites (Han et al, 2010; Rasbery et al, 2007; Suzuki et al, 2002; Uchida et al, 2007). For example, MtSE2 participated in both sterol biosynthesis and triterpenoid formation (Suzuki et al, 2002); PgSQE1 regulated ginsenoside biosynthesis, but not that of phytosterol (Han et al, 2010). Therefore, further confirmation will be needed for the homologs numbers of SE and their regulating functions between the biosynthesis of saikosaponins and phytosterols in B. chinense. The tissue-specific and MeJA-induced expression patterns of BcSE1 were preliminarily analyzed. Using real-time PCR, BcSE1 transcript was detected in all organs studied. Expression levels differed among various organs, the highest expression level was found in fruits, and the lowest in stems. In P. ginseng, PgSQE1 mRNA abundantly accumulated in all organs, but slightly more mRNA accumulated in flower buds and leaves than in other plant tissues. PgSQE2 was only weakly expressed and preferentially in petioles and flower buds (Han et al, 2010). In M. truncatula, MtSE1 was expressed weakly in all plant tissues. MtSE2 was also expressed in all tissues, but at a higher level than MtSE1 (Suzuki et al, 2002). In E. tirucalli, the expression level of EtSE in stem internodes was almost the same as that in the leaves, which were more abundant than in roots (Uchida et al, 2007). In conclusion, BcSE1 is similar with PgSQE1 in tissue specific expression pattern. MeJA is known to induce the biosynthesis of many secondary metabolites, such as ginsenosides (Kim et al, 2004; Chen et al, 2007) and saikosaponins (Aoyagi et al, 2001; Zhao et al, 2010). While a study showed that MeJA could not induce the accumulation of phytosterols in M. truncatula (Suzuki et al, 2002). In this study, BcSE1 mRNA level was about double-folds at 24 h after MeJA-treatment as that 8 h, and the expression of β-AS increased about three-fold. In a previous study (Han et al, 2010), MeJA treatment enhanced the accumulation of PgSQE1 mRNA in P. ginseng roots, but rather suppressed expression of PgSQE2. In M. truncatula, MtSE2 was upregulated by treatment with MeJA in constrast to MtSE1 (Suzuki et al, 2002). For to date, no other SE gene except BcSE1 was cloned and analyzed in B. chinense, therefore, the possibility can not be neglected that the expression of BcSE1 showed in this study may be the total outcome of all SE homologs. With regard to this aspect, further studies on the SE genes in B. chinense will be needed to elucidate the regulating function of SE in the biosynthesis of saikosaponins and phytosterols. In conclusion, we have cloned for the first time a SE gene, BcSE1, from the plants of Bupleurum L. The tissue-specific and MeJA-induced expression patterns of BcSE1 have been preliminarily analyzed. As SE catalyzes the first oxygenation step in phytosterol and triterpenoid saponin biosynthesis and is suggested to represent one of the rate-limiting enzymes in this pathway. Although the exact catalysis of BcSE1 and regulatory

74

Gao K et al. Chinese Herbal Medicines, 2016, 8(1): 67-74

mechanism needs to be further investigated; Anyway, isolation and expression analyses of BcSE1 are essential for the further understanding of molecular mechanism in saikosaponin and phytosterol biosynthesis pathway in B. chinense.

  References    Abe I, Rohmer M, Prestwieh GD, 1993. Enzymatic cyclization of squalene and oxidosqualene to sterols and triterpenes. Chem Rev 93: 2189-22069. Aoyagi H, Kobayashi Y, Yamada K, Yokoyama M, Kusakari K, Tanaka H, 2001. Efficient production of saikosaponins in Bupleurum falcatum root fragments combined with signal transducers. Appl Microb Biotech 57: 482-488. Ashour ML, Wink M, 2011. Genus Bupleurum: A review of its phytochemistry, pharmacology and modes of action. J Pharm Pharmacol 63: 305-321. Augustin JM, Kuzina V, Andersen SB, Bak S, 2011. Molecular activities, biosynthesis and evolution of triterpenoid saponins. Phytochemistry 72: 435-457. Chen LR, Chen YJ, Lee CY, Lin TY, 2007. MeJA-induced transcriptional changes in adventitious roots of Bupleurum kaoi. Plant Sci 173: 12-24. Dong LM, Sui C, Liu YJ, Yang Y, Wei JH, Yang YF, 2010. Validation and application of reference genes for quantitative gene expression analyses in various tissues of Bupleurum chinense. Mol Biol Rep 38: 5017-5023. Fang Y, Zhang F, Liu JL, Zhou YZ, Tian JS, Qin XM, Gao XX, 2015.  Isolation and quantitative determination of polyacetylenes in Bupleuri Radix. Chin Tradit Herb Drugs 46(16): 2365-2370. Favre B, Ryder NS, 1996. Characterization of squalene epoxidase activity from the dermatophyte Trichophyton rubrum and its inhibition by terbinafine and other antimycotic agents. Antimicrob Agents CH 40: 443-447. Gill S, Stevenson J, Kristiana I, Brown AJ, 2011. Cholesteroldependent degradation of squalene monooxygenase, a control point in cholesterol synthesis beyond HMG-CoA reductase. Cell Metab 13: 260-273. Han JY, In JG, Kwon YS, Choi YE, 2010. Regulation of ginsenoside and phytosterol biosynthesis by RNA interferences of squalene epoxidase gene in Panax ginseng. Phytochemistry 71: 36-46. Haralampidis K, Trojanowska M, Osbourn AE, 2002. Biosynthesis of triterpenoid saponins in plants. Adv Biochem Eng Biot 75: 31-49. He FM, Zhu YP, He MX, Zhang YZ, 2008. Molecular cloning and characterization of the gene encoding squalene epoxidase in Panax notoginseng. Mitochondr DNA 19: 270-273. He X, Ye W, Gao XX, Wang L, Zhang WM, 2015. Cloning, bioinformatics, and expression analysis of sesquiterpene synthase gene As-SesTPS1 from Aquilaria sinensis. Chin Tradit Herb Drugs 46(5): 733-739. Kim YS, Cho JH, Ahn J, Hwang B, 2006. Upregulation of isoprenoid pathway genes during enhanced saikoposanin biosynthesis in the hairy roots of Bupleurum falcatum. Mol Cells 22: 269-274. Kim YS, Cho JH, Park S, Han JY, Back K, Choi YE, 2011. Gene regulation patterns in triterpene biosynthetic pathway driven by overexpression of squalene synthase and methyl jasmonate elicitation in Bupleurum falcatum. Planta 233: 343-355. Kim YS, Hahn EJ, Murthy HN, Paek KY, 2004. Adventitious root growth and ginsenoside accumulation in Panax ginseng cultures as affected by methyl jasmonate. Biotechnol Lett 26: 1619-1622.

 

Kusakari K, Yokoyama M, Inomata S, 2000. Enhanced production of saikosaponins by root culture of Bupleurum falcatum L. using two-step control of sugar concentration. Plant Cell Rep 19: 1115-1120. Landl KM, Klosch B, Turnowsky F, 1996. ERG1, encoding squalene epoxidase, is located on the right arm of chromosome VII of Saccharomyces cerevisiae. Yeast 12: 609-613. Lin TY, Chiou CY, Chiou SJ, 2013. Putative genes involved in saikosaponin biosynthesis in Bupleurum species. Int J Mol Sci 14: 12806-12826. Lipinski M, Scholz M, Pieper K, Fischer R, Prüfer D, Müller KJ, 2009. A squalene epoxidase from Nigella sativa participates in saponin biosynthesis and mediates terbinafine resistance in yeast. Cent Eur J Biol 4: 163-169. Rasbery JM, Shan H, LeClair RJ, Norman M, Matsuda SPT, Bartel B, 2007. Arabidopsis thaliana squalene epoxidase 1 is essential for root and seed development. J Biol Chem 282: 17002-17013. Razdan S, Bhat WW, Rana S, Dhar N, Lattoo SK, Dhar RS, Vishwakarma RA, 2013. Molecular characterization and promoter analysis of squalene epoxidase gene from Withania somnifera (L.) Dunal. Mol Biol Rep 40: 905-916. Sakakibara J, Watanabe R, Kanai Y, Ono T, 1995. Molecular cloning and expression of rat squalene epoxidase. J Biol Chem 270: 17-20. Shan RH, She ML, 1979. Flora of China. Beijing: Science Press 55: 215-295. Shyu KG, Tsai SC, Wang BW, Liu YC, Lee CC, 2004. Saikosaponin C induces endothelial cells growth, migration and capillary tube formation. Life Sci 76: 813-826. Sui C, Wei JH, Zhan QQ, Yang CM, 2010a. Cloning and sequence analysis of squalene synthase gene and cDNA in Bupleurum chinense DC. Acta Horticult Sin 37: 283-290. Sui C, Zhan QQ, Wei JH, Chen HQ, Yang CM, 2010b. Full-length cDNA cloning and sequence analysis of IPPI involved in saikosaponin biosynthesis in Bupleurum chinense DC. Chin Tradit Herb Drugs 41: 1178-1184. Sui C, Zhang J, Wei JH, Chen SL, Li Y, Xu JS, Jin Y, Xie CX, Gao ZH, Chen HJ, Yang CM, Zhang Z, Xu YH, 2011. Transcriptome analysis of Bupleurum chinense focusing on genes involved in the biosynthesis of saikosaponins. BMC Genomics 12: 539. Sun Y, Cai TT, Zhou XB, Xu Q, 2009. Saikosaponin a inhibits the proliferation and activation of T cells through cell cycle arrest and induction of apoptosis. Int Immunopharmacol 9: 978-983. Suzuki H, Achnine L, Xu R, Matsuda SP, Dixon RA, 2002. A genomics approach to the early stages of triterpene saponin biosynthesis in Medicago truncatula. Plant J 32: 1033-1048. Uchida H, Sugiyama R, Nakayachi O, Takemura M, Ohyama K, 2007. Expression of the gene for Landl sterol-biosynthesis enzyme squalene epoxidase in parenchyma cells of the oil plant, Euphorbia tirucalli. Planta 226: 1109-1115. Wong VKW, Zhou H, Cheung SSF, Li T, Liu L, 2009. Mechanistic study of saikosaponin-d (Ssd) on suppression of murine T lymphocyte activation. J Cell Biochem 107: 303-315. Zhao CL, Cui XM, Chen YP, Liang QA, 2010. Key enzymes of triterpenoid saponin biosynthesis and the induction of their activities and gene expressions in plants. Nat Prod Commun 5: 1147-1158. Zong Z, Fujikawa-Yamamoto K, Ota T, Guan X, Murakami M, Li A, Yamaguchi N, Tanino M, Odashima S, 1998. Saikosaponin b2 induces differentiation without growth inhibition in cultured B16 melanoma cells. Cell Struct Funct 23: 265-272.